Phylogenetics of Stelis and closely related genera (Orchidaceae: Pleurothallidinae)

Abstract

Stelis, one of the largest genera within Pleuro- thallidinae, was recently recircumscribed to include a few hundred more species, most of which had previously been assigned to Pleurothallis. Here, a new phylogenetic anal- ysis of Stelis and closely related genera based on DNA sequences from nuclear ITS and chloroplast matK, based on a much larger sample, is presented; it includes more than 100 species assigned to Stelis and covers all proposed groupings within the genus, many of which have not pre- viously been represented. Clades are proposed to enable easier discussion of groups of closely related species; eachclade is characterized morphologically, ecologically, and geographically to explain the evidence found in the molecular analysis. Discussion of the evolutionary trends of character states found in the genus in its broad sense is given. The current taxonomy of the group is given and the possible taxonomical implications of the findings presented here are discussed.

Full text

1 23












1 23
Your article is protected by copyright and
all rights are held exclusively by Springer-
Verlag Wien. This e-offprint is for personal
use only and shall not be self-archived in
electronic repositories. If you wish to self-
archive your work, please use the accepted
author’s version for posting to your own
website or your institution’s repository. You
may further deposit the accepted author’s
version on a funder’s repository at a funder’s
request, provided it is not made publicly
available until 12 months after publication.

ORIGINAL ARTICLE
Phylogenetics of Stelis and closely related genera (Orchidaceae:
Pleurothallidinae)
Adam P. Karremans •Freek T. Bakker •
Franco Pupulin •Rodolfo Solano-Go
´mez •
Marinus J. M. Smulders
Received: 5 July 2012 / Accepted: 22 September 2012
!Springer-Verlag Wien 2012
Abstract Stelis, one of the largest genera within Pleuro-
thallidinae, was recently recircumscribed to include a few
hundred more species, most of which had previously been
assigned to Pleurothallis. Here, a new phylogenetic anal-
ysis of Stelis and closely related genera based on DNA
sequences from nuclear ITS and chloroplast matK, based
on a much larger sample, is presented; it includes more
than 100 species assigned to Stelis and covers all proposed
groupings within the genus, many of which have not pre-
viously been represented. Clades are proposed to enable
easier discussion of groups of closely related species; each
clade is characterized morphologically, ecologically, and
geographically to explain the evidence found in the
molecular analysis. Discussion of the evolutionary trends
of character states found in the genus in its broad sense is
given. The current taxonomy of the group is given and the
possible taxonomical implications of the findings presented
here are discussed.
Keywords Stelis !Pleurothallidinae !Orchidaceae !
Molecular phylogeny !Morphology !Evolutionary trends
Introduction
The general characteristics of the genus Stelis Sw., on the
basis of its morphological characters, were not substan-
tially discussed until Garay (1979) proposed the segrega-
tion of several taxa on the basis of their bilobed stigma into
the genus Apatostelis Garay, a concept that was not widely
accepted (Pupulin 2002; Luer 2003; Pridgeon 2005;
Govaerts et al. 2011). Species of Stelis sensu stricto (Stelis
s. str.) can be distinguished from other groups of the sub-
tribe Pleurothallidinae by the terminal, racemose, fascicled,
few or multi-flowered inflorescences, the triangular flowers
with almost identical sepals, tending to radial symmetry,
diversely connate sepals, much larger than the petals and
lip, the very reduced petals usually with a thick margin, the
thickened lip that is similar to the petals, and a very short,
unwinged column with an apical stigma and anther (Luer
2003).
The analysis of Pridgeon et al. (2001) using DNA
sequences suggested a different scheme of phylogenetic
relationships among the Pleurothallidinae, and, therefore,
the need for a recircumscription of the genus in order to
attain monophyly. Consequently, several subgenera of the
A. P. Karremans (&)!F. Pupulin
Lankester Botanical Garden, University of Costa Rica,
P.O. Box 302-7050, Cartago, Costa Rica
e-mail: akarremans@gmail.com
A. P. Karremans
NCB Naturalis, NHN Universiteit Leiden,
Leiden, The Netherlands
F. T. Bakker
Biosystematics Group, Wageningen University,
Wageningen, The Netherlands
F. Pupulin
Harvard University Herbaria, Cambridge, MA, USA
F. Pupulin
Marie Selby Botanical Gardens, Sarasota, FL, USA
R. Solano-Go
´mez
Instituto Polite
´cnico Nacional, Centro Interdisciplinario de
Investigacio
´n para el Desarrollo Integral Regional unidad
Oaxaca, Hornos 1003, Santa Cruz Xoxotla
´n, Oaxaca 71230,
Mexico
M. J. M. Smulders
Wageningen UR Plant Breeding, PO Box 16,
6700AA Wageningen, The Netherlands
123
Plant Syst Evol
DOI 10.1007/s00606-012-0712-7
Author's personal copy

sister genus Pleurothallis (i.e., Crocodeilanthe (Rchb.f. &
Warsz.) Luer, Dracontia Luer, Effusia Luer, Elongatia
Luer, Mystax Luer, Physosiphon (Lindl.) Luer, Physo-
thallis (Garay) Luer, Pseudostelis (Schltr.) Luer, and
Unciferia (Luer) Luer), as well as the smaller genera
Condylago Luer and Salpistele Dressler were reduced in
synonymy under Stelis sensu lato (Stelis s.l.). Because that
phylogenetic inference was based on few species of Stelis
in its broad sense, extrapolation of the results using pre-
vious morphologically inferred relationships (basically
those described by Luer 1986) was required to re-accom-
modate most of the species involved.
Luer, rejected the new circumscription of Stelis, and
instead recognized it in its narrower delimitation and the
genera Condylago,Crocodeilanthe Rchb.f. & Warsz.,
Mystacorchis Szlach. & Marg., Physothallis Garay, Physosi-
phon Lindl., Salpistele, and Specklinia Lindl., and elevated
to the generic rank four subgenera of Pleurothallis as
Dracontia (Luer) Luer, Effusiella Luer, Elongatia (Luer)
Luer, and Unciferia (Luer) Luer (Luer 2004,2006). He also
described the monotypic genera Lomax Luer, Loddigesia
Luer (an illegitimate name later legitimized as Lalexia
Luer), and Niphantha Luer for a few ‘‘misfit’’ species not
clearly belonging to any of the previously recognized
groups (Luer 2006,2007,2011). All of these genera include
one or more species treated by Pridgeon and Chase (2001)
as members of Stelis in its broader sense. There is general
consensus that other older generic names, for example
Dialissa Lindl. (1845), Humboldtia Ruiz & Pavo
´n (1794),
Pseudostelis Schltr. (1922), Steliopsis Brieger (1976; nom.
inval.), and Apatostelis Garay (1979; nom.illeg.), should be
regarded as synonymous with Stelis (Pridgeon 2005).
The two contradicting taxonomic systems, i.e., the fine
generic splitting proposed by Luer based mostly on mor-
phological grounds, and the more conservative approach
proposed by Pridgeon and Chase (2001) on the basis of
molecular data, are still debated. Although the concept of
Stelis in a broad sense is more commonly accepted
(Govaerts et al. 2011; Ha
´gsater and Soto 2003; Pridgeon
2005; Pupulin 2002; Solano-Go
´mez and Salazar 2007),
the narrow circumscription has also been used (Dressler
and Bogarı
´n2007; Duque 2008; Karremans 2011,2012;
Karremans & Smith 2012;Luer2009,2011;Milleretal.2011).
With approximately 900 species in its narrower cir-
cumscription and over 1100 in its broadest circumscription
(Luer 2009), Stelis is one of the largest genera in the largest
angiosperm family on the planet, accounting for 3–4 % of
Orchidaceae species, only rivaled by Bulbophyllum Thou.,
Dendrobium Sw., Epidendrum L., and Lepanthes Sw. Even
though they are restricted to the humid environment of
American tropics and subtropics, species of Stelis are major
epiphytic components of forest landscapes, in which many
of the taxa occur in large sympatric populations. Although
‘‘mammoth’’ genera such as Stelis, with their astonishing
and intricate diversity, have traditionally discouraged sys-
tematic botanists, they are unparalleled opportunities
enabling evolutionary biologists to speculate on the
mechanisms leading to speciation. Irrespective of the tax-
onomic system used to define Stelis, the success of this
group of plants in colonizing the American tropics, in
terms of ecological diversity, frequency, and species
number (i.e. accepted species names), deserves particular
attention by botanists.
The objective of this work was to produce an overall
picture of phylogenetic relationships within the genus Stelis
in its broad sense. It includes larger and more balanced
sampling, covering all groups involved in Stelis s.l. We used
the molecular phylogenetic tree based on chloroplast and
nuclear sequences as a hypothesis to establish phylogenetic
relationships and further investigate congruence with mor-
phological data and geographic distribution patterns.
Although there might be evidence of a need for taxo-
nomic changes, these are not proposed here. To produce a
stable system of nomenclature for this complex group, it is
necessary:
1. to estimate phylogeny on the basis of maximum tax-
onomic and character sampling;
2. to conduct a morphological study of each species
group in order to characterize it uniquely; and
3. to associate clades and morphological characters with
biological and ecological data.
Some of these objectives are beyond the scope of this
work, which focuses on the internal relationships among
groups of Stelis s.l., as suggested by the molecular evidence
obtained as a result of improved sampling and the use of
updated software for data analysis.
Materials and methods
Most specimens were field collected or obtained from the
living collections of Lankester Botanical Garden (JBL),
University of Costa Rica; a few were obtained from the
private collections of T. Sijm and J. Wubben in the Neth-
erlands. Material was selected on the basis of availability
and inter-specific variability (thus preferring species that
were not very closely related). At least one sample from
each of the genera, subgenera, or artificial groupings
accepted in the alternative classification systems was
included in the sampling, when available. Most of the
species included in the sampling are Costa Rican in dis-
tribution, reflecting the prevailing nature of the JBL col-
lections. Vouchers of the specimens are kept in the liquid
collections at JBL, WAG, or L, unless specified otherwise.
In general DNA sequences of determinate species are
obtained from any specimen available and rarely is that
A. P. Karremans et al.
123
Author's personal copy

specimen part of the type collection. Although those are
equally useful, their determination is interpretative. It is,
therefore, noteworthy that in this work the DNA sequences
of Dracontia hydra,D. lueriana,Pleurothallis sijmii,
P. silvae-pacis,Salpistele adrianae,Stelis adrianae, and
S. tacanensis were obtained from the actual plants that served
as types, and sequences of Stelis alajuelensis,S. atwoodii,
S. ferrelliae,S. kareniae, and S. segoviensis (Karremans
544), even though not part of the type collection, were
nonetheless obtained from specimens collected at the type
locality.
DNA extraction and sequencing
Fresh leaf and flower cuttings of approximately 1 cm
2
were
obtained from all the selected individuals of each species.
Each individual sample was placed in a polypropylene bag
with silica gel to dry for approximately a week after which
the silica was removed and new dry silica was added.
Samples (20 mg) were pulverized in liquid nitrogen by
shaking them in a Retsch MM 300 shaker for 5 min using
three bullets. Extraction was performed by following the
DNEasy extraction procedure (Qiagen). DNA concentra-
tion for each sample was adjusted to 10 lmol/l by use of a
Nano Drop Spectrophotometer (ND 1000).
The nuclear ribosomal internal transcribed spacer (ITS)
region was amplified using the methods and primers, 17SE
(ACGAATTCATGGTCCGGTGAAGTGTTCG) and 26SE
(TAGAATTCCCCGGTTCGCTCGCCGTTAC), for sequ-
encing and amplification described by Sun et al. (1994). The
chloroplast gene matK was amplified and sequenced using
the Kew matK primers 2.1aF (ATCCATCTGGAAAT
CTTAGTTC) and 5R (GTTCTAGCACAAGAAAGTCG).
Amplification was done by preparing each sample with a
PCR mix composed of DTB, dNTPs, both primers (four in
the case of ITS), Dream Taq, water, and the extracted DNA.
Samples were amplified in an MJ Research PTC-200
Pelthier Thermal Cycler, using a temperature profile
of 94 "C/5 min, followed by 34 cycles of 94 "C/30 s,
55 "C/30 s, and 72 "C/2 min, and finally 72 "C/10 min. To
prepare for sequencing, a DETT kit was used according to
the manufacturer’s instructions (GE Healthcare). Each
sample had two mega-mixes, one for the F-primer and
another for the R-primer (four for ITS), and were cycle-
sequenced using a standard thermo-profile of 94 "C/20 s,
50 "C/15 s, and 60 "C/1 min, repeated 25 times. Products
were analyzed on an ABI 9600 DNA analyzer.
Building the data sets
The Staden (2003) package was used for editing the
sequences. When more than one base pair was equally
probable, the Unicode nomenclature (IUPAC) was used. In
a few cases the two traces for one sample were too short
and there was no overlap so Pregap was unable to build a
contig. To keep the information, both sequences were
merged by filling in missing positions with Ns. Sequences,
for each region independently were aligned by use of
Clustal X in BioEdit v.7.5.0.3 (Hall 1999). These were then
exported as .fas files and opened in Mesquite v2.72
(Maddison and Maddison 2007) where they were checked
for misalignments and adjusted manually. The ends of each
data set were trimmed to eliminate possible erroneous data,
and gaps at the ends of sequences were regarded as missing
data (filled with Ns). Each indel and possible informative
sites were re-checked by going back to the original traces.
After the alignments had been edited, additional
sequences were obtained from Mark Wilson (unpublished),
Rodolfo Solano-Go
´mez (unpublished), Hagen Stenzel
(sequences published in his dissertation thesis, 2004), and
from GenBank, the latter using nBLAST. Myoxanthus
uncinatus AF265478 (now Echinosepala uncinata (Fawc.)
Pridgeon & M.W. Chase) was used as outgroup in all cases,
because it is suggested to be the furthest related of all
included species (Pridgeon et al. 2001).
Phylogenetic analysis
Bayesian analysis methods were preferred over parsimony
and maximum likelihood because they were found to
explain the data better and have overall greater support and
resolution. MrBayes version 3.2 (Huelsenbeck and Ron-
quist 2001; Ronquist and Huelsenbeck 2003) was used to
obtain a distribution of possible gene trees which are
summarized in a consensus tree with posterior probability
values for each node. Both ITS and matK complete data
sets were analyzed using the Find Model web server
(available at http://www.hiv.lanl.gov/content/sequence/find
model/findmodel.html) which uses Modeltest (software
designed to compare different nested models of DNA
substitution in a hierarchical hypothesis-testing framework
(Posada and Crandall 1998) to calculate the model scores,
based on the AIC criterion. In both cases the GTR ?C
(gamma) model was the most likely to fit the data best and
was therefore used in all subsequent Bayesian analysis. The
GTR ?Cmodel was implemented throughout and the
temperature for heated chains was set to 0.05. Both matK
and ITS were tested without partitions, however, matK was
also analyzed with a partition based on the codon position
1?2 versus 3. Gaps were very small and scarce and were,
therefore, treated as missing data or eliminated from the
data set. A combined analysis was done where partitions
were set for each gene. Methods of phylogenetic inference
depend on their underlying models. If the results of the
analysis are to be trusted, the model must be trusted; one
must, therefore, investigate which explicit evolution model
Phylogenetics of Stelis
123
Author's personal copy

fits the data best. In all cases 3,500,000 generations were
run and results were inspected for convergence and mixing
by use of Tracer v.1.5 software (Rambaut and Drummond
2007).
Bayesian evolutionary analysis sampling trees (BEAST;
Drummond and Rambaut 2007) were used to analyze the
ITS and ITS ?matK combined matrices. BEAST estimate
rooted, time-measured phylogenies inferred using strict or
relaxed molecular clock models. It is also a framework for
testing evolutionary hypotheses without conditioning on a
single tree topology. Substitution and clock models were
unlinked. The GTR ?Cmodel, estimated frequencies, and
10 categories were used for both ITS ?matK, only matK
was analyzed using independent codon positions. The
relaxed clock model was used for both; however, that of ITS
was lognormal, whereas for matK the clock model was set
to exponential. The tree prior used was speciation—yule
birth—and the number of generations was set to
20,000,000. Concatenated gene sequences for phylogenetic
analysis can lead to artifacts, especially when discord is
found between the individual gene trees (Edwards et al.
2007; Kubatko and Degnan 2007). Therefore we tested
whether strongly-supported incongruence existed between
our rDNA ITS and matK-based trees. In the concatenated
data set, ITS sequences are directly followed by the matK
sequence. Trees were visualized in FigTree v.1.3.1 (Ram-
baut 2009). Posterior probability (PP) values were added to
the branches of the trees by use of the labeling option.
Branches were reordered for better visualization. Consensus
networks summarize all (or most) of the possible trees
resulting from one data set, ‘‘it extends the notion of strict
and majority consensus trees to allow the display of con-
flicting evolutionary hypotheses within a collection of
trees’’ (Holland and Moulton 2003; Holland et al. 2005).
When calculating the posterior probabilities, in MrBayes
for example, the software produces a distribution of possi-
ble trees with several alternative explanations for the same
data. In the consensus network all the alternative explana-
tions above a specific threshold are included in a three-
dimensional multi-branched network, resulting in more
information than the two-dimensional two-branched tree.
Trees obtained from BEAST analysis of the combined
ITS ?matK data set were analyzed by use of Splits Tree4
v.4.11.3 (Huson and Bryant 2006). The consensus network
was built on the basis of 2800 trees, eliminating the first
and using a 0.20 cutoff value. By allowing for different
explanations of the data (viewed as branching points), in a
consensus network one can detect areas of conflict between
a percentage of the resulting trees. This enables comparison
of data from different origins and identification of possible
cases of horizontal gene flow. Here, the consensus network
is not used for phylogenetic reconstruction but as evidence
for unclear phylogenetic relationships.
Exclusion and editing of sequences
While handling the sequences matrix, reading mistakes
could be seen in the form of repeated insertions (for
example 5 times A instead of 4) or similarities at the
beginning and/or end of unrelated sequences which share a
common sequencing origin. DNA extraction and/or
sequencing of Condylago furculifera Dressler & Bogarı
´n,
Stelis pilostoma (Luer) Pridgeon & M.W.Chase, and Stelis
vaginata (Schltr.) Pridgeon & M.W.Chase failed repeat-
edly. Sequences obtained from Stelis aristocratica
(L.O.Williams) Pridgeon & M.W.Chase, Stelis jalapensis
(Kraenzl.) Pridgeon & M.W.Chase, Stelis nigriflora
(L.O.Williams) Pridgeon & M.W.Chase, and Stelis re-
supinata (Ames) Pridgeon & M.W.Chase were too short
and/or messy, and were therefore omitted. The same cri-
teria were used to exclude GenBank sequences from Stelis
rodrigoi (Luer) Pridgeon & M.W.Chase (type species of
genus Condylago), for which different affinities were
observed in every unique analysis, and S. resupinata. Most
of these ‘‘problematic’’ sequences in terms of quality
belonged to species of genus Pleurothallis subgenus Effu-
sia and subgenera Unciferia and Condylago, all probably
close relatives. The complete list of sequences used, and
their vouchers and origin, are found in Table 1. The
aligned ITS and/or matK matrices are available from the
corresponding author.
Results
Nomenclature
Clades have been coded to simplify description of some
species groups. They have been assigned letters from A to
F, and have been chosen among those found in the
Bayesian Analysis Consensus Tree, which were more
constant and easiest to discuss. They may not be found in
all trees and do not necessarily reflect the authors’ opinions
about the taxonomy of those particular groups. Taxa names
follow Pridgeon (2005) and/or Govaerts et al. (2011).
Analysis of combined ITS/matK
Differences between the separate analyses of the plastid
matK and nuclear ITS matrices were found. The differ-
ences were mostly ‘‘soft’’, however the matK analyses
being less well resolved may be shading some ‘‘hard’’ in-
congruencies between both. An explanation for the dif-
ferences might be their different origin and ancestry. Even
so, the combined analyses were preferred for their higher
resolution and support, and because they better explained
the data than either single analysis. Overall the consensus
A. P. Karremans et al.
123
Author's personal copy

Table 1 Complete list of all taxa, their available vouchers, and DNA sequences and their source, used in the different analysis presented in this
study
Taxon Voucher matK ITS Source
Andinia pensilis – AF265455 AF262826 GenBank
Anathallis anderssonii 1 A. P. Karremans 2957 (N.V.) JF934841 JF934777 This Study
Anathallis anderssonii 2 A. P. Karremans 4842 (L-Spirit; Epidendra) – JQ995324 This Study
Anathallis angustilabia – AF302647 AF262868 GenBank
Anathallis dolichopus 1 A. P. Karremans 2871 (JBL-Spirit) JF934838 JF934774 This Study
Anathallis dolichopus 2 D. Bogarı
´n 3736 (JBL-Spirit; Epidendra) JF934840 JF934776 This Study
Anathallis dolichopus 3 F. Pupulin 5301 (JBL-Spirit; WAG-Spirit) JF934839 JF934775 This Study
Anathallis dolichopus 4 M. Soto 4358 (AMO) – JF934755 This Study
Anathallis obovata H. Stenzel 840 (HAJB) – JF934822 Stenzel (2004)
Anathallis rubens A. P. Karremans 4824 (L-Spirit; Epidendra) – JQ995325 This Study
Anathallis sclerophylla 1 A. P. Karremans 4791 (JBL-Spirit) – JQ995326 This Study
Anathallis sclerophylla 2 A. P. Karremans 4830 (L-Spirit) – JQ995327 This Study
Dracontia hydra D. Bogarı
´n 5746 (JBL-Spirit; Epidendra) – JF934809 This Study
Dracontia lueriana D. Bogarı
´n 1987 (JBL-Spirit; CR; Epidendra) JF934870 JF934810 This Study
Dracontia sp. nov.1 1 A. P. Karremans 4604 (A) (JBL-Spirit) – JQ995328 This Study
Dracontia sp. nov.1 2 A. P. Karremans 4604 (B) (JBL-Spirit) – JQ995329 This Study
Dracontia sp. nov.2 D. Bogarı
´n 7698 (JBL-Spirit; CR) – JQ995330 This Study
Dryadella simula – AF265453 AF262825 GenBank
Echinosepala uncinata – AF265478 AF262904 GenBank
Frondaria caulescens – AF265471 AF262914 GenBank
Lepanthes platysepala A. P. Karremans 4847 (L-Spirit) – JQ995331 This Study
Lepanthes woodburyana – AF265470 AF262890 GenBank
Pabstiella aryter D. Bogarı
´n 6501 (JBL-Spirit; Epidendra) JF934876 JF934816 This Study
Pabstiella mirabilis – – AF262830 GenBank
Pabstiella tripterantha 1 D. Bogarı
´n 5905 (JBL-Spirit) JF934875 JF934815 This Study
Pabstiella tripterantha 2 – AF302649 AF275694 GenBank
Pabstiella wacketii A. P. Karremans 4832 (L-Spirit; Epidendra) – JQ995334 This Study
Pabstiella yauaperyensis – – AF262864 GenBank
Platystele misera – AF265470 AF262823 GenBank
Pleurothallis allenii – – AF262844 GenBank
Pleurothallis cardiantha – – AF262832 GenBank
Pleurothallis cardiothallis – – AF262917 GenBank
Pleurothallis excavata – – AF262841 GenBank
Pleurothallis grandiflora – – AF368320 GenBank
Pleurothallis loranthophylla – – AF262837 GenBank
Pleurothallis miranda – – AF262875 GenBank
Pleurothallis niveoglobula – – AF262834 GenBank
Pleurothallis nuda – – AF262874 GenBank
Pleurothallis penicillata – – AF368320 GenBank
Pleurothallis rowleei – – AF262842 GenBank
Pleurothallis ruscifolia 1 – AF265463 AF262836 GenBank
Pleurothallis ruscifolia 2 F. Pupulin 7254 (B) (JBL-Spirit) JF934874 JF934814 This Study
Pleurothallis ruscifolia 3 H. Stenzel 635 (HAJB) – JF934821 Stenzel (2004)
Pleurothallis ruscifolia 4 F. Pupulin 7254 (A) (JBL-Spirit) JF934873 JF934813 This Study
Pleurothallis sijmii A. P. Sijm 200425 (MO; Epidendra) – JQ995335 This Study
Pleurothallis silvae-pacis 1 A. P. Karremans 3069 (A) (JBL-Spirit; CR; Epidendra) – JQ995336 This Study
Pleurothallis silvae-pacis 2 A. P. Karremans 3069 (B) (JBL-Spirit; CR; Epidendra) – JQ995337 This Study
Pleurothallis sp. nov. D. Bogarı
´n 8775 (JBL-Spirit) – JQ995338 This Study
Phylogenetics of Stelis
123
Author's personal copy

Table 1 continued
Taxon Voucher matK ITS Source
Pleurothallis talpinaria – – AF262840 GenBank
Pleurothallis teaguei – – AF275695 GenBank
Pleurothallis truncata – – AF262834 GenBank
Pleurothallis viduata – – AF262838 GenBank
Salpistele adrianae 1 D. Bogarı
´n 5917 (A) (JBL-Spirit; Epidendra) JF934860 JF934799 This Study
Salpistele adrianae 2 D. Bogarı
´n 5917 (B) (JBL-Spirit; Epidendra) JF934861 JF934800 This Study
Salpistele adrianae 3 A. P. Sijm 220411 (L-Spirit; MO; Epidendra) – JQ995339 This Study
Specklinia costaricensis JBL-02512 (JBL-Spirit) – JF934817 This Study
Stelis adrianae A. P. Sijm 201231 (MO; Epidendra) – JQ995340 This Study
Stelis alajuelensis F. Pupulin 4900 (JBL-Spirit; CR; Epidendra) – JQ995341 This Study
Stelis alta 1 D. Bogarı
´n 4604 (A) (JBL-Spirit) JF934865 JF934804 This Study
Stelis alta 2 D. Bogarı
´n 4604 (B) (JBL-Spirit) JF934866 JF934805 This Study
Stelis allenii JBL-03905 (JBL-Spirit) – JQ995342 This Study
Stelis antillensis H. Stenzel 662 (HAJB) – JF934818 Stenzel (2004)
Stelis argentata D. Bogarı
´n 1862 (CR; JBL-Spirit; Epidendra) – JF934764 This Study
Stelis atroviolacea – – AF262879 GenBank
Stelis atwoodi A. P. Karremans 3540 (JBL-Spirit; Epidendra) – JQ995343 This Study
Stelis brunnea 1 D. Bogarı
´n 6226 (JBL-Spirit) JF934859 JF934798 This Study
Stelis brunnea 2 – EU214439 – GenBank
Stelis aff. canae 1 D. Bogarı
´n 6805 (JBL-Spirit) – JF934793 This Study
Stelis aff. canae 2 D. Bogarı
´n 6790 (JBL-Spirit) – JF934782 This Study
Stelis carnosilabia 1 D. Bogarı
´n 730 (A) (JBL-Spirit) JF934868 JF934807 This Study
Stelis carnosilabia 2 D. Bogarı
´n 730 (B) (JBL-Spirit) JF934869 JF934808 This Study
Stelis carpinterae 1 D. Bogarı
´n 7148 (A) (JBL; WAG-Spirit; Epidendra) JF934857 JF934796 This Study
Stelis carpinterae 2 D. Bogarı
´n 7148 (B) (JBL; WAG-Spirit; Epidendra) JF934858 JF934797 This Study
Stelis ciliaris – – AF262927 GenBank
Stelis cobanensis 1 D. Bogarı
´n 8884 (JBL-Spirit; Epidendra) – JQ995344 This Study
Stelis cobanensis 2 – – AF262926 GenBank
Stelis convallaria 1 Hoffmann s.n. (A) (CR; JBL; WAG-Spirit; Epidendra) JF934851 JF934791 This Study
Stelis convallaria 2 Hoffmann s.n. (B) (CR; JBL; WAG-Spirit; Epidendra) JF934852 JF934792 This Study
Stelis cylindrata A. P. Karremans 4025 (JBL-Spirit; Epidendra) – JQ995345 This Study
Stelis cypripedoides A. P. Karremans 2951 (WAG-Spirit) – JQ995346 This Study
Stelis deregularis D. Bogarı
´n 5331 (JBL-Spirit) – JF934771 This Study
Stelis despectans 1 D. Bogarı
´n 5249 (A) (JBL-Spirit) JF934831 JF934761 This Study
Stelis despectans 2 D. Bogarı
´n 5249 (B) (JBL-Spirit) JF934832 JF934762 This Study
Stelis dracontea D. Bogarı
´n 616 (JBL-Spirit; Epidendra) – EU214426 This Study/GenBank
Stelis dressleri 1 F. Pupulin 7579 (A) (JBL-Spirit) JF934829 JF934759 This Study
Stelis dressleri 2 F. Pupulin 7579 (B) (JBL-Spirit) JF934830 JF934760 This Study
Stelis emarginata 1 – AF265466 AF262845 GenBank
Stelis emarginata 2 A. P. Karremans 2947 (WAG-Spirit) – JF934781 This Study
Stelis endresii M. Soto 4382 (AMO) – JF934753 Solano-Go
´mez (Unp.)
Stelis ephemera A. P. Karremans 4805 (L-Spirit) – JQ995332 This Study
Stelis ferrelliae A. P. Karremans 4326 (JBL-Spirit; Epidendra) – JQ995347 This Study
Stelis galeata A. P. Karremans 4800 (L-Spirit) – JQ995348 This Study
Stelis gelida 1 A. P. Karremans 2481 (JBL-Spirit) JF934843 JF934779 This Study
Stelis gelida 2 D. Bogarı
´n 622 (JBL-Spirit) JF934842 JF934778 This Study
Stelis gelida 3 D. Bogarı
´n 7639 (N.V.) JF934844 JF934780 This Study
Stelis gemma – – AF262880 GenBank
A. P. Karremans et al.
123
Author's personal copy

Table 1 continued
Taxon Voucher matK ITS Source
Stelis gigantea 1 – AF265461 AF262843 GenBank
Stelis gigantea 2 F. Pupulin 4498 (JBL; WAG-Spirit) JF934864 JF934803 This Study
Stelis glomerosa A. P. Karremans 4837 (L-Spirit) – JQ995349 This Study
Stelis glossula D. Bogarı
´n 2695 (JBL-Spirit; Epidendra) – JF934766 This Study
Stelis aff. glossula Y. Kisel 2046 (JBL-Spirit) – JF934767 This Study
Stelis guatemalensis 1 – – AF262928 GenBank
Stelis guatemalensis 2 F. Pupulin 3977 (JBL-Spirit) – JF934765 This Study
Stelis guttata – – AF262833 GenBank
Stelis harlingii 1 – AF265465 AF262846 GenBank
Stelis harlingii 2 – EF065591 EF079364 GenBank
Stelis hypnicola A. P. Karremans 4803 (L-Spirit) – JQ995333 This Study
Stelis immersa 1 – EU214427 AF262828 GenBank
Stelis immersa 2 D. Bogarı
´n 6588 (JBL-Spirit) JF934850 JF934789 This Study
Stelis immersa 3 D. Bogarı
´n 5450 (JBL-Spirit) – JF934790 This Study
Stelis imraei D. Bogarı
´n 752 (JBL-Spirit; WAG-Spirit-Epidendra) – JF934784 This Study
Stelis janetiae 1 D. Bogarı
´n 5008 (JBL-Spirit) JF934863 JF934802 This Study
Stelis janetiae 2 Holst 8763 (JBL-Spirit) JF934862 JF934801 This Study
Stelis kareniae D. Bogarı
´n 7594 (JBL-Spirit) JF934834 JF934769 This Study
Stelis kefersteiniana 1 A. P. Karremans 4845 (L-Spirit) – JQ995350 This Study
Stelis kefersteiniana 2 A. P. Karremans 2948 (A) (WAG-Spirit) – JQ995351 This Study
Stelis kefersteiniana 3 A. P. Karremans 2948 (B) (WAG-Spirit) – JQ995352 This Study
Stelis lanata – – AF262881 GenBank
Stelis lankesterii A. P. Karremans 4269 (JBL-Spirit) – JQ995353 This Study
Stelis leucopogon E. Pe
´rez 167 (AMO) – JF934750 Solano-Go
´mez (Unp.)
Stelis listerophora 1 D. Bogarı
´n 6000 (JBL-Spirit) JF934846 JF934785 This Study
Stelis listerophora 2 D. Bogarı
´n 6006 (JBL-Spirit; Epidendra) JF934847 JF934786 This Study
Stelis maculata – – AF262827 GenBank
Stelis megachlamys 1 – EU214491 AF262877 GenBank
Stelis megachlamys 2 A. P. Karremans 1222 (JBL-Spirit; WAG-Spirit) JF934867 JF934806 This Study
Stelis megachlamys 3 PL296 (COCO) – JF934823 Wilson (Unp.)
Stelis aff. microchila 1 D. Bogarı
´n 6965 (JBL-Spirit) JF934827 JF934757 This Study
Stelis aff. microchila 2 D. Bogarı
´n 5356 (JBL-Spirit) JF934828 JF934758 This Study
Stelis aff. microchila 3 M. Soto 7222 (AMO) – JF934751 Solano (Unp.)
Stelis morae A. P. Karremans 1088 (JBL-Spirit) – JF934768 This Study
Stelis multirostris 1 A. P. Karremans 4826 (L-Spirit) – JQ995354 This Study
Stelis multirostris 2 H. Stenzel 643 (HAJB) – JQ995368 Stenzel (2004)
Stelis mystax 1 – – AF262876 GenBank
Stelis mystax 2 D. Bogarı
´n 2988 (JBL-Spirit; Epidendra) JF934855 JF934794 This Study
Stelis mystax 3 A. P. Karremans 4868 (L-Spirit) – JQ995355 This Study
Stelis nexipous A. P. Karremans 4874 (L-Spirit) – JQ995356 This Study
Stelis ornata 1 M. Soto 4947 (AMO) – JF934756 Solano
Stelis ornata 2 A. P. Karremans 4838 (L-Spirit) – JQ995357 This Study
Stelis ornata 3 A. P. Karremans 4870 (Epidendra) – JQ995358 This Study
Stelis pachyglossa A. P. Karremans 4822 (L-Spirit; Epidendra) – JQ995359 This Study
Stelis papillifera 1 D. Bogarı
´n 6585 (JBL-Spirit) JF934871 JF934811 This Study
Stelis papillifera 2 D. Bogarı
´n 7186 (JBL-Spirit; WAG-Spirit) – JF934812 This Study
Stelis pilosa 1 – AF265467 AF262831 GenBank
Stelis pilosa 2 F. Pupulin 7203 (A) (JBL-Spirit) JF934848 JF934787 This Study
Phylogenetics of Stelis
123
Author's personal copy

trees from the Bayesian and BEAST analysis for the clades
found similar tree topologies, differing mostly in some
support values for those clades and that the first allows for
polytomies. Theoretically it is possible to establish an
infinite number of clades in the resulting phylogenetic
trees; for the purpose of facilitating the discussion, how-
ever, six clades were established (A, B, C, D, E, and F).
These were chosen for their consistency, support, and the
ease of morphological characterization. Concatenation of
sequences was not always possible, because fewer matK
sequences were available. The Bayesian consensus tree
(Fig. 1a) is used hereafter for discussion purposes, and only
hard topological differences from the BEAST consensus
tree (Fig. 1b) are mentioned.
Combined analysis (Fig. 1). The Stelis s.l. clade (clades A
to F) is highly supported, posterior probability (P.P.) =1; it
excludes Stelis restrepioides (Lindl.) Pridgeon &
M.W.Chase and S. quadrifida (Lex.) Solano & Soto Arenas,
both are closer to Pleurothallis ruscifolia (type species of
Pleurothallis). Additionally, Anathallis anderssonii (Luer)
Pridgeon & M.W.Chase and Anathallis dolichopus (Schltr.)
Pridgeon & M.W.Chase are embedded in this clade.
Clade A is basal (or sister) to the Stelis s.l. and is made
up of one sequence of S. imraei (Lindl.) Pridgeon &
M.W.Chase only. Its inclusion in Stelis s.l. is highly sup-
ported (P.P. =1).
Clade B is a weakly supported clade (P.P =0.55) that
includes Stelis canae (Ames) Pridgeon & M.W.Chase,
Table 1 continued
Taxon Voucher matK ITS Source
Stelis pilosa 3 F. Pupulin 7203 (B) (JBL-Spirit) JF934849 JF934788 This Study
Stelis platystylis 1 A. P. Karremans 4819 (L-Spirit) – JQ995360 This Study
Stelis platystylis 2 A. P. Karremans 4802 (L-Spirit) – JQ995361 This Study
Stelis pompalis 1 D. Bogarı
´n 6516 (A) (JBL-Spirit) JF934853 – This Study
Stelis pompalis 2 D. Bogarı
´n 6516 (B) (JBL-Spirit) JF934854 – This Study
Stelis aff. pompalis A. P. Karremans 4076 (JBL-Spirit; Epidendra) – JQ995362 This Study
Stelis pulchella 1 A. P. Karremans 2480 (JBL-Spirit) JF934836 JF934772 This Study
Stelis pulchella 2 A. P. Karremans 2502 (JBL-Spirit; Epidendra) – JQ995363 This Study
Stelis punctulata 1 JBL-11487 (JBL-Spirit) – JQ995364 This Study
Stelis punctulata 2 A. P. Karremans 2946 (WAG-Spirit) JF934845 JF934783 This Study
Stelis quadrifida 1 H. Stenzel 1298 (HAJB) – JF934819 Stenzel (2004)
Stelis quadrifida 2 H. Stenzel 967 (HAJB) – JF934820 Stenzel (2004)
Stelis quadrifida 3 – AY396076 AY008477 GenBank
Stelis quadrifida 4 D. Bogarı
´n 1676 (JBL-Spirit; Epidendra) JF934872 – This Study
Stelis quadrifida 5 – EU214429 – GenBank
Stelis quadrifida 6 PL294 (COCO) – JF934824 Wilson (Unp.)
Stelis restrepioides 1 A. P. Karremans 2953 (N.V.) JF934856 JF934795 This Study
Stelis restrepioides 2 PL297 (COCO) – JF934825 Wilson (Unp.)
Stelis restrepioides 3 PL362 (COCO) – JF934826 Wilson (Unp.)
Stelis rufobrunnea M. Soto 7816 (AMO) – JF934754 Solano-Go
´mez (Unp.)
Stelis segoviensis 1 – AF276313 AF262866 GenBank
Stelis segoviensis 2 A. P. Karremans 544 (JBL-Spirit; CR; Epidendra) – JQ995365 This Study
Stelis aff. segoviensis 1 D. Bogarı
´n 8099 (JBL-Spirit) – JQ995366 This Study
Stelis aff. segoviensis 2 A. P. Karremans 4844 (L-Spirit) – JQ995367 This Study
Stelis sp.nov. 1 D. Bogarı
´n 5576 (JBL-Spirit) JF934835 JF934770 This Study
Stelis sp.nov. 2 D. Bogarı
´n 6427 (JBL-Spirit) JF934833 JF934763 This Study
Stelis tacanensis M. Soto 2939 (AMO; K; MO; MEXU) – AF262918 GenBank
Stelis tenuissima E. Ha
´gsater 11722 (AMO) – JF934752 Solano-Go
´mez (Unp.)
Stelis velaticaulis – AF302646 AF262847 GenBank
Stelis cf. velaticaulis A. P. Karremans 2954 (WAG-Spirit) JF934837 JF934773 This Study
Trichosalpinx orbicularis – AF265476 AF262886 GenBank
AMO, COCO, CR, HAJB, JBL, L, and WAG are the herbaria where the material has been deposited. Epidendra refers to the digital voucher data
base available online at: http://www.epidendra.org
N.V., no voucher; matK, ITS, accession numbers assigned by GenBank to those sequences
A. P. Karremans et al.
123
Author's personal copy

S. pompalis (Ames) Pridgeon & M.W.Chase, and S. seg-
oviensis (Rchb.f.) Pridgeon & M.W.Chase in a well-sup-
ported subclade (P.P. =1), S. immersa (Linden & Rchb.f.)
Pridgeon & M.W.Chase and S. pilosa Pridgeon &
M.W.Chase in a second well-supported subclade (P.P. =
0.95), and accessions of S. listerophora (Schltr.) Pridgeon &
M.W.Chase and S. ornata (Rchb.f.) Pridgeon & M.W.Chase.
Clade C is a well-supported clade (P.P. =1). It can be
subdivided into two subclades, a highly supported
(P.P. =1) subclade which includes, on the one hand,
Salpistele adrianae Luer & Sijm, Stelis brunnea (Dressler)
Pridgeon & M.W.Chase, and S. maculata Pridgeon &
M.W.Chase, brought together with a support of P.P. =1
and, on the other hand, S. guttata (Luer) Pridgeon &
M.W.Chase and S. janetiae (Luer) Pridgeon & M.W.Chase,
equally well supported. The second subclade is weakly
supported (P.P. =0.57) and includes the accessions of
S. carpinterae (Schltr.) Pridgeon & M.W.Chase, S. con-
vallaria (Schltr.) Pridgeon & M.W.Chase, and S. mystax
(Luer) Pridgeon & M.W.Chase in a polytomy with a highly
supported (P.P. =0.91) clade comprising Dracontia hydra
Karremans & C.M.Sm., Dracontia lueriana Karremans,
Fig. 1 Mirrored consensus trees obtained from analysis of a concat-
enated matrix of 117 ITS and 73 matK sequences for a total of 120
combined sequences of: aa 3,500,000 generation Bayesian analysis,
with partitions set for each gene. bA 20,000,000 generation BEAST
analysis, with partitions set for each gene. Branch values are posterior
probabilities
Phylogenetics of Stelis
123
Author's personal copy

Stelis alta Pridgeon & M.W.Chase, S. carnosilabia
(A.H.Heller & A.D.Hawkes) Pridgeon & M.W.Chase,
S. cobanensis (Schltr.) Pridgeon & M.W.Chase, S. dracontea
(Luer) Pridgeon & M.W.Chase, S. gigantea Pridgeon &
M.W.Chase, S. megachlamys (Schltr.) Pupulin, and
S. papillifera (Rolfe) Pridgeon & M.W.Chase.
Clade D is a well-supported clade (P.P. =0.99) that
includes several accessions of Stelis gelida (Lindl.) Prid-
geon & M.W.Chase and one marked as S. antillensis
Pridgeon & M.W.Chase. The clade is found basal to clade
F, with high support (P.P. =1), in the Bayesian analysis
whereas it is found basal (weakly supported) to clades E
and F in the BEAST analysis.
Clade E is a well-supported clade (P.P. =1) that
includes accessions of Stelis emarginata Soto Arenas &
Solano, S. tacanensis (Lindl.) Soto Arenas & Solano, and
S. punctulata (Rchb.f.) Soto Arenas.
Clade F is a well-supported clade (P.P. =1) with a
basal polytomy indicative of three well supported sub-
clades. The first (P.P. =0.98) includes accessions of Stelis
harlingii (Garay) Pridgeon & M.W.Chase and Anathallis
anderssonii, the second (P.P. =1) includes Stelis deregu-
laris Barb. Rodr., S. pulchella Kunth,. and S. velaticaulis
(Rchb.f.) Pridgeon & M.W.Chase, and the third (P.P. =
84) shows in one subclade different accessions of
Anathallis dolichopus (P.P. =1) and in another a highly
supported subclade (P.P. =1), with all species belonging
to Stelis s. str.
Single analyses
The topology of the Bayesian consensus trees of each of
the single dataset’s analyses is not discussed in as much
detail as were the combined analyses, which have been
preferred for their better representation of the data and
overall support.
Bayesian analysis of the matK dataset (Fig. 2). In the
analyses the Stelis s.l. clade is still highly supported
(P.P. =0.98), with the exclusion of Stelis restrepioides
and S. quadrifida, and the inclusion of Anathallis anders-
sonii and A. dolichopus. Species belonging to the other
established clades are not found together in monophy-
letic groups, except for those of clade F, which includes
Stelis s. str.
Bayesian analysis of the ITS dataset (Fig. 3). The Stelis
s.l. clade has very high support (P.P. =1), with the
exclusion of Stelis restrepioides and S. quadrifida, and the
inclusion of Anathallis anderssonii and A. dolichopus.
Clade A is basal (or sister) to the whole Stelis s.l. clade.
Clade B appears in a moderately supported (P.P. =0.72)
polytomy that includes a well-supported Clade C
(P.P. =0.92). Clade D is highly supported (P.P. =1) and
Fig. 1 continued
A. P. Karremans et al.
123
Author's personal copy

is excluded from clades E and F with high support
(P.P. =1). Clade E is moderately supported (P.P. =0.76).
Clade F includes four highly supported subclades, one
(P.P. =0.99) including Stelis harlingii and Anathallis
anderssonii, another (P.P. =1) that includes S. deregularis,
S. pulchella, and S. velaticaulis. (P.P. =1), a third subclade
(P.P. =1) formed by different accessions of Anathallis
dolichopus, and a last one (P.P. =1) that includes all the
species assigned to Stelis s. str.
BEAST analysis of the ITS dataset (Fig. 4). The Stelis
s.l. clade has very high support (P.P. =1). It excludes
Stelis ephemera (Lindl.) Pridgeon & M.W.Chase, Stelis
hypnicola (Lindl.) Pridgeon & M.W.Chase, S. restrepio-
ides, and S. quadrifida, the first two related to Pabstiella
Brieger & Senghas and the latter two to Pleurothallis.
Anathallis anderssonii,A. dolichopus,A. rubens (Lindl.)
Pridgeon & M.W.Chase, and A. sclerophylla (Lindl.)
Pridgeon & M.W.Chase are embedded in the clade. Stelis
imraei, the only member of clade A, was not included, and
Clade B and Clade C were only weakly supported. Clade
D, however, is a well-supported clade (P.P. =1) and high
support (P.P. =1) is found to exclude it from clades E and
Fig. 2 Consensus tree from
Bayesian analysis of a matrix of
58 matK sequences after
8,533,000 generations, with
three partitions, one for each
codon position. Node values are
posterior probabilities
Phylogenetics of Stelis
123
Author's personal copy

F. Clade E is moderately supported (P.P. =0.74) with an
accession of Stelis nexipous Garay weakly supported as
basal to it (P.P. =0.58). Clade F is weakly supported
(P.P. =0.64), but includes four major highly supported
and interrelated clades.
Consensus networks
So called ‘‘boxes’’ in the consensus network show areas of
phylogenetic uncertainty. Alternative explanations of the
data were plotted if they were found in 20 % or more of the
Fig. 3 Consensus tree from
Bayesian analysis of a matrix of
92 ITS sequences after
5,600,000 generations. It is
unpartitioned. Node values are
posterior probabilities
A. P. Karremans et al.
123
Author's personal copy

trees (0.20 cutoff value used here). The consensus network
(Fig. 5) calculated from BEAST analysis of the combined
matrix basically suggests the phylogenetic relationships are
unclear:
1. between species of clade B;
2. between Stelis carpinterae,S. convallaria, and S.
mystax in clade C;
3. between clades D and E; and
4. between species of Crocodeilanthe and Pleurothallis
subgen. Acuminatia in clade F.
Morphology
Morphological characterization of clades and subclades
was done by evaluating the available plant material or,
when no specimen was available, by relying on the cited
literature, mostly Luer (1986). The characters that proved
most consistently distinct between the clades (Table 2)
were:
1. the type of inflorescence, which could either have open
flowers and undeveloped blossoms on the same inflo-
rescence (successive) and may keep on producing
flowers for long periods (indeterminate) or have all or
almost all flowers open at a time (simultaneous) and
produce a similar amount of flowers per inflorescence
(determinate);
2. floral ornamentation, which refers to the fact that even
though most species in Stelis s.l. have prominently
hairy sepals (hirsute), a few groups have virtually no
hairs (glabrous);
3. in most Pleurothallidinae the two lateral sepals are
fused into a synsepal, a structure similar to the dorsal
sepal in shape and size (present), but the synsepal is
not found in all clades of Stelis s.l. (absent);
4. the glenion is a depression-like, rounded, shiny
structure at the base of the lip, of unknown function-
ality associated with some Pleurothallidinae; some
species with apical anthers and stigmas in genera
Pleurothallis and Stelis have a glenion at the base of
the lip (present), such a structure is not found in
species with an elongated column and lip (absent);
5. the position of the anther in Pleurothallidinae very
much depends on the size and shape of the column, in
species of Stelis s. str. the column is much reduced,
placing the anther in an frontal position (apical),
whereas species with an elongated column mostly have
the anther tending towards the underside (incumbent);
and
6. somehow correlated with the position of the anther, the
shape and structure of pollinaria can be basically of
two kinds in Stelis s.l.:
(a) pollinaria provided with two pollen sacks
brought together by a flat and dry pair of
suborbicular caudicles (whale-tail); and
(b) pollinaria where the two pollen sacks are
brought together by linear caudicles fused to a
drop-like viscidium (bubble-like). (Structurally,
(a) is made up of male organs only whereas
(b) also involves a female organ).
Geographical distribution
Stelis (in the broad sense) is one of the most widespread
genera in Pleurothallidinae, found from Florida south to
Argentina passing through Central America and the
Caribbean (Pridgeon 2005). However, distinct geographical
Fig. 4 Consensus tree from BEAST analysis of a matrix of 149 ITS sequences. The analysis ran for 20,000,000 generations. Node values are
posterior probabilities
Phylogenetics of Stelis
123
Author's personal copy

Fig. 4 continued
A. P. Karremans et al.
123
Author's personal copy

patterns can be seen in the resulting phylogenetic trees.
Following the known distribution given by Govaerts et al.
(2011), species closely related to Stelis imraei, which are
represented here by only one accession, are mostly
Colombian, whereas those belonging to clades B and C
have a higher diversity in the south of Central America
(especially Costa Rica and Panama) and species of clades
D, E, and F are clearly more diverse in the northern Andes
(especially Ecuador). A summary of species numbers of the
clades reported per country is found in Fig. 6.
Table 2 Set of diagnostic morphological characters compared among the proposed clades
Inflorescence Ornamentation Synsepal Glenion Anther Pollinaria
Clades A and B Successive and indeterminate Hirsute Present Absent Incumbent Whale-tail
Clade C (Salpistele) Successive and indeterminate Glabrous Present Absent Incumbent Bubble-like
Clade C (Dracontia) Successive and indeterminate Glabrous Present Absent Incumbent Whale-tail
Clades D, E, and F (Acuminatia) Simultaneous and determinate Hirsute Absent Absent Incumbent Whale-tail
Clade F (Crocodeilanthe and Stelis s. str.) Simultaneous and determinate Hirsute Absent Present Apical Bubble-like
Fig. 5 Consensus Network calculated from the last 2800 trees
resulting from BEAST analysis of the concatenated ITS and matK
sequences. The threshold was set to x=0.2. Areas with boxes
indicate alternative explanations for the data in at least 20 % of the
resulting trees as compared with the final consensus tree
Phylogenetics of Stelis
123
Author's personal copy

Discussion
The resulting clades
Stelis sensu lato clade. The genus Stelis in its broad sense
(clade Stelis s.l.) is well supported, but as currently defined
it is not monophyletic. Excluded are Stelis restrepioides
and Stelis quadrifida (type species of genera Elongatia
Luer and Lalexia Luer, respectively), which are both closer
to genus Pleurothallis. Also excluded are Stelis ephemera
and Stelis hypnicola (the latter is the type species of
Pleurothallis sect. Effusae Lindl.), which are within clade
Pabstiella. In addition, Anathallis anderssonii,A. doli-
chopus,A. rubens, and A. sclerophylla are embedded in the
Stelis s.l. clade. All of these belong to Pleurothallis subgen.
Acuminatia section Acuminatae (Luer 1999; subsequently
referred to as Pleurothallis sect. Acuminatae).
Clade A. This clade is represented by a single accession
of Stelis imraei Luer (2007) included this species in his
genus Effusiella, which is supported by floral morphology
but cannot be proved genetically with the evidence pro-
vided here. We encountered problems extracting DNA and
Fig. 6 Map of most of the
American countries showing
estimated species number per
country of: aspecies belonging
to clades D, E, and F with high
diversity in the northern Andes
around Ecuador; bspecies
belonging to clades B and C
with higher diversity in Costa
Rica, Panama, and Colombia
A. P. Karremans et al.
123
Author's personal copy

sequence species from this group, but the only sequence
obtained was placed at the base of Stelis s.l. in the com-
bined analysis with high support. Whether that position is
correct can only be corroborated by adding sequences from
the other species that belong to this group in the future.
Stelis imraei and close relatives have an uncommon com-
bination of features within Stelis s.l. They have a ramicaul
that is at least twice as long as the suborbicular leaf, a
series of short, racemose, successive inflorescences that are
borne from the leaf base and aggregate to its abaxial side,
and the flowers are non-resupinate and prominently hirsute.
The habit somewhat resembles that of Pleurothallis and it
may prove to be basal to the whole Stelis s.l. group. The
Stelis imraei group is most diverse in Colombia.
Clade B. One of the least resolved relationships is that of
species belonging to genera Unciferia (sensu Luer 2004)
and Effusiella (sensu Luer 2007). Species assigned to
those genera weakly group together with several clades
depending on:
1. the presence or absence of other related sequences;
2. phylogenetic inference methods and criteria; and
3. the genetic regions analyzed.
Clade B is moderately supported in most of the analysis,
with S. immersa and S. pilosa in one group, sister to
S. canae,S. pompalis, and accessions of S. segoviensis;
both groups are variously interrelated with S. listerophora
and S. ornata.Stelis cypripedioides and S. kefersteniana,
belonging to Effusiella, and S. rodrigoi, type of genus
Condylago, occupy unresolved positions altering from the
base of Stelis s.l. to anywhere else within this clade. In the
ITS tree presented here S. cypripedioides and S. keferste-
niana are placed basal to clades D, E, and F, with low
support. It is clear that further sampling is necessary to
adequately place all the species related to this clade. On the
one hand, Pleurothallis subgen. Effusia (Luer 2000) was
composed of a series of unrelated species that were trans-
ferred to Stelis by Pridgeon and Chase (2001), but later
assigned to several different genera including Dracontia
(Luer 2004), Lalexia (Luer 2011), Niphantha (Luer 2010),
and Pabstiella (Luer 2007), the latter including the type of
the subgenus, Pabstiella hypnicola. On the other hand,
genus Effusiella (sensu Luer 2006, typified by E. ampar-
oana =Stelis pilosa), included a group of much more
closely related species, which seem to be intermingled with
Unciferia (sensu Luer 2004, typified by U. segovien-
sis =Stelis segoviensis). Species of Condylago,Effusiella,
and Unciferia (with a few exceptions) can be recognized by
having ramicauls subequal to shorter (normally much so)
than the leaves, long successive inflorescences (mostly
exceeding the leaves) and continuing to flower for several
weeks, conspicuously hirsute sepals, the lateral ones fused
into a concave synsepal, petals that are less than half the
length of the sepals, a winged column and a short (as long
as the column) movable lip, pollinaria in pairs, and whale-
tail type. They are mostly Mesoamerican. Condylago is
endemic to Panama and Colombia; most species of
Unciferia are endemic to Costa Rica and Panama, whereas
Mexico and Guatemala share most species of Effusiella.A
few species of Effusiella are reported from the Andean
region and from Brazil, but, at least in the latter, most have
been misapplied to species of Pabstiella (sensu Luer 2007).
Clade C. This clade is composed of:
1. species of genus Salpistele (Luer 1991) and Pleuro-
thallis subgenus Elongatia section Petiolatae (Luer
1994);
2. species belonging to Dracontia (sensu Luer 2004); and
3. Mystacorchis (Szlachetko and Margonska 2001) and a
few ‘‘misfits’’ from other genera.
1. A highly supported clade includes accessions of Sal-
pistele adrianae,Stelis brunnea, and Stelis maculata,
all assigned to genus Salpistele (Luer 1991), and Stelis
guttata and S. janetiae, placed in Pleurothallis subgen.
Elongatia sect. Petiolatae, later elevated to genus
Elongatia (Luer 2004). Although the similarities are
not immediately apparent, all species of this clade have
small plants (less than 10 cm tall), with petiolate
leaves that are 3 or more times longer than the rami-
cauls, creeping successive inflorescences with only one
flower open at once, petals and sepals subequal, and a
hirsute lip. All the known species are confined to the
shared mountain range between Costa Rica and Pan-
ama, where they grow at mid-elevations at approxi-
mately 1500 m.
2. Stelis alajuelensis,S. alta,S. cobanensis,S. cylindrata,
S. dracontea,S. ferrelliae,S. gigantea,S. megachla-
mys,S. multirostris,S. pachyglossa, and S. papillifera,
have been placed by Luer (2004) in genus Dracontia.
Those species, together with Dracontia hydra,
D. lueriana, and Stelis platystylis, are mostly found
associated in a well-supported clade. Those species
can be recognized by the successive inflorescences,
fleshy flowers with long, thick, three-lobed, movable
lips, convergent sepals forming a synsepal that is
similar to the dorsal sepal, concave petals, a triangular
column which is apically dentate and much shorter
than the lip, an incumbent, helm-like and large anther
(exceeding the column), ventral stigma covered by a
bubble-like rostellum, and two flat, dry, whale-tail
shaped caudicles, to name just a few distinguishing
features. Species assigned to genus Dracontia range
from Mexico to Panama, with one species in the
Greater Antilles. The greatest diversity is found in
Costa Rica and Panama, whence 16 of the 17 described
species have been reported. All are epiphytic herbs or
Phylogenetics of Stelis
123
Author's personal copy

grow on terrestrial mosses, usually found in humid or
seasonally dry forests. Most species grow at mid to
high elevations, mostly between 800 and 1800 m.
3. The relationships of the different accessions of Stelis
carpinterae,S. convallaria, and S. mystax are not clear.
They are related somehow to species allocated to
Dracontia and Salpistele; however, they are not placed
with support. On the basis of morphology the species
do not seem closely related. Sampling of closely related
species might help clarify their position; none seems to
have known close relatives, however. Luer (2004)
placed Stelis carpinterae in genus Elongatia, but the
DNA evidence presented here suggests that the other
members of that genus (S. guttata,S. janetiae, and
S. restrepioides) are not closely related to it. Stelis
mystax was placed in monotypic genus Mystacorchis
Szlach. & Marg., and Stelis convallaria in genus
Effusiella (Luer 2006), where it has no close relatives
(Luer 2000). The three taxa differ substantially mor-
phologically, both vegetatively and florally. Stelis
carpinterae and S. mystax each have a ramicaul that
exceeds the suborbicular-cordate leaf for at least twice
its length, and S. convallaria has a large elliptic leaf
that exceeds the ramicaul. They have successive
inflorescences, that of S. convallaria being multi-
flowered and much exceeding the leaf, with several
flowers open at once, whereas those of S. carpinterae
(cleistogamous) and S. mystax just exceed the leaf
and are few-flowered, with only one flower open at a
time. Sepals are elliptic and in S. carpinterae and
S. convallaria they are fused into a synsepal that is
similar to the dorsal sepal, whereas the lateral sepals of
S. mystax are fused only to the middle and are then
divergent. The petals of S. carpinterae (1:4 sepal
length) and S. mystax (1:2 sepal length) are elliptic and
acute, the petals of S. convallaria are subequal to the
sepals, spatulate and bilobed. The lip of S. carpinterae
is as long as the synsepal, flat, spatulate, with two lobes
in the middle and a suborbicular midlobe, while that of
S. convallaria is less than half the length of the sepals,
inconspicuously bilobed at the base, the midlobe
prominently bilobed, and tricallous. The lip of S. mystax
is half the length of the sepals, thick, spatulate, with an
orbicular midlobe, and a depression along the claw. All
three have a long claw at the base of the lip. The column
of S. convallaria (1:1 lip length) is alate and fimbriate,
that of S. carpinterae (1:2 lip length) is narrowed in
the middle, alate at the apex and with entire margins. The
column of S. mystax (1:4 lip length) is cylindrical. The
three species have the anther incumbent, the stigma
ventral, and the pollinaria whale-tail shaped. All three
species are found in Central America, where they are
more frequent in Costa Rica and Panama.
Clade D. Stelis emarginata (type species of Physosi-
phon), S. punctulata (type of the monotypic genus Lomax),
and Stelis tacanensis, are included in a highly supported
clade that is constant throughout all analysis. It is note-
worthy that this clade seems to be sister to the species of
Salpistele in the matK analysis consensus tree. That rela-
tionship is found in no other analysis and is not at all
apparent from the morphological characters. Morphologi-
cally, species of this clade have ramicauls that are subequal
to the elliptic leaf; they have a racemose, simultaneous
inflorescence with more than a dozen flowers, which
exceeds the leaf by up to twice the length. Sepals are
deeply connate into a tube constricted near the middle, with
free, spreading, thickened, similar apices. Petals, lip, and
column are very much reduced, approximately one-third or
less the length of the sepals. Petals are membranous, sub-
spatulate, acute. Lip is linear-elliptic, with callous lateral
lobes near the middle and an elliptic, obtuse midlobe. The
cylindrical column is as long as the lip, with the apex
winged. The anther is incumbent and the stigma is ventral.
Pollinaria are whale-tail shaped. The plant and inflores-
cence morphology remind of species of Stelis s. str., but
their floral details are unique. Species referable to this
clade seem to have their center of diversity in Mexico
where S. emarginata,S. greenwoodii,S. punctulata, and
S. tacanensis are found.
Clade E. Three different accessions of S. gelida and one
of S. antillensis constitute a highly supported clade, that is
found in all analysis. Genus Niphantha (Luer 2007) was
described without Latin description to accommodate Stelis
gelida (the type species) and S. pidax, and later validated
by the same author (Luer 2007,2010). The sequence of
S. antillensis, taken from Hagen Stenzel’s dissertation paper
(2004), is embedded in Stelis gelida. Rather than consid-
ering both species as synonymous, we believe it more
likely the samples were mixed up, as both grow in Cuba,
are morphologically similar, and the sample of S. antill-
ensis was taken from a cleistogamous plant. Stelis gelida is
characterized by a robust, tall (frequently exceeding
50 cm) habit, with a large elliptical leaf subequal to the
ramicaul, which is covered by loose tubular sheaths. The
inflorescences are 1–5 (normally a few present), subequal
to the leaf, flowers simultaneous, and transparent-white.
Sepals are obtuse and pubescent, the dorsal free, lateral
sepals fused for the first third, not converged into a syn-
sepal, petals obtuse, glabrous, thin, and margin minutely
erose. The lip is thin, subpandurate, arcuate, with a pair
parallel calli in the middle third, and apically broadly
truncate. The column is semiterete, winged, erose, and
exceeds the lip. The anther and stigma are ventral. The
pollinaria are whale-tail type. Morphologically, Stelis gelida
seems to be midway between species of Crocodeilanthe
and Effusiella (sensu Luer 2006), with the plant and
A. P. Karremans et al.
123
Author's personal copy

inflorescence morphology resembling the first, whereas the
subpandurate, arcuate lip, the long column that exceeds the
lip, the incumbent anther, the ventral stigma, and the
whale-tail pollinaria resemble the second. Stelis gelida may
be the most widely distributed of all Pleurothallidinae, as it
is frequent from Florida to the south of Brazil and the
Antilles.
An accession of Stelis nexipous, the type species of
Stelis sect. Nexipous (Garay) Luer, is related with weak
support to the Stelis gelida clade in the ITS BEAST anal-
ysis. Species of sect. Nexipous have an aberrant floral
morphology within Stelis s. str., and sampling more species
of the section may help in clarifying its position. The
section includes some 18 species from Colombia, Ecuador,
and Peru, with Ecuador by far the center of diversity with
16 endemics. They are characterized by thick ramicauls
with loose tubular sheaths, bearing coriaceous leaves,
mostly surpassed by a long, thick, racemose, multi-flow-
ered, successive inflorescence, flowers with the lateral
sepals connate more deeply to the dorsal sepal than to each
other, and stigmatic lobes that overlap the petals. Most
species of this section are epiphytic and grow at high ele-
vations, mostly above 2000 m.
Clade F. This highly supported clade has four major
subclades, basically formed by the species assigned to:
1. Stelis s. str. (Luer 2009);
2. Crocodeilanthe (Luer 2004);
3. Pleurothallis. sect. Acuminatae (Luer 1999); and
4. Physothallis (Garay 1953).
1. High support is found for a monophyletic and natural
clade that includes all species traditionally regarded as
part of Stelis s. str., and it is found in all analysis. It
includes the type species of Stelis (S. ophioglossoides,
results not presented here), and excludes Stelis nexi-
pous, from Stelis subgen. Nexipous Garay. Plant
morphology is very variable in this large group; the
habit can be caespitose or repent, tall (up to 30 cm or
more) or short (below 5 cm), the ramicaul can be
longer, subequal or shorter than the linear, elliptic, or
suborbicular leaves. The erect inflorescence is borne
from a foliaceous spathe and is simultaneous (all or
most flowers open at once). Flowers are resupinate and
with horizontal disposition perpendicular to the inflo-
rescence. The flowers of many species have temporal
activity, opening and closing in apparent response to
environmental conditions. Sepals are ovate, mostly
variously hirsute and suffused (never maculate) with a
light color, all three are mostly equally fused below the
middle, with spreading free portions, forming a fan-
like calyx. The equally long as wide petals are much
shorter than the sepals and have a recurved, thickened
apex. The lip is similar to the petals, very short and
thick, provided with a basal glenion, and immobile.
The column is straight and short, stout, cylindrical,
widening toward the apex, wing-less, with an apical
anther and stigma. A column foot which is suggested
by Luer (2009) but was not seen, if present, would be
very much reduced and with no apparent functionality.
The stigma is trilobed with one lobe transformed into a
triangular rostellum positioned just below the anther.
The ovate acute anther covers two rounded pollinia.
The pollinaria are provided with a pair of cylindrical
caudicles, which are attached to a sticky, hard visci-
dium (subsequently referred to as bubble-like polli-
naria). The viscidium looks like a droplet on the apex
of the column. In this large group many species have
diverged from the typical morphological character
states, several species have successive inflorescences
(instead of the more common simultaneous), glabrous
sepals (instead of hirsute), convergent lateral sepals
(instead of spreading), elliptic and flat petals (instead
of ovate and transversely thickened), and a curved,
elongated column (instead of short and straight).
However, even if it is common for species of Stelis s.
str. to have one of these alternative states, they are
never all found together in one species. Garay (1979)
segregated a group of species from Stelis on the basis
of an unlobed stigma. Throughout the whole group,
however, the stigma is variable, sometimes seeming
clearly lobed and others not at all, without any clear
phylogenetic pattern. Species of Stelis s. str. can be
found from Florida to Bolivia and Argentina and in the
Antilles, from sea level to above 3000 m elevation and
in almost any kind of life zone. The highest diversity is
found in the central Andes, almost 500 (more than half
the known species) are found in Ecuador, whereas only
a few dozen are found in each of the Central American
countries (except Costa Rica) and the Antilles.
2. Stelis atwoodii,S. deregularis,S. galeata,S. pulchella,
and S. velaticaulis, are grouped together (when
present) with high support in all the analysis. All
these species have been assigned to Pleurothallis
subgen. Crocodeilanthe (Luer 1986,1998), and were
later placed in genus Crocodeilanthe (Luer 2004).
Stelis deregularis was included in Pleurothallis sub-
gen. Crocodeilanthe (Luer 1986), but not transferred to
genus Crocodeilanthe. It was instead selected as type
species of Pleurothallis subgen. Pseudostelis (Luer
1999), and genus Pseudostelis. The type species of
genus Crocodeilanthe has not been sequenced, but,
because of morphological affinity, is expected to be
close to Stelis galeata and S. velaticaulis. Species of
Crocodeilanthe (sensu Luer 2004) can be recognized
by the relatively large plants with long ramicauls
(normally much longer than the leaves), the loose
Phylogenetics of Stelis
123
Author's personal copy

conspicuous bracts that enclose the bases of the
ramicauls, and the erect racemose multiflowered
simultaneous inflorescences, borne from a normally
conspicuous spathe, bearing relatively small, mostly
whitish or yellowish resupinate flowers. Sepals are
similar to each other, never caudate, the lateral ones
connate to around the middle. The petals are obtuse
and 1 to 3 veined. The lip is short and simple,
commonly with two small lateral lobes, attached to the
bulbous base of the usually short and straight column,
the anther is apical to subapical, and the pollinia are
bubble-like type. Some 80 species belong to this clade,
almost exclusively from the Northern Andes in
Colombia to Peru
´. The only species known from the
Antilles is S. antillensis, whereas S. deregularis has a
wide distribution, from Mexico south to Brazil. With
the exception of S. deregularis, all Crocodeilanthe are
found above 1500 m elevation, more commonly
between 2000 and 3000 m.
3. Pleurothallis subgen. Acuminatia (Luer 1999) was
divided into two sections, sect. Acuminatae, with
Pleurothallis acuminata as type, and sect. Alatae Luer,
typified by Pleurothallis obovata (Luer 1999). Prid-
geon et al. (2001) found that Pleurothallis obovata
(=Pleurothallis fasciculata, lectotype of genus Ana-
thallis) and other species of sect. Alatae occupied a
basal position in the phylogeny of the Pleurothallid-
inae, but no species of sect. Acuminatae were included
in their phylogenetic analysis. Anathallis anderssonii,
A. dolichopus,A. sclerophylla, and A. rubens, all
belong to sect. Acuminatae, and are close relatives but
do not group together into a monophyletic clade;
instead, they are all somehow interrelated with species
of Physothallis (Garay 1953) and Crocodeilanthe
(Luer 2004). Species of this group can be recognized
by the ramicauls longer than the elliptic leaf, and the
erect, racemose, multiflowered, simultaneous inflores-
cences that are longer than the leaf, borne from an
inconspicuous spathe, with yellowish, resupinate flow-
ers. Sepals are similar to each other, mostly long
caudate, and spreading; thus most species appear star-
like, pubescent within, the petals broadly obtuse to
rounded at the apex, the column is long and slender,
with an incumbent anther, the lip is entire to shallowly
lobed. Approximately two dozen species belong to this
clade, mostly found in the central Andes of Peru and
Bolivia, usually above 2000 m elevation. Anathallis
dolichopus and A. scariosa are the only two species to
occur north of Panama, and A. acuminata and A.
rubens are the only two species found in Brazil.
4. Contradictory relationships are found between two
accessions of Stelis harlingii, (type species of genus
Physothallis), and members of Pleurothallis sect.
Acuminatae (Luer 1999). In the ITS and combined
consensus trees, S. harlingii is found together with
A. anderssonii, with high support, whereas in the matK
analysis consensus tree it associates with A. dolich-
opus. The second species assigned to genus Physo-
thallis,Stelis cylindrica (Luer 1977), was not
sequenced. In the strict sense, members of Physothallis
can be recognized by the long, successive, racemose,
multi-flowered inflorescences, the lateral sepals com-
pletely fused with the dorsal, and the apex thickened
and recurved. The two species known to belong to this
clade are endemic to Ecuador, are terrestrial (probably
lithophytic), and grow at approximately 2000 m
elevation.
Not all species assigned to Stelis s. str., Pleurothallis
sect. Acuminatae,Crocodeilanthe (including Pseudostelis),
Physothallis,Niphantha, and Physosiphon (including
Lomax) have been included here; additional sampling may
be required to accommodate the remaining species into one
of the groupings. Further sampling could possibly resolve
how species of Pleurothallis sect. Acuminatae are related
to species of Physothallis and Crocodeilanthe, where the
remaining species allocated to Pleurothallis subgen.
Pseudostelis (Luer 1999) should be placed, whether all
species in the variable Crocodeilanthe (Luer 2004) actually
belong together, and whether all species of Stelis sect.
Nexipous should be excluded from Stelis s. str. and where
they should be actually placed.
Evolutionary trends
Several ancestral and derived character states have been
suggested for orchids in the past, together with hypotheses
about evolutionary trends in some lineages. However,
determining state polarization for groups belonging to
different phyletic lines has always been a difficult task for
systemacists. DNA-based phylogenies enable us, with a
greater certainty, to determine which character state is
more basal and which more derived in the strict framework
of the studied groups. As for Stelis, the computer-generated
phylogenetic trees reveal distinct tendencies among the
sampled taxa and the groups to which they belong (Fig. 7).
Reproductive organs (Fig. 8). Most groups of Pleuro-
thallidinae have what has here been called ‘‘whale-tail’’
type pollinaria, where two pollinia are brought together by
a pair of flattened, dry, suborbicular, bifid caudicles, pro-
vided with irregular margins and perhaps at least partly
formed by sterile pollen grains (as in other groups of
the Epidendroideae, e.g., Laeliinae). The non-detachable
viscidium (a drop or line of viscid liquid, for which the term
viscarium has been proposed) is well separate, and found
on the apex of the rostellum. However, in several unrelated
A. P. Karremans et al.
123
Author's personal copy

Fig. 7 Morphological characters patterns plotted on per clade
summarized trees. Thickened branches indicate clades in which:
athe inflorescence is simultaneous and determinate (vs. successive
and indeterminate); bthe inflorescence is creeping (vs. erect);
cflowers have the lateral sepals fused into a synsepal (vs. no
synsepal); dflowers have a glenion at the base of the lip (vs. no
glenion); eflowers have an apical anther (vs. incumbent); fflowers
have a bubble-like type pollinaria (vs. whale-tail type pollinaria)
Phylogenetics of Stelis
123
Author's personal copy

clades the distance between the apex of the rostellum and
the base of the anther is shorter (proximity achieved by
reduction in column length and the apical position of the
anther and stigma), and the caudicles are united to the
viscid liquid to form a ‘‘bubble-like’’ type pollinaria.
Bubble-like type (B) pollinaria are found in derived groups
whereas the ancestral state has a whale-tail type (W).
Examples are Pleurothallis quadrifida (Lex.) Lindl. (W),
which is basal to genus Pleurothallis (B), and Pleurothallis
rubella Luer (W) which is basal to genus Platystele (B). As
discussed here, species of clades A, B, and C (excluding
those assigned to genus Salpistele) all have W-type polli-
naria, whereas species assigned to Salpistele in clade C,
have B-type; and species of clades D, E, and those assigned
to Acuminatia in clade F, all have W-type pollinaria but
those assigned to Crocodeilanthe and Stelis s. str. in clade
F are B-type.
Speciation (Fig. 9). Number of species traditionally has
been associated one way or another with evolutionary
success. Even though most of the genera within Pleuro-
thallidinae have an elongated column and incumbent
anther, the most diverse genera have compact columns and
apical anthers. Lepanthes,Pleurothallis, and Stelis are the
most species rich genera of Pleurothallidinae, altogether
accounting for more than 50 % of the species of the sub-
tribe, and they are predominantly characterized by short
columns and apical anthers. On a smaller scale, the clades
of Stelis s.l. commonly have only a few to a couple dozen
Fig. 8 Variation in the morphology, structure, and function of
the reproductive organs within Stelis s.l. aColumn apices showing
1,S. megachlamys, ventral view showing an incumbent anther at the
base of which the dry pollinaria’s caudicles are visible, well separate
from the ventral stigma covered by a bubble-like rostellum (whale-tail
type pollinaria); 2,S. janetiae, frontal view showing the apical anther,
embraced the apical stigma’s lobes, at the base of the anther a drop-
like viscidium unites the pollinaria’s caudicles with the apex of the
rostellum (bubble-like type pollinaria); 3,Stelis s. str., ventral view
showing an intermediate structure, with an incumbent anther and
ventral stigma, but a rostellum shortened to enable contact between its
viscid apex and the pollinaria’s caudicles. bPollinaria of Stelis imraei
(1), S. alta (2), S. papillifera (3), S. ramonensis (4), Condylago
furculifera (5), Stelis segoviensis (6), S. janetiae (7), Stelis s. str. (8)
and S. deregularis.1–6 are whale-tail type, and lack a viscidium; 7–9
are the bubble-like type, with the drop like viscidium still attached in
8and 9. Photographs by A.P. Karremans and F. Pupulin
A. P. Karremans et al.
123
Author's personal copy

Fig. 9 Representative members of Stelis s.l. showing variation in flower morphology; with the here assigned clade each species belongs to
indicated in brackets. Photographs by A.P. Karremans, D. Bogarı
´n and F. Pupulin
Phylogenetics of Stelis
123
Author's personal copy

species (clades A, B, C, D, and E), whilst clade F, which
includes subclades Crocodeilanthe (with almost 100 spe-
cies) and Stelis s. str. (with several hundred species), has
about ten times more species than all other clades com-
bined, and both with a compact column and apical anther.
It is perhaps not irrational to suggest that the apical position
of the rostellum and the detachable viscidium, paired with
a distinct shortening of the column, were particularly
functional to improving pollination efficiency and broad-
ening the spectrum of effective pollinators.
Geographical distribution (Fig. 10). Species of Stelis (in
its broad sense) and Pleurothallidinae in general are
widely distributed, growing as epiphytes or as terrestrials
in humus throughout most of tropical and subtropical
America and at almost every elevation available. None-
theless, there are noticeable patterns in their distribution.
Dilomilis Raf. and Neocogniauxia Schltr., basal to the
whole subtribe, are only found in the Antilles, whereas
Acianthera Scheidw., Anathallis Barb. Rodr., and
Octomeria R.Br., the largest basal genera, have their centers
of diversity in the Brazilian lowlands. The overall most
species-rich genera (Lepanthes,Pleurothallis, and Stelis)
are both more derived and predominantly Andean in dis-
tribution. In the clades studied here a similar pattern is
found, the more basal clades (species of clades A, B, C, D,
and E) being composed of species that are most diverse in
Central America south to Colombia and mostly found at
mid elevations, from 1000 to 2000 m, whereas clade F
includes species which are most predominantly Andean in
distribution and more diverse at highest elevations (above
2000 m).
Conclusions
Much has been said to defend or reject molecular evidence
as the key to classifying organisms. The reality is that
DNA-based phylogenies may well be the least subjective in
inferring species evolutionary relationships and, therefore,
a powerful starting point. DNA-based phylogenetic trees
enable us, for the first time, to identify the ancestral and
derived states of characters in a group context; they are,
thus, a significant tool enabling understanding of evolu-
tionary trends in character states and their systematic rel-
evance in related species groups.
Taxonomic implications
On the basis of DNA alone it is not possible to establish
whether genus Stelis should include all species of clade
Stelis s.l. or only those of Stelis s. str. (or for that matter
any other clade along the way). Both clades are clear,
monophyletic, constantly and highly supported, and
include a large number of species, and so either is equally
justifiable on a genetic basis. Stelis s. str. is, however,
easier to circumscribe on morphological terms, which
seemingly reflect evolutionary trends. It is important to
mention that Stelis nexipous did not group together with the
other members of Stelis s. str., this species is the only
member of the morphologically aberrant Stelis subgen.
Nexipous (Garay) Luer that was included here. Further
research on its floral morphology and inclusion of other
species of the group might reveal they should be excluded
from Stelis s. str.
Fig. 10 Geographical patterns plotted on a per clade summarized
tree. Latin America has been tentatively divided into three represen-
tative geographical regions, Mesoamerica, Colombia, and the
northern Andes. Colors on the tree indicate the region in which each
clade(s) is most diverse following their known distributions
A. P. Karremans et al.
123
Author's personal copy

Elongatia (Luer 2004) and Effusiella (Luer 2007) are
both paraphyletic. Although the type species of the first is
closer to Pleurothallis than to Stelis, at least three other
species assigned to the genus belong to what has here been
denoted clade C. Genus Effusiella has members spread out
among clades A, B, and C. Species assigned to genus
Unciferia (Luer 2004) seem to form a monophyletic group,
but they are variously related to several species of Effusi-
ella, including its type, and other taxa placed in clade
B. Additionally, that generic name is too similar to
Uncifera Lindl., another genus in Orchidaceae, and should
therefore not be used.
The type species of genera Pseudostelis Schltr. (1922)
and Lomax Luer (2006) are embedded in the generic con-
cepts of Crocodeilanthe Rchb.f. (clade F) and Physosiphon
Lindl. (clade D), respectively. Genus Lalexia (Luer 2011)
is not synonymous with Stelis in any of its circumscrip-
tions; it forms a quite distinctive clade, allied to
Pleurothallis.
Anathallis,Pabstiella,Pleurothallis, and Stelis, as cir-
cumscribed by Pridgeon and Chase (2001) and Pridgeon
(2005), are non-monophyletic or paraphyletic according
to our results. Several species assigned to Anathallis
are closer to Stelis, including Anathallis anderssonii,
A. dolichopus,A. rubens, and A. sclerophylla, and, on the
basis of morphology, it is highly likely that Luer’s whole
Pleurothallis subgen. Acuminatia sect. Acuminatiae
belongs in Stelis s.l. Several species assigned to Stelis s.l.
are actually closely allied to Pabstiella and Pleurothallis.
Stelis ephemera and S. hypnicola belong in genus Pabstiella,
possibly together with all other species placed by Luer in
Pleurothallis subgen. Effusia (2000) and later transferred to
Pabstiella (Luer 2007). Stelis quadrifida and S. restrepioides
are clearly related to Pleurothallis, the first seems to have no
close relatives whereas the second, placed in genus Elongatia
(Luer 2004), is morphologically similar to Stelis excelsa
Garay, Stelis holtonii Luer, Stelis macrophylla H.B.K., and
Stelis superbiens, which we suspect should all be excluded
from Stelis s.l.
However, it is premature at this point to establish new
schemes of classification for this group as a whole. The
results of genetic sampling must be coupled with mor-
phological characters and geographical distributions to
enable understanding of evolutionary patterns, and, to
place them adequately, additional sequencing of several
species groups should be conducted.
Acknowledgments We are indebted to J. Wieringa, M. Sosef, and
T. Damen at the herbarium Vadense in Wageningen, for access to the
collections, for sharing their knowledge, and for their support. We are
very grateful to Antonius Sijm and Jacobus Wubben for free access to
their collections and their openness. We are very much indebted to
Linda Kodde for her collaboration and knowledge on DNA extraction
and sequencing; without her this paper would not have been possible.
We thank Stephen Kirby and Mark Wilson for revising the manu-
script and for their help throughout this study. Hagen Stenzel was
kind enough to allow us to use some of his DNA sequences. Diego
Bogarı
´n helped with several of the photographs and specimen col-
lections. Federico Albertazzi kindly helped with the sequencing of a
few species in his laboratory. We are especially thankful to the sci-
entific services of Costa Rican Ministry of Environment, Energy and
Telecommunications (MINAET) and its National System of Con-
servation Areas (SINAC) for issuing the Scientific Passports under
which wild species treated in this study were collected. We thank the
Vice-Presidency of Research of the University of Costa Rica for
providing support under projects 814-A7-015 ‘‘Inventario y taxo-
nomı
´a de la flora epı
´fita de la regio
´n Mesoamericana’’, 814-BO-052,
‘‘Flora Costaricensis: Taxonomı
´a y Filogenia de la subtribu Pleuro-
thallidinae (Orchidaceae) en Costa Rica’’, and 814-B1-239 ‘‘Filogenia
molecular de las especies de Orchidaceae ende
´micas de Costa Rica’’.
We are grateful to the personnel at CR, INB, JBL, L, USJ, and WAG
for granting full access to their collections. Finally, Jorge Warner,
director of Lankester Botanical Garden, opened up the living plant
collection at JBL to us and helped with transfer of plant material.
References
Brieger F, Senghas K (1976) Pabstiella, eine neue Orchideengattung
aus Brasilien. Die Orchidee 27:193–196
Dressler RL, Bogarı
´n D (2007) A new and bizarre species in the
genus Condylago (Orchidaceae: Pleurothallidinae) from Panama.
Harvard Pap. Bot. 12(1):1–5
Drummond AJ, Rambaut A (2007) BEAST: Bayesian evolutionary
analysis by sampling trees. BMC Evol Biol 7:214
Duque O (2008) Orchidaceae Stelis Swartz—Compendium. Editorial
Universidad de Antioquı
´a, Coleccio
´n de Ciencia y Tecnologı
´a
Edwards SV, Liu L, Pearl DK (2007) High-resolution species trees
without concatenation. PNAS 104(14):5936–5941
Garay LA (1953) Orchidaceae Austro-Americanae I. Svensk Bot.
Tidskr. 47:190–234
Garay LA (1979) Systematics of the genus Stelis Sw. Bot. Mus. Leafl.
27:167–259
Govaerts R, Pfahl J, Campacci MA, Holland Baptista D, Tigges H,
Shaw J, Cribb P, George A, Kreuz K, Wood J (2011) World
checklist of Orchidaceae. The Board of Trustees of the Royal
Botanic Gardens, Kew. http://www.kew.org/wcsp/. Accessed 30
June 2011
Ha
´gsater E, Soto MA (2003) Icones Orchidacearum 5–6: orchids of
Mexico 2–3. Herbario AMO, Me
´xico City
Hall TA (1999) BioEdit: a user-friendly biological sequence align-
ment editor and analysis program for Windows 95/98/NT.
Nucleic Acids Symp Ser 41:95–98
Holland BR, Moulton V (2003) Consensus networks: a method for
visualizing incompatibilities in collections of trees. In: Benson
G, Page R (eds) Algorithms in bioinformatics, WABI (2003).
Springer, Germany, pp 165–176
Holland BR, Delsuc F, Moulton V (2005) Visualizing Conflicting
Evolutionary Hypotheses in Large Collections of Trees: Using
Consensus Networks to Study the Origins of Placentals and
Hexapods. Syst Biol 54(1):66–76
Huelsenbeck JP, Ronquist F (2001) MrBayes: Bayesian inference of
phylogeny. Bioinformatics 17:754–755
Huson DH, Bryant D (2006) Application of Phylogenetic Networks in
Evolutionary Studies. Mol Biol Evol 23(2):254–267
Karremans AP (2010) Phylogenetics of Stelis (Orchidaceae: Pleuro-
thallidinae) and closely related genera, based on molecular data,
morphological characteristics and geographical distribution in
the Central American and Andean Cordilleras. MSc Thesis, Plant
Phylogenetics of Stelis
123
Author's personal copy

Sciences Group and Biosystematics Group, Wageningen
University
Karremans AP (2011) Dracontia, little known dragon orchids.
Orchids, Mag. Amer. Orchid Soc. 80(9):560–566
Karremans AP (2012) Illustrations and studies in Neotropical
Orchidaceae. 3. On the identity of Dracontia pachyglossa and
D.ramonensis; with a new species, D. lueriana (Pleurothallid-
inae). Ann. Naturhist Mus. Wien, B 113:119–132
Karremans AP, Smith CM (2012) A note on Dracontia (Orchidaceae:
Pleurothallidinae), with a new species. Harv. Pap. Bot. 17(1):
13–17
Kubatko LS, Degnan JH (2007) Inconsistency of phylogenetic
estimates from concatenated data under coalescence. Systems
Biology 56(1):17–24
Luer CA (1977) Icones Pleurothallidinarum Miscellaneous species in
the Pleurothellidinae. Addenda et corrigenda. Selbyana 3(3–4):
203–412
Luer CA (1986) Systematics of the genus Pleurothallis (Orchida-
ceae). Monogr. Syst. Bot. Missouri Bot. Gard. 20
Luer CA (1991) Icones Pleurothallidinarum VIII Systematics of
Lepanthopsis,Octomeria Subgenus Pleurothallopsis,Restrepi-
ella,Restrepiopsis,Salpistele, and Teagueia (Orchidaceae).
Monogr. Syst. Bot. Missouri Bot. Gard. 39
Luer CA (1994) Icones Pleurothallidinarum XI Systematics of
Lepanthes Subgenus Brachycladium and Pleurothallis Subgenus
Aenigma, Subgenus Elongatia, Subgenus Kraenzlinella (Orchid-
aceae). Monogr. Syst. Bot. Missouri Bot. Gard. 52
Luer CA (1998) Icones Pleurothallidinarum XVI Systematics of
Pleurothallis subgenera Crocodeilanthe,Rhynchopera,Talpina-
ria (Orchidaceae). Monogr. Syst. Bot. Missouri Bot. Gard. 65
Luer CA (1999) Icones Pleurothallidinarum XVIII Systematics of
Pleurothallis Subgen. Pleurothallis Sect. Pleurothallis Subsect.
Antenniferae, Subsect. Longiracemosae, Subsect. Macrophyllae-
Racemosae, Subsect. Perplexae, Subgen. Pseudostelis, Subgen.
Acuminatia. Monogr. Syst. Bot. Missouri Bot. Gard. 76
Luer CA (2000) Icones Pleurothallidinarum XX. Systematics of
Jostia,Andinia,Barbosella,Barbrodia, and Pleurothallis Sub-
gen. Antilla, Subgen. Effusia, Subgen. Restrepioidia. Monogr.
Syst. Bot. Missouri Bot. Gard. 79
Luer CA (2003) Pleurothallis. In: Hammel BE, Grayum MH, Herrera
C, Zamora N (eds) Manual de plantas de Costa Rica, vol III.
Missouri Botanical Garden Press, Missouri, pp 386–452
Luer CA (2004) Icones Pleurothallidinarum XXVI Pleurothallis
subgenus Acianthera and three allied subgenera. A second
century of new species of Stelis of Ecuador. Epibator,Ophidion,
Zootrophion. Monogr. Syst. Bot. Missouri Bot. Gard. 95
Luer CA (2006) Icones Pleurothallidinarum XXVIII Reconsideration
of Masdevallia, and the Systematics of Specklinia and vegeta-
tively similar genera (Orchidaceae). Monogr. Syst. Bot. Missouri
Bot. Gard. 105
Luer CA (2007) Icones Pleurothallidinarum XXIX. A third century of
Stelis of Ecuador and Systematics of Apoda-Prorepentia and
Systematics of Miscellaneous small genera, addenda: new
genera, species, and combinations (Orchidaceae). Monogr. Syst.
Bot. Missouri Bot. Gard. 112
Luer CA (2009) Icones Pleurothallidinarum XXX. Lepanthes of
Jamaica and Systematics of Stelis,Stelis of Ecuador, part four
and addenda: systematics of Masdevallia, new species of
Lepanthes from Ecuador, and miscellaneous new combinations.
Monogr. Syst. Bot. Missouri Bot. Gard. 115
Luer CA (2010) Icones Pleurothallidinarum XXXI: Lepanthes of
Bolivia. Systematics of Octomeria Species North and West of
Brazil; Addenda and Corrigenda. Monogr. Syst. Bot. Missouri
Bot. Gard. 120
Luer CA (2011) Miscellaneous new species in the Pleurothallidinae
(Orchidaceae) excluding species from Brazil. Harv. Pap. Bot.
16(2):311–360
Maddison WP, Maddison DR (2007) Mesquite: a modular system for
evolutionary analysis. Mesquite v. 2.72. http://mesquiteproject.
org
Miller D, Warren R, Moura Miller I, Seehawer H (2011) The Organ
mountain range its history and its orchids: Rı
´o de Janeiro.
Editora Scart, Nova Friburgo/RJ, Brazil
Posada D, Crandall KA (1998) ModelTest: Testing the model of DNA
substitution. Bioinformatics 14:817–818
Pridgeon AM (2005) Subtribe Pleurothallidinae. In: Pridgeon AM,
Cribb PJ, Chase MW, Rasmussen FN (eds) Genera Orchidacea-
rum, vol 4, Epidendroideae (Part One), pp 405–412
Pridgeon AM, Chase MW (2001) A phylogenetic reclassification of
Pleurothallidinae (Orchidaceae). Lindleyana 16(4):235–271
Pridgeon AM, Solano-Go
´mez R, Chase MW (2001) Phylogenetic
relationships in Pleurothallidinae (Orchidaceae): combined evi-
dence from nuclear and plastid DNA sequences. Am J Bot
88(12):2286–2308
Pupulin F (2002) Cata
´logo revisado y anotado de las Orchidaceae de
Costa Rica. Lankesteriana 4:1–88
Rambaut A (2009) FigTree v1.3.1. http://tree.bio.ed.ac.uk/software/
Rambaut A, Drummond AJ (2007) Tracer v1.4. http://tree.bio.ed.ac.
uk/software/
Ronquist F, Huelsenbeck JP (2003) MrBayes 3: Bayesian phylogenetic
inference under mixed models. Bioinformatics 19:1572–1574
Schlechter R (1922) Orchidaceae Bradeanae Paulenses. Anexos Mem.
Inst. Butantan 1(4):6–82
Solano-Go
´mez R, Salazar GA (2007) A new species of Stelis
(Orchidaceae, Pleurothallidinae) from Guerrero. Mexico. Revista
Mex. Biodivers. 78(2):253–285
Staden R, Judge DP, Bonfield JK (2003) Analysing Sequences Using
the Staden Package and EMBOSS. In: Krawetz SA, Womble DD
(eds) Introduction to Bioinformatics. A Theoretical and Practical
Approach. Human Press Inc., Totawa, NJ 07512
Stenzel H (2004) Systematics and evolution of the genus Pleurothallis
R Br. (Orchidaceae) in the Greater Antilles. Dissertation.
Mathematisch-Naturwissenschaftlichen Fakulta
¨t I der Hum-
boldt- Universita
¨t zu Berlin
Sun Y, Skinner DZ, Liang GH, Hulbert H (1994) Phylogenetic
analysis of Sorghum and related taxa using internal transcribed
spacers of nuclear ribosomal DNA. Theor Appl Genet 89:26–32
Szlachetko DL, Margonska HB (2001) Genera et species orchidalium.
3. Polish Bot. J. 46(2):113–121
A. P. Karremans et al.
123
Author's personal copy