ArticlePDF Available

Unsealed Tubewells Lead to Increased Fecal Contamination of Drinking Water

Authors:

Abstract and Figures

Bangladesh is underlain by shallow aquifers in which millions of drinking water wells are emplaced without annular seals. Fecal contamination has been widely detected in private tubewells. To evaluate the impact of well construction on microbial water quality 35 private tubewells (11 with intact cement platforms, 19 without) and 17 monitoring wells (11 with the annulus sealed with cement, six unsealed) were monitored for culturable Escherichia coli over 18 months. Additionally, two 'snapshot' sampling events were performed on a subset of wells during late-dry and early-wet seasons, wherein the fecal indicator bacteria (FIB) E. coli, Bacteroidales and the pathogenicity genes eltA (enterotoxigenic E. coli; ETEC), ipaH (Shigella) and 40/41 hexon (adenovirus) were detected using quantitative polymerase chain reaction (qPCR). No difference in E. coli detection frequency was found between tubewells with and without platforms. Unsealed private wells, however, contained culturable E. coli more frequently and higher concentrations of FIB than sealed monitoring wells (p < 0.05), suggestive of rapid downward flow along unsealed annuli. As a group the pathogens ETEC, Shigella and adenovirus were detected more frequently (10/22) during the wet season than the dry season (2/20). This suggests proper sealing of private tubewell annuli may lead to substantial improvements in microbial drinking water quality.
Content may be subject to copyright.
Provided for non-commercial research and educational use only.
Not for reproduction or distribution or commercial use.
This article was originally published by IWA Publishing. IWA Publishing recognizes
the retention of the right by the author(s) to photocopy or make single electronic
copies of the paper for their own personal use, including for their own classroom use,
or the personal use of colleagues, provided the copies are not offered for sale and
are not distributed in a systematic way outside of their employing institution.
Please note that you are not permitted to post the IWA Publishing PDF version of
your paper on your own website or your institution’s website or repository.
Please direct any queries regarding use or permissions to jwh@iwap.co.uk
Unsealed tubewells lead to increased fecal contamination
of drinking water
Peter S. K. Knappett, Larry D. McKay, Alice Layton, Daniel E. Williams,
Md. J. Alam, Brian J. Mailloux, Andrew S. Ferguson, Patricia J. Culligan,
Marc L. Serre, Michael Emch, Kazi M. Ahmed, Gary S. Sayler
and Alexander van Geen
ABSTRACT
Bangladesh is underlain by shallow aquifers in which millions of drinking water wells are emplaced
without annular seals. Fecal contamination has been widely detected in private tubewells. To
evaluate the impact of well construction on microbial water quality 35 private tubewells (11 with
intact cement platforms, 19 without) and 17 monitoring wells (11 with the annulus sealed with
cement, six unsealed) were monitored for culturable Escherichia coli over 18 months. Additionally,
two snapshot sampling events were performed on a subset of wells during late-dry and early-wet
seasons, wherein the fecal indicator bacteria (FIB) E. coli, Bacteroidales and the pathogenicity genes
eltA (enterotoxigenic E. coli; ETEC), ipaH(Shigella) and 40/41 hexon (adenovirus) were detected using
quantitative polymerase chain reaction (qPCR). No difference in E. coli detection frequency was
found between tubewells with and without platforms. Unsealed private wells, however, contained
culturable E. coli more frequently and higher concentrations of FIB than sealed monitoring wells (p <
0.05), suggestive of rapid downward ow along unsealed annuli. As a group the pathogens ETEC,
Shigella and adenovirus were detected more frequently (10/22) during the wet season than the dry
season (2/20). This suggests proper sealing of private tubewell annuli may lead to substantial
improvements in microbial drinking water quality.
Peter S. K. Knappett (corresponding author)
Larry D. McKay
Department of Earth & Planetary Sciences,
University of Tennessee,
Knoxville, TN 37996-1410, USA
E-mail: pknappet@utk.edu
Peter S. K. Knappett
Alexander van Geen
Lamont-Doherty Earth Observatory of Columbia
University,
Palisades, NY 10964, USA
Alice Layton
Daniel E. Williams
Gary S. Sayler
Center for Environmental Biotechnology,
University of Tennessee,
Knoxville, TN 37996-1605, USA
Md. J. Alam
Kazi M. Ahmed
Department of Geology,
University of Dhaka,
Dhaka 1000, Bangladesh
Brian J. Mailloux
Department of Environmental Science,
Barnard College,
New York, NY 10027, USA
Andrew S. Ferguson
Patricia J. Culligan
Civil Engineering & Engineering Mechanics,
Columbia University,
New York, NY 10027, USA
Marc L. Serre
Department of Environmental Sciences &
Engineering,
University of North Carolina Chapel Hill,
USA
Michael Emch
Department of Geography,
University of North Carolina Chapel Hill,
USA
and
Carolina Population Center,
University of North Carolina Chapel Hill,
USA
Key words
|
adenovirus, Asia, Bacteroidales, E. coli, Shigella, tubewells
565 © IWA Publishing 2012 Journal of Water and Health
|
10.4
|
2012
doi: 10.2166/wh.2012.102
INTRODUCTION
Fecal bacteria and viruses have been detected in ground-
water wells emplaced in aquifers of diverse geologic
material (Rudolph et al. ; Abbaszadegan et al. ;
Embrey & Runkle ; Borchardt et al. ; Johnson
et al. ; Kozuskanich et al. ). In developed countries,
such as the USA, wells are typically sealed with an expand-
ing clay which lls the annulus between the well casing and
the surrounding aquifer sediments from ground surface to
approximately 1 m above the screened interval to prevent
short circuiting by downward ow of contaminated surface
water or shallow groundwater. In developing countries,
such as Bangladesh, the annulus of shallow drinking water
wells, referred to as tubewells, is typically lled with soil
or sediments obtained during drilling; a measure unlikely
to prevent rapid annular ow. Recent programs have
encouraged the construction of cement platforms and drain-
age channels around well-heads to drain wash water before
it inltrates down the tubewell annulus, but there is insuf-
cient information to indicate whether this is successful
(Luby et al. ; Leber et al. ; van Geen et al. ).
Although tubewells are considered an improved drink-
ing water source by the World Health Organization
(WHO ), these tubewells still do not have adequate pro-
tection from annular ow and are considered unsealed
(personal communication, Peter Ravenscroft). The goal of
this study was to evaluate the impact of tubewell construc-
tion (specically annular seals and cement platforms) on
the levels of human exposure to fecal contamination and
pathogens.
Over 10 million of these tubewells provide drinking
water for millions of inhabitants throughout rural Bangla-
desh. In this country, 11% of all deaths are estimated to be
caused by diarrheal disease (Streatfield et al. ) with
recent studies suggesting that sustained levels of diarrheal
disease are caused in part by drinking untreated ground-
water (Escamilla et al. , ; Wu
et al. ). The
widespread fecal indicator bacteria (FIB) and bacterial and
viral pathogens found in tubewells (Luby et al. ; van
Geen et al. ; Leber et al. ; Ferguson et al. ) are
known to be predictive of diarrheal disease in diverse popu-
lations around the world (Gundry et al. ).
Bangladesh is underlain by shallow aquifers consisting
of unconsolidated sand and silt laid down by streams and
rivers owing through the Ganges-Brahmaputra delta
(Goodbred & Kuehl ; Weinman et al. ). In addition
to annular ow around the tubewell, it is possible that fecal
contamination enters aquifers and tubewells through inl-
tration from latrines or seepage from the many ponds and
canals found in rural villages (Knappett et al. a).
Recent eld experiments in Bangladesh indicate efcient
spatial removal of FIB in typical medium-grained aquifers,
with 7-log
10
removal within 13 m from leaking latrine
ponds (Knappett et al. ). This nding suggests that
fecal contamination of unconned aquifers from latrines,
ponds and other sources should have relatively limited
spatial extent. Contamination would be expected to be
even more limited in areas where the aquifer is overlain by
silt or clay layers. This is not consistent, however, with the
widespread occurrence of FIB in tubewells located in both
unconned sandy aquifers and aquifers overlain by silt
(Leber et al. ), suggesting the presence of rapid ow path-
ways, such as annular ow around the tubewell casing.
Recent programs in Bangladesh and other developing
countries have encouraged the construction of 23m
2
cement platforms with drainage channels around tubewells
to remove standing water and reduce the likelihood of annu-
lar ow of contaminated water (Luby et al. ; WHO/
UNICEF ). The utilization of cement platforms is sup-
ported by studies in rural Africa (Godfrey et al. ),
which found links between the presence of standing water
around the well-head and poor microbial water quality in
the well.
Studies spanning multiple villages and seasons in Ban-
gladesh, however, have shown that E. coli detection
frequency in private tubewells is typically insensitive to
both the presence and quality of a platform (Luby et al.
; van Geen et al. ; Leber et al. ) leading some
to suggest that tubewells are not subject to annular ow
(Luby et al. ). Only one study (Escamilla et al. ),
considering a subset of approximately 90 wells from the
study by van Geen et al.(), found that the presence of
a well platform correlated to lower E. coli detection
566 P. S. K. Knappett et al.
|
Unsealed tubewells lead to increased fecal contamination of drinking water Journal of Water and Health
|
10.4
|
2012
frequency in private wells. This effect was only signicant
during the early monsoon period (AprilJune) and at no
other time of year (Escamilla et al. ). Likely more critical
than the presence of an intact platform in preventing annu-
lar ow is the presence of a seal between the borehole and
the annulus of a well from surface to screened depth.
E. coli prevalence peaks in tubewells during the wet
season (Leber et al. ), being closely associated with ante-
cedent rainfall events (van Geen et al. ). Increases in
allochthonous bacteria concentrations in aquifers following
rainfall events are attributed to vertical ushing when bac-
teria are both introduced to the vadose zone and
mobilized from grain surfaces due to increasing water con-
tent and shear velocity (De Novio et al. ; Pronk et al.
). Pit latrines and ponds are the primary repository of
human feces in Bangladesh and the water table is very
shallow, lying 15 m below the surface, giving ample oppor-
tunity for contamination of the water table from these
numerous point sources in densely populated rural villages.
Further, ooding is widespread during the late wet season,
potentially widening the spatial extent of fecal contami-
nation sources at the surface during the time of year when
the vadose zone is thinnest (van Geen et al. ; Knappett
et al. ).
The objective of this study is to quantify the impact of
private well construction on the frequency and concen-
trations of FIB detected in tubewells within a sandy
aquifer underlying a village in rural Bangladesh. A further
objective is to assess the utility of molecular FIB markers
in predicting the year-round risk of fecal contamination of
a well emplaced within a shallow, reducing aquifer. Quanti-
tative PCR (qPCR) was used to screen for the pathogenicity
genes elt A (enterotoxigenic E. coli; ETEC), ipaH(Shigella)
and 40/41 hexon (adenovirus) to assess the ability of FIBs to
indicate the presence/absence of pathogens.
Some of the monthly cultured E. coli measurements
reported in this study for private tubewells have been pub-
lished previously in the context of a larger study nding a
broad negative correlation between E. coli detection fre-
quency and arsenic (van Geen et al. ). The previously
published monthly E. coli detection frequencies for 35 pri-
vate wells at Site K is compared here to synoptic
measurements made on 17 additional monitoring wells.
Additionally, the previously unpublished results of two
snapshot monitoring events for FIB DNA and pathogens on
a subset of private and monitoring wells are presented here.
METHODS
Site description
The village of Char Para is referred to herein as Site K
(Knappett et al. a, b). Char Para overlies a sand bar
deposit of the neighboring Old Brahmaputra river, which
ows throughout Araihazar upazilla and transported far
more water and sediment, in the past, than it does today
(Weinman et al. ). Bangladesh has a dry season
during which the region receives little rain from November
through May. The dry season is followed by the monsoon, a
period of 34 months during which Bangladesh receives the
vast majority of its total rainfall for the year. In this study,
rainfall was measured using a HOBO weather station
(ONSET, Bourne, MA) in the region of Matlab, 50 km
south of Site K. The unconned water table at Site K uctu-
ates throughout the year from 4 m below the surface at the
end of the dry season to within 1 m of the surface during
the wet season (Knappett et al. ). Although there is an
inuence of the local river which bounds three sides of the
village, lateral hydraulic gradients throughout Site K are
small and affected by irrigation pumping in the surrounding
rice elds. Approximately 1,500 people live in Site K.
Roughly 50 ponds and 180 latrines are scattered throughout
the site. Half of these latrines spill efuent onto the open
ground (Knappett et al. a), consistent with the country-
wide improved sanitation coverage for rural Bangladesh in
2010 of only 43% (WHO/UNICEF ).
Private wells in Bangladesh, referred to as tubewells,
are inexpensive PVC pipes with 11.5 m screened intervals
equipped with iron hand pumps and are typically screened
at depths ranging from 8 to 30 m below the ground surface
(van Geen et al. ). As of 2009 our exhaustive survey of
Char Para (Site K) indicated that it contained 144 private
tubewells. Therefore 1 tubewell supplies drinking water for
10 people, as there are 1,500 inhabitants in the village
(Knappett et al. a ). Drillers will typically drill no further
than the depth necessary to ensure a year-round supply. In
the absence of poorly conductive surface deposits, tubewells
567 P. S. K. Knappett et al.
|
Unsealed tubewells lead to increased fecal contamination of drinking water Journal of Water and Health
|
10.4
|
2012
will be quite shallow as they are at Site K (Leber et al. ).
The minimum and maximum depths of these private tube-
wells, reported by the owners, were 6.1 and 91.5 m,
respectively, with a median depth of 9.1 m. The positions
of all wells in this study were determined using high accu-
racy (sub-meter) GPS using a Trimble GeoXH receiver
and Terrasync 2.4 software. GPS data were post-processed
using Pathnder Ofce 3.0 (Trimble Navigation Ltd, Sunny-
vale, CA).
Drillers in Bangladesh do not typically use any material
to seal the outside of the PVC pipe (personal communi-
cation, Peter Ravenscroft) from rapid annular ow or
short-circuiting of surface water or near-surface water to
screened interval depth. In developed countries, bentonite,
an expanding clay, will typically be used to seal wells. To
control for the possibility of annular ow, 11 monitoring
wells with cement seals (MS) were installed in January
2008 throughout Site K. Ten of these had 1.5 m screens at
the same depth as a nearby private well, and one was
installed at some distance from all the 35 monitored private
wells (Figure 1) and was screened at a typical depth. In
addition six monitoring wells were installed within two
multilevel nests, previous to 2008 without cement seals
(M) (Table 1). These unsealed monitoring wells served as
intermediates between private (P) and sealed monitoring
(MS) wells to test for an effect of regular pumping only (as
opposed to pumping absence and seal presence combined)
on the frequency of E. coli detections in the well. The
depths of the 35 class P wells varied between 5.8 and
30.5 m (5th and 95th percentile were 6.1 and 15.2 m,
respectively) and the median depth was 7.6 m. Depths of
the 11 MS wells varied between 7.2 and 15.4 m and the
median depth was 7.7 m. All wells were monitored for
E. coli monthly for the period from April 2008 through
November 2009.
Well sampling
Continuous pumping from both P and MS tubewells has
been observed to dramatically decrease measured concen-
trations of E. coli over a 24-hour period (Knappett et al.
b), therefore prior to sampling all wells were purged
for a consistent three well-bore volumes. Duplicate 100 mL
water samples were taken from every well. Private tubewells
Figure 1
|
Locations of 35 unsealed private tubewells (triangles), six unsealed (circles) and 11 sealed monitoring wells (squares) within Char Para (Site K). The six unsealed monitoring wells
are contained within two multilevel piezometer nests. Image produced in Google Earth
©
. The inset country map is from www.mapresources.com. The scale bar in the bottom
left corner represents 200 m.
568 P. S. K. Knappett et al.
|
Unsealed tubewells lead to increased fecal contamination of drinking water Journal of Water and Health
|
10.4
|
2012
were sampled using the existing iron hand pump whereas
monitoring wells were pumped using submersible electric
pumps (Typhoon, Groundwater Essentials, LLC) at ow
rates ranging from 2 to 8 L/min. In between monitoring
wells, all tubing and electric pumps were ushed with a
bleach and TWEEN solution diluted in water derived from
the well just sampled, followed by rinsing once with well
water and once with sodium thiosulfate as detailed in Knap-
pett et al.(b).
Two snapshot sampling events were performed, once
during the dry season (March 1618) and once during the
wet season (July 37) in 2009 to analyze for a broad spectrum
of FIBs and pathogens. Cultured E. coli was measured con-
currently, only during the wet season sampling event.
Microbial analyses
E. coli was quantied using the Most Probable Numbers
(MPN) based Colilert test kit (IDEXX Laboratories,
Inc.). Duplicate 100 mL groundwater samples were col-
lected in sterile containers and measurements were carried
out in a laboratory within 8 hours of sample collection.
MPN of E. coli were determined by combining the numbers
of discrete positive wells in both trays (Hurley & Roscoe
; Knappett et al. b).
For enumeration of fecal bacteria genomes, 48L of
groundwater was ltered onto 0.22 μm nitrocellulose lters.
The lters were removed from the plastic housing, placed in
sterile Petri dishes, frozen and transported on dry ice to the
University of Tennessee. DNA was extracted and puried
from the lters using the FastDNA
®
SPIN for Soil Kit (MP
Biomedicals, LLC, Solon, Ohio) following the manufac-
turers protocols. DNA was measured using a nanodrop
and the extracts were diluted to 510 ng/μL of total DNA
to avoid inhibition, and this was further veried by
measuring the amount of a known plasmid spike added to
each sample for each PCR run.
Quantitative PCR was performed to detect E. coli and
Bacteroidales using the same assays and laboratory methods
as described in our previous study (Knappett et al. b).
The gene targets for the E. coli (herein referred to as mE.
coli) and Bacteroidales assays were the 23S rRNA gene
and the 16S rRNA gene, respectively (Bernhard & Field
; Scott et al. ; Layton et al. ; Noble et al.
; Kildare et al. ) and the primer and probe
sequences are provided in Table 2. Pathogen genes (eltA,
ipaH and adenovirus 40/41) were assayed in duplicate or tri-
plicate using the primers, probes and master mix types listed
in Table 2 and following standard qPCR protocols described
in previous studies (Knappett et al. b). Standards for the
quantitative PCR reactions were made from a relevant gene
fragment cloned into PCR4-TOPO cloning vector (Layton
et al. ). The method detection limit (MDL) was deter-
mined from the standard curve to be 20 gene copies per
qPCR reaction. Data were calculated only for samples in
which at least two PCR reactions had >1 gene copy and
were quantied as copies/μL nucleic acid extract. Gene
copies were adjusted to copies/100 mL for tubewell water
based on the fraction of the lter extracted, multiplied by
the volume of DNA extract and divided by the ltered
sample volume. Due to differences in the volume of water
ltered for each sample, the MDL varied somewhat with
each sample (Knappett et al. b) with a mean detection
limit of four copies/100 mL for the groundwater samples
(Ferguson et al. ).
Experimental design and statistical analyses
The three well types (P, M and MS) were compared for E. coli
prevalence using binned wet/dry season box plots and a
monthly time series comparison between P and MS wells.
A 6-month dry season was dened here from November 15
through May 15 with the wet season being the other half of
the year. A total of 18 months were available (April 2008
through October 2009) for which all three classes of wells
were sampled each month (class P wells were also sampled
from January 2008 through April 2008). For statistical testing
on binned wet/dry season data a minimum of ve sampling
events were required in each season for each well, causing
Table 1
|
Classication of tubewells at Site K
Well type (notation) Seal (y/n) Pumping frequency Count
Private (P) N Daily 35
Monitoring (M) N Monthly 6
Monitoring (MS) Y Monthly 11
Total 52
569 P. S. K. Knappett et al.
|
Unsealed tubewells lead to increased fecal contamination of drinking water Journal of Water and Health
|
10.4
|
2012
the numbers of wells in each category to be reduced to 33, 6
and 11 for P, M and MS, respectively. Analysis of variance
(ANOVA) was performed three times with well class as the
treatment and E. coli frequency during year round, wet
and dry seasons as response variables, to determine differ-
ences between the classes of wells. Further, the non-
parametric Kruskal-Wallis test was performed on the ranks
to conrm statistical differences between paired classes of
wells using the statistical software NCSS (version 07.1.14,
NCSS, LLC, Kaysville, Utah). E. coli prevalence in a given
well (across time) or during a given month (across space)
was accompanied by the approximation ±2[p (1 p)/n]
1/2
used to estimate 95% CIs for the proportion of wells p with
detectable E. coli where n is the total number of sampling
events or wells respectively (Gelman & Hill ).
RESULTS AND DISCUSSION
Monthly E. coli detection frequency in sealed and
unsealed wells
E. coli prevalence in tubewells was observed to be substan-
tially higher in the monsoon than the dry season
(Figures 2(b) and 2(c)). An ANOVA on the E. coli preva-
lence data conrmed that well class (P, M, MS)
signicantly impacted the frequency of E. coli detected in
a well, both year-round (Figure 2(a)) and during the wet
season (p < 0.05) (Figure 2(b)), but not during the dry
season (Figure 2(c)). Non-parametric Kruskal-Wallis tests
between pairs of well classes conrmed that P wells were
more frequently contaminated than MS wells year-round
and during the wet season (p < 0.05) (Figures 2(a) and
2(b)). E. coli prevalence in M wells was intermediate and
not signicantly different from either P or MS wells. The
lesser E. coli prevalence in M wells than P wells suggests
that daily pumping from private tubewells plays a role in
fecal contamination. Other possible causes of more frequent
private tubewell contamination over monitoring wells (M
and MS) include biolm growth within the iron hand
pump (Ferguson et al. ) and the introduction of E. coli
into the well following pump priming of private wells (van
Geen et al. ).
Although annular sealing appeared to substantially
reduce E. coli detection frequency, the presence of an
intact cement platform had no impact on the microbial
drinking water quality from a private tubewell in either the
wet or dry seasons (Figures 2(e) and 2(f)). The WHO/
Table 2
|
Quantitative PCR primer and probes used to target specic genes and organisms in tubewell water samples
Target organism
Assay gene target (assay
type and annealing
temperature) Oligonucleotide sequences
a
Reference
E. coli 23S rRNA
(uorogenic probe,
55
W
C)
EC23Sf, 5
0
GAG CCT GAA TCA GTG TGT GTG 3
0
Knappett et al.
(b)EC23Sr, 5
0
ATT TTT GTG TAC GGG GCT GT 3
0
EC23Srv1Taq, 5
0
CGC CTT TCC AGA CGC TTC CAC
All Bacteroides 16S rRNA
(uorogenic probe,
60
W
C)
AllBac296f, 5
0
-GAGAGGAAGGTCCCCCAC-3
0
Layton et al.
()AllBac412r, 5
0
-CGCTACTTGGCTGGTTCAG-3
0
AllBac375Taq, 5
0
CCATTGACCAATATTCCTCACTGCTGCCT
(BHQ-1)-3
0
Shigella and entero-
invasive E.coli
(dysentery-type E. coli)
ipaH(uorogenic
probe, 60
W
C)
IpaH U1f- 5
0
CCTTTTCCGCGTTCCTTG A-3
0
von Seidlein
et al.()IpaH L1r- 5
0
- CGGAATCCGGAGGTATTG C-3
0
IpaHTaq- 5
0
-CGCCTTTCCGATACCGTCTCTGCA-3
0
Enterotoxigenic E. coli
strains
eltA (heat labile toxin
LT) ( uorogenic
probe, 60
W
C)
Elt311f- 5
0
TCTGAATATAGCTCCGGCAGA-3
0
Modied from
Persson et al.
()
Elt414r-5
0
CAACCTTGTGGTGCATGATGA-3
0
Elt383Taqr -5
0
TTCTCTCCAAGCTTGGTGATCCGGT-3
0
Adenovirus 40/41 Hexon (uorogenic
probe, 60
W
C)
AV40/41-117f, 5
0
- CAGCCTGGGGAACAAGTTCAG 3
0
Rajal et al.
()AV40/41-258r, 5
0
-CAGCGTAAAGCGCACTTTGTAA 3
0
AV40/41-157Taq, 5
0
ACCCACGATGTAACCACAGACAGGTC 3
0
a
All probes synthesized with FAM (uorescein) and black hole quencher 1 (BHQ1) from Biosearch Technologies.
570 P. S. K. Knappett et al.
|
Unsealed tubewells lead to increased fecal contamination of drinking water Journal of Water and Health
|
10.4
|
2012
UNICEF () well construction guidelines emphasize the
importance of an adequate drainage channel to allow the
spilled water to leave the well-head area; however, strictly
speaking this is not required for the classication of a tube-
well as an improved drinking water source (WHO/
UNICEF ). As of 2010, 80% of the rural population in
Bangladesh was recorded drinking from improved water
sources (WHO/UNICEF ). In our exhaustive survey of
the 144 private tubewells at Site K in 2009, however, only
42% (61/144) of private tubewells had intact platforms,
and many of these did not have drainage channels. In a
related study combining 32 wells from Site K with 93
wells in Matlab upazilla, 50 km south of Site K, only 51%
(64/125) of all tubewells had intact platforms (van Geen
et al. ). In the present study, we did not differentiate
between intact platforms with and without good drainage
channels. The sample size in the present study for which
monthly E. coli measurements were available is small,
with 11 tubewells having good platforms and 19 that did
not have platforms or had broken platforms. Other studies,
however, have reported the insensitivity of platform quality
and presence for FIB detection frequency in private tube-
wells in Bangladesh (Luby et al. ; Leber et al. ;
van Geen et al. ). This nding has led some to conclude
that annular ow is not important in Bangladesh where
wells are drilled and not dug (Luby et al. ). Based on
the information presented in this study, annular ow
seems to degrade microbial water quality, but the presence
of an intact platform has little protective effect. This may
be due to the general absence of good drainage channels,
or the at terrain which leads to ponding around well-
heads, rendering intact platforms and long drainage chan-
nels irrelevant following large rainfall events.
It was hypothesized that E. coli detection frequency
would decrease with depth. Well depth was not found to
correlate to E. coli detection frequency for any class (P,
M, MS) of wells in this study for any month or binned
season. This is consistent with other studies measuring
Figure 2
|
Detection frequencies of E. coli in monthly monitored private (P), unsealed monitoring (M), and sealed monitoring (MS) wells from April 2008 through November 2009. For the
well type plots (a)(c) the number of wells with at least 5 months of monthly data in each season were 33, six and 11 for P, M and MS respectively. There were a total of 12
possible wet season sampling events and 6 dry season months. In the platform presence plots (d)(f), only private wells are presented here since no monitoring wells had
cement platforms. A reduced number of private wells (n ¼ 30) was available due to missing information.
571 P. S. K. Knappett et al.
|
Unsealed tubewells lead to increased fecal contamination of drinking water Journal of Water and Health
|
10.4
|
2012
FIB contamination risk factors in private tubewells in Ban-
gladesh (Luby et al. ; Leber et al. ; van Geen et al.
). One study showed consistent decreases in FIB con-
centration with depth in paired MS wells installed only
3 m apart vertically in highly contaminated aquifers in
the vicinity of latrine ponds (Knappett et al. ). It is
likely that sediment heterogeneity and well-specic pro-
cesses such as biolm growth (Ferguson et al. ) and
rapid ow down unsealed annuli confound a simple
relationship between depth and E. coli detection frequency
in studies where comparatively shallow tubewells (<36 m)
are compared across village(s) (Leber et al. ; van
Geen et al. ).
Throughout the 18-month monitoring period MS wells
were typically less frequently contaminated on a month-to-
month basis (Figure 3(b)). During the early monsoon
season E. coli was just as prevalent in MS wells as P wells;
however, E. coli prevalence tended to decrease later in the
monsoon in MS wells but continued to increase in P wells
(Figure 3(b)). Two exceptions to this pattern were when
E. coli prevalence in MS wells exceeded P wells, following
major rainfall events in the 2008 wet season.
These ndings can be explained the following way.
Sealed monitoring wells act to sample aquifer water that
becomes contaminated via vertical inltration through the
vadose zone in a rst ush event when the water table is
still >4 m below the surface (Figure 3(a)). Since 90% of all
wells in this study have total depths that vary between 6
and 15 m, this rst ush water reaches the saturated water
table only 0.59.5 m above the screened interval (1.5 m).
As the water table rises the impetus for downward movement
of inltrating rainwater through sediment decreases with the
thinning of the vadose zone. Similarly, E. coli prevalence
increases in P wells at the start of monsoonal rains, but in
contrast to the MS wells, as the water table rises unsealed
P wells become more frequently contaminated (Figure 3(b)).
This can be explained by vertical ow along the annulus
of the private wells enhanced by regular pumping.
Dry and wet season snapshots of molecular FIBs and
pathogens
During the wet season, snapshot sampling event concen-
trations of molecular E. coli and Bacteroidales in MS
Figure 3
|
Comparing culturable E. coli prevalence in wells with rainfall and water table levels. (a) Weekly precipitation (vertical grey bars) for Matlab located 50 km south of Site K (left-
axis). Manual groundwater levels are displayed at Site K (black line with grad symbols) from April 1 2008 through November 1 2009 (right-axis). Months assigned to the wet
season are indicated by boxes outlined by dashed lines. (b) Monthly proportion of private (P) (n ¼ 35) and sealed monitoring (MS) (n ¼ 11) wells testing positive for cultured E. coli
(left-axis). 75th percentile cultured E. coli concentrations (MPN/100 mL) for both P (dashed grey line) and MS (solid grey line) wells (right-axis).
572 P. S. K. Knappett et al.
|
Unsealed tubewells lead to increased fecal contamination of drinking water Journal of Water and Health
|
10.4
|
2012
wells were signicantly lower than in P wells as assessed by
the Kruskal-Wallis test (p < 0.05). Although FIB DNA con-
centrations were high during the dry season, no signicant
difference in concentration was observed between MS and
P wells (Figures 4(a) and 4(c)). This contrasts with the cul-
tured E. coli data, which shows all three classes of
tubewells have lower frequency of E. coli detected during
the dry season than the wet (Figures 2(b) and 2(c)). The
similar concentrations of molecular FIBs in MS and P
wells during the dry season suggests that short circuiting
is not active during the dry season, and rather these con-
centrations of FIB DNA represent background levels in
the aquifer sustained throughout much of the year.
This nding suggests that FIB DNA persistence in these
shallow anaerobic aquifers is longer than culturable E. coli.
This agrees with ndings in Knappett et al.() where
mE. coli and Bacteroidales were detected well above detec-
tion limit in ne sediments adjacent to latrine ponds in the
absence of culturable E. coli. Even in sediments containing
abundant culturable E. coli, Bacteroidales and E. coli
DNA was observed to be transported further laterally and
especially vertically (Knappett et al. ). Another study
found widespread high concentrations of FIB DNA in pri-
vate wells across several villages and seasons (Ferguson
et al. ). It is likely that the reduced metabolism and
size of starving fecal bacteria in oligotrophic aquifers
allows them to pass much further than readily culturable
E. coli. This was found in a study by Jansen et al.()
in sand columns with Pseudomonas uorescens where
the starved, coccoid bacteria were less efciently removed
than metabolically active rod-shaped bacteria. This
phenomenon has important implications for understanding
the perceived threat of FIB and pathogen DNA in ground-
water. Traditionally culturing of E. coli has been relied
upon to indicate the relative health risk from drinking
water (WHO ). Fecal bacteria DNA, contained in
dead or starving cells, however, may be transported further
and persist longer in an aquifer than the more metaboli-
cally active culturable cells. Therefore, the relative health
risk represented by different concentrations of FIB and
Figure 4
|
Concentrations of mE. coli and Bacteroidales DNA in private (P) and sealed monitoring wells (MS) during dry season and wet season snap shot sampling events. Sample size for
each group is indicated in parentheses. Unsealed monitoring wells (M) were not included in this analysis due to low sample numbers (n < 5).
573 P. S. K. Knappett et al.
|
Unsealed tubewells lead to increased fecal contamination of drinking water Journal of Water and Health
|
10.4
|
2012
pathogen DNA occurring in groundwater (Ferguson et al.
) is currently unknown and needs to be assessed as it
has been for recreational water exposure (Wade et al.
).
One advantage of enumerating FIB DNA over culturing
E. coli is that it is present in high concentrations year round
at multiple eld sites (Figure 4)(Ferguson et al. ). When
concentrations of mE. coli and Bacteroidales from the dry
and wet season snapshot sampling events are plotted against
each other for 14 overlapping wells, Bacteroidales emerges
as more consistent year round, whereas mE. coli concen-
trations are uncorrelated in the same wells in different
seasons (Figure 5(a)). Furthermore, wet season Bacteroi-
dales were the only FIB (and the only season) found to be
somewhat predictive (R
2
¼ 0.33, p < 0.05) of annual E. coli
detection frequency (Figure 5(b)). Bacteroidales may be a
more seasonally unbiased estimate of year round suscepti-
bility of a groundwater well to fecal contamination than
either mE. coli or the sporadically detected cultured E.
coli. Sampling at one or two points in time, rather than fre-
quent monitoring over years, may save substantial labor.
Although correlated with each other during the wet
season snapshot, no combination of FIBs was found to be
predictive of pathogen presence/absence (Figures 6(a) and
6(b)), with 10/22 samples found to be positive for at least
one pathogen. There were several false negatives with
respect to the indicators, with pathogens being found in
water samples containing low concentrations of E. coli,
mE. coli and Bacteroidales. Annual E. coli detection fre-
quency did not predict the wet season presence of
pathogens (Figure 5(b)), either. In contrast, although only
2/20 dry season snapshot wells were positive for pathogens,
both of these wells were highly contaminated with mE. coli
and Bacteroidales (cultured E. coli was not measured simul-
taneously during the dry season snapshot) (Figure 6(c)). It is
noteworthy that pathogens were detected in approximately
equal numbers of both unsealed (P) and sealed (MS) wells,
reinforcing the idea that although well construction effects
lead to increased contamination of the tubewells them-
selves, fecal bacteria and pathogen DNA are clearly
inltrating the broader aquifer beyond the near-well
environment (Knappett et al. ).
Figure 5
|
Inter-seasonal comparisons of FIB and pathogens detected in unsealed private
wells (P), unsealed monitoring wells (M) and sealed monitoring wells (MS). (a)
Measured FIB marker gene concentrations in wells from during the wet and
dry season snap shot sampling events (n ¼ 14). Only the equation for the line
of best t for Bacteroidales is displayed since the t was very poor for mE. coli .
(b) Wet season concentrations of Bacteroidales 16S genes and pathogen
presence/absence plotted against cultured E. coli detection frequency for all
months (n ¼ 22). Samples where no pathogens were detected are indicated by
black symbols. Samples positive for Shigella and Adenovirus are indicated by
red and blue, respectively.
574 P. S. K. Knappett et al.
|
Unsealed tubewells lead to increased fecal contamination of drinking water Journal of Water and Health
|
10.4
|
2012
CONCLUSION
Multiple differences, including annular sealing and usage
frequency, between private wells and monitoring wells led
to more frequent detections of E. coli in unsealed tubewells.
Clearly some simple well construction improvements can be
made that will lead to decreases in FIB detections and cases
of diarrheal disease obtained by drinking untreated ground-
water (Gundry et al. ). In a related study, hand pumps
themselves were found to harbor E. coli long after being
exposed to high levels of E. coli (Ferguson et al. ). This
effect could have accounted for some of the more frequent
contamination seen here in private wells. Amongst unsealed
private wells, however, platform presence/absence had no
impact on microbial water quality. This nding could possi-
bly be due to the lack of adequate drainage channels
accompanying intact platforms; however, this lack of sensi-
tivity to platform presence and quality has been reported
previously in Bangladesh (Luby et al. ; Leber et al.
; van Geen et al. ). Together these ndings suggest
that annular sealing or another private well construction
factor may be much more important in determining
Figure 6
|
Comparison of FIB concentrations and pathogen presence/absence during wet ( n ¼ 22) and dry season (n ¼ 20) snapshot sampling events. (a) Comparison of synoptic
measurements of cultured E. coli (MPN/100 mL) and mE. coli (copies/100 mL) from the wet season snapshot sampling event. The culturable E. coli method detection limit (MDL)
was 0.5 MPN/100 mL. (b) Comparison of Bacteroidales and mE. coli concentrations during wet season snapshot. (c) Comparison of Bacteroidales and mE. coli during dry season
snapshot. Culturable E. coli was not measured synoptically during the dry season snap shot sampling event. Samples where no pathogens were detected are indicated by black
symbols. Samples positive for Shigella, EltA (ETEC E. coli) and Adenovirus are indicated by red, green and blue, respectively.
575 P. S. K. Knappett et al.
|
Unsealed tubewells lead to increased fecal contamination of drinking water Journal of Water and Health
|
10.4
|
2012
microbial drinking water quality than platforms and drain-
age channels in Bangladesh.
The molecular FIB Bacteroidales sampled in 22 wells
during the wet season was found to be predictive of year-
round fecal contamination in both unsealed and sealed
wells, as assessed by annual E. coli detection frequency
and dry season Bacteroidales. Pathogens were more fre-
quently detected in the wet season, but their presence was
uncorrelated to any FIB or well type. The high prevalence
of E. coli, and high concentrations of FIB DNA, in sealed
monitoring wells, especially during the early monsoon
season, indicate that fecal contamination is indeed inltrat-
ing and spreading over broad volumes of the aquifer.
Inltration pathways likely include both leaky tubewell
annuli and inltration from ponds (Knappett et al. ).
Other factors potentially contributing to E. coli prevalence
in tubewells in Bangladesh include the size distribution
(Leber et al. ; Knappett et al. ) and mineralogy
(Ryan et al. ; Flynn et al. ) of the overlying sedi-
ment, pore-water ionic strength and chemical composition
(Fontes et al. ; Loveland et al. ), and the local spatial
density of contamination sources (Knappett et al. a; van
Geen et al. ). Multi-season FIB monitoring could be con-
ducted on both unsealed and sealed private wells with
similar usage frequency to isolate for an effect of well sealing
only apart from regular pumping and well-head effects (Fer-
guson et al. ). Further, private wells could be tested for
leaks in the PVC pipe to determine how prevalent this is
and whether leaking well pipes can explain the fecal con-
tamination patterns in the unsealed private wells.
ACKNOWLEDGEMENTS
This study was supported by grant 5 R01 TW008066 from
the NIH/FIC Ecology of Infectious Disease program.
Additional funding was provided by the Center for
Environmental Biotechnology, the Institute for a Secure
and Sustainable Environment at the University of
Tennessee and the Marie Curie Training Network
GOODWATER program. An anonymous reviewer greatly
contributed to the nal product. Thank you to
V. Escamilla for carrying out a detailed survey of Char
Para in June 2009; to K. Radloff for providing long-term
groundwater levels; and to Md. R. Huq for his assistance
in the eld.
REFERENCES
Abbaszadegan, M., LeChevallier, M. & Gerba, C. P. 
Occurrence of viruses in U.S. groundwaters. J. Am. Water
Works Assoc. 95, 107120.
Bernhard, A. E. & Field, K. G.  Identication of nonpoint
sources of fecal pollution in coastal waters by using host-
specic 16S ribosomal DNA genetic markers from fecal
anaerobes. Appl. Environ. Microbiol. 66, 15871594.
Borchardt, M. A., Bradbury, K. R., Alexander Jr., E. C. , Kolberg, R.
J., Alexander, S. C., Archer, J. R., Braatz, L. A., Forest, B. M.,
Green, J. A. & Spencer, S. K.  Norovirus outbreak caused
by a new septic system in a dolomite aquifer. Ground Water
49,8597.
De Novio, N. M., Saiers, J. E. & Ryan, J. N.  Colloid
movement in unsaturated porous media: recent advances and
future directions. Vadose Zone J. 3, 338351.
Embrey, S. S. & Runkle, D. L.  Microbial Quality of the
Nations Ground-Water Resources, 19932004. National
Water-Quality Assessment Program Principal Aquifers. US
Geol. Survey Scientic Investigations Report 2006-5290. US
Geol. Survey, Reston, Virginia.
Escamilla, V., Knappett, P., Yunus, M., Streateld, P. K. & Emch,
M.  Inuence of latrine proximity and type on tubewell
water quality and diarrheal disease in Bangladesh. Ann.
Assoc. Am. Geogr. In Press.
Escamilla, V., Wagner, B., Yunus, M., Streateld, P. K., van Geen,
A. & Emch, M.  Effect of deep tubewell use on childhood
diarrhoea in Bangladesh. Bull. WHO 89, 521527.
Ferguson, A. S., Layton, A. C., Mailloux, B. J., Culligan, P. J.,
Williams, D. E., Smartt, A. E., Sayler, G. S., Feighery, J.,
McKay, L., Knappett, P. S. K., Alexandrova, E., Arbit, T.,
Emch, M., Escamilla, V., Ahmed, K. M., Alam, Md. J.,
Streateld, P. K., Yunus, Md. & van Geen, A. 
Comparison of fecal indicators with pathogenic rotavirus in
groundwater. Sci. Total Environ. 431, 314322.
Ferguson, A. S., Mailloux, B. J., Ahmed, K. M., van Geen, A.,
McKay, L. D. & Culligan, P. J.  Hand-pumps as reservoirs
for microbial contamination of well water. J. Water Health 9,
708717.
Flynn, R., Hunkeler, D., Guerin, C., Burn, C., Rossi, P. & Aragno, M.
 Geochemical inuences on H40/1 Bacteriophage
inactivation in glaciouvial sands. Environ. Geol. 45, 504517.
Fontes, D. E., Mills, A. L., Hornberger, G. M. & Herman, J. S. 
Physical and chemical factors inuencing transport of
microorganisms through porous media. Appl. Environ.
Microbiol. 57, 24732481.
Gelman, A. & Hill, J.  Data Analysis Using Regression and
Multilevel/Hierarchical Models. Cambridge University Press,
New York.
576 P. S. K. Knappett et al.
|
Unsealed tubewells lead to increased fecal contamination of drinking water Journal of Water and Health
|
10.4
|
2012
Godfrey, S., Timo, F. & Smith, M.  Microbiological risk
assessment and management of shallow groundwater sources
in Lichinga, Mozambique. Water Environ. J. 20, 194202.
Goodbred, S. L. & Kuehl, S. A.  Floodplain processes in the
Bengal Basin and the storage of Ganges-Brahmaputra river
sediment: an accretion study using 137Cs and 210Pb
geochronology. Sediment. Geol. 121, 239258.
Gundry, S., Wright, J. & Conroy, R.  A systematic review of
the health outcomes related to household water quality in
developing countries. J. Water Health 2,113.
Hurley, M. A. & Roscoe, M. E.  Automated statistical-analysis
of microbial enumeration by dilution series. J. Appl.
Bacteriol. 55, 159164.
Jansen, S., Vereecken, H. & Klumpp, E.  On the role of
metabolic activity on the transport and deposition of
Pseudomonas uorescens in saturated porous media. Water
Res. 44, 12881296.
Johnson, T. B., McKay, L. D., Layton, A. C., Jones, S. W., Johnson,
G. C., Cashdollar, J. L., Dahling, D. R., Villegas, L. F., Fout,
G. S., Williams, D. E. & Sayler, G.  Viruses and bacteria
in karst and fractured rock aquifers in East Tennessee, USA.
Ground Water 49,98110.
Kildare, B. J., Leutenegger, C. M., McSwain, B. S., Bambic, D. G.,
Rajal, V. B. & Wuertz, S.  16S rRNA-based assays for
quantitative detection of universal, human-, cow- and dog-
specic fecal Bacteroidales: a Bayesian approach. Water Res.
41, 37013715.
Knappett, P. S. K., Escamilla, V., Layton, A., McKay, L. D., Emch,
M., Williams, D. E., Huq, Md. R., Alam, Md. J., Farhana, L.,
Mailloux, B. J., Ferguson, A., Sayler, G. S., Ahmed, K. M. &
van Geen, A. a The impact of sanitation on fecal bacteria
and pathogens in village ponds in Bangladesh. Sci. Total
Environ. 409, 31743182.
Knappett, P. S. K., Layton, A., McKay, L. D., Williams, D.,
Mailloux, B. J., Huq, Md. R., Alam, Md. J., Ahmed, K. M.,
Akita, Y., Serre, M. L., Sayler, G. S. & van Geen, A. b
Efcacy of hollow-ber ultraltration for microbial sampling
in groundwater
. Ground Water 49,5365.
Knappett, P. S. K., McKay, L. D., Layton, A., Williams, D. E.,
Alam, Md. J., Huq, Md. R., Mey, J., Feighery, J. E., Culligan, P.
J., Mailloux, B. J., Zhuang, J., Escamilla, V., Emch, M.,
Perfect, E., Sayler, G. S., Ahmed, K. M. & van Geen, A. 
Implications of fecal bacteria input from latrine-polluted
ponds for wells in sandy aquifers. Environ. Sci. Technol. 46,
13611371.
Kozuskanich, J., Novakowski, K. S. & Anderson, B. C.  Fecal
indicator bacteria variability in samples pumped from
monitoring wells. Ground Water 49,4352.
Layton, A., McKay, L. D., Williams, D., Garrett, V., Gentry, R. &
Sayler, G.  Development of Bacteroides 16S rRNA gene
TaqMan-based real-time PCR assays for estimation of total,
human, and bovine fecal pollution in water. Appl. Environ.
Microbiol. 72, 42144224.
Leber, J., Rahman, M. M., Ahmed, K. M., Mailloux, B. J. & van
Geen, A.  Contrasting inuence of geology on E. coli
and arsenic in aquifers of Bangladesh. Ground Water 49,
111123.
Loveland, J. P., Ryan, J. N., Amy, G. L. & Harvey, R. W.  The
reversibility of virus attachment to mineral surfaces. Colloid
Surf. A 107, 205221.
Luby, S. P., Gupta, S. K., Sheikh, M. A., Johnston, R. B., Ram, P. K.
& Islam, M. S.  Tubewell water quality and predictors of
contamination in three ood-prone areas in Bangladesh. J.
Appl. Microbiol. 105, 10021008.
Noble, R. T., Grifth, J. F., Blackwood, A. D., Fuhrman, J. A.,
Gregory, J. B., Hernandez, X., Liang, X., Bera, A. A. &
Schiff, K.  Multitiered approach using quantitative
PCR to track sources of fecal pollution affecting Santa
Monica bay, California. Appl. Environ. Microbiol. 72,
16041612.
Persson, S., Olsen, K. E. P., Scheutz, F., Krogfelt, K. A. &
Gerner-Smidt, P.  A method for fast and simple
detection of major diarrhoeagenic Escherichia coli
in the
routine diagnostic laboratory. Clin. Microbiol. Infect. 13,
516524.
Pronk, M., Goldscheider, N. & Zop,J. Particle-size
distribution as indicator for fecal bacteria contamination of
drinking water from karst springs. Environ. Sci. Technol. 41,
84008405.
Rajal, V. B., McSwain, B. S., Thompson, D. E., Leutenegger, C. M.,
Kildare, B. J. & Wuertz, S.  Validation of hollow ber
ultraltration and real-time PCR using bacteriophage PP7 as
surrogate for the quantication of viruses from water
samples. Water Res. 41, 14111422.
Rudolph, D. L., Barry, D. A. J. & Goss, M. J.  Contamination
in Ontario farmstead domestic wells and its association with
agriculture: 2. Results from multilevel monitoring well
installations. J. Contam. Hydrol. 32 , 295311.
Ryan, J. N., Elimelech, M., Ard, R. A., Harvey, R. W. & Johnson, P.
R.  Bacteriophage PRD1 and silica colloid transport and
recovery in and iron oxide-coated sand aquifer. Environ. Sci.
Technol. 33,6373.
Scott, T. M., Rose, J. B., Jenkins, T. M., Farrah, S. R. & Lukasik, J.
 Microbial source tracking: current methodology and
future directions. Appl. Environ. Microbiol. 68, 57965803.
Streateld, K., Persson, L. A., Chowdhury, H. R. & Saha, K. K.
 Disease Patterns in Bangladesh: Present and Future
Needs. International Centre for Diarrhoeal Disease Research,
Bangladesh, Dhaka, Bangladesh.
Wade, T. J., Calderon, R. L., Brenner, K. P., Sams, E., Beach, M.,
Haugland, R., Wymer, L. & Dufour, A. P.  High
sensitivity of children to swimming-associated
gastrointestinal illness. Epidemiology 19, 375383.
Weinman, B., Goodbred Jr., S. L. , Zheng, Y., Aziz, Z., Steckler,
M., van Geen, A., Singhvi, A. K. & Nagar, Y. C. 
Contributions of oodplain stratigraphy and evolution to the
spatial patterns of groundwater arsenic in Araihazar,
Bangladesh. Bull. Geo. Soc. Am.
120, 15671580.
World Health Organization  Global Water Supply and
Sanitation Assessment 2000 Report. World Health
577 P. S. K. Knappett et al.
|
Unsealed tubewells lead to increased fecal contamination of drinking water Journal of Water and Health
|
10.4
|
2012
Organization, Geneva, Switzerland. Available from: www.
who.int/water_sanitation_health/monitoring/globalassess/
en/.
World Health Organization  Guidelines for Drinking-water
Quality 3rd Ed. Incorporating the First and Second Addenda
Volume 1, Recommendations. World Health Organization,
Geneva, Switzerland. Available from: www.who.int/
water_sanitation_health/dwq/gdwq3rev/en/index.html.
World Health Organization & United Nations Childrens Fund
Joint Monitoring Programme  World Health
Organization & United Nations Childrens Fund, Geneva,
Switzerland. Available from: www.wssinfo.org/data-
estimates/table/.
Wu, J., van Geen, A., Ahmed, K. M., Akita, Y., Alam, Md. J.,
Culligan, P. J., Escamilla, V., Feighery, J., Ferguson, A. S.,
Knappett, P., Mailloux, B. J., McKay, L. D., Serre, M. L.,
Streateld, P. K., Yunus, M. & Emch, M.  Increase in
diarrheal disease associated with arsenic mitigation in
Bangladesh. PLoS One 6, e29593.
van Geen, A., Ahmed, K. M., Akita, Y., Alam, M. J., Culligan, P. J.,
Emch, M., Escamilla, V., Feighery, J., Ferguson, A. S.,
Knappett, P., Layton, A. C., Mailloux, B. J., McKay, L. D.,
Mey, J. L., Serre, M. L., Streateld, P. K., Wu, J. & Yunus, Md.
 Fecal contamination of shallow tubewells in Bangladesh
inversely related to arsenic. Environ. Sci. Technol. 45,
11991205.
van Geen, A., Zheng, Y., Versteeg, R., Stute, M., Horneman, A.,
Dhar, R., Steckler, M., Gelman, A., Small, C., Ahsan, H.,
Graziano, J. H., Hussain, I. & Ahmed, K. M.  Spatial
variability of arsenic in 6000 tubewells in a 25 km
2
area of
Bangladesh. Water Resour. Res. 39, 1140.
von Seidlein, L., Kim, D. R., Ali, M., Lee, H., Wang, X., Thiem, V.
D., Canh, D. G., Chaicumpa, W., Agtini, M. D., Hossain, A.,
Bhutta, Z. A., Mason, C., Sethabutr, O., Talukder, K., Nair, G.
B., Deen, J. L., Kotloff, K. & Clemens, J.  A multicentre
study of Shigella diarrhoea in six Asian countries: disease
burden, clinical manifestations, and microbiology. PLoS Med
3, e353.
First received 5 June 2012; accepted in revised form 9 September 2012. Available online 25 October 2012
578 P. S. K. Knappett et al.
|
Unsealed tubewells lead to increased fecal contamination of drinking water Journal of Water and Health
|
10.4
|
2012
... The microbiological quality if drinking water is assessed by testing for non-pathogenic bacteria of faecal origin. Microorganisms used as indicators of water quality are coliforms, faecal Streptococci, Clostridium perfringes and Pseudomonas aeruginosa (13). Oguntoke et al., (14) reported that poor well construction, and proximity to point source of contamination make wells vulnerable to microbial pollution. ...
... These results agreed with the findings of similar studies conducted in Awka (10) and Kaduna (25) in Nigeria where high contaminations of wells by coliforms were reported. The high number of coliforms may be due to the percolation and entry of sewage into ground water through cracked casings (15), poor construction of the wells and poor environmental conditions of well locations (13). In Ibadan, wells with cracked casings showed high possibilities of contamination from pollutants seeping into them. ...
Article
Full-text available
Background: Water is a basic necessity used by humans for both domestic and industrial uses. Next to air, water is essential to life. It takes up about 71% of the earth’s surface. The objective of this study is to determine the bacteriological quality of well water in Enugu urban, Nigeria Methodology: A total of 60 domestic wells were selected from Abakpa, Obiagu and Achara layouts in Engu urban, Nigeria by stratified random sampling method, with 20 wells selected from each area based on location of well sites and construction parameters. Water samples were collected from each well using a sterile 200ml plastic bottle for bacteriological analysis to estimate total bacteria count in colony forming unit (cfu)/ml, total coliform count in most probable number (mpn)/100ml, and faecal coliform count in most probable number (mpn)/100ml. Bacterial isolates were identified using Gram reaction and conventional biochemical tests including catalase and coagulase for Gram positive bacteria, and oxidase, citrate utilization, hydrogen sulfide, indole, urease, methyl red, Voges Proskauer, and sugar fermentation tests for Gram negative bacteria. Antibiotic susceptibility testing (AST) of each isolate was performed by the disk diffusion method against selected antibiotics including penicillin G (10µg), ciprofloxacin (5µg), streptomycin (10µg), amoxicillin-clavulanic acid (20/10µg), and trimethoprim-sulfamethoxazole (25µg), and result interpreted using the European Committee for Antimicrobial Susceptibility Testing (EUCAST) break points. Comparative statistics of the data was performed using analysis of variance (ANOVA) with p<0.05 considered statistically significant. Results: The well water in the three layouts were heavily contaminated as shown by comparatively high mean total bacteria counts of 0.8825±0.66x104 cfu/ml, 0.8435±0.6413x104 cfu/ml, and 0.8384±0.5948x104 cfu/ml for Abakpa, Obiagu and Achara layouts respectively (p=0.9714). The mean total coliform counts were 5.15±5.284, 5.45±4.31 and 5.05±4.763 mpn/100ml (p=0.8038), and the mean faecal coliform counts were 2.4±3.393, 2.65±2.796 and 2.05±2.35 mpn/100ml (p=0.9631) for Abakpa, Obiagu and Achara layouts respectively. A total of 50 pathogenic bacterial isolates were identified; Klebsiella pneumoniae 21 (43.8%), Escherichia coli 13 (30.0%), Proteus spp 6 (12.5%), Pseudomonas aeruginosa 6 (12.5%), and Staphylococcus aureus 2 (4.2%). The AST result shows that 75% of K. pneumoniae, E. coli, Proteus spp and S. aureus were resistant to all five antibiotics tested. Conclusion: These findings showed high faecal contamination of domestic well water sources, which poses a significant infection risk to the community. Proper water treatment measures and personal hygiene practices are recommended, and well sites should be located at a safe distance from septic tanks, pit latrines, flowing gutters and refuse dump sites.
... In the context of urban Indonesia, the presence of a concrete platform may often indicate that the borehole is present inside the house, meaning contaminated run-off is less likely to enter the boreholes. Other studies on self-supply also found that appropriate well protection is important to improve microbial water quality, such as sealing of the annulus (Knappett et al., 2013) and proper condition of protected borehole casings (Potgieter et al., 2006). ...
Article
Full-text available
In urban Indonesia, more than 40 million people rely on groundwater self‐supply, but the extent to which self‐supply delivers safe water and the associated risk factors for fecal contamination remain unclear. This study quantified Escherichia coli (E. coli) for 511 self‐supply sources and at point‐of‐use for 173 households in the Indonesian cities of Bekasi and Metro. A structured questionnaire collected information about the household, water sources, and potential contamination sources. Univariate and multivariate logistic regression analysis examined risk factors for fecal contamination. E. coli was detected in 66% of sources, including 55% of boreholes, 64% of protected dug wells, and 82% of unprotected dug wells. Widespread boiling of water meant microbial quality improved significantly between source and point‐of‐use, with E. coli detected in 30% of self‐supply samples at point‐of‐use. Unprotected dug wells were significantly more likely to be contaminated than boreholes. In Bekasi, the analysis found a significant association between presence of E. coli and sanitation systems located within 10 m of the groundwater source. In Metro, poorer households had significantly higher odds of contamination than wealthier households. Other significant factors included shallower borehole depths in Bekasi, use of a rope and bucket, and absence of a concrete platform in Metro. In Bekasi, E. coli concentration at source was significantly associated with water quality at point‐of‐use. Risk of fecal contamination could be reduced by supporting households to invest in improved protection, and by facilitating promotion for safe household water treatment. Support for self‐supply improvements should be weighed against the expansion and improvement of piped water services.
... The coliform counts were decreasing significantly with increasing depth of the tube wells in all the seasons due to retention of bacteria by soil particles and death of the microorganisms at a greater depth as the environment becomes extremely hostile for life with increasing depth (Bitton and Harvey, 1992;Graham and Polizzotto, 2013;Keesari et al., 2015;Elisante and Muzuka, 2016). In a study of Bangladesh, Knappett et al. (2012b) also observed a continuous decrease in fecal indicator bacteria with a depth of wells located near latrine ponds. This negative correlation between TC count and the depth of the tube wells can also be attributed to the sediment heterogeneity and some well-specific processes like the growth of biofilm in the space between the contamination source and the deeper aquifer that can filter out bacterial cells from reaching the groundwater (Ferguson et al., 2011). ...
Article
Full-text available
Access to clean water has been identified as one of the primary Sustainable Development Goals. Rapid urbanization is going on in developing nations creating additional pressure on water resources in most of these places which in turn also affects individuals which is largely reliant on proper sanitation and drinking water quality. In addition, open sanitation practice is becoming major public health problem in rural and in some urban areas in India. Groundwater contamination by pathogenic bacteria sourced from both sanitation system and surface water is becoming one of the major concerns now-a-days. The residents of the Ganges river basin in India are already stressed with natural arsenic pollution as well as other various types of water pollution, and microbial pollution from sanitation is a new addition to it. A field-based hydrogeological investigation with the identification of sanitation sites (surface and subsurface) was conducted in some parts of the Ganges basin, in and around a lower order distributary river, River Churni in West Bengal state, to identify the natural and human influences on sanitation drinking water pollution in a highly populated part of South Asia. Groundwater was found to be contaminated severely with total (TC) and fecal (FC) coliform bacteria. The abundance of TC was found to be the highest in monsoon season (78%) than in pre-monsoon (48%) and post-monsoon (29%) seasons. The results revealed that the groundwater samples from shallow depths and close to sanitation sites were highly contaminated with coliform bacteria than the deeper and higher distant (>30 m distance) ones. Shallow groundwater samples near to surface water (River Churni) source, other than sanitation sites, showed elevated TC levels. The occurrence of coliform bacteria in studied groundwater samples was observed to be positively correlated with conductivity, TDS, TOC, chloride, and sulfate, while the abundance was restricted by pH and temperature of groundwater. Thus, improper sanitation systems and contaminated surface water were identified as one of the major sources of pathogenic contamination of groundwater-sourced drinking water in the studied area, whereas improper human practices further complicate the scenario which needs to be managed properly.
... The unsealed borehole probably enabled B. pseudomallei from surface soil to contaminate groundwater during rainfall. Other studies have reported higher rates of gastrointestinal pathogens in water from boreholes with unsealed annuli (14,15). Therefore, persons using boreholes in countries where melioidosis is endemic should ensure proper construction and maintenance to avoid contamination with B. pseudomallei and other pathogens from surface soil. ...
Article
Full-text available
Within 8 months, 3 children from 1 family in northern Vietnam died from melioidosis. Burkholderia pseudomallei of the same sequence type, 541, was isolated from clinical samples, borehole water, and garden and rice field soil. Boreholes should be properly constructed and maintained to avoid B. pseudomallei contamination.
... Water-borne diarrheal diseases constitute a major health problem in Bangladesh, especially among children under the age of 5 years, and may account for up to 11% of all deaths in the country. 5 Densely populated urban areas constitute a major hotspot for spreading diarrheal diseases, and Bangladesh is among the most risky zones for epidemics in the world. 6 While there are many different water-borne pathogens, viruses have the greatest infectivity among them all and exhibit the longest survival potential in the environment. ...
Article
Full-text available
ABSTRACT: This article describes for the first time the full cycle of development from raw material cultivation to real-life application of a truly sustainable and scalable filter paper material intended for point-of-use drinking water purification in Bangladesh. The filter paper, featuring tailored pathogen removal properties, is produced from nanocellulose extracted from Pithophora green macroalgae, growing locally in Bangladesh, a new unexploited resource that can address a global problem. We demonstrate that the Pithophora cellulose filter paper can be used as a total pathogen barrier to remove all types of infectious viruses and bacteria from water. The performance of the filter is validated using surrogate latex nanobeads, in vitro model viruses, and real-life water samples collected from the Turag River and Dhanmondi Lake in Dhaka, Bangladesh. Access to clean drinking water is a persistent problem in Bangladesh, affecting tens of millions of people every day. The mortality rate due to water-borne diarreal infections, including viral infections, among susceptible population groups, especially among children under age of 5, is still very high. The proposed solution can dramatically improve the quality of lives for millions of people in the entire Southeast Asian region including and beyond the borders of Bangladesh. KEYWORDS: Pithophora algae cellulose, Cladophora algae cellulose, Water-borne infections, Viruses, Filtration
... Nonetheless, wells can also receive surface contamination from the surrounding environment through unsealed or malfunctioning wellheads. 48 Furthermore, almost all control households in our study population had some form of on-site sanitation, such that the trial presented an improvement in latrine quality and drainage as well as access to tools for child feces management but not basic latrine access. A setting with lower latrine coverage in the control group and a larger contrast in sanitation access between controls and intervention recipients may be better poised to detect an impact on environmental contamination. ...
... In medium-and fine-grained non-confined aquifers, contamination of tubular wells by indicator bacteria transported in the porous medium of the soil from the infiltration of locally disposed excreta is relatively limited. In rainy periods, the rapid route of downward flow of water from the surface or surface layers of the soil can alternatively explain this contamination when the annular space of the well is not sealed (Knappett, et al., 2012a(Knappett, et al., , 2012b. The collections of the present study were carried out predominantly in the dry period and, therefore, the contamination of tubular wells by EC must have had little influence from the unsealed annular space. ...
Article
Full-text available
Rural environments lack basic sanitation services. Facilities for obtaining water and disposing sewage are often under the initiative of each resident, who may not be able to build and maintain them properly. Thus, water for human consumption is subject to fecal contamination and, consequently, the presence of waterborne pathogens, such as enteric viruses. This study evaluated fecal contamination of water samples from individual sources used for domestic water supply on small farms in the state of Goiás, Brazil. Samples were collected from 78 houses whose water sources were tubular wells, dug wells, springs, and surface waters. Escherichia coli (EC) bacteria, analyzed by the defined chromogenic substrate method, was used as a traditional indicator of fecal contamination. The enteric viruses Human mastadenovirus (HAdV) and Enterovirus (EV), analyzed by qPCR, were tested as complementary indicators of fecal contamination. At least one of these markers was found in 89.7% of the samples. Detection rates were 79.5% for EC, 52.6% for HAdV, and 5.1% for EV. The average concentration for EC was 8.82 × 101 most probable number (MPN) per 100 mL, while for HAdV and EV the concentrations were 7.51 × 105 and 1.89 × 106 genomic copies (GC) per liter, respectively. EC was the most frequent marker in ground and surface water samples. HAdV was detected significantly more frequently in groundwater than in surface water and was more efficient in indicating contamination in tubular wells. There was no association of frequencies or correlation of concentrations between EC and HAdV. HAdV indicated human fecal contamination and performed well as a complementary indicator. The results reveal that a large part of the analyzed population is vulnerable to waterborne diseases caused by enteric pathogens.
... The results of this study suggest that if civil engineering structural interventions are applied correctly as per standards and specifications (Figs. 4, 5, 6; Table 3) they are effective in breaking the localised pathways and protecting the source from getting contaminated. Several studies carried in different countries (Still and Nash 2002;Knappett et al. 2012;Omer et al. 2014;Ercumen et al. 2017;Gwimbi et al. 2019) indicate that protective structures reduce the risk of microbial contamination of source water. The actual protective structures applied in this study to mitigate the four risk factors to break the localised pathways created due to drilling of borewell and installation of handpumps are illustrated in Fig. 6. ...
Article
Full-text available
Microbial contamination of handpump (HP) is common in developing countries like India. The WHO recommends sanitary inspection (SI) to assess the risk of water source contamination. In SI, all risks are given equal weightage. However, different mathematical models have shown that risks associated with localised pathways have a relatively higher influence on microbial contamination. This study aims to assess the efficacy of eliminating four risks associated with localised pathways and have shown a higher positive association with microbial contamination of HP than others in bivariate frequency analysis and four binary logistic regressions applied on 324 HPs randomly selected from nine districts of Uttar Pradesh, India. Analysis showed the four risks: (i) HP loose at base: (ii) apron cracked: (iii) apron < 1 m an: (iv) drainage broken have a higher positive association than others. In this study, the above four risks were eliminated from 154 HPs (safe 48 and unsafe 106) through standard civil structures keeping other risks untouched. Post-intervention thermotolerant coliforms (TTC) tests were carried out and unsafe HPs were reduced from 106 to 3. Therefore, managing the four risks associated with localised pathways is highly effective in preventing microbial contamination of HP water.
Article
Full-text available
Background: Co-existence of more than one acute or chronic infectious diseases in a person either concurrently or sequentially with consequent economic burden varies differently from one part of the world to another, with regional and population specific patterns. This study aims to provide co-morbid patho-epidemiological pattern of six infectious diseases; HIV, tuberculosis (TB), malaria, syphilis, hepatitis B and hepatitis C virus infections. Methodology: This research is a ten-year retrospective review of records of patients admitted at various wards of Kogi State University Teaching hospital and referred to the Laboratory Department of the hospital for investigations between June 2012 and July 2021. HIV was screened using the national serial algorithm, TB was diagnosed with the GeneXpert MTB, malaria parasite was identified by blood film microscopy, and syphilis, hepatitis B and hepatitis C viruses were screened using rapid diagnostic kits. Data were analysed with SPSS version 23.0 and association of variables with respect to gender and age group was determined using Chi square, with p< 0.05 considered to be statistically significant. Results: A total of 223 patients were retrospectively reviewed with 102 (45.7%) males and 121 (54.3%) females. Co-morbidities occurred most frequently among age groups 21-30 years (34.1%), 31-40 years (39.0%) and 41-50 years (16.6%). The most frequent co-morbidity pattern was HIV/TB (81.6%) followed by HBV/MP (4.5%), HIV/HBV (4.0%), HIV/MP (3.1%), TB/MP (2.7%), HBV/HCV (2.2%) while HCV/MP, TB/HCV, HCV/syphilis, and TB/HBV were (0.4%) each. There was no significant difference in the frequency of co-morbidity with respect to gender and age groups of patients (p>0.05). Conclusion: Co-existence of chronic infectious disease in a person increases the risk of morbidities and mortalities. Therefore, diagnosis, and concurrent treatment and management of co-morbid infectious diseases should be incorporated into our routine healthcare system and appropriate resources should be allotted for this in health plans. Keywords: co-morbidity, retrospective, patho-epidemiological, infectious diseases
Article
Full-text available
There is increasing awareness of household self-supply and the role it can play in securing water for domestic needs in low- and middle-income countries (LMICs), but its scale across the Asia-Pacific has not previously been quantified. This study analysed 77 datasets from 26 countries to estimate the prevalence of self-supplied drinking water, and its associated trends in LMICs in South Asia, Southeast Asia and the Pacific. When factoring in temporal trends, results suggest that >760 million people—or 31% of the population—relied on self-supply for their drinking water in these regions in 2018, with the number of users increasing by >9 million each year. Reliance on self-supply for drinking water is greater in rural areas than in urban areas (37% of rural population vs 20% of urban population), though results vary considerably between countries. Groundwater sources constitute the most common form of self-supply in South Asia and Southeast Asia, while rainwater collection is dominant in the Pacific. The results confirm the significance of self-supply in the Asia-Pacific and suggest that households are a major but often overlooked source of financing within the water sector. The findings raise important questions about how policy and practice should respond to this widespread phenomenon.
Article
Full-text available
Investigations of colloid movement through geologic materials are driven by a variety of issues, including contaminant transport, soil-profile development, and subsurface migration of pathogenic microorganisms. In this review, we address recent advances in understanding of colloid transport through partially saturated porous media. Special emphasis is placed on features of the vadose zone (i.e., the presence of air-water interfaces, rapid fluctuations in porewater flow rates and chemistry) that distinguish colloid transport in unsaturated media from colloid transport in saturated media. We examine experimental studies oncolloid deposition and mobilization and survey recent developments in modeling colloid transport and mass transfer. We conclude with an overview of directions for future research in this field.
Article
Full-text available
Diarrheal diseases are endemic in Bangladesh, where sanitation is poor, and untreated drinking water extracted from shallow (Escherichia coli concentrations for 100 wells, monthly diarrheal events for all children under five, and a detailed water and sanitation infrastructure database created through a submeter accuracy Global Positioning System survey. We developed sanitation metrics to measure the relationship between tubewell water fecal contamination and estimates of human fecal loadings at varying scales. The relationship between childhood diarrhea and E. coli in drinking water was measured for households that obtained drinking water from survey wells. Results show that tubewells surrounded by unsanitary latrines, latrine-polluted ponds, and higher population densities were more frequently contaminated with fecal coliforms. The analysis also showed that poor sanitation infrastructure might affect childhood diarrheal disease via tubewell contamination. Our findings shed light on the importance of integrating population and environment data to identify circumstances in which shallow well water quality is compromised and children are put at risk of contracting diarrheal diseases. Sanitation interventions should highlight the spatial separation of latrines and drinking water wells to limit contamination.
Article
Full-text available
1] Arsenic concentrations measured by graphite furnace atomic absorption range from < 5 to 900 mg/L in groundwater pumped from 6000 wells within a 25 km 2 area of Bangladesh. The proportion of wells that exceed the Bangladesh standard for drinking water of 50 mg/L arsenic increases with depth from 25% between 8 and 10 m to 75% between 15 and 30 m, then declines gradually to less than 10% at 90 m. Some villages within the study area do not have a single well that meets the standard, while others have wells that are nearly all acceptable. In contrast to the distribution of arsenic in the 8–30 m depth range which does not follow any obvious geological feature, the arsenic content of groundwater associated with relatively oxic Pleistocene sand deposits appears to be consistently low. The depth of drilling necessary to reach these low-As aquifers ranges from 30 to 120 m depth within the study area. INDEX TERMS: 1030 Geochemistry: Geochemical cycles (0330); 1045 Geochemistry: Low-temperature geochemistry; 1806 Hydrology: Chemistry of fresh water; 1831 Hydrology: Groundwater quality; 1884 Hydrology: Water supply; KEYWORDS: arsenic, groundwater, Bangladesh, tube well Citation: van Geen, A., et al., Spatial variability of arsenic in 6000 tube wells in a 25 km 2 area of Bangladesh, Water Resour. Res., 39(5), 1140, doi:10.1029/2002WR001617, 2003.
Article
In a study that may affect the upcoming Ground Water Rule, the authors of this article determined that because of the widespread occurrence of virus in groundwater, most well water supplies should be disinfected before distribution. Scientific data were needed to support the upcoming rule, and this study provides a snapshot of viral contamination of groundwater at the nation al level. This article looks at information regarding the occurrence of pathogens and microbial indicators in source waters and their relationships with different abiotic parameters such as water quality, geologic formation of groundwater sites, and other factors. Sites were selected based on their geological characteristics to match the national profile for groundwater sources. Two different microbial methods were used to detect viruses in groundwater sources, and during the study a new microbial detection methodology was field-tested. Results indicate that when a well tested positive once for any of the biological assays, it was likely to test positive in future samplings. This article also offers a strategy to predict the vulnerability of groundwater supplies to fecal contamination.
Article
Extreme spatial heterogeneity has emerged as a salient characteristic of groundwater arsenic in many complex fluviodeltaic environments. Here we examine patterns of arsenic heterogeneity in the shallow (<23 m) groundwaters of a well-studied floodplain setting in Araihazar, Bangladesh. Ninety-five augers and 200 shallow wells sampled at spacings of 10(1)-10(3) m in the 25 km(2) area indicate that the concentration of arsenic in shallow groundwater largely varies with the grain size, thickness, and distribution of fine-grained (<63 mu m) sediments that overlie buried aquifer sands. The overall pattern shows that lower arsenic concentrations are typically found where aquifer sands outcrop at or near the surface, whereas higher arsenic levels typically underlie, or are adjacent to thicker, fine-grained deposits. Furthermore, chronostratigraphic reconstructions of aquifer sediments indicate that sediment distribution, and consequently the patterning of dissolved arsenic, is readily explained in the context of local river history and floodplain development within the past 1000 yr. An important implication is that complex patterns of groundwater arsenic in afflicted fluviodeltaic settings can be better understood through reconstructions of local aquifer history. This finding is especially relevant because the village and tube-well locations are closely linked with surface landforms such as former levees and bars. An additional and worrisome finding is that the artificial filling of villages to protect from flooding can mimic the natural fine-grained stratigraphy commonly associated with high concentrations of arsenic.
Article
Floodplain deposits are recognized as potentially large sinks for fluvial sediments, yet spatial and temporal patterns of accumulation are not known for many river systems. In the tectonically active Bengal Basin, the Ganges and Brahmaputra rivers coalesce and have formed a large floodplain/delta complex, where widespread overbank flooding may deposit a significant portion of the river's estimated sediment discharge. To investigate the magnitude and distribution of this process, accumulation rates were determined by 137Cs and 210Pb radioisotope geochronology at 60 sites located in three regions of the Bengal Basin differing in age, physiography, and river influence. These geochronological methods have been applied to floodplain environments in only a few recent studies, and the present research offers a revised approach for heterogeneous systems. Patterns of sediment deposition in the Bengal Basin reveal three dominant controls on floodplain accretion: channel processes, overbank flooding, and surface runoff. Accretion is most rapid in the river braidbelt and adjacent floodplain, decreasing rapidly with distance from the main channel. Accumulation rates increase again in low-lying distal basins, where several meters of annual precipitation and associated runoff rework surrounding floodplain surfaces and transport remobilized sediments to local catchments. The extent and magnitude of this process indicate its comparable importance with overbank deposition for floodplain accumulation. A sediment budget for the study area reveals that at least 15% of the estimated 1 billion tonnes of fluvial sediment discharge is stored annually and not reaching the oceans as previously assumed. Extrapolated to the remaining ∼60,000 km2 of floodplain not covered in this project, the sequestered load could rise to >30% of annual sediment discharge.
Article
Virus transport through groundwater is limited by attachment to mineral surfaces and inactivation. Current virus transport models do not consider the implications of the reversibility of virus attachment to minerals. To explore the reversibility of virus attachment to mineral surfaces, we attached PRDI, a bacteriophage considered to be a good model of enteric viruses, to quartz and ferric oxyhydroxide-coated quartz surfaces over a range of pH values in equilibrium "static columns." Following attachment, we detached the viruses by replacing the pore solution with solutions of equal and higher pH. The extent of virus attachment followed an attachment "edge" that occurred at a pH value about 2.5-3.5 pH units above the pH IEP of the mineral surfaces. Viruses attached below this edge were irreversibly attached until the pH of the detachment solution exceeded the pH value of the attachment edge. Viruses attached above this edge were reversibly attached. Derjaguin-Landau-Verwey-Overbeek (DLVO) potential energy calculations showed that the attachment edge occurred at the pH at which the potential energy of the primary minimum was near zero, implying that the position of the primary minimum (attractive or repulsive) controlled the equilibrium distribution of the viruses. The results suggest that the reversibility of virus attachment must be considered in virus transport models for accurate predictions of virus travel time.
Article
Bacteriophage PRD1 and silica colloids were co-injected into sewage-contaminated and uncontaminated zones of an iron oxide-coated sand aquifer on Cape Cod, MA, and their transport was monitored over distances up to 6 m in three arrays. After deposition, the attached PRD1 and silica colloids were mobilized by three different chemical perturbations (elevated pH, anionic surfactant, and reductant). PRD1 and silica colloids experienced less attenuation in the contaminated zone where adsorbed organic matter and phosphate may be hindering attachment of PRD1 and silica colloids to the iron oxide coatings. The PRD1 collision efficiencies agree well with collision efficiencies predicted by assuming favorable PRD1 deposition on iron oxide coatings for which the surface area coverage was measured by microprobe analysis of sediment thin sections. potentials of the PRD1, silica colloids, and aquifer grains corroborated the transport results, indicating that electrostatic forces dominated the attachment of PRD1 and silica colloids. Elevated pH was the chemical perturbation most effective at mobilizing the attached PRD1 and silica colloids. Elevated surfactant concentration mobilized the attached PRD1 and silica colloids more effectively in the contaminated zone than in the uncontaminated zone.
Article
Background: Culture-based methods of monitoring fecal pollution in recreational waters require 24 to 48 hours to obtain results. This delay leads to potentially inaccurate management decisions regarding beach safety. We evaluated the quantitative polymerase chain reaction (QPCR) as a faster method to assess recreational water quality and predict swimming-associated illnesses. Methods: We enrolled visitors at 4 freshwater Great Lakes beaches, and contacted them 10 to 12 days later to ask about health symptoms experienced since the visit. Water at the beaches was polluted by point sources that carried treated sewage. We tested water samples daily for Enterococcus using QPCR and membrane filtration (EPA Method 1600). Results: We completed 21,015 interviews and tested 1359 water samples. Enterococcus QPCR cell equivalents (CEs) were positively associated with swimming-associated gastrointestinal (GI) illness (adjusted odds ratio per 1 log10 QPCR CE =1.26; 95% confidence interval = 1.06–1.51). The association between GI illness and QPCR CE was stronger among children aged 10 years and below (1.69; 1.24–2.30). Nonenteric illnesses were not consistently associated with Enterococcus QPCR CE exposure, although rash and earache occurred more frequently among swimmers. Enterococcus QPCR CE exposure was more strongly associated with GI illness than Enterococcus measured by membrane filtration. Conclusions: Measurement of the indicator bacteria Enterococci in recreational water using a rapid QPCR method predicted swimming-associated GI illness at freshwater beaches polluted by sewage discharge. Children at 10 years or younger were at greater risk for GI illness following exposure.
Article
Equations are formulated for the standard error and confidence interval for the MPN estimate of microbial density from a general dilution series. A statistical test of homogeneity is presented. This tests whether a handling error in the dilution series may have occurred which would invalidate the density estimate. The analysis may be automated using a Basic computer program which contains a fast algorithm for the solution of the general MPN equation. This allows the calculation of the MPN, standard error, 95% confidence interval and test statistic for any dilution series, with any degree of replication at each dilution level, with variable sample volumes at each dilution level, with variable dilution ratio between levels, and with any number of levels.