Interferon gamma-signature transcript profiling and IL-23 upregulation in response to Helicobacter pylori infection

Unite de Pathogénie Bacterienne des Muqueuses, Institut Pasteur, Paris, France.
International journal of immunopathology and pharmacology (Impact Factor: 1.62). 07/2008; 21(3):515-26.
Source: PubMed
ABSTRACT
Helicobacter pylori infection is the major cause of gastroduodenal pathologies including gastric cancer. The long persistence of bacteria and the type of immune and inflammatory response determine the clinical issue. In this study, the global gene expression profile after 6 and 12 months of H. pylori infection was investigated in the mouse stomach, using the Affymetrix GeneChip Mouse Expression Array A430. Genes related to the inflammatory and immune responses were focused. Levels of selected transcripts were confirmed by reverse transcription polymerase chain reaction. Twenty- five and nineteen percent of the differentially expressed genes observed at 6 and 12 months post-infection respectively, were related to immune response. They are characterized by an interferon (IFN)gamma-dependent expression associated to a T helper 1 (Th1) polarised response. In-depth analysis revealed that an up-regulation of IL-23p19, took place in the stomach of H. pylori infected-mice. Strong IL-23p19 levels were also confirmed in gastric biopsies from H. pylori-infected patients with chronic gastritis, as compared to healthy subjects. Our microarray analysis revealed also, a high decrease of H+K+-ATPase transcripts in the presence of the H. pylori infection. Association of gastric Th1 immune response with hypochlorhydria through the down-regulation of H+K+-ATPase contributes to the genesis of lesions upon the H. pylori infection. Our data highlight that the up-regulation of IL-23 and of many IFNgamma signature transcripts occur early on during the host response to H. pylori, and suggest that this type of immune response may promote the severity of the induced gastric lesions.

Full-text

Available from: Jose Ramos Vivas
INTERNATIONAL JOURNAL OF IMMUNOPATHOLOGY AND PHARMACOLOGY Vol. 21, no. 3, 0-0 (2008)
0394-6320 (2008)
Copyright © by BIOLIFE, s.a.s.
This publication and/or article is for individual use only and may not be further
reproduced without written permission from the copyright holder.
Unauthorized reproduction may result in nancial and other penalties
473
INTERFERON γ-SIGNATURE TRANSCRIPT PROFILING AND IL-23 UPREGULATION
IN RESPONSE TO HELICOBACTER PYLORI INFECTION
J.R. VIVAS
1,5
, B. RÉGNAULT
2
, V. MICHEL
1,6
, F.I. BUSSIÈRE
1,6
, P. A
3
, M. HUERRE
3
,
A. LABIGNE
1
, M.M. D’ELIOS
4
and E. TOUATI
1,6
1
Unité de Pathogénie Bactérienne des Muqueuses,
2
Genopole DNA Chip Platform,
3
Unité de
Recherche et d’Expertises en Histotechnologie et Pathologie, Institut Pasteur, Paris, France;
4
Department of Internal Medicine, University of Florence, Florence, Italy;
5
Department of
Molecular Microbiology, Centro de Investigaciones Biologicas, CIB-CSIC, Madrid, Spain;
6
Unité
Postulante de Pathogenèse de Helicobacter, Institut Pasteur, Paris, France
Received November 5, 2007 – Accepted April 15, 2008
Helicobacter pylori infection is the major cause of gastroduodenal pathologies including gastric
cancer. The long persistence of bacteria and the type of immune and inammatory response determine the
clinical issue. In this study, the global gene expression prole after 6 and 12 months of H. pylori infection
was investigated in the mouse stomach, using the Affymetrix GeneChip Mouse Expression Array A430.
Genes related to the inammatory and immune responses were focused. Levels of selected transcripts
were conrmed by reverse transcription polymerase chain reaction. Twenty- ve and nineteen percent of
the differentially expressed genes observed at 6 and 12 months post-infection respectively, were related
to immune response. They are characterized by an interferon (IFN)γ-dependent expression associated
to a T helper 1 (Th1) polarised response. In-depth analysis revealed that an up-regulation of IL-23p19,
took place in the stomach of H. pylori infected-mice. Strong IL-23p19 levels were also conrmed in
gastric biopsies from H. pylori-infected patients with chronic gastritis, as compared to healthy subjects.
Our microarray analysis revealed also, a high decrease of H
+
K
+
-ATPase transcripts in the presence of
the H. pylori infection. Association of gastric Th1 immune response with hypochlorhydria through the
down-regulation of H
+
K
+
-ATPase contributes to the genesis of lesions upon the H. pylori infection. Our
data highlight that the up-regulation of IL-23 and of many IFNγ signature transcripts occur early on
during the host response to H. pylori, and suggest that this type of immune response may promote the
severity of the induced gastric lesions.
Mailing address: Dr Eliette Touati,
UPPH, Department of Microbiology,
Institut Pasteur,
28 rue du Dr Roux,
75724 Paris Cedex 15, France
Tel: ++33 1 40 61 37 85 Fax: ++33 1 40 61 36 40
e-mail: etouati@pasteur.fr
Key words: H. pylori, immune response, IL-23, gastric cancer
Half of the world population is chronically
infected by Helicobacter pylori, a bacterium that
specically colonizes the human stomach. The H.
pylori infection is the major cause of gastroduodenal
pathologies such as chronic gastritis, peptic ulcer
diseases, gastric adenocarcinoma and lymphoma
(1). The most important co-factor in the induction
of Helicobacter-related disease is the host immune
response. Studies in humans and in animal models
have shown that a pro-inammatory T helper (Th)1
response, with high levels of interferon (IFN)γ,
interleukin (IL)-12, IL-17 and IL-18, is associated
Page 1
474
with severe lesions but does not clear the infection
(2-3). Various bacterial factors have been reported to
promote the mucosal Th1 polarization, one of which
is the H. pylori neutrophil-activating (HP-NAP),
previously described to promote neutrophil adhesion
to endothelial cells, which leads to production
of high levels of IFNγ and tumor necrosis factor
(TNF)α with increased expression of class II major
histocompatibility molecules (MHC II) on the
dendritic cell surface (4-5).
Transcriptome studies on human and animal host
response have demonstrated that H. pylori targets
specic host factors involved mainly in cytoskeletal
changes, activation of different signal transduction
pathways, change in cell morphology, cytokine
induction, alteration of cell proliferation pattern and
apoptosis (6-12). In the present study, the global host
gene expression proling in response to chronically
H. pylori SS1 infected and non-infected C57BL/6
mice was investigated after six and twelve months,
the same conditions previously demonstrated to
induce an active gastritis with moderate metaplasia
associated with the induction of a gastric mutagenic
effect (13), known to be among the earliest events
in the carcinogenic process. We focused our
investigations on the differentially expressed genes
related to the inammatory/immune responses
and on gastric expression of IL-23. We provided
in vivo data supporting a characteristic IFNγ-
dependent signature transcript associated with the
chronic gastritis induced by the H. pylori infection,
and consequent IFN-related regulation of gene
expression that might drive the induction of severe
gastric lesions.
MATERIALS AND METHODS
Animal infections
Six-week-old specic-pathogen-free C57BL/6 male
mice (Charles Rivers, France) were infected orogastrically
with 1x10
8
cfu/100 µl of the H. pylori strain SS1 (n=6)
or received peptone broth (n=6) (13). Non-infected (n=3)
and H. pylori-infected mice (n=3) were sacriced after
6 and 12 months. The stomachs were isolated and used
for quantication of H. pylori colonization, histological
analysis as described previously (13), and RNA isolation.
All experiments were performed in accordance with
institutional guidelines as determined by the Central
Animal Facility Committee of the Institut Pasteur, in
conformity with the French Ministry of Agriculture
guidelines for animal care.
Microarray hybridisation and data mining
Analysis of gene expression was conducted using
GeneChip Mouse Expression Array 430A (Affymetrix,
Santa Clara, CA). Total RNA were isolated from the
stomach samples by TRIzol extraction (Invitrogen Life
Technologies), puried on RNeasy minicolumns (Qiagen,
Courtaboeuf, France) and quality checked with an Agilent
Bioanalyzer (Agilent Technologies; Palo Alto, CA). 20
µg of total RNA was amplied and biotin labeled (Enzo
Diagnostic, New York, NY), and then hybridised to the
array according to recommended protocols (Affymetrix,
Santa Clara, CA). Four arrays, for each analysed condition
were used, two arrays to hybridize cRNA from two
mice independently and two arrays to hybridize cRNA
from the third mouse in duplicate. Hybridization and
scanning of the chips were performed according to the
recommended protocols of Affymetrix. Gene microarray
data (ArrayExpress accession: E-MEXP-1135) from this
study have been deposited in the Miamexpress data bank
(http://www.ebi.ac.uk/miamexpress/).
Data analysis was performed using MicroArray Suite
software MAS-5.0 algorithms (Affymetrix) and Splus
ArrayAnalyser software (Insightful). Pre-processing by
robust multi-chip analysis (RMA) (14), was applied to
normalize summary values for each probe set (transcript).
An LPE (local pooled error) test was carried out for each
gene (15), followed by Benjamini-Hochberg correction
for multiple testing (16). The probe sets corresponding to
differentially expressed genes according to the infection
status were selected according to a change call that were
two times higher or lower than those of the controls
with P values less than 0.05. ArrayMiner software
TM
2
(Optimal Design) was then used for clustering according
to gene expression proles.
Detection of transcripts by reverse transcriptase
polymerase chain reaction. (RT-PCR) and real-time PCR
analysis
RT-PCR analyses were performed to conrm
differential expression of selected genes of interest
according to infection status, with 100 pg of total RNA
in each case, using the Superscript
TM
One-Step RT-PCR
kit (Life Technologies, Cergy Pontoise, France). Primer
sequences for the selected genes and the endogenous
control glyceraldehyde-3-phosphate dehydrogenase
(GAPDH) gene are listed in Table I.
Real-time PCR analysis for IL-23p19 gene expression
were performed with RNA extracted from mouse
stomach, which was reverse transcribed and amplied
with p19 primers and probe generated according to the
J.R. VIVAS ET AL.
Page 2
475
Int. J. Immunopathol. Pharmacol.
published sequence of p19 in the Applied Biosystems
(Foster City, CA) Primer Express software program
(17). The primer sequences used are as follows: forward
primer, 5’-CAGCAGCTCTCTCGGAAT-3’ reverse
primer, 5’-ACAACCATCTTCACACTGGATACG-3’;
and probe, 5’-CATGCTAGCCTGGAACGCACATGC-3’.
Amplications of p19 and 18S cDNA for the endogenous
control, were carried out with Taqman (Applied
Biosystems) reagents and the ABI Prism 7700 sequence
detection system (Applied Biosystems).
Total RNA was isolated from gastric antrum biopsies
from ve H. pylori-infected patients with a chronic gastritis
and ve healthy subjects who gave informed consent prior
to their inclusion in the study. None of the patients had
taken antibiotics or gastric proton pump inhibitors within
the two months before the study. Total RNA was prepared
with RNAbee� solution (Duotech, Friendswood, Texas)
according to the manufacturers instructions. RNA
was reverse transcribed and then amplied with the
following primers: 5’-AGCAACAGGGTGGTGGAC-
3’, 5’-GTGTGGTGGGGGACTGAG-3’ for
GAPDH; 5’-TCCACCAGGGTCTGATTTTT-3’, 5’-
TTGAAGCGGAGAAGGAGACG-3’ for IL-23p19.
After amplication, data analysis was performed with the
‘Second Derivative Method’ algorithm. For each sample,
the amount of IL-23p19 mRNA was expressed as an n-
fold of the normalised amount of mRNA from untreated
cells (1 AU = mRNA IL-23p19 concentration (fmol/μl)
/ mRNA GAPDH (fmol/μl), as described previously (4).
This part of the study on human samples was approved by
the appropriate ethics committee.
RESULTS
H. pylori gastric colonization and associated
histological lesions
H. pylori SS1 strain efciently colonized
the stomach of infected mice during the entire
experiment, with a mean level of 2x10
5
and 8x10
6
cfu/g of tissue at 6 and 12 months post-infection
respectively. No bacteria were observed in non-
infected tissues. Analysis of histological lesions in the
infected gastric mucosa indicated an active gastritis
correlated with the presence of mixed inammatory
inltrates, including polymorphonuclear cells and
lymphocytes in the antrum and fundus, as compared
to non-infected mucosa (data not shown). Presence
of low grade metaplasia was observed mostly at 12
months post-infection, as reported previously (13). In
addition, we observed loss of parietal cells, irregular
features, cytoplasmic swelling with cell membrane
irregularities and karyolysis in infected-mice (Fig.
Gene name Primer
Product size
(bp)
Glyceraldehyde-3-phosphate Dehydrogenase F: 5’ GATGACATCAAGAAGGTGGTGA3’
(Gapdh)
R: 5’ TGCTGTAGCCGTATTCATTGTC 3’ 199
Indoleamine-pyrrole 2,3 dioxygenase F: 5’ GGGGGTCAGTGGAGTAGACA 3’
(Ido)
R: 5’ TGGGCAGCTTTTCAACTTCT 3’ 199
Chitinase F:5’ AGGGCTACACTGGGGAGAAT 3’
(Chia)
R: 5’ TAGGGGCACCAATTCCATTA 3’ 198
Upstream transcription factor 2 F: 5’GACACACCCCTATTCTCCGAAA 3’
(Usf2)
R: 5’ TCCAGGTTGTGCTGCTGTAG3’ 361
H+/K+ ATPase transporting, alpha polypeptide F: 5’ GTCTGGAGGGAACAGCTCAG 3’
(Atp4a)
R: 5’ TACCACAATGGCCATGAAGA 3’ 242
Pancreatic phospholipase A2 (group IB) F: 5’ GGAGTGATCCCCTGAAGGAT 3’
(Pla2gIb)
R: 5’ GTTGTACGGGACCTTGGAGA 3’ 293
Table I. Primers list for RT-PCR analysis.
Page 3
476
1B) but not in those non-infected (Fig. 1A).
Global pattern of gene expression in H. pylori
infected mice
We analysed the global patterns of gene
expression in H. pylori-infected and non-infected
mice after 6 and 12 months, according to the
changes in transcripts evaluated as the fold change
shown as logarithmic scale, between the average
signal of infected samples and the baseline signal
of non-infected control at each time point. There
were no differences in gene expression proles of
non-infected samples between the 6 and 12 month
time points, supporting the reliability of the changes
observed between gene expression proles for
infected vs non-infected mice at each time point.
The expression levels of 92 (40 up- and 52 down-
regulated) genes and 171 (81 up- and 90 down-
regulated) genes after 6 and 12 months of infection
respectively were different from time-matched
non-infected controls. These genes were mainly
related to immune response, signal transduction
pathways, cytoskeleton components, membrane
proteins and transport, mitochondrial components,
digestion process, general metabolism, transcription
regulation, apoptosis and cell proliferation (Fig. 2).
Overall, gene expression levels were between two
to four times higher or lower in infected-samples
than in non-infected controls. Fourteen genes were
down- or up- regulated more than ve fold at 6
and/or 12 months after infection (Table II). Chia
and Pla2g1b, coding for an acidic chitinase and the
pancreatic phospholipase A2 group IB respectively,
were two of the genes most affected by H. pylori
infection (Table II). The transcript levels of the α and
β subunits of the H
+
K
+
-ATPase (Atp4a and Atp4b)
primarily responsible for gastric acidication were
ten times lower in infected mice than in controls,
12 months after infection (Table II). Moreover, we
found down-regulated expression of Atp4a, Atp4b
and of the gastric intrinsic factor (Gif) after chronic
H. pylori SS1-strain infection (Table II).
Conrmation of microarray data by RT-PCR
Microarray analysis showed that several probe
sets for the same transcript detected similarly
modulated expression due to infection, supporting
the validity of the data obtained. We analysed, by
Locus
link Gene Description
6 Months
Fold P value
expression
12 Months
Fold P value
expression
81600
18778
109820
109791
11944
11945
14077
18947
11806
22282
14603
11459
21925
69060
Chia
Pla2g1b
Pgc
Clps
Atp4a
Atp4b
Fabp3
Plrp2
Apoa1
Usf2
Gif
Acta1
Tnnc2
Pnlip
Chitinase
Pancreatic PhospholipaseA2
Progastricsin
Pancreatic colipase
H+/K+ ATPase α subunit
H+/K+ ATPase β subunit
Fatty acid binding protein 3
Pancreatic lipase-related protein2
Apolipoprotein A1
Upstream transcription factor2
Gastric intrinsic factor
Actin α 1 skeletal muscle
Troponin C2, Fast
Pancreatic lipase
-3
-4
-2
-2
-2
-1.5
-3
0.00E+00
0.00E+00
1.4x10
-8
1.3x10
-10
2 .1x10
-5
2x10
-2
1.7x10
-11
-30
-19
-18
-11
-10
-10
-6
-6
-5.5
-5
-5
8
8
5
5x10
-236
5x10
-236
2x10
-200
9x10
-126
3x10
-82
4x10
-82
1.3x10
-62
6.2x10
-7
6x10
-56
2x10
-33
3x10
-93
0.00E+00
0.00E+00
6.2x10
-7
Table II. List of the genes most differentially expressed after 6 and 12 months of H. pylori infection as compared to the
non-infected control mice at the same time point.
J.R. VIVAS ET AL.
Page 4
477
Int. J. Immunopathol. Pharmacol.
Locus
Link
Gene Name
6 Months
Fold
expression
Adjusted P
value
12 Months
Fold
expression
Adjusted P
value
14969 H2-Eb1 Histocompatibility 2, class II antigen E beta 2.0 9.40E-13
12260 C1qb Complement component 1 q, subcomponent, beta polypeptide 2.0 3.85E-02 2.0 2.61E-07
14998 H2-DMa Histocompatibility 2, class II, locus DMa 2.6 0.00E+00
215384 Fcgbp IgG Fc binding protien 5.5 0.00E+00
14999 H2-Dmb1 Histocompatibility 2, class II, locus Mb1 2.0 1.93E-04 2.1 0.00E+00
12575 Cdkn1a Cyclin-dependent kinase inibitor 1A (P21) 2.0 3.72E-03 2.0 1.00E-11
110454 Ly6a Lymphocyte antigen 6 complex, locus A 2.0 0.00E+00
26365 Ceacam1 CEA-related cell adhesion molecule 1 2.0 9.05E-04 2.7 5.34E-08
21822 Tgtp T-cell specic GTPase 2.0 4.54E-05 2.0 0.00E+00
56045 Samhd1 SAM domain and HD domain, 1 2.2 4.11E-02
14469 Gbp2 Guanylate nucleotide binding protein 2 2.4 4.43E-09
15980 Ifngr2 Interferon gamma receptor 2 2.0 2.00E-02
15930 Ido Indoleamine-pyrrole 2,3 dioxygenase 2.2 3.81E-06 2.2 0.00E+00
21356 Tapbp TAP Binding protein/Tapasin 2.0 1.93E-04
20701 Serpina1b Serine (or cysteine) proteinase inhibitor, clade A, member 1b 2.2 0.00E+00
16145 Igtp Interferon gamma induced GTPase 2.0 3.73E-02
22375 Tts Tryptophanyl-tRNA synthetase 2.0 1.14E-02 2.0 2.42E-10
16149 Cd74 Ia-associated invariant chain 2.0 6.08E-04 2.6 0.00E+00
14961 H2-Ab1 Histocompatibility 2, class II antigen A beta 1 3.0 4.51E-10 3.0 0.00E+00
14968 H2-Ea Histocompatibility 2, class II antigen E alpha 2.0 1.5
E-04 2.5 0.00E+00
15000 H2-Dmb2 Histocompatibility 2, class II, locus Mb2 2.0 2.73E-03 2.3 0.00E+00
14960 H2-Aa Histocompatibility 2, class II antigen A, alpha 2.0 0.00E+00
17988 Ndrg1 N-myc downstream regulated 1 2.0 3.2E-02 2.0 3.12E-02
16081 Igk-V1 Immunoglobulin kappa chain variable 1 (VI) 2.0 4.38E-05 2.0 0.00E+00
17857 Mx1 Myxovirus (inuenza virus) resistance 1 -2.3 7.88E-08
16145 Il1ra1 Interleukin 11 receptor, alpha chain 1/GP130 -2.0 6.32E-06
15957 It1 Interferon-induced protein with tetratricopeptide repeat1 -2.0 3.80E-03 -3 6.61E-07
15959 It3 Interferon-induced protein with tetratricopeptide repeat3 -2.0 6.20E-04 -2.3 6.61E-07
53606 Glp2 Interferon-alpha inducible protein -2.0 1.41E-04 -2.5 2.75E-08
Table III. Differentially expressed genes related to immune response in H. pylori infected mouse stomachs as compared
to non-infected.
a: Numbers indicate the fold increase or decrease of the mean expression values for each gene, calculated in each
conditions between infected and non-infected mouse stomach samples at each time point, as described in the materials
and methods section.
Page 5
478
Fig. 1. Histological lesions in the fundus of gastric mucosa of one representative non-infected mouse (A) and H. pylori
infected-mouse for 12 months (B) revealed by hematoylin/eosin staining. Strong recruitment of lymphocytes and plasma
cells were observed in the infected-mucosa as indicated by open symbols (B). As compared to the normal architecture of
uninfected gastric mucosa and parietal cells as indicated by arrows (A), highly altered parietal cells (arrow heads) with
atypical morphology as hyperchromatism and karyolysis, associated with atypical chief cells were seen in the infected
gastric mucosa (B) (original magnication 200x).
Fig. 2. Distribution of genes differentially expressed in stomachs of mice after 6 and 12 months of infection according
to functional categories. The bars represent the number of genes with an expression up-regulated at 6 months (hatched
bars) and 12 months (black bars) or down-regulated after 6 months (open bars) and 12 months (grey bars) of infection
as compared to non-infected control.
J.R. VIVAS ET AL.
Page 6
479
Int. J. Immunopathol. Pharmacol.
Fig. 3. Validation of microarray gene expression by RT-PCR analysis. Each band represents one mouse (A). Relative
quantication of the differential expression of selected genes (B), including chitinase (Chia), pancreatic phospholipase
A2 group IB pancreatic (Pla2g1b), H
+
/K
+
ATPase α subunit (Atp4a), upstream stimulatory factor 2 (Usf2) and the
indoleamine-pyrrole 2, 3 dioxygenase after 12 months of infection compared to non-infected samples. Comparison of
the mean fold changes observed for gene expression by microarray and RT-PCR analysis (C). RT-PCR experiments were
performed 3 times.
Page 7
480
RT-PCR, the levels of specic mRNAs for relevant
genes as Chia, Pla2gIB, Atp4a and Usf2 encoding
for upstream stimulatory factor 2 (Fig. 3). These
were among the most differentially down-regulated
genes especially at 12 months after infection (Table
II). RT-PCR analysis conrmed the low levels
of expression for Chia, Pla2gIB, Atp4a and Usf2
observed by microarray analysis 12 months after
infection, that were 3, 4, 7.4 and 3 times lower
than in non-infected samples, respectively. We
conrmed the infection-mediated inhibitory effect
on the expression of Chia and Pla2g1b six months
after infection (data not shown). The expression of
indoleamine-pyrrole 2,3 dioxygenase (Ido) involved
in tryptophane catabolism, was 2.2 times higher
after 6 and 12 months in infected-mice as compared
to non-infected. By RT-PCR analysis only a 1.5-fold
increase was observed in infected-mice, compared to
the controls (Fig. 3A, 3B). For each of the selected
genes, comparison of microarray data and RT-PCR
results indicated that microarray analysis slightly
overestimated the fold changes (Fig. 3C), consistent
with a previous report (18).
Immune response genes differentially expressed in
infected-mice
Twenty-ve and nineteen percent of the genes
up-regulated by the infection after 6 and 12 months
respectively, were related to the host immune
response, with more than a third found at both
time points (Fig. 2). They are listed in Table III,
according to their expression prole. They pointed
to a characteristic IFNγ-dependent expression.
These included genes encoding components of the
major histocompatibility complex class II antigens
(MHC II), with an expression increased 2 to 3-
fold either at 6 and 12 months post-infection as
compared to the control. Genes involved in the
antigen processing and presentation, e.g. the IFNγ-
inducible GTP binding proteins IGTP and TGTP
(T cell specic), the TAP binding protein (Tapasin)
and the guanylate nucleotide binding protein 2
(GBP2) were also observed up-regulated (Table
III). Transcript levels for the Ia-associated invariant
chain (CD74), the IFNγ-regulated GTPase and
IFNγ-receptor 2, were also found two times higher at
six months in infected than in non-infected samples.
Fig. 4. IL-23p19 gastric transcript levels of expression in H. pylori infection. IL-23p19/GAPDH average ratio in stomach
samples from C57BL/6 mice 6 and 12 months after infection with H. pylori (lled bars), compared to non-infected samples
(open bars) at the same time points. At the right part of the graph the levels are reported of IL-13p19 gene expression from
gastric biopsies from H. pylori-infected patients with chronic gastritis (lled bars) (n=5) compared to healthy subjects
(open bars) (n = 5). Error bars indicate SD.
J.R. VIVAS ET AL.
Page 8
481
Int. J. Immunopathol. Pharmacol.
It is interesting to notice that in the presence of the
H. pylori infection, concomitantly to the induction
of the indoleamine-pyrrole 2,3 dioxygenase (Ido),
which is a pro-inammatory enzyme catalyzing
the rate-limiting step in the oxidative catabolism of
tryptophan, the transcript level for the tryptophanyl
tRNA synthetase (Tts) was 2 times higher in infected
than in non-infected controls either after 6 or 12
months. The same increase was observed for the four
Tts corresponding probe sets present on the arrays.
Another gene product to be mentioned, is CEA-
related cell adhesion molecule 1 (Ceacam 1), a
major component of the apical surface glycocalyx
of the mature epithelial cells. It plays an important
role in adherence of enteric bacteria. A 2 and
2.7-fold induction of Ceacam 1 gene expression
were observed at 6 and 12 months post-infection
respectively.
Induction of IL23p19 associated with the IFNγ
–signature in the immune response to H. pylori
infection
The cytokines produced by the host in response
to H. pylori strongly inuence the outcome of the
infection. A new member of the IL-12 cytokine
family, IL-23, has been identied (19). It consists
of two subunits, p40 (shared with IL-12) and p19.
As cited above, our microarray data documented an
induction of the expression of various MHC class II
related genes in H. pylori-infected mice (Table III).
Considering the important relevance of IL-23 in the
host immune response and its ability to drive the Th1
response and to get further insights into the immune
mechanisms related to the H. pylori infection, we
compared, by real time-PCR analysis, the IL-23p19
transcript levels from mice stomach samples after
6 and 12 months of infection with non-infected
controls. In the infected-mice, the expression of IL-
23p19 was 18 times higher than in those non-infected
at 6 months (p<0.005). This important difference was
maintained up to 12 months (Fig. 4).
In vivo relevance of IL-23 up-regulation during H.
pylori infection in humans
We investigated the in vivo relevance of the IL-
23 up-regulation by the H. pylori positive patients.
RNA from the antrum of ve H. pylori-infected
patients with chronic gastritis and ve healthy non-
infected subjects were isolated. IL-23p19 transcript
levels were found 13 times higher (p<0.005) in the
H. pylori-infected patients than in the non-infected
(Fig. 4).
DISCUSSION
Important host co-factors in the outcome of the
H. pylori infection relate to innate and immune
response in both humans and experimental
animals. In the present study, we investigated the
global host gene expression prole in C57BL/6
mice in response to the H. pylori infection over
6 and 12 months, taking advantage of the ability
of H. pylori SS1 strain to chronically colonize the
mouse stomach for long periods. Our data focused
on genes related to immune response. Multiple
IFNγ-dependent signature transcripts were found
up-regulated 6 and 12 months after infection,
consistent with a Th1-polarized response. An up-
regulation for carcinoembryonic antigen-related
cell adhesion protein family, Ceacam 1 transcript
level, was observed. Ceacam1 isoforms are
activation-induced cell surface molecules on T-cells,
specically involved in Th1-mediated inammation
and associated with the release of IL-6 and IL-12,
as demonstrated in a murine model of colitis (20).
The concomitant up-regulation of indoleamine 2,3-
dioxygenase (Ido) and tryptophanyl tRNA synthetase
(Tts) genes expression is interesting to mention as it
has never been reported so far in the case of the H.
pylori infection. Ido and Tts are both IFN γ-inducible
and responsible for tryptophan degradation and its
use in protein synthesis respectively. Ido and Tts
display immunomodulatory regulation of T-cell
proliferation in human and in animal models (21).
It is tempting to speculate that Tts could play a role
in the balance between the anti-inammatory role of
Ido and the inhibitory effect on infection that should
probably result in a global advantage for the host by
turning down the gastric tissue damage.
Our data also documented increased transcript
levels for components of the MHC class II system.
MHC class II molecules are up-regulated during
Helicobacter infection due to IFΝγ exposure,
favouring presentation of H. pylori antigens, and
leading to activation of signal transduction cascade
and apoptosis (22). They are over-expressed in
Page 9
482
gastric carcinogenesis and associated with a host
genetic polymorphism with higher risk of intestinal-
type gastric adenocarcinoma, mainly associated with
the H. pylori infection (23).
During the infection, the driving of gastric T
cell response towards a Th1 type immune response
is characterized by a high production of IFNγ with
consequences on the severity of the gastric lesions.
Various H. pylori factors have been reported to play
a role in T cell polarisation, associated with a high
production of IL-12 and IL-23 (4-5). Recently, a
new link between inammation and tumorigenesis
has been proposed through the action of IL-23,
which has been described to play an important role
in triggering tissue inammation and facilitating
tumour growth (24). Levels of IL-23p19 mRNA,
coding for the specic subunit of IL-23, were
signicantly higher in a large panel of human tumours
than in their adjacent normal tissues (24). Induction
of IL-23 leads to the recruitment of inammatory
cells, and is crucial for the pathogenesis of different
inammatory diseases, such as experimental colitis
and arthritis (25). Moreover, IL-23 is produced by the
host in response to many bacterial infections (26). In
the case of the H. pylori infection, IL-23 expression
has been reported to be induced by the bacterial HP-
NAP factor, leading to an IFNγ−mediated immune
response, associated with an induced expression
of MHC class II components (4-5). We show here
that IL-23p19 transcript levels were much higher in
samples from infected-mice than in non-infected at
each time point. In our mouse model it occurred in
the context of an active gastritis with the presence
of metaplasia, especially at 12 months of infection
(13). The up-regulation of IL-23 expression has been
found also to be relevant in vivo in humans, since
the IL-23p19 expression levels were much higher
in gastric biopsies from H. pylori infected-patients
with chronic gastritis than from non-infected healthy
subjects. Our data argue for the involvement of IL-
23, IFNγ and its related transcripts in the genesis
of the Th1-mediated immune response in H. pylori
infection. While the IL-23 gastric action remains
unknown, it is tempting to speculate that its up-
regulation favours the severity of the gastric lesions
induced by the H. pylori infection, as demonstrated
in an H. hepaticus mouse model of colitis, where
IL-23 drives IFNγ and IL-17 response and promotes
severe intestinal inammation (27).
The association between gastric Th1 immune
response and hypochlorhydria through down-
regulation of H
+
K
+
-ATPase has been reported
previously in the INS-GAS mouse model in which
Helicobacter infection exacerbates the development
of gastric cancerous lesions (28). In the present
study, H
+
K
+
-ATPase is strongly decreased at 12
months after H. pylori infection. Inhibition of
H
+
K
+
-ATPase expression may be attributed to the
progressive destruction of parietal cells observed in
infected samples. The loss of parietal cells and the
associated hypochlorhydria represent two crucial
events preceding gastric dysplasia and neoplasia in
H. felis-infected INS-GAS mice (28). In humans,
molecular mimicry between H. pylori proteins and
H
+
K
+
-ATPase has been reported as a key event in the
genesis of H. pylori-relative gastric autoimmunity
and consequent T-cell attack to H
+
K
+
-ATPase
target on parietal cell surface (29). Although such
a mechanism has not been identied in the mouse
model, it cannot be excluded. A marked decrease
of the gastric intrinsic factor (Gif) in the H. pylori
infected mice was also observed in the present
study. Atp4a, Atp4b and Gif have been previously
shown strongly down-regulated in human gastric
cancer (30) as well as in the H. felis-infected INS-
GAS mouse model, previously described to develop
metaplasia and gastric cancerous lesions exacerbated
by Helicobacter infection (28).
The results obtained on long-term H. pylori SS1
infection in the present study consistently argued
for the occurrence in our mouse model of the early
events known to be involved in the promotion of
severe gastric lesions. They provide novel insights
in the immune response to H. pylori infection,
demonstrating the in vivo involvement of IL-23
associated with the Th1-related IFNγ-signature
transcripts, concomitantly with events preceding
the induction of severe gastric lesions at the gastritis
stage. The gastric IL-23 expression associated with
polarized Th1 response might play an important
role in the pathogenesis of H. pylori infection,
constituting a new eld of investigations.
ACKNOWLEDGEMENTS
We thank Thierry Pedron for helpful discussions.
J.R. VIVAS ET AL.
Page 10
483
Int. J. Immunopathol. Pharmacol.
José Ramos Vivas is a recipient of a FEMS fellowship
2004-I and of the Fundación Ramón Areces, Spain.
Françoise I. Bussière is a recipient of the INCA
consortium/FP6 program.
This study was supported by the DNA-microarray
Platform at the Institut Pasteur (Affymetrix project
03/033), the INCA consortium/FP6 program
(contract reference: LSHC-CT-2005-018704), the
Istituto Superiore di Sanità and the Associazione
Italiana per la Ricerca sul Cancro (AIRC).
REFERENCES
1. Blaser MJ, Atherton JC. Helicobacter pylori
persistence: biology and disease. J Clin Invest 2004;
113:321-33.
2. D’Elios MM, Manghetti M, De Carli M, et al. T
helper 1 effector cells specic for Helicobacter
pylori in gastric antrum of patients with peptic ulcer
disease. J Immunol 1997; 158:962-7.
3. Smythies LE, Waites KB, Lindsey JR, Harris
PR, Ghiara P, Smith PD. Helicobacter pylori-
induced mucosal inammation is Th1 mediated
and exacerbated in IL-4, but not IFN gamma, gene
decient mice. J Immunol 2000; 165:1022-9.
4. Amedei A, Cappon A, Codolo G, Cabrelle A, Polenghi
A, Benagiano M, Tasca E, Azzurri A, D’Elios MM,
Del Prete G, de Bernard M. The neutrophil-activating
protein of Helicobacter pylori promotes Th1 immune
responses. J Clin Invest 2006; 116:1092-101.
5. D’Elios MM, Amedei A, Cappon A, Del Prete G,
de Bernard M. The neutrophil-activating protein
of Helicobacter pylori (HP-NAP) as an immune
modulating agent. FEMS Immunol and Med
Microbiol 2007; 50:157-64.
6. Boussioutas A, Li H, Liu J. Distinctive patterns of
gene expression in premalignant gastric mucosa and
gastric cancer. Cancer Res 2003; 63:2569-77.
7. Backert S, Gressmann H, Kwok T, Zimny-Arndt U,
Köning W, Jungblut PR, Meyer TF. Gene expression
and protein proling of AGS gastric epithelial cells
upon infection with H. pylori. Proteomics 2005; 5:
3902-18.
8. Chiou CC, Chan CC, Sheu DL, Chen KT, Li YS,
Chan EC. Helicobacter pylori infection induced
alteration of gene expression in human gastric cells.
Gut 2001; 48:598-604.
9. Mueller A, Scott Merrell D, Grimm J, Falkow S.
Proling of microdissected gastric epithelial cells
reveals a cell type-specic response to Helicobacter
pylori infection. Gastroenterology 2004; 127:1446-62.
10. Huff JL, Hansen LM, Solnick JV. Gastric
transcription prole of Helicobacter pylori infection
in the Rhesus Macaque. Infect Immun 2004; 72:
5216-26.
11. Mills JC, Syder AJ, Hong CV, Guruge JL, Raaii
F, Gordon JI. A molecular proling of the mouse
gastric parietal cell with and without exposure to
Helicobacter pylori. Proc Natl Acad Sci USA 2001;
98:13687-92.
12. Mueller A, O’Rourke JL, Grimm J, Guillemein
K, Dixon MF, Lee A, Falkow S. Distinct gene
expression proles characterize the histopathological
stages of disease in Helicobacter-induced mucosa-
associated lymphoid tissue lymphoma. Proc Natl
Acad Sci USA 2003; 100:1292-7.
13. Touati E, Michel V, Thiberge J, Wuscher N, Huerre
M, Labigne A. Chronic Helicobacter pylori infections
induce gastric mutations in mice. Gastroenterology
2003; 124:1408-19.
14. Irizari RA, Hobbs B, Collin F, Beazer-BArckay YD,
Antonellis KJ, Scherf U, Speed TP. Exploration,
normalization and summaries of high density
oligonucleotide array probe level data. Biostatistics
2003; 4:249-64.
15. Jain N, Tahatte J, Braciale T, Ley K, O’Connell
M, Lee JK. Local-pooled error test for identifying
differentially expressed genes with a small number
of replicated microarrays. Bioinformatics 2003; 19:
1945-51.
16. Benjamini Y, Hochberg Y. Controlling the false
discovery rate: a practical and powerful approach
to multiple testing. J Roy Stat Soc B 1995; 57:289-
300.
17. Cooper AM, Kipnis A, Turner J, Magram J,
Ferrante J, Orme IM. Mice lacking bioactive IL-12
Can generate protective, antigen-specic cellular
responses to mycobacterial infection only if the
IL-12 p40 subunit is present. J Immunol 2002; 168:
1322-7.
18. Resnick MB, Sabo E, Meitner PA, Kim SS, Cho Y,
Kim HK, Tavares R, Moss SF. Global analysis of the
human gastric epithelial transcriptome altered by
Page 11
484
Helicobacter pylori eradication in vivo. Gut 2006;
55:1717-24.
19. Hunter CA. New IL-12 family members: IL-23 and
IL-27, cytokines with divergent functions. Nat Rev
Immunol 2005; 5:521-31.
20. Iijima H, Neurath MF, Nagaishi T, Glickman JN,
Nieuwenhuis EE, Nakajima A, Chen D, Fuss IJ,
Utku N, Lewicki DN, Becker C, Gallagher TM,
Homes KV, Blumberg RS. Specic regulation of T
helper cell 1-mediated murine colitis by Ceacam1. J
Exp Med 2004; 4:471-82.
21. Boasso A, Herbeuval JP, Hardy AW, Winkler
C, Shearer GM. Regulation of indoleamine 2,3-
dioxygenase and tryptophanyl-tRNA-synthetase by
CTLA-4-Fc in human CD4+ T cells. Blood 2005;
105:1574-81.
22. Fan XJ, Crowe SE, Behar S, Gunasena H, Ye
G, Haeberle H, Van Houten N, Gourley WK,
Ernst P, Reyes V. The effect of class II major
histocompatibility complex expression on adherence
of Helicobacter pylori and induction of apoptosis in
gastric epithelial cells: A mechanism for T helper
cell type 1-mediated damage. J Exp Med 1998; 187:
1659-69.
23. Azuma T, Ito S, Sato F, Yamazaki Y, Miyaji H, Ito Y,
Suto H, Kuriyama M, Kato T, Kohli Y. The role of
HLA-DQA1 gene in resistance to atrophic gastritis
and gastric adenocarcinoma induced by Helicobacter
pylori infection. Cancer 1998; 82:1013-8.
24. Langowski JL, Zhang X, Wu L, Mattson JD, Chen
T, Smith K, Bashman B, McClanahan T, Kastelen
RA, Oft M. IL-23 promotes tumour incidence and
growth. Nature 2006; 442:461-5.
25. Langrish CL, Chen Y, Blumenschein WM, Mattson
JD, Bashman B, Sedgwick T, McClanahan T,
Kastelein RA, Cua DJ. IL-23 drives a pathogenic
T cell population that induces autoimmune
inammation. J Exp Med 2005; 201:233-40.
26. Mangan PR, Harrington LE, O’Quinn DB, Helms
WS, Bullard DC, Elson CO, Hatton RD, Wahl
SM, Schoeb TR, Weaver CT. Transforming growth
factor-beta induces development of the TH17
lineage. Nature 2006; 441:231-4.
27. Kullberg MC, Jankovic D, Feng CG, Hue S, Gorelick
PL, McKenzie BS, Cua DJ, Powrie F, Cheever
AW, Maloy KJ, Sher A. IL-23 plays a key role in
Helicobacter hepaticus-induced T cell-dependent
colitis. J Exp Med 2006; 11:2485-94.
28. Takaishi S, Wang TC. Gene expression proling
in a mouse model of Helicobacter-induced gastric
cancer. Cancer Sci 2007; 98:284-93.
29. Amedei A, Bergman MP, Appelmelk BJ, Azzuri A,
Benagiano M, Tamburini C, Van Der Zee R, Telford
JL, Vandenbroucke-Grauls CM, D’Elios MM, Del
Prete G. Molecular mimicry between Helicobacter
pylori antigens and H+, K+-adenosine triphosphate
in human gastric autoimmunity. J Exp Med 2003;
198:1147-56.
30. Lee JY, Eom EM, Kim DS, Ha-Lee YM, Lee DH.
Analysis of gene expression proles of gastric
normal and cancer tissues by SAGE. Genomics
2003; 82:78-85.
J.R. VIVAS ET AL.
Page 12
  • Source
    • "Thus, combined exposure to H. pylori infection and excessive salt intake appears to be very important for the development and progression of gastric tumors, although the detailed mechanisms, especially in terms of gene expression profiles, remain to be clarified. High throughput microarray technology provides a powerful tool for comprehensive gene analysis, already applied to assess gene expression patterns in both human samples and animal models of gastric disorders78910111213141516 . Although many researchers have focused on gene expression in H. pylori-treated gastric cell lines171819, results in cell culture do not necessarily correlate with expression of specific genes in the in vivo microenvironment featuring host immune responses and stromal-epithelial interactions in cancers. "
    [Show abstract] [Hide abstract] ABSTRACT: Helicobacter pylori (H. pylori) infection and excessive salt intake are known as important risk factors for stomach cancer in humans. However, interactions of these two factors with gene expression profiles during gastric carcinogenesis remain unclear. In the present study, we investigated the global gene expression associated with stomach carcinogenesis and prognosis of human gastric cancer using a mouse model. To find candidate genes involved in stomach carcinogenesis, we firstly constructed a carcinogen-induced mouse gastric tumor model combined with H. pylori infection and high-salt diet. C57BL/6 J mice were given N-methyl-N-nitrosourea in their drinking water and sacrificed after 40 weeks. Animals of a combination group were inoculated with H. pylori and fed a high-salt diet. Gene expression profiles in glandular stomach of the mice were investigated by oligonucleotide microarray. Second, we examined an availability of the candidate gene as prognostic factor for human patients. Immunohistochemical analysis of CD177, one of the up-regulated genes, was performed in human advanced gastric cancer specimens to evaluate the association with prognosis. The multiplicity of gastric tumor in carcinogen-treated mice was significantly increased by combination of H. pylori infection and high-salt diet. In the microarray analysis, 35 and 31 more than two-fold up-regulated and down-regulated genes, respectively, were detected in the H. pylori-infection and high-salt diet combined group compared with the other groups. Quantitative RT-PCR confirmed significant over-expression of two candidate genes including Cd177 and Reg3g. On immunohistochemical analysis of CD177 in human advanced gastric cancer specimens, over-expression was evident in 33 (60.0%) of 55 cases, significantly correlating with a favorable prognosis (P = 0.0294). Multivariate analysis including clinicopathological factors as covariates revealed high expression of CD177 to be an independent prognostic factor for overall survival. These results suggest that our mouse model combined with H. pylori infection and high-salt diet is useful for gene expression profiling in gastric carcinogenesis, providing evidence that CD177 is a novel prognostic factor for stomach cancer. This is the first report showing a prognostic correlation between CD177 expression and solid tumor behavior.
    Full-text · Article · Jul 2013 · BMC Gastroenterology
  • Source
    • "During H. pylori infection, significant overexpression of MHC II antigen-presenting genes, IL-7R ubiquitin-D, CXCR4, lactoferrin immune response-related genes, CXCL-2 and -13, CCL18 chemokine ligand, and VCAM-1 genes have been established (Galamb et al., 2008). In addition, IL-23p19 up-regulation is confirmed in gastric biopsies from both H. pylori infected-mice and patients with chronic gastritis (Vivas et al., 2008). CCR6 is markedly upregulated in CD3 (+) T cells infiltrating the gastric mucosa and has been reported to mediate lymphocyte homeostasis and immune responses in mucosal tissue ( Tsai & Hsu, 2010). "
    Preview · Chapter · Jun 2011
  • Source
    • "Atypia in the antrum and the fundus are also observed. Consistent with our previous findings (Vivas et al., 2008), USF1 and USF2 gene expression levels were one-third to one half and one-sixth to one half those in uninfected mice at 12 and 18 months post infection respectively (Fig. 2B). H. pylori infection decreases USF1/USF2-DNA binding to the E-box promoter region USF1 and USF2 bind to the E-box element present in the promoter region of genes (Corre and Galibert, 2005). "
    [Show abstract] [Hide abstract] ABSTRACT: Helicobacter pylori infection is associated with the development of gastric adenocarcinoma. Upstream stimulatory factors USF1 and USF2 regulate the transcription of genes related to immune response, cell cycle and cell proliferation. A decrease in their expression is observed in human gastric epithelial cells infected with H. pylori, associated to a lower binding to their DNA E-box recognition site as shown by electrophoretic mobility shift assay. DNA methylation leads to gene silencing. The treatment of cells with 5'-azacytidine, an inhibitor of DNA methylation, restored the USF1 and USF2 gene expression in the presence of infection. Using promoter PCR methylation assay, a DNA hypermethylation was shown in the promoter region of USF1 and USF2 genes, in infected cells. The inhibition of USF1 and USF2 expression by H. pylori and the DNA hypermethylation in their gene promoter region was confirmed in gastric tissues isolated from 12 to 18 months infected mice. Our study demonstrated the involvement of USF1 and USF2 as molecular targets of H. pylori and the key role of DNA methylation in their regulation. These mechanisms occurred in the context of metaplastic lesions, suggesting that alteration of USF1 and USF2 levels could participate in the promotion of neoplastic process during H. pylori infection.
    Full-text · Article · Feb 2010 · Cellular Microbiology
Show more