No full-text available
To read the full-text of this research,
you can request a copy directly from the authors.
Improved detection suggests all Merkel cell carcinomas harbor Merkel polyomavirus
Abstract
A human polyomavirus was recently discovered in Merkel cell carcinoma (MCC) specimens. The Merkel cell polyomavirus (MCPyV) genome undergoes clonal integration into the host cell chromosomes of MCC tumors and expresses small T antigen and truncated large T antigen. Previous studies have consistently reported that MCPyV can be detected in approximately 80% of all MCC tumors. We sought to increase the sensitivity of detection of MCPyV in MCC by developing antibodies capable of detecting large T antigen by immunohistochemistry. In addition, we expanded the repertoire of quantitative PCR primers specific for MCPyV to improve the detection of viral DNA in MCC. Here we report that a novel monoclonal antibody detected MCPyV large T antigen expression in 56 of 58 (97%) unique MCC tumors. PCR analysis specifically detected viral DNA in all 60 unique MCC tumors tested. We also detected inactivating point substitution mutations of TP53 in the two MCC specimens that lacked large T antigen expression and in only 1 of 56 tumors positive for large T antigen. These results indicate that MCPyV is present in MCC tumors more frequently than previously reported and that mutations in TP53 tend to occur in MCC tumors that fail to express MCPyV large T antigen.
... Subsequent studies comparing the immunohistochemical method with PCR demonstrated a good correlation between the two methods [19,26]. In 2012, a new clone of the MCPyV antibody, termed Ab3, was found to show higher sensitivity than CM2B4 [27]. Both clones were developed based on the peptide sequence of exon 2 in the LTag of the virus, which is unique for MCPyV [28]. ...
... Both clones were developed based on the peptide sequence of exon 2 in the LTag of the virus, which is unique for MCPyV [28]. CM2B4 binds to amino acids 116-129, while Ab3 targets the region spanning amino acids 79-260 [21,25,27]. ...
... Nuclear staining was evaluated [25,27]. In some cases, cytoplasmic staining was observed alongside nuclear staining. ...
Merkel cell carcinoma (MCC) is diagnosed through histopathological and immunohistochemical examination of biopsies from skin or other organs. Its distinguishing features include perinuclear dot-like staining with Cytokeratin 20 (CK20) and detection of Merkel cell polyomavirus (MCPyV) using various methods. However, CK20 and MCPyV negative MCC cases have been reported at varying rates. In this single center cross-sectional study, we aimed to determine which clones are more effective in diagnosing MCC by comparing the performance of CK20 antibody clones Ks20.8 and SP33, as well as MCPyV antibody clones Ab3 and CM2B4. Fifty-four patients diagnosed with MCC were included. Among these, 42 cases were primary cutaneous, and 12 cases were nodal MCC. Fifty-two (96.3%) cases were positive with both CK20 clones, while two cases were negative. Clone SP33 stained areas of necrosis, whereas Ks20.8 showed no aberrant staining. MCPyV was detected in 44 cases (81.5%) using clone Ab3 and 39 cases (72.2%) using clone CM2B4. Staining with MCPyV clone Ab3 was diffuse and strong in most cases, while approximately 30% of CM2B4-positive cases exhibited low percentages and/or weak staining, complicating the evaluation. The two CK20-negative cases were also negative with both MCPyV clones. Our data demonstrated that CK20 clone Ks20.8 may be preferred for MCC diagnosis due to its consistent performance and lack of aberrant staining. Similarly, MCPyV clone Ab3 appears superior to CM2B4 for identifying MCPyV-positive cases.
... Since its discovery in 2008, MCV has been identified in up to 80% of Merkel cell carcinoma cases (IARC 2013), with newer studies suggesting over 98% of Merkel cell carcinoma tumors contain MCV (Rodig et al. 2012). Other studies suggest that there are two varieties of Merkel cell carcinoma, one that is MCV infected, and one that is not; however, the existence of a MCVnegative subset is controversial (Moore and Chang 2014). ...
... To date, Merkel cell carcinoma is the only neoplasm associated with MCV (see Section 3); however, an etiologic role has been suggested for some cases of small-cell lung cancer (Helmbold et al. 2009), non-small cell lung cancer Hashida et al. 2013;Joh et al. 2010a;Lasithiotaki et al. 2013), and some hematologic malignancies (Teman et al. 2011). MCV was identified as a causal factor in Merkel cell carcinoma after it was found clonally integrated into the cellular DNA of approximately 80% of Merkel cell carcinoma tumors examined (Becker et al. 2009b;Feng et al. 2008;Kassem et al. 2008;Martel-Jantin et al. 2014;Rodig et al. 2012). In contrast, MCV DNA is maintained as a circular episome in the host cell during productive infection ). ...
... MCV has been detected in approximately 70% to 97% of Merkel cell carcinoma cases (Amber et al. 2013;Feng et al. 2008;IARC 2013;Rodig et al. 2012;Sihto et al. 2009;Spurgeon and Lambert 2013;Stakaityte et al. 2014). The data suggest that Merkel cell carcinoma can develop through both a virus-mediated pathway in which MCV promotes tumorigenesis and possibly, in a minority of cases, a nonvirus-mediated pathway (Amber et al. 2013;Martel-Jantin et al. 2012). ...
Introduction: In the United States, Merkel cell polyomavirus (MCV or MCPyV) infection (as assessed by seroprevalence) ranges from 22% to 88%, with lower rates in children and higher rates in adults. MCV is a stable, nonenveloped DNA virus found in the skin. Transmission of MCV is not fully characterized, but possible transmission through personal contact via saliva or skin has been suggested. MCV establishes a chronic, lifelong, symptomless infection in a large majority of healthy individuals. MCV was discovered in 2008 when nonhuman DNA was detected in human Merkel cell carcinoma cells.
Methods: The National Toxicology Program (NTP) conducted a cancer hazard evaluation of MCV infection for possible listing in the Report on Carcinogens (RoC). The evaluation included the findings from studies reported in the 2008 IARC monograph and from a search for all literature related to MCV. For each cancer site, the evidence from human and mechanistic studies was integrated, considering the following guidelines: Hill’s characteristics of causality, multicausality epidemiology issues, and concepts of direct and indirect carcinogenesis proposed by several virus experts. Finally, the RoC’s listing criteria were applied to the assessment to reach an overall cancer hazard conclusion.
Results and Discussion: Epidemiological, clinical, and molecular studies demonstrated evidence of a causal association between MCV and Merkel cell carcinoma, a rare cancer most commonly observed in the elderly and in immunosuppressed individuals. This association was seen in studies of populations in different geographical areas. Case-control studies and a nested case-control study found consistent evidence of elevated risk estimates among MCV-infected individuals. Risk estimates were highest among those with high levels of anti-MCV antibodies. Clinical studies found significantly higher MCV antibody levels in MCV-positive Merkel cell carcinoma cases, and case series studies found MCV DNA integrated into tumors. Molecular studies in humans found MCV monoclonally integrated into the cellular genome of tumor cells, providing evidence that virus infection precedes cancer.
Mechanistic studies support the epidemiological evidence. Integration of MCV DNA can lead to the expression of two proteins, including a large T (LT) antigen and a small T antigen, which are required for transformation of the host cell into a cancer cell and for proliferation and survival of the cancer cells. The mutated LT antigen prevents viral replication and allows the virus to evade immune detection. Only the mutated, integrated form of MCV is associated with carcinogenicity, which may explain why only a small percentage of infected individuals develop cancer.
NTP Hazard Conclusion and Significance: The conclusion of the cancer hazard evaluation was that MCV should be listed as known to be a human carcinogen in the RoC. The Secretary of Health and Human Services approved the listing of MCV in the 14th RoC. The rationale for the listing was sufficient evidence from studies in humans (human cancer, clinical, and molecular) and supporting mechanistic data. Globally, MCV is estimated to be responsible for approximately 10,000 cancers per year.
... The MCPyV genome is maintained as episomal circular dsDNA during the normal life cycle but is integrated in virus positive (V+) MCCs [11]. Characteristic for V+ MCC is the expression of a C-terminal truncated LT (tLT), resulting from mutations or a reading frame shift, which introduce premature stop codons [7,[12][13][14]. ...
... Hallmarks of V+ MCC tumors and cell lines are the integration of the MCPyV genome and the presence of a nonsense mutation in the LT gene encoding a C-terminal truncated form of LT (tLT) [7,[12][13][14]. We investigated whether full-length LT (LT), tLT variants, and sT could induce the expression of IL-33. ...
Merkel cell polyomavirus (MCPyV) is a causal factor in Merkel cell carcinoma (MCC). The oncogenic potential is mediated through its viral oncoproteins large T-antigen (LT) and small T-antigen (sT). Cytokines produced by tumor cells play an important role in cancer pathogenesis, and viruses affect their expression. Therefore, we compared human cytokine and receptor transcript levels in virus positive (V+) and virus negative (V−) MCC cell lines. Increased expression of IL-33, a potent modulator of tumor microenvironment, was observed in V+ MCC cell lines when compared to V− MCC-13 cells. Transient transfection studies with luciferase reporter plasmids demonstrated that LT and sT stimulated IL-33, ST2/IL1RL1 and IL1RAcP promoter activity. The induction of IL-33 expression was confirmed by transfecting MCC-13 cells with MCPyV LT. Furthermore, recombinant human cytokine domain IL-33 induced activation of MAP kinase and NF-κB pathways, which could be blocked by a ST2 receptor antibody. Immunohistochemical analysis demonstrated a significantly stronger IL-33, ST2, and IL1RAcP expression in MCC tissues compared to normal skin. Of interest, significantly higher IL-33 and IL1RAcP protein levels were observed in MCC patient plasma compared to plasma from healthy controls. Previous studies have demonstrated the implication of the IL-33/STL2 pathway in cancer. Because our results revealed a T-antigens-dependent induction of the IL-33/ST2 axis, IL-33/ST2 may play a role in the tumorigenesis of MCPyV-positive MCC. Therefore, neutralizing the IL-33/ST2 axis may present a novel therapeutic approach for MCC patients.
... This tumor-associated mutation does not change the splicing motif at either the donor (at nt 1622) or the acceptor (at nt 861) site required for circMCV-T backsplicing. WaGa cells, derived from ascites fluid (51,55), similarly express a truncated LT protein due to a single C-T mutation at nt 1461, which also is not predicted to affect circMCV-T formation. Additionally, both of the circMCV-T-positive cell lines WaGa and CVG-1 contain a relatively high number of integrated viral genome copies per cell, in contrast to MKL-2 and MS-1 cells, which do not express circMCV-T (52,55). ...
... WaGa cells, derived from ascites fluid (51,55), similarly express a truncated LT protein due to a single C-T mutation at nt 1461, which also is not predicted to affect circMCV-T formation. Additionally, both of the circMCV-T-positive cell lines WaGa and CVG-1 contain a relatively high number of integrated viral genome copies per cell, in contrast to MKL-2 and MS-1 cells, which do not express circMCV-T (52,55). This may explain the increased circMCV-T and 57kT levels detected in these cell lines (Fig. 2C). ...
Viral noncoding RNAs have acquired increasing prominence as important regulators of infection and mediators of pathogenesis. Circular RNAs (circRNAs) generated by backsplicing events have been identified in several oncogenic human DNA viruses. Here, we show that Merkel cell polyomavirus (MCV), the etiologic cause of ∼80% of Merkel cell carcinomas (MCCs), also expresses circular RNAs. By RNase R-resistant RNA sequencing, four putative circRNA backsplice junctions (BSJs) were identified from the MCV early region (ER). The most abundantly expressed MCV circRNA, designated circMCV-T, is generated through backsplicing of all of ER exon II to form a 762-nucleotide (nt) circular RNA molecule. Curiously, circMCV-T, as well as two other less abundantly expressed putative MCV circRNAs, overlaps in a complementary fashion with the MCV microRNA (miRNA) locus that encodes MCV-miR-M1. circMCV-T is consistently detected in concert with linear T antigen transcripts throughout infection, suggesting a crucial role for this RNA molecule in the regulatory functions of the early region, known to be vital for viral replication. Knocking out the hairpin structure of MCV-miR-M1 in genomic early region expression constructs and using a new high-efficiency, recombinase-mediated, recircularized MCV molecular clone demonstrates that circMCV-T levels decrease in the presence of MCV-miR-M1, underscoring the interplay between MCV circRNA and miRNA. Furthermore, circMCV-T partially reverses the known inhibitory effect of MCV-miR-M1 on early gene expression. RNase R-resistant RNA sequencing of lytic rat polyomavirus 2 (RatPyV2) identified an analogously located circRNA, stipulating a crucial, conserved regulatory function of this class of RNA molecules in the family of polyomaviruses.
IMPORTANCE
Covalently closed circular RNAs were recently described in the human DNA tumor viruses Epstein-Barr virus (EBV), Kaposi’s sarcoma-associated herpesvirus (KSHV), and human papillomavirus (HPV). Here, we show that MCV, another DNA tumor virus, generates circRNAs from its early regulatory region in concert with T antigen linear transcripts. MCV circMCV-T interacts with another MCV noncoding RNA, miR-M1, to functionally modulate early region transcript expression important for viral replication and long-term episomal persistence. This work describes a dynamic regulatory network integrating circRNA/miRNA/mRNA biomolecules and underscores the intricate functional modulation between several classes of polyomavirus-encoded RNAs in the control of viral replication.
... Indeed, chronic inflammation has been linked to an increased risk of certain cancers, including esophageal, lung and colorectal cancer 66-68 , suggesting a causative role for inflammatory processes in human oncogenesis. In addition to inflammation, viral infections have been established as causative drivers of cancer, although evidence for this in the context of neurological neoplasms is lacking [69][70][71][72][73][74][75][76][77][78][79][80][81][82] . Despite an absence of conclusive studies linking viral infections to brain tumors, an abundance of correlative . ...
Non-canonical roles for growth factors in the nucleus have been previously described, but their mechanism of action and biological roles remain enigmatic. Platelet-derived growth factor B (PDGFB) can drive formation of low-grade glioma and here we show that it localizes to the nucleus of human glioma cells where it binds chromatin to preserve genome stability and cell lineage. Failure of PDGFB to localize to the nucleus leads to chromosomal abnormalities, aberrant heterochromatin architecture and accelerated tumorigenesis. Furthermore, nuclear localization of PDGFB is reliant upon the expression levels and mutation status of isocitrate dehydrogenase (IDH). Unexpectedly, we identified macrophages as the predominant source of PDGFB in human, finding that immune-derived PDGFB can localize to the nucleus of glioma cells. Collectively, these studies show that immune derived PDGFB enters the nucleus of glioma cells to maintain genomic stability, while identifying a new mechanism by which IDH mutations promote gliomagenesis.
... Techniques for the detection of MCPyV in tumors contain immunohistochemistry, PCR, RNA or DNA in situ hybridization, and next-generation sequencing (NGS) (71)(72)(73)(74)(75). CM2B4 is a commercially accessible mouse monoclonal antibody for the detection of MCPyV LT and is about 88% sensitive and 94% specific (compared to multimodal methods combining PCR with immunohistochemistry. ...
Polyomaviruses are a group of small, double-stranded DNA viruses that are known to be associated with the development of certain human diseases, but there is evidence that these viruses might be associated with gastrointestinal (GI) cancers. Several polyomaviruses have been identified, such as JC polyomavirus (JCPyV), BK polyomavirus (BKPyV) and recently Merkel cell polyomavirus (MCPyV). Although the direct effects of polyomaviruses on transformation of human cells and cancer development are not clearly recognized, their association with certain human diseases including GI cancers has been proposed through several molecular and epidemiological studies. For example, JCPyV and BKPyV have been linked to colorectal cancer, as there is growing evidence of finding viral genomes in cancerous tissues. Nevertheless, the major role of JCPyV, BKPyV and MCPyV in colorectal cancer progression is still under extensive investigation, and further surveys is required to establish a conclusive cause-and-effect relationship. Understanding the role of these viruses in cancer development has significant implications for diagnosis, treatment, and prevention strategies. It seems that proving a causal link between polyomaviruses and GI cancers might provide a novel path for targeted therapies or design and development of specific therapeutic vaccines. In addition, performing research on the possible link can provide insights into the underlying molecular mechanisms of carcinogenesis, potentially leading to the identification of novel biomarkers. This review focuses on polyomaviruses, in particular a recently discovered polyomavirus, MCPyV, and their possible link with human gastrointestinal disorders.
... Detection and quantitation of MCPyV DNA in FFPE sections were performed by a quantitative polymerase chain reaction (qPCR) employing the previously described primers and probe for the MCPyV sT gene (forward: TTAGCTGTAAGTTGTCTCGCC; reverse: CACCAGTCAAAACTTTCCCAAG) [38]. All qPCRs were carried out in triplicate, and MCPyV viral load, given as the mean of at least three positive reactions was expressed as copies/milliliter. ...
Despite recent advances in prevention, detection and treatment, oral squamous cell carcinoma (OSCC) remains a global health concern, strongly associated with environmental and lifestyle risk factors and infection with oncogenic viruses. Merkel Cell Polyomavirus (MCPyV), well known to be the causative agent of Merkel Cell Carcinoma (MCC) has been found in OSCC, suggesting its potential role as a co-factor in the development of oral cavity cancers. To improve our understanding about MCPyV in oral cavities, the detection and analysis of MCPyV DNA, transcripts and miRNA were performed on OSCCs and oral potentially malignant disorders (OPMDs). In addition, the cellular miR-375, known to be deregulated in tumors, was examined. MCPyV DNA was found in 3 out of 11 OSCC and 4 out of 12 OPMD samples, with a viral mean value of 1.49 × 10² copies/mL. Viral integration was not observed and LTAg and VP1 transcripts were detected. Viral miRNAs were not detected whereas the cellular miR-375 was found over expressed in all MCPyV positive oral specimens. Our results reported evidence of MCPyV replication in both OSCC and OPMD suggesting the oral cavity as a site of replicative MCPyV infection, therefore underscoring an active role of this virus in the occurrence of oral lesions.
... Similar data have been published, raising the question of which immunohistochemical staining is best for detecting MCPyV. 39 It has been suggested that the use of combined stains, such as CM2B4, CM5E1 and Ab3, may be more reliable in determining virus-induced MCC. 8 Additional modalities, such as quantitative polymerase chain reaction (PCR) or next-generation sequencing may increase the precision. 40 The mutational landscape is also consistent with the different nature of the two MCC groups. ...
Background
Merkel cell carcinoma (MCC) is an aggressive malignant neuroendocrine tumour. There are two subsets of MCC, one related to Merkel cell polyomavirus (MCPyV) and the other to ultraviolet (UV) radiation. MCPyV-positive and MCPyV-negative MCCs have been considered to be different tumours, since the former type harbours few DNA mutations and is not related to UV radiation, and the latter usually arises in sun-exposed areas and may be found in conjunction with other keratinocytic tumours, mostly squamous cell carcinomas. Two viral oncoproteins, large T antigen (LT, coded by MCPyV_gp3) and small T antigen (sT, coded by MCPyV_gp4), promote different carcinogenic pathways.
Objectives
We hypothesized that the biological behaviours of MCPyV-positive and MCPyV-negative MCCs are different. We aimed to determine which genes are differentially expressed in MCPyV-positive and MCPyV-negative MCC, to describe the mutational burden and the most frequently mutated genes in the two MCC types, and to identify the clinical and molecular factors that may be related to patient survival.
Methods
Ninety-two cases with a diagnosis of MCC were identified from the medical databases of the participating centres.
To study gene expression, a customized panel of 172 genes was developed. Gene expression profiling was performed with nCounter Technology (NanoString Technologies, Seattle, WA, USA).
For mutational studies, a customized panel of 26 genes was designed. Somatic single nucleotide variants (SNVs) were identified following the best practices GATK workflow for somatic mutations.
Results
The expression of LT enabled the series to be divided into two groups, (LT-positive, n=55; LT-negative, n=37). Genes differentially expressed in LT-negative cases were related to epithelial differentiation, especially SOX9, or proliferation and cell cycle (MYC, CDK6), among others. Congruently, LT displayed lower expression in SOX9-positive cases, and differentially expressed genes in SOX9-positive cases were related to epithelial/squamous differentiation.
In LT-positive cases, the mean SNV frequency was 4.3 per case, and 10 per case in LT-negative cases (p=0.03).
The expression of SNAI1 (HR=1.046, 95% CI=1.007–1.086, p=0.021) and CDK6 (HR=1.049, 95% CI=1.020–1.080, p=0.001) were identified as risk factors in a multivariate survival analysis.
Conclusions
Tumours with weak expression of LT tend to co-express genes related to squamous differentiation and cell cycle, and to have a higher mutational burden. These findings are congruent with those of earlier studies.
... The presence and quantity of MCPyV DNA were determined by a quantitative polymerase chain reaction (qPCR) using primers and a probe for the sT gene sequence [21]. All samples were tested in triplicate, and the number of viral copies was calculated from Pathogens 2023, 12, 894 4 of 8 standard curves, which were constructed using a ten-fold dilution series of plasmid pMCV-R17a containing the entire genome of MCPyV (Addgene, #24729) (dilution range: 10 8 -10 copies/mL). ...
Merkel cell polyomavirus (MCPyV) is the etiological agent of the majority of Merkel cell carcinoma (MCC): a rare skin tumor. To improve our understanding of the role of MCPyV in MCCs, the detection and analysis of MCPyV DNA and transcripts were performed on primary tumors and regional lymph nodes from two MCC patients: one metastatic and one non-metastatic. MCPyV-DNA was searched by a quantitative polymerase chain reaction (qPCR), followed by the amplification of a Large T Antigen (LTAg), Viral Protein 1 (VP1) and Non-Coding Control Region (NCCR). LTAg and VP1 transcripts were investigated by reverse-transcription PCR (RT-PCR). Viral integration was also studied, and full-length LTAg sequencing was performed. qPCR revealed that the primary tumor of both patients and the lymph node of one patient was positive for the small t-antigen, with an average value of 7.0 × 10² copies/µg. The same samples harbored LTAg, NCCR and VP1 DNA. Sequencing results showed truncated LTAg with the conserved retinoblastoma (Rb) protein binding motif and VP1 and NCCR sequences identical to the MCC350 strain. RT-PCR detected LTAg but not VP1 transcripts. The MCPyV genome was integrated into the primary tumor of both patients. The results confirmed the connection between MCPyV and MCC, assuming integration, LTAg truncation and Rb sequestration as key players in MCPyV-mediated oncogenesis.
... MCC is an aggressive NE carcinoma of the skin currently distinguished by two etiological subtypes defined by clonally integrated MCPyV or UV-induced mutagenesis. Despite these profound genetic differences, diagnostic IHC markers other than expression of MCPyV LT do not readily distinguish between these subtypes (68,69). Prior work has shown variable expression of NE genes in MCC (19), while studies of other NE cancers including SCLC have used NE transcription factors as means of subtype deconvolution (34)(35)(36)(37)(38)40). ...
Background:
Merkel cell carcinoma (MCC) is an aggressive neuroendocrine (NE) skin cancer caused by severe UV-induced mutations or expression of Merkel cell polyomavirus (MCPyV) large and small T antigens (LT and ST). Despite deep genetic differences between MCPyV-positive and -negative subtypes, current clinical diagnostic markers are indistinguishable between subtypes and the expression profile of MCC tumors is unexplored.
Methods:
Here we leveraged bulk and single-cell RNA sequencing of patient-derived tumor biopsies and cell lines to explore the underlying transcriptional diversity of MCC.
Results:
Strikingly, MCC samples could be separated into transcriptional subtypes that were independent of MCPyV status. Instead, we observed an inverse correlation between a NE gene signature and the Hippo pathway transcription factors Yes1-associated transcriptional regulator (YAP1) and WW domain containing transcriptional regulator (WWTR1). This inverse correlation was present at the transcript and protein levels in the tumor biopsies as well as in established and patient-derived cell lines. Mechanistically, expression of YAP1 or WWTR1 in a MCPyV-positive MCC cell line induced cell-cycle arrest at least in part through TEAD-dependent transcriptional repression of MCPyV LT.
Conclusion:
These findings describe previously unrecognized heterogeneity in NE gene expression within MCC and support the model that YAP1/WWTR1 silencing is essential for the development of MCPyV-positive MCC.
Funding:
US Public Health Service grants R35CA232128, P01CA203655, and P30CA06516.
... Quantitative determination of BKPyV DNA was carried out by the Thermo Scientific AcroMetrix BKPyV Panel containing intact, encapsidated viral particles (VP1) [34,36]. MCPyV DNA quantity was analyzed, using primers and probes for MCPyV sT, as previously described [37]. For HPyV6 and HPyV7, qPCRs with primers targeting the VP1 gene were performed [38]. ...
Since it was clearly established that HIV/AIDS predisposes to the infection, persistence or reactivation of latent viruses, the prevalence of human polyomaviruses (HPyVs) among HIV-1-infected patients and a possible correlation between HPyVs and HIV sero-status were investigated. PCR was performed to detect and quantify JCPyV, BKPyV, MCPyV, HPyV6, HPyV7 and QPyV DNA in the urine and plasma samples of 103 HIV-1-infected patients. Subsequently, NCCR, VP1 and MCPyV LT sequences were examined. In addition, for MCPyV, the expression of transcripts for the LT gene was investigated. JCPyV, BKPyV and MCPyV’s presence was reported, whereas HPyV6, HPyV7 and QPyV were not detected in any sample. Co-infection patterns of JCPyV, BKPyV and MCPyV were found. Archetype-like NCCRs were observed with some point mutations in plasma samples positive for JCPyV and BKPyV. The VP1 region was found to be highly conserved among these subjects. LT did not show mutations causing stop codons, and LT transcripts were expressed in MCPyV positive samples. A significant correlation between HPyVs’ detection and a low level of CD4+ was reported. In conclusion, HPyV6, HPyV7 and QPyV seem to not have a clinical relevance in HIV-1 patients, whereas further studies are warranted to define the clinical importance of JCPyV, BKPyV and MCPyV DNA detection in these subjects.
... The detection was performed with the use of qPCR assays. In contrast, qPCR analyses of gallbladder [37], pancreas [37], intestine [106,107], appendix [106] and gastrointestinal cancers [108] indicated no trace of MCPyV genome. Another examined digestive-tractassociated cancer is colon cancer. ...
Merkel cell polyomavirus (MCPyV), the sole member of Polyomavirus associated with oncogenesis in humans, is the major causative factor of Merkel cell carcinoma (MCC), a rare, neuroendocrine neoplasia of the skin. Many aspects of MCPyV biology and oncogenic mechanisms remain poorly understood. However, it has been established that oncogenic transformation is the outcome of the integration of the viral genome into the host DNA. The high prevalence of MCPyV in the population, along with the detection of the virus in various human tissue samples and the strong association of MCPyV with the emergence of MCC, have prompted researchers to further investigate the role of MCPyV in malignancies other than MCC. MCPyV DNA has been detected in several different non-MCC tumour tissues but with significantly lower prevalence, viral load and protein expression. Moreover, the two hallmarks of MCPyV MCC have rarely been investigated and the studies have produced generally inconsistent results. Therefore, the outcomes of the studies are inadequate and unable to clearly demonstrate a direct correlation between cellular transformation and MCPyV. This review aims to present a comprehensive recapitulation of the available literature regarding the association of MCPyV with oncogenesis (MCC and non-MCC tumours).
... Following transfer, membranes were stained with 0.1% Ponceau S in 1% acetic acid to verify equal loading and successful transfer of proteins and then blocked with 5% nonfat dry milk in TBS-BGT (Tris-buffered saline containing BSA and glycine supplemented with 0.1% Tween-20). Separated and immobilized proteins were analyzed using the following primary antibodies at the indicated dilutions: β-actin (1:5000; Sigma, St. Louis, MO), COXIV (1:1000; ab33985; Abcam, Cambridge, United Kingdom), MCPyV LT (Ab3) (1:5000; [28,68]), MCPyV small/LT (Ab5) (1:5000; [28]), and pRb (1:200; sc-74570 clone H-2; Santa Cruz, Dallas, TX). To visualize immune complexes, horseradish peroxidase-conjugated secondary antibodies (1:10,000; Jackson Immunoresearch, West Grove, PA) and chemiluminescent substrate (Clarity ECL; BioRad, Hercules, CA) were applied to membranes, followed by exposure on a ChemiDoc Gel Imaging system (BioRad, Hercules, CA). ...
Clear evidence supports a causal link between Merkel cell polyomavirus (MCPyV) and the highly aggressive human skin cancer called Merkel cell carcinoma (MCC). Integration of viral DNA into the human genome facilitates continued expression of the MCPyV small tumor (ST) and large tumor (LT) antigens in virus-positive MCCs. In MCC tumors, MCPyV LT is truncated in a manner that renders the virus unable to replicate yet preserves the LXCXE motif that facilitates its binding to and inactivation of the retinoblastoma tumor suppressor protein (pRb). We previously developed a MCPyV transgenic mouse model in which MCC tumor-derived ST and truncated LT expression were targeted to the stratified epithelium of the skin, causing epithelial hyperplasia, increased proliferation, and spontaneous tumorigenesis. We sought to determine if any of these phenotypes required the association between the truncated MCPyV LT and pRb. Mice were generated in which K14-driven MCPyV ST/LT were expressed in the context of a homozygous RbΔLXCXE knock-in allele that attenuates LT-pRb interactions through LT’s LXCXE motif. We found that many of the phenotypes including tumorigenesis that develop in the K14-driven MCPyV transgenic mice were dependent upon LT’s LXCXE-dependent interaction with pRb. These findings highlight the importance of the MCPyV LT-pRb interaction in an in vivo model for MCPyV-induced tumorigenesis.
... Furthermore, blood detection of circulating T antigens targeting antibodies has been identified as a relevant tool in MCPyV-positive cases [49,53] and is now available in several countries. However, standards for MCPyV determination are not yet well established [54] and while PCR might lack specificity by detecting the wild-type episomal form of the virus, immunohistochemistry using the CM2B4 antibody can also lack sensitivity [54,55] as shown in this series. Indeed, in 25 MCPyV positive cases, an expression of the large T was observed using the AB3 antibody while CM2B4 remained negative. ...
MCC (Merkel cell carcinoma) is an aggressive neuroendocrine cutaneous neoplasm. Integration of the Merkel cell polyomavirus (MCPyV) is observed in about 80% of the cases, while the remaining 20% are related to UV exposure. Both MCPyV-positive and -negative MCCs—albeit by different mechanisms—are associated with RB1 inactivation leading to overexpression of SOX2, a major contributor to MCC biology. Moreover, although controversial, loss of RB1 expression seems to be restricted to MCPyV-negative cases.
The aim of the present study was to assess the performances of RB1 loss and SOX2 expression detected by immunohistochemistry to determine MCPyV status and to diagnose MCC, respectively.
Overall, 196 MCC tumors, 233 non-neuroendocrine skin neoplasms and 70 extra-cutaneous neuroendocrine carcinomas (NEC) were included. SOX2 and RB1 expressions were assessed by immunohistochemistry in a tissue micro-array. Diagnostic performances were determined using the likelihood ratio (LHR).
RB1 expression loss was evidenced in 27% of the MCC cases, 12% of non-neuroendocrine skin tumors and 63% of extra-cutaneous NEC. Importantly, among MCC cases, RB1 loss was detected in all MCPyV(-) MCCs, while MCPyV( +) cases were consistently RB1-positive (p < 0.001). SOX2 diffuse expression was observed in 92% of the MCC cases and almost never observed in non-neuroendocrine skin epithelial neoplasms (2%, p < 0.0001, LHR + = 59). Furthermore, SOX2 diffuse staining was more frequently observed in MCCs than in extra-cutaneous NECs (30%, p < 0.001, LHR + = 3.1).
These results confirm RB1 as a robust predictor of MCC viral status and further suggest SOX2 to be a relevant diagnostic marker of MCC.
... Several clinical and pathological factors have been investigated as potential prognosis factors in MCC with the aim to personalize treatment. Beyond clinical factors such as lymph nodes involvement or MCYpV infection (Rodig et al. 2012;Becker et al. 2009), prognosis may also be influenced by the presence and composition of tumor-infiltrating lymphocytes (TILs), highlighting the regulation of this cancer by the immune system Andea et al. 2008;Sihto and Joensuu 2012;Bichakjian et al. 2007). This is of particular interest in the context of radiation. ...
IntroductionThe aim of this study was to evaluate prognostic factors in patients with non-metastatic Merkel cell carcinoma (MCC), with a particular focus on immunological markers such as TILs subtyping (CD3, CD8, CD68, FoxP3, PD-L1 and PD-1) and MCPyV.Methods
Patients treated for a non-metastatic MCC with oncologic surgical resection followed or not by adjuvant radiotherapy between 01/2007 and 12/2018 were analyzed. Local and regional control (LC, RC), distant metastasis-free survival (DMFS) and overall survival (OS) were evaluated. Clinical variables analyzed included age, gender, performance status, comorbidity, tumor size, location and presentation type, extension, oncologic resection and adjuvant radiotherapy. Pathological variables analyzed included type of tumor-infiltrating lymphocytes, CD3, CD8, CD68, PD-L1 expression on immune cells and tumors cells, PD-1, FoxP3 and MCPyV, assessed with immunohistochemistry (IHC).Results77 patients were included. After a median follow-up of 18 months (range 0.2–144), the 1-year LC, RC, DMFS and OS were 83%, 60%, 82% and 75%, respectively. In multivariate analysis, a percentage of PD-L1 expression by immune cells ≥ 1% was significantly correlated with improvement of RC (p = 0.012), DMFS (p = 0.003) and OS (p = 0.006). Adjuvant radiotherapy significantly improved DMFS (p = 0.021) and OS (0.041) rates. There was a correlation between the presence of MCPyV + and the expression of PD-L1 on IC (p = 0.05) and TC (p = 0.03).ConclusionPD-L1 expression by immune and tumor cells in non-metastatic MCC seems to significantly improve outcome in patients who did not received PD-1/PD-L1 inhibitors. Prospective studies are needed to confirm our hypothesis.
... The skin face is the most common location at about 25%. The risk factors are sun exposure, immunosuppression and polyomavirus (MCPyV) infection; this virus can be found integrated in the genome of more than 80% of tumours 19 . MCC carcinogenesis can be initiated by the clonal integration of the MCPyV genome or UV-mediated DNA damage caused by chronic exposure to sunlight, since UV exposure could also play a part in viral carcinogenesis by causing local immunosuppression. ...
Quando è indicato un approccio chirurgico multidisciplinare nel management dei tumori primitivi cutanei non melanocitari della testa e del collo e dei tumori localmente avanzati del distretto testa-collo con interessamento della cute?
Riassunto: I tumori della pelle non melanocitari, che comprendono soprattutto il carcinoma squamocellulare e il carcinoma basocellulare, sono i tumori maligni più frequenti nella popolazione caucasica, e la cute della testa e del collo rappresenta la sede più coinvolta. Tali tumori non dovrebbero essere sottovalutati, in particolare le cosiddette lesioni ad alto rischio e i tumori cutanei avanzati richiedono un iter diagnostico più accurato e un trattamento chirurgico più aggressivo, che dovrebbe essere gestito coinvolgendo il chirurgo testa-collo, il dermatologo e il chirurgo plastico. Le neoplasie primitive cutanee del distretto testa-collo sono spesso trascurate e non sono routinariamente discusse in seno a teams chirurgici multidisciplinari. Allo stesso modo, per i tumori primari della testa e del collo con infiltrazione cutanea, il coinvolgimento del dermatologo e del chirurgo plastico può più efficacemente definire la diagnosi e pianificare il trattamento. La gestione di questi pazienti pone problemi sia terapeutici che etici, perché la prognosi infausta è gravata da importanti inestetismi facciali, ferite aperte maleodoranti e dolore intrattabile. Pertanto, anche nei pazienti con malattia avanzata non suscettibile di chirurgia radicale, la chirurgia potrebbe ugualmente trovare spazio, ma con finalità palliativa, al fine di migliorare la qualità di vita.
... This polyomavirus was found to be clonally integrated in the genome of approximately 80% of MCC tumors, 8 and in some studies using more sensitive techniques, MCPyV DNA and/or antigens can be detected in almost 100%. 9 Despite this, there is controversy over whether this virus is the driving factor for all MCC cases, and many believe that approximately 20% of MCC tumors are related to a distinct, nonviral, UV-mediated pathogenesis. 10 Regardless, both subsets of MCC appear to be intricately involved with the immune system, which early on suggested a potential role for immunotherapy in the treatment. ...
Merkel cell carcinoma (MCC) is an aggressive form of skin cancer which, while chemosensitive, has high rates of relapse and chemoresistance, limiting the impact of chemotherapy. An immunogenic tumor, the management of advanced MCC has changed dramatically with the introduction of checkpoint inhibitors. This review will focus on the impact of immunotherapy in unresectable and metastatic MCC, ongoing research in the adjuvant and neoadjuvant settings, and future directions of immune‐based strategies for this challenging cancer.
... IHC was scored as positive (cytoplasmic and/or nuclear staining in >5% of tumor cells), equivocal (blush staining), or negative. Quantitative PCR was performed on 15 ng of tumor DNA using LT2 primer/probes [18] with Taqman detection. Viral copy number was quantitated against the reference cell line MKL-2, with copy number <0.01 considered negative, as well as a negative control cell line (HEK293). ...
Purpose:
Merkel cell carcinoma (MCC) is an aggressive cutaneous neuroendocrine carcinoma that can be divided into two classes: virus-positive (VP) MCC, associated with oncogenic Merkel cell polyomavirus (MCPyV); and virus-negative (VN) MCC, associated with photodamage.
Experimental design:
We classified 346 MCC tumors from 300 patients for MCPyV using a combination of immunohistochemistry, in situ hybridization, and quantitative PCR assays. In a subset of tumors, we profiled mutation status and expression of cancer-relevant genes. MCPyV and molecular profiling results were correlated with disease-specific outcomes. Potential prognostic biomarkers were further validated by immunohistochemistry.
Results:
177 tumors were classified as VP-MCC, 151 tumors were VN-MCC, and 17 tumors were indeterminate. MCPyV positivity in primary tumors was associated with longer disease-specific and recurrence-free survival in univariate analysis, and in multivariate analysis incorporating age, sex, immune status, and stage at presentation. Prioritized oncogene or tumor suppressor mutations were frequent in VN-MCC but rare in VP-MCC. TP53 mutation developed with recurrence in one VP-MCC case. Importantly, for the first time we find that VP-MCC and VN-MCC display distinct sets of prognostic molecular biomarkers. For VP-MCC, shorter survival was associated with decreased expression of immune markers including granzyme and IDO1. For VN-MCC, shorter survival correlated with high expression of several genes including UBE2C Conclusions: MCPyV status is an independent prognostic factor for MCC. Features of the tumor genome, transcriptome, and microenvironment may modify prognosis in a manner specific to viral status. MCPyV status has clinicopathologic significance and allows for identification of additional prognostic subgroups.
... The differences in MCPyV-positive and negative MCC have been extensively researched [34], some even going as far as suggesting that MCPyV-negative MCC does not exist [35]. Our findings in gender differences in outcome may add another dimension to previous findings. ...
Simple Summary
Merkel cell carcinoma (MCC) is a rare and aggressive skin cancer which is believed to be partially caused by a virus or ultraviolet exposure. Most previous studies have shown that MCC is more common in men compared to women, virus associated MCC has a better prognosis and surgery followed by radiotherapy gives a better outcome. In this article, we explore these traits in a Swedish cohort of 113 patients and find that MCC is more common in women and female patients have a longer survival compared to male patients. In addition, we found that virus negative MCC has a worse outcome in male patients and radiotherapy after surgery gives a better outcome for patients who are treated with a curative dosage, irrespective of sex.
Abstract
Merkel cell carcinoma (MCC) is a rare and aggressive skin cancer where Merkel cell Polyomavirus (MCPyV) contributes to the pathogenesis. In an adjuvant setting, radiotherapy (RT) is believed to give a survival benefit. The prognostic impact of sex related to MCPyV-status and adjuvant RT were analyzed in patients referred to Karolinska University Hospital. Data were collected from 113 patients’ hospital records and MCPyV analyses were made in 54 patients (48%). We found a significantly better overall survival (OS) for women compared to men and a significant difference in OS in patients receiving adjuvant RT. Furthermore, we found that men with virus negative MCC have an increased risk for earlier death (HR 3.6). This indicates that MCPyV positive and negative MCC act as two different diseases, and it might be due to different mechanism in the immune response between male and female patients. This could have significance in tailoring treatment and follow-up in MCC patients in the future.
... The presence and quantity of viral DNA in FFPE sections were carried out by quantitative polymerase chain reaction (qPCR) after DNA extraction, using primer and probe, targeting sT gene, as previously described [15]. ...
Because the incidence of Merkel cell carcinoma (MCC) has increased significantly during the last 10 years and it is recognized that Merkel cell polyomavirus (MCPyV) and ultraviolet (UV) radiation represent two different etiological inputs sharing clinical, histopathological, and prognostic similar features, although with different prognosis, this study investigated the detection of MCPyV in skin and lymph nodes with histological diagnosis of MCC. Formalin-fixed paraffin-embedded tissue (FFPE) were retrieved from archived specimens and MCPyV non-coding control region (NCCR) and viral capsid protein 1 (VP1) sequences were amplified and sequenced. Results provide an interesting observation concerning the discrepancy between the MCPyV DNA status in primary and metastatic sites: in fact, in all cases in which primary and metastatic lesions were investigated, MCPyV DNA was detected only in the primary lesions. Our data further support the “hit-and-run” theory, also proposed by other authors, and may lead to speculation that in some MCCs the virus is only necessary for the process of tumor initiation and that further mutations may render the tumor independent from the virus. Few point mutations were detected in the NCCR and only silent mutations were observed in the VP1 sequence compared to the MCPyV MCC350 isolate. To unequivocally establish a role of MCPyV in malignancies, additional well-controlled investigations are required, and larger cohorts should be examined.
... Merkel cell carcinoma) [54]. Obecność Poliomawirusa związanego z komórkami Merkla potwierdza się w około 80-97% przypadków nowotworów MCC [77,78]. Infekcje wirusem MCV są bardzo często spotykane zwłaszcza u dzieci. ...
Wirusy onkogenne (onkowirusy) są zaangażowane w powstawanie około 12% nowotworów u ludzi. Obecnie wirusy, o których wiadomo, że powodują raka, to wirusy zapalenia wątroby typu C i B (HCV i HBV), wirusy brodawczaka ludzkiego (HPV), wirus polyoma komórek Merkla (MCV), ludzki herpeswirus-8 (HHV-8) i ludzki wirus limfotropowy komórek T (HTLV-1). Wirusy nie są jednak pełnymi kancerogenami i w procesie transformacji nowotworowej odgrywają różną rolę. Onkowirusy mogą bezpośrednio zakłócać funkcjonowanie genów kodujących komórkowe białka regulatorowe w wyniku insercji własnego genomu do genomu komórkowego. Mają także własne geny kodujące białka, które zaburzają regulację procesów komórkowych lub zawierają onkogeny wirusowe v-onc, które mogą brać udział bezpośrednio w rozwoju procesu nowotworowego.
... Merkel cell carcinoma (MCC) is the most aggressive skin cancer [1]. It is considered to be a predominantly virus-induced disease because (i) the genome of the Merkel cell polyomavirus (MCPyV) can be detected in the vast majority of cases [2], (ii) a monoclonal integration of the virus in the genome of the tumor cells implies that integration occurred before tumor development, and (iii) MCPyV-positive MCC cells depend on expression of the virus-encoded T antigens [3]. ...
Merkel cell carcinoma (MCC) is an aggressive skin cancer frequently caused by the Merkel cell polyomavirus (MCPyV), and proliferation of MCPyV-positive MCC tumor cells depends on the expression of a virus-encoded truncated Large T antigen (LT) oncoprotein. Here, we asked in which phases of the cell cycle LT activity is required for MCC cell proliferation. Hence, we generated fusion-proteins of MCPyV-LT and parts of geminin (GMMN) or chromatin licensing and DNA replication factor1 (CDT1). This allowed us to ectopically express an LT, which is degraded either in the G1 or G2 phase of the cell cycle, respectively, in MCC cells with inducible T antigen knockdown. We demonstrate that LT expressed only in G1 is capable of rescuing LT knockdown-induced growth suppression while LT expressed in S and G2/M phases fails to support proliferation of MCC cells. These results suggest that the crucial function of LT, which has been demonstrated to be inactivation of the cellular Retinoblastoma protein 1 (RB1) is only required to initiate S phase entry.
Importance
Merkel cell carcinoma (MCC) is a rare but aggressive skin cancer. Quantifying the contribution of major potentially modifiable risk factors to the burden of MCC may inform prevention efforts.
Objective
To estimate the population attributable fraction of MCC cases in the US that were attributable to major immunosuppressing conditions (eg, HIV, solid organ transplant, chronic lymphocytic leukemia [CLL]), ambient UV radiation [UVR] exposure, and Merkel cell polyomavirus [MCPyV]).
Design, Setting, and Participants
This epidemiological assessment combined data from population-based registries and case series and included cases of MCC that were diagnosed from January 2001 to December 2019 diagnosed in people with HIV, solid organ transplant recipients, and patients with CLL who were identified through population-based cancer registries and linkages with HIV and transplant registries. UVR-based on cloud-adjusted daily ambient UVR irradiance was merged with cancer registry data on the county of residence at diagnosis. Studies reporting the prevalence of MCPyV in MCC specimens collected in the US were combined via a meta-analysis.
Exposures
HIV, solid organ transplant, CLL, UVR, and MCPyV.
Main Outcomes and Measures
Population attributable fraction of MCC cases attributable to major risk factors.
Results
A total of 38 020 MCCs were diagnosed in the US among xx patients (14 325 [38%] female individuals; 1586 [4%] Hispanic, 561 [1%] non-Hispanic Black, and 35 171 [93%] non-Hispanic White individuals). Compared with the general US population, MCC incidence was elevated among people with HIV (standardized incidence ratio [SIR], 2.78), organ transplant recipients (SIR, 13.1), and patients with CLL (SIR, 5.75). Due to the rarity of these conditions, only 0.2% (95% CI, 0.1%-0.3%) of MCC cases were attributable to HIV, 1.5% (95% CI, 1.4%-1.7%) to solid organ transplant, and 0.8% (95% CI, 0.5%-1.3%) to CLL. Compared with individuals of racial and ethnic minority groups, MCC incidence was elevated among non-Hispanic White individuals at lower and higher ambient UVR exposure levels (incidence rate ratios: 4.05 and 4.91, respectively, for MCC on the head and neck). Overall, 65.1% (95% CI, 63.6%-66.7%) of MCCs were attributable to UVR. Based on a meta-analysis of 19 case series, 63.8% (95% CI, 54.5%-70.9%) of MCCs were attributable to MCPyV. Studies were identified from a MEDLINE search performed on October 12, 2023.
Conclusions and Relevance
The results of this study suggest that most MCC cases in the US were attributable to ambient UVR exposure or MCPyV, with a small fraction due to immunosuppressive conditions. Efforts to lower MCC incidence could focus on limiting UVR exposure.
Pathology is pivotal in diagnosing skin tumors, and the precision of diagnosis is crucial to devise customized treatment plans and enhance patient care in dermatology. The latest edition of the World Health Organization's classification of skin tumors serves as a comprehensive compendium, summarizing and categorizing all recent advancements in both anatomical-pathological and molecular aspects of cutaneous neoplasms. Several relevant advances have been introduced and new entities have been described. While the fundamental structure of the classification remains unchanged, notable additions include three new sections aimed at providing a more exhaustive description of skin lesions: nail unit tumors, skin metastases, and genetic tumor syndromes associated with skin malignancies. Recent strides in molecular pathology have led to significant breakthroughs in decoding the underlying mechanisms of various skin tumors, ranging from adnexal neoplasms to hematolymphoid neoplasms, soft tissue tumors, and melanocytic lesions. Of particular importance is the evolution in our understanding of melanocytic neoplasms, with the introduction of the term "melanocytoma" reserved for lesions exhibiting "intermediate" biological behavior and characterized by specific molecular mutations. The pathologic diagnosis process integrates morphological, immunohistochemical, and molecular features, playing a crucial role in clinical decision-making. The WHO classification serves as a valuable tool in promoting multidisciplinarity in the management of cutaneous neoplasms with the aim of translating novel pathological discoveries into more effective treatments. This review aims to distill the major updates introduced by the new classification, providing a synthesis of the latest scientific insights.
Background
Merkel cell carcinoma (MCC) is an aggressive cancer with often poor outcomes. Limited biomarkers exist for predicting clinical outcomes. The Merkel cell polyomavirus (MCPyV) serum antibody test (AMERK) has shown potential for indicating better recurrence‐free survival in a single‐institution study. The study aimed to evaluate the link between initial AMERK serostatus and survival. Secondary objectives included examining the relationship between initial AMERK titer levels and tumor burden.
Methods
A retrospective cohort study across two institutions analyzed patients tested with AMERK within 90 days of MCC diagnosis. Regression models assessed the association of survival outcomes with serostatus, considering various factors. The relationship between AMERK titer and tumor burden indicators was evaluated using ANOVA. Significance testing was exploratory, without a fixed significance level.
Results
Of 261 MCC patients tested, 49.4% were initially seropositive (titer ≥75). Multivariable analysis showed that seropositivity improved recurrence, event‐free, overall, and MCC‐specific survival rates. Strong associations were found between initial AMERK titer and clinical, tumor, and nodal stages, tumor size, and disease extent. Notably, improved survival with seropositivity was observed only in patients with localized disease at initial presentation.
Conclusion
Circulating antibodies to MCPyV oncoproteins, as indicated by the AMERK test, are linked with better survival in MCC patients with localized disease at presentation. This could enhance patient risk profiling and treatment personalization. The study's retrospective nature and exploratory analysis are key limitations.
Plain Language Summary
Merkel cell carcinoma (MCC) is a potentially aggressive skin cancer, and tools to predict patient outcomes are limited.
A blood test called anti‐Merkel cell panel (AMERK), which checks for specific antibodies related to this cancer, might give us some clues.
In this study, we looked at 261 MCC patients who took the AMERK test within 90 days of diagnosis.
We found that patients with an initial positive AMERK result tended to have better outcomes, especially if their cancer was in the early stages.
However, it is important to note that this study has limitations, including using retrospective data and exploratory analyses.
Карцинома Меркеля (КМ) — редкая и агрессивная немеланомная опухоль кожи. Пациенты с данной патологией имеют кране неблагоприятный прогноз и низкие показатели 5-летней выживаемости. На сегодняшний день основными методами лечения являются хирургическое вмешательство, лучевая терапия и лекарственная терапия. Развитие новых опций иммунотерапии значимо увеличивает показатели ОВ и ВБП. На данном этапе активно применяется использование пембролизумаба, авелумаба, ниволумаба в лечении распространенной и метастической КМ. Также ведутся исследования ниволумаба в неоадъювантном и адъвантном режимах у пациентов с КМ, которые уже демонстрируют положительные результаты. Важно отметить, что исследователи не ограничиваются на изучении иммунотерапии в монорежиме, но и рассматривают ее сочетание, например, с иммуномодулирующими препаратами, онколитическими вирусами и адаптивной клеточной терапией.
Skin disease due to viruses may be a primary infection of the epidermis or may arise secondary to systemic infection. Depending on the virus, the effects may be necrotic damage of the infected cells, proliferation and tumour formation or inflammation without major skin cell damage. The features of DNA and RNA virus infections and their skin manifestations are covered in this chapter.
Merkel cell carcinoma (MCC), a rare but aggressive skin cancer, remains a challenge in the era of precision medicine. Immune checkpoint inhibitors (ICIs), the only approved therapy for advanced MCC, are impeded by high primary and acquired resistance. Hence, we dissect transcriptomic heterogeneity at single-cell resolution in a panel of patient tumors, revealing phenotypic plasticity in a subset of treatment-naive MCC. The tumor cells in a "mesenchymal-like" state are endowed with an inflamed phenotype that portends a better ICI response. This observation is also validated in the largest whole transcriptomic dataset available from MCC patient tumors. In contrast, ICI-resistant tumors predominantly express neuroepithelial markers in a well-differentiated state with "immune-cold" landscape. Importantly, a subtle shift to "mesenchymal-like" state reverts copanlisib resistance in primary MCC cells, highlighting potential strategies in patient stratification for therapeutics to harness tumor cell plasticity, augment treatment efficacy, and avert resistance.
Viruses have been frequently identified in several human neoplasms, but the etiological role of these viruses in some tumors is still a matter of controversy. Polyomaviruses stand out among the main viruses with oncogenic capacity, specifically the Merkel cell polyomavirus (MCPyV). Recent revisions in the taxonomy of polyomaviruses have divided the Polyomaviridae family into six genera, including 117 species, with a total of 14 currently known human-infecting species. Although the oncogenicity of polyomaviruses has been widely reported in the literature since 1950, the first description of a polyomavirus as an etiological agent of a neoplasm in humans was made only in 2008 with the description of MCPyV, present in approximately 80% of cases of Merkel cell carcinoma (MCC), with the integration of its genome to that of the tumor cells and tumor-specific mutations, and it is considered the etiological agent of this neoplasm since then. MCPyV has also been detected in keratinocyte carcinomas, such as basal cell carcinoma and squamous cell carcinoma of the skin in individuals with and without immunosuppression. Data on the occurrence of oncogenic viruses potentially involved in oncogenesis, which cause persistence and tissue injury, related to the Merkel cell polyomavirus are still scarce, and the hypothesis that the Merkel cell polyomavirus may play a relevant role in the genesis of other cutaneous carcinomas in addition to MCC remains debatable. Therefore, the present study proposes to explore the current knowledge about the presence of MCPyV in keratinocyte carcinomas.
Merkel cell carcinoma (MCC) is an uncommon primary cutaneous neuroendocrine carcinoma associated with an adverse prognosis. In recent years, our understanding of MCC biology has markedly progressed. Since the discovery of the Merkel cell polyomavirus, it has become clear that MCC represents an ontogenetically dichotomous group of neoplasms with overlapping histopathology. Specifically, most MCCs arise secondary to viral oncogenesis, while a smaller subset is the direct result of UV-associated mutations. The distinction of these groups bears relevance in their immunohistochemical and molecular characterization, as well as in disease prognosis. Further recent developments relate to the landmark utilization of immunotherapeutics in MCC, providing optimistic options for the management of this aggressive disease. In this review, we discuss both fundamental and emerging concepts in MCC, with particular focus on topics of practical relevance to the surgical or dermatopathologist.
Purpose
Merkel cell polyomavirus (MCPyV) infection is a known to be a critical risk factor for the development of Merkel cell carcinoma (MCC). Various reports on cutaneous MCC have shown that the differences in clinicohistopathological characteristics depend on the presence of MCPyV, but the situation in eyelid MCC is unknown. This study aimed to assess the prevalence of MCPyV in patients with eyelid MCC and examine the clinicohistopathological characteristics of MCPyV-associated eyelid MCC.
Design
Retrospective observational case series with laboratory investigations
Methods
Ten patients treated for eyelid MCC were included. Histopathological characteristics were examined by immunohistochemical staining using 12 antibodies. MCPyV infection was evaluated by PCR using primer set targeting large T antigen of MCPyV genome and by immunohistochemical staining using CM2B4 and Ab3 monoclonal antibodies. MCPyV viral load was also quantified by PCR using three primer sets.
Results
All patients (4 males and 6 females) were Japanese with mean age of 79 (range: 63 to 87) years. One patient died due to distant metastasis 8 months after surgery for MCC. Immunohistochemical studies showed typical MCC findings in all cases, including CK20 and neuroendocrine marker positivity. PCR and immunohistochemistry with CM2B4 and Ab3 detected MCPyV antigen in all tumors. Quantitative PCR using sT, LT4 and TAg primers yielded 0.94, 1.72 and 1.05 copies per cell, respectively.
Conclusion
Clinical and histopathological characteristics of ten patients with eyelid MCC were elucidated. MCPyV infection was detected in all the eyelid MCC studied. These results provide insight for understanding the tumorigenesis of eyelid MCC.
The prevalence of Merkel cell polyomavirus(MCPyV) in Merkel cell carcinoma(MCC) and non-MCC skin lesions and its possible role in the etiology of other skin diseases remain controversial. To systematically assess the association between MCPyV infection and MCC, non-MCC skin lesions, and normal skin. For this systematic review and meta-analysis, a comprehensive search for eligible studies was conducted using Medline Ovid, Pubmed, Web of Science, and the Cochrane CENTRAL databases until August 2021; references were searched to identify additional studies. Observational studies that investigated the association between MCPyV infection and MCC, non-MCC skin lesions, and normal skin using polymerase chain reaction(PCR) as a detection method and provided sufficient data to calculate the prevalence of MCPyV positivity. A total of 50 articles were included in the study after exclusion criteria were applied. Two reviewers independently reviewed and assessed the eligibility of the studies, and all disagreements were resolved by consensus. To determine the association between MCPyV and MCC, overall odds ratio (OR) were calculated with 95% CI using a random-effects model. Single-arm meta-analyses were performed to examine the prevalence rate of MCPyV+ in MCC, non-MCC skin lesions, and normal skin. The primary analysis was the prevalence rate of MCPyV+ in MCC. Secondary outcomes included the prevalence rate of MCPyV+ in non-MCC skin lesions and normal skin. A total of 50 studies involving 5428 patients were reviewed based on our inclusion and exclusion criteria. Compared with the control group, MCPyV infection was significantly associated with MCC (OR = 3.51, 95% CI = 2.96 - 4.05). The global prevalence of MCPyV+ in MCC, melanoma, squamous cell carcinoma, basal cell carcinoma, Bowen’s disease, actinic keratosis, keratoacanthoma, seborrheic keratosis, and normal skin was 80%, 4%, 15%, 15%, 21%, 6%, 20%, 10%, and 11%, respectively. The current results suggest that MCPyV infection is significantly associated with an increased risk of MCC. However, the low prevalence rate of MCPyV+ in non-MCC skin lesions does not exclude a pathogenic association of this virus with the development of non-MCC skin lesions.
Polycomb repressive complex 2 (PRC2) has a critical role in the maintenance of bivalent promoters and is often perturbed in cancer, including neuroendocrine tumors. Here we investigate the susceptibility of Merkel cell carcinoma (MCC), a neuroendocrine carcinoma of the skin, to inhibitors of the PRC2 catalytic subunit EZH2. We show that a subset of MCC cell lines is sensitive to EZH2 inhibitor-induced cell viability loss. We find that inhibitor treatment of susceptible cells derepresses the PRC2 target SIX1, a transcription factor in the PAX-SIX-EYA-DACH network (PSEDN) normally involved in inner ear hair cell development, and that PSEDN transcription factors are critical contributors to EZH2 inhibitor-induced MCC cell viability loss. Furthermore, we show the EZH2 inhibitor tazemetostat slows the growth of MCC xenografts and derepresses SIX1 and its downstream inner ear target gene MYO6 in vivo. We propose that EZH2 inhibition in MCC leads to SIX1 derepression, with dysregulation of hearing-related transcriptional programs and growth inhibition. This study provides evidence that MCC tumors may be specifically susceptible to EZH2 inhibitors while giving mechanistic insight into the transcriptional programs these inhibitors perturb in MCC, and potentially in other neuroendocrine cancers.
Merkel cell carcinoma (MCC) is a rare cutaneous neuroendocrine carcinoma of uncertain origin. MCC incidence varies by country and has been increasing among white populations over the last three decades. MCC occurs most commonly in elderly men and typically arises on sun-exposed areas. It is associated with a high mortality rate due to rapid growth and significant metastatic potential. Clinical and histopathological diagnosis are challenging, but prompt recognition of the disease is imperative for a correct management. Several hypotheses have been proposed to define the cell of origin, which still remains controversial. The discovery of Merkel cell polyoma virus, identified in the majority of MCCs, led to the hypothesis of the existence of two tumour subtypes showing biological, clinico-pathological and prognostic differences. Significant interest is nowadays directed to characterize MCC genomic alterations and microRNA (miRNA) expression profiles. Current treatment strategies for MCC depend on staging, and typically consist of surgery, radiation therapy, chemotherapy and/or, more recently, immunotherapy. The aim of this review is to provide an updated overview of MCC with a special focus on clinico-pathological aspects, molecular-genetics and therapy.
Merkel cell carcinoma is an aggressive skin cancer frequently caused by the Merkel cell polyomavirus (MCPyV). Since proliferation of MCPyV-positive MCC tumor cells strictly depends on expression of the virus-encoded T antigens (TA), these proteins theoretically represent ideal targets for different kinds of therapeutic approaches. Here we developed a cell-based assay to identify compounds which specifically inhibit growth of MCC cells by repressing TA expression. Applying this technique we screened a kinase inhibitor library and identified six compounds targeting glycogen synthase kinase 3 (GSK3) such as CHIR99021 as suppressors of TA transcription in MCC cells. Involvement of GSK3α and -β in the regulation of TA-expression was confirmed by combining GSK3A knockout with inducible GSK3B shRNA knockdown since double knockouts could not be generated. Finally, we demonstrate that CHIR99021 exhibits in vivo antitumor activity in an MCC xenograft mouse model suggesting GSK3 inhibitors as potential therapeutics for the treatment of MCC in the future.
Nodal fine needle aspiration (FNA) is usually the first procedure in the work‐up of malignancy of unknown primary. Merkel cell carcinoma (MCC) is an aggressive cutaneous cancer more common in Caucasians but rare among Asians. It is a diagnostic challenge in evaluating FNA from a metastatic MCC without the knowledge of a current or prior history of skin cancer. We report the case of a Taiwanese male with cervical and axillary masses. The diagnosis of the FNA from the axillary lymph node was lymphoproliferative lesion suspicious for lymphoma. The histopathological evaluation of nodal biopsy revealed a metastatic neuroendocrine carcinoma and the subsequent excision of the right palm tumor confirmed MCC. Retrospective review of the FNA and imprint cytology smears of the nodal biopsy showed nuclear molding, Indian filing and rare cytoplasmic pale bodies, but no lymphoglandular bodies. Cytologically metastatic MCC may mimic small round cell tumor including lymphoma, we consider these three cytological features as additional diagnostic clues for metastatic MCC. In this report, we present the cytologic and pathological features of this metastatic MCC and discuss the differential diagnosis of the cytologic mimickers.
Neuroendocrine neoplasms (NENs) are a heterogeneous group of neoplasms which represent a true challenge for clinicians. Their incidence and prevalence have been increasing over the past years partly due to increased awareness and improvements in instrumental diagnostic techniques so that a growing number of clinicians are facing this disease. Management of NEN represents a clinical challenge because of its late presentation, scarcity of standardized guidelines, and limitations in imaging modalities and biomarkers to guide management. The beginning of the diagnostic process of NENs is often based on the measurement of circulating markers, before planning expensive and invasive diagnostic tests; however up to 60–80% of NENs are metastatic at diagnosis, which highlights the frequent failure to identify symptoms or to establish a biochemical diagnosis. Classical available markers, which can be divided into general and specific biomarkers, often lack sensitivity and/or specificity and need to be interpreted in the diagnostic process. Therefore, it is very important to know the advantages and limitations of these diagnostic tools. On the other hand, new biomarkers are emerging in the scenario of molecular diagnostics. This chapter aims to review the different characteristics of the available biomarkers, exposing the strengths and limitations of each, for their best clinical use.
Merkel cell carcinoma is a rare, highly aggressive primary cutaneous tumor, predominantly affecting older patients.
Merkel Cell polyomavirus (MCPyV) is the only member of the Polyomaviridae family that is directly linked to a type of human cancer, Merkel Cell Carcinoma (MCC). Predominantly, the clinical significance of MCPyV is due to the aggressive nature of MCC with a low survival rate and, presently, unavailability of a comprehensive and effective treatment regime. Secondly, the molecular mechanisms of MCPyV infection and oncogenic potential are currently poorly understood. Despite MCPyV ubiquitously infects humans, studies suggest that MCC is caused only after prolonged infection and integration of MCPyV DNA in the host genome. Mechanistically, transformation of normal cells into cancerous by MCPyV is mainly driven by truncated LT and sT antigens and the abnormal molecular modulation they carry out. Presently, conventional treatment options against MCC like surgery, radiotherapy and chemotherapy are on board, but, with limitations that pose them inadequate. However, modern treatment options are emerging which, in preliminary investigation, show great promise. However, extensive exploration needs to be carried out before their large scale acceptance and application as therapies against MCC.
Objectives
Merkel cell carcinoma (MCC) is a rare and aggressive neuroendocrine tumor with limited evidence on the role of ¹⁸F-FDG PET/CT. The aim of this study was to assess the impact of the ¹⁸F-FDG PET/CT in the management of MCC.
Methods
Fifty-one studies of ¹⁸F-FDG PET/CT of 35 patients (19 men [54.30%]; 72.17 ± 14.63 years) with histologic diagnosis of MCC were retrospectively evaluated. The change in tumor staging and the impact on the treatment were analysed.
Results
There were 23 PET/CT positive studies (45.10%) and 28 (54.90%) negative. Thirty four (66.7%) studies were performed for assessment of stage at initial presentation and 17 (33.3%) were performed during the follow up: 6 (35.29%) for suspected recurrence; 7 (41.18%) for restaging; 4 (23.53%) as a part of ongoing surveillance. On the basis of PET/CT results, there was a change in disease stage (SC) in 20 studies (39.20%) and impact in the management (MI) in 28 (54.90%): 11 (32.40%) SC and 12 (35.30%) MI in the initial staging; 5 (71.43%) SC and 7 (100%) MI in the restaging; 3 (50%) SC and 6 (100%) MI in suspected recurrence; 1 (25%) SC and 3 (75%) MI in the surveillance. ¹⁸F-FDG PET/CT incidentally detected one additional histologically confirmed cancer. The presence of nodal involvement in the beginning (0.0098; HR 3.82; 95% CI: 1.38–10.6), chemotherapy treatment (6e−04; HR 7.06; 95% CI: 2.30–21.60), size of primary tumor >2 cm (6e−04; HR 7.06; 95% CI: 2.30–21.60) and positive resection margin (0.00069; HR 4.01; 95% CI: 1.46–11.00) were statistically significant prognostic factors for overall survival. There was a trend towards significance for worse overall survival with initial positive ¹⁸F-FDG PET/CT but the trend did not reach statistical significance.
Conclusion
¹⁸F-FDG PET/CT altered the stage in 2 out of 5 studies and changed the treatment in more than half of the studies performed. The study confirms the important impact of ¹⁸F-FDG PET/CT on the management of MCC patients.
Objectives:
Merkel cell carcinoma (MCC) is a rare and aggressive neuroendocrine tumor with limited evidence on the role of 18F-FDG PET/CT. The aim of this study was to assess the impact of the 18F-FDG PET/CT in the management of MCC.
Methods:
Fifty-one studies of 18F-FDG PET/CT of 35 patients (19 men [54.30%]; 72.17±14.63years) with histologic diagnosis of MCC were retrospectively evaluated. The change in tumor staging and the impact on the treatment were analysed.
Results:
There were 23 PET/CT positive studies (45.10%) and 28 (54.90%) negative. Thirty four (66.7%) studies were performed for assessment of stage at initial presentation and 17 (33.3%) were performed during the follow up: 6 (35.29%) for suspected recurrence; 7 (41.18%) for restaging; 4 (23.53%) as a part of ongoing surveillance. On the basis of PET/CT results, there was a change in disease stage (SC) in 20 studies (39.20%) and impact in the management (MI) in 28 (54.90%): 11 (32.40%) SC and 12 (35.30%) MI in the initial staging; 5 (71.43%) SC and 7 (100%) MI in the restaging; 3 (50.00%) SC and 6 (100%) MI in suspected recurrence; 1 (25.00%) SC and 3 (75.00%) MI in the surveillance. 18F-FDG PET/CT incidentally detected one additional histologically confirmed cancer. The presence of nodal involvement in the beginning (0.0098; HR 3.82; 95%CI: 1.38-10.6), chemotherapy treatment (6e-04; HR 7.06; 95%CI: 2.30-21.60), size of primary tumor >2cm (6e-04; HR 7.06; 95%CI: 2.30-21.60) and positive resection margin (0.00069; HR 4.01; 95%CI: 1.46-11.00) were statistically significant prognostic factors for overall survival. There was a trend towards significance for worse overall survival with initial positive 18F-FDG PET/CT but the trend did not reach statistical significance.
Conclusion:
18F-FDG PET/CT altered the stage in 2 out of 5 studies and changed the treatment in more than half of the studies performed. The study confirms the important impact of 18F-FDG PET/CT on the management of MCC patients.
Merkel cell polyomavirus (MCPyV) causes the majority of human Merkel cell carcinomas (MCC), a rare but highly aggressive form of skin cancer. We recently reported that constitutive expression of MCC tumor-derived MCPyV tumor (T) antigens in the skin of transgenic mice leads to hyperplasia, increased proliferation, and spontaneous epithelial tumor development. We sought to evaluate how the MCPyV T antigens contribute to tumor formation in vivo using a classical, multi-stage model for squamous cell carcinoma development. In this model, two chemical carcinogens, DMBA and TPA, contribute to two distinct phases of carcinogenesis—initiation and promotion, respectively—that are required for tumors to develop. By treating the MCPyV transgenic mice with each chemical carcinogen, we determined how the viral oncogenes contributed to carcinogenesis. We observed that the MCPyV T antigens synergized with the tumor initiator DMBA, but not with the tumor promoter TPA, cause tumors. Therefore, the MCPyV tumor antigens function primarily as tumor promoters, similar to that seen with human papillomavirus (HPV) oncoproteins. These studies provide insight into the role of MCPyV T antigen expression in tumor formation in vivo and contribute to our understanding of how MCPyV may function as a human DNA tumor virus.
Resumen
En numerosas situaciones clínicas, el dermatólogo tiene que pensar en una etiología vírica, puesto que la semiología de las infecciones víricas es muy variada. El diagnóstico virológico dermatológico recurre a las diferentes técnicas disponibles, en especial las técnicas serológicas y la biología molecular. Estas técnicas se muestran aquí y se expone su interés en función de las diferentes situaciones clínicas. Según el virus causal, se presentan los métodos diagnósticos y sus indicaciones. La prescripción de los exámenes virológicos, numerosos, a veces complejos y costosos, siempre debe guiarse por la clínica; son útiles únicamente si el diagnóstico no es evidente y si la identificación del virus causal tiene una consecuencia práctica para el paciente. El diálogo entre el médico clínico y el virólogo es primordial para elegir el examen adecuado, en el mejor momento y para interpretar el resultado.
Increasing evidence suggests that Merkel cell carcinoma (MCC) is caused by the Merkel cell polyoma virus (MCV). The viral sequence encodes for two potential oncoproteins, i.e. the small T antigen (sT) and the Large T antigen (LT). Indeed, sT has recently been shown to bear transforming activity. Here, we confirm this observation by demonstrating focus formation upon expression of MCV sT in NIH3T3 fibroblasts. On the other hand, however, we provide evidence that established MCC cells do not require sT for growth and survival. Silencing of sT protein expression by two different sT specific shRNAs leads to variable degrees of growth retardation in MCV-positive MCC cell lines. However, these effects are not sT-specific since proliferation of MCV-negative cell lines is similarly affected by these sT shRNAs. Furthermore, ectopic expression of shRNA-insensitive sT does not revert the growth inhibition implicated by sT silencing. Finally, the unambiguous and specific growth inhibition induced by means of an shRNA targeting both T antigens, can be completely rescued by ectopic expression of LT alone, thus demonstrating a dispensable role of sT. Altogether, our results indicate that MCV LT is more relevant in maintaining the proliferation and survival of established MCC cell lines.Journal of Investigative Dermatology accepted article preview online, 25 February 2013; doi:10.1038/jid.2013.82.
Merkel cell carcinoma (MCC) is a highly aggressive skin cancer with an increasing incidence. The understanding of the molecular carcinogenesis of MCC is limited. Here, we scrutinized the PI3K/AKT pathway, one of the major pathways activated in human cancer, in MCC. Immunohistochemical analysis of 41 tumor tissues and 9 MCC cell lines revealed high levels of AKT phosphorylation at threonine 308 in 88% of samples. Notably, the AKT phosphorylation was not correlated with the presence or absence of the Merkel cell polyoma virus (MCV). Accordingly, knock-down of the large and small T antigen by shRNA in MCV positive MCC cells did not affect phosphorylation of AKT. We also analyzed 46 MCC samples for activating PIK3CA and AKT1 mutations. Oncogenic PIK3CA mutations were found in 2/46 (4%) MCCs whereas mutations in exon 4 of AKT1 were absent. MCC cell lines demonstrated a high sensitivity towards the PI3K inhibitor LY-294002. This finding together with our observation that the PI3K/AKT pathway is activated in the majority of human MCCs identifies PI3K/AKT as a potential new therapeutic target for MCC patients.
Merkel cell carcinoma (MCC) is an aggressive cutaneous neuroendocrine tumor, often metastatic at presentation, for which current chemotherapeutic regimens are largely ineffective. As its pathogenesis is still unknown, we hypothesized that deregulation of signaling pathways commonly activated in cancer may contribute to MCC tumorigenesis and may provide insights into targeted therapy approaches for this malignancy.
We retrospectively profiled 60 primary MCC samples using a SNaPshot-based tumor genotyping assay to screen for common mutations in 13 cancer genes.
We identified mutations in 9 (15%) MCC primary tumors, including mutations in TP53 (3 of 60) and activating mutations in the PIK3CA gene (6 of 60). Sanger sequencing of the primary MCC tumors detected one additional PIK3CA mutation (R19K) that had not been previously described in cancer. Merkel cell polyoma virus (MCPyV) was detected in 38 (66%) MCC cases and patients with MCPyV-positive cancers showed a trend toward better survival. With one exception, the presence of MCPyV and activating mutations in PIK3CA appeared mutually exclusive. We observed that signaling through the PI3K/pAKT pathway was active in one MCPyV-positive and in all MCPyV-negative MCC cell lines, as evidenced by AKT phosphorylation. Importantly, the presence of a PIK3CA-activating mutation was associated with sensitivity to treatment with ZST474, a specific phosphoinositide 3-kinase (PI3K) inhibitor, and to NVP-BEZ235, a dual PI3K/mTOR inhibitor, targeted agents under active clinical development.
PI3K pathway activation may drive tumorigenesis in a subset of MCC and screening these tumors for PIK3CA mutations could help identify patients who may respond to treatment with PI3K pathway inhibitors.
Epithelial ovarian cancer is the most lethal of all gynecologic malignancies, and high grade serous ovarian cancer (HGSC) is the most common subtype of ovarian cancer. The objective of this study was to determine the frequency and types of point somatic mutations in HGSC using a mutation detection protocol called OncoMap that employs mass spectrometric-based genotyping technology.
The Center for Cancer Genome Discovery (CCGD) Program at the Dana-Farber Cancer Institute (DFCI) has adapted a high-throughput genotyping platform to determine the mutation status of a large panel of known cancer genes. The mutation detection protocol, termed OncoMap has been expanded to detect more than 1000 mutations in 112 oncogenes in formalin-fixed paraffin-embedded (FFPE) tissue samples. We performed OncoMap on a set of 203 FFPE advanced staged HGSC specimens. We isolated genomic DNA from these samples, and after a battery of quality assurance tests, ran each of these samples on the OncoMap v3 platform. 56% (113/203) tumor samples harbored candidate mutations. Sixty-five samples had single mutations (32%) while the remaining samples had ≥ 2 mutations (24%). 196 candidate mutation calls were made in 50 genes. The most common somatic oncogene mutations were found in EGFR, KRAS, PDGRFα, KIT, and PIK3CA. Other mutations found in additional genes were found at lower frequencies (<3%).
Sequenom analysis using OncoMap on DNA extracted from FFPE ovarian cancer samples is feasible and leads to the detection of potentially druggable mutations. Screening HGSC for somatic mutations in oncogenes may lead to additional therapies for this patient population.
Merkel cell polyomavirus (MCV) is the recently discovered cause of most Merkel cell carcinomas (MCCs), an aggressive form of nonmelanoma skin cancer. Although MCV is known to integrate into the tumor cell genome and to undergo mutation, the molecular mechanisms used by this virus to cause cancer are unknown. Here, we show that MCV small T (sT) antigen is expressed in most MCC tumors, where it is required for tumor cell growth. Unlike the closely related SV40 sT, MCV sT transformed rodent fibroblasts to anchorage- and contact-independent growth and promoted serum-free proliferation of human cells. These effects did not involve protein phosphatase 2A (PP2A) inhibition. MCV sT was found to act downstream in the mammalian target of rapamycin (mTOR) signaling pathway to preserve eukaryotic translation initiation factor 4E-binding protein 1 (4E-BP1) hyperphosphorylation, resulting in dysregulated cap-dependent translation. MCV sT-associated 4E-BP1 serine 65 hyperphosphorylation was resistant to mTOR complex (mTORC1) and mTORC2 inhibitors. Steady-state phosphorylation of other downstream Akt-mTOR targets, including S6K and 4E-BP2, was also increased by MCV sT. Expression of a constitutively active 4E-BP1 that could not be phosphorylated antagonized the cell transformation activity of MCV sT. Taken together, these experiments showed that 4E-BP1 inhibition is required for MCV transformation. Thus, MCV sT is an oncoprotein, and its effects on dysregulated cap-dependent translation have clinical implications for the prevention, diagnosis, and treatment of MCV-related cancers.
Merkel cell polyomavirus (MCV), a previously unrecognized component of the human viral skin flora, was discovered as a mutated and clonally-integrated virus inserted into Merkel cell carcinoma (MCC) genomes. We reconstructed a replicating MCV clone (MCV-HF), and then mutated viral sites required for replication or interaction with cellular proteins to examine replication efficiency and viral gene expression. Three days after MCV-HF transfection into 293 cells, although replication is not robust, encapsidated viral DNA and protein can be readily isolated by density gradient centrifugation and typical ∼40 nm diameter polyomavirus virions are identified by electron microscopy. The virus has an orderly gene expression cascade during replication in which large T (LT) and 57kT proteins are first expressed by day 2, followed by expression of small T (sT) and VP1 proteins. VP1 and sT proteins are not detected, and spliced 57kT is markedly diminished, in the replication-defective virus suggesting that early gene splicing and late gene transcription may be dependent on viral DNA replication. MCV replication and encapsidation is increased by overexpression of MCV sT, consistent with sT being a limiting factor during virus replication. Mutation of the MCV LT vacuolar sorting protein hVam6p (Vps39) binding site also enhances MCV replication while exogenous hVam6p overexpression reduces MCV virion production by >90%. Although MCV-HF generates encapsidated wild-type MCV virions, we did not find conditions for persistent transmission to recipient cell lines suggesting that MCV has a highly restricted tropism. These studies identify and highlight the role of polyomavirus DNA replication in viral gene expression and show that viral sT and cellular hVam6p are important factors regulating MCV replication. MCV-HF is a molecular clone that can be readily manipulated to investigate factors affecting MCV replication.
MCC, Merkel cell carcinoma; MCPyV, Merkel cell polyomavirus
MCC, Merkel cell carcinoma; MCPyV, Merkel cell polyomavirus
In the general population Merkel's cell carcinoma (MCC) is an aggressive neuroendocrine skin cancer. More than 600 cases have been reported. MCC seems to be common in transplant recipients, with 41 cases being reported to the Cincinnati Transplant Tumor Registry, and another 11 in the transplant literature. In the general population, it is a disease of older adults, with only 51% of cases occurring below the age of 50 years. In transplant patients, the mean age at diagnosis was 53 (range 33-78) years, and 29% of recipients were <50 years old. The tumor appeared from 5 to 286 (mean 91.5) months after the transplant. Of 44 lesions that occurred in 41 patients, the distribution was similar to that seen in the general population, with 36% occurring on the head and neck, 32% on the upper extremities, 16% on the trunk, 9% at unknown sites, and 7% on the lower extremities. Twenty of the patients (49%) had 22 other malignancies, the great majority of which (91%) were other skin cancers. Treatment depended on the stage of the disease and included wide surgical excision, radical lymph node dissection, radiation therapy, and chemotherapy. In transplant patients, MCC probably proved to be more aggressive than in the general population in that 68% of patients developed lymph node metastases and 56% died of their malignancies. Furthermore, one third of surviving patients still have active cancers from which they may die. Also, follow-up of survivors has been relatively short, with a mean of only 18 (range 0-135) months.
Merkel cell carcinoma (MCC) is rare skin cancer that is often associated with Merkel cell polyomavirus (MCPyV) infection. Polyomaviruses repress tumor suppressor proteins, thus influencing cell-cycle progression, but the effect of MCPyV on the key cell-cycle regulating proteins is poorly understood.
We evaluated expression of the MCPyV large T-antigen (LTA), Ki-67, and the key putative tumor suppressor proteins, the retinoblastoma protein (RB and phospho-RB) and p53, and their regulatory proteins (cyclin D1, cyclin E, p16, p21, p27, and MDM2) by using immunohistochemistry from tumors of 91 MCC patients identified from a population-based nationwide cohort. Tumor MCPyV DNA was measured by using quantitative PCR, and TP53 mutations were identified with sequencing.
MCPyV LTA expression was strongly associated with presence of MCPyV DNA in tumor, and it was almost invariably associated with tumor RB expression (P < 0.0001 for both comparisons). Both MCC LTA and RB expression were strongly associated with favorable MCC-specific and overall survival in univariable analyses (P ≤ 0.01 for all four analyses). Presence of MCPyV LTA was also associated with the female gender, the intermediate type of tumor histology, location of the tumor in a limb, cell proliferation rate, and absence of p53 expression. TP53 mutations were detected only in MCPyV DNA-negative tumors.
MCPyV DNA-positive MCC has several clinical and molecular features that differ from MCPyV DNA-negative cancers. MCPyV-associated MCCs express RB, but may not harbor TP53 mutations. These findings provide further support that MCPyV causes the majority of MCCs.
The majority of Merkel cell carcinomas (MCCs) are associated with the recently identified Merkel cell polyomavirus (MCV). However, as it is still unclear to which extent the presence of MCV impacts tumor characteristics or clinical outcome, we correlated the MCV status of tumor lesions obtained from 174 MCC patients including 38 MCC patients from Australia and 138 MCC patients from Germany with clinical characteristics, histomorphology, immunohistochemistry, and course of the disease. MCV DNA was present in 86% of MCCs and, in contrast to previous reports, no significant difference in MCV prevalence was present between Australian and German MCC cases. When patients were stratified according to their MCV status, only tumor localization (P=0.001), gender (P=0.024), and co-morbidity, i.e., frequency of patients with previous skin tumors (P=0.024), were significantly different factors. In contrast, year of birth and diagnosis, age at diagnosis, or histological type and features representing the oncogenic phenotype such as mitotic rate or expression of p16, p53, RB1, and Ki67 were not significantly different between MCV-positive and MCV-negative MCCs. MCV status also did not influence recurrence-free, overall, and MCC-specific survival significantly. In summary, although MCV-positive and MCV-negative MCCs may have different etiologies, these tumors have comparable clinical behaviors and prognosis.
The aim of this retrospective analysis was to evaluate the status of p53 and possible mutations in Merkel cell carcinoma (MCC) cell lines and MCC tissue samples. The p53 mutations are common in different cancer origins but rare in MCCs detected so far. MCCs are highly aggressive neuroendocrine tumors with an enhanced potential to metastasize. Until now, less is known about MCC and new approaches to understand this disease are necessary. RNA and DNA were extracted from two MCC cell lines and 27 archival paraffin-embedded patient samples. After reverse transcription, a real-time PCR and a high-resolution melt analysis were carried out. In both MCC cell lines, we could detect a p53 missense mutation at codon 193 (exon 6) with a change in amino acids (His → Leu). This mutation was equal in both cell lines and was investigated in 27 tissue samples in succession to detect possible accounts for the aggressive behavior of MCCs. Unfortunately, no corresponding p53 mutation could be observed in the investigated tissue samples. A new p53 mutation was detected in MCC cell lines. This mutation could not be determined in patients' samples. Therefore, the aggressiveness of MCC seems to be independent of p53 mutations and other mutations might be responsible for developing MCC.
Merkel cell carcinoma (MCC) is the most aggressive skin cancer. Recently, it was demonstrated that human Merkel cell polyomavirus
(MCV) is clonally integrated in ∼80% of MCC tumors. However, direct evidence for whether oncogenic viral proteins are needed
for the maintenance of MCC cells is still missing. To address this question, we knocked down MCV T-antigen (TA) expression
in MCV-positive MCC cell lines using three different short hairpin RNA (shRNA)-expressing vectors targeting exon 1 of the
TAs. The MCC cell lines used include three newly generated MCV-infected cell lines and one MCV-negative cell line from MCC
tumors. Notably, all MCV-positive MCC cell lines underwent growth arrest and/or cell death upon TA knockdown, whereas the
proliferation of MCV-negative cell lines remained unaffected. Despite an increase in the number of annexin V-positive, 7-amino-actinomycin
D (7-AAD)-negative cells upon TA knockdown, activation of caspases or changes in the expression and phosphorylation of Bcl-2
family members were not consistently detected after TA suppression. Our study provides the first direct experimental evidence
that TA expression is necessary for the maintenance of MCV-positive MCC and that MCV is the infectious cause of MCV-positive
MCC.
Detection of critical cancer gene mutations in clinical tumor specimens may predict patient outcomes and inform treatment options; however, high-throughput mutation profiling remains underdeveloped as a diagnostic approach. We report the implementation of a genotyping and validation algorithm that enables robust tumor mutation profiling in the clinical setting.
We developed and implemented an optimized mutation profiling platform ("OncoMap") to interrogate approximately 400 mutations in 33 known oncogenes and tumor suppressors, many of which are known to predict response or resistance to targeted therapies. The performance of OncoMap was analyzed using DNA derived from both frozen and FFPE clinical material in a diverse set of cancer types. A subsequent in-depth analysis was conducted on histologically and clinically annotated pediatric gliomas. The sensitivity and specificity of OncoMap were 93.8% and 100% in fresh frozen tissue; and 89.3% and 99.4% in FFPE-derived DNA. We detected known mutations at the expected frequencies in common cancers, as well as novel mutations in adult and pediatric cancers that are likely to predict heightened response or resistance to existing or developmental cancer therapies. OncoMap profiles also support a new molecular stratification of pediatric low-grade gliomas based on BRAF mutations that may have immediate clinical impact.
Our results demonstrate the clinical feasibility of high-throughput mutation profiling to query a large panel of "actionable" cancer gene mutations. In the future, this type of approach may be incorporated into both cancer epidemiologic studies and clinical decision making to specify the use of many targeted anticancer agents.
Immunosuppression and Merkel-cell polyomavirus (MCPyV) infection may have a role in the pathogenesis of Merkel-cell carcinoma (MCC), a rare neuroendocrine carcinoma of the skin.
We studied incidence of chronic lymphocytic leukaemia (CLL) and MCC from the files of the Finnish Cancer Registry and the largest hospital of Finland, Helsinki University Central Hospital, from 1979 to 2006. Presence of MCPyV DNA in MCCs was investigated by quantitative PCR.
We identified 4164 patients diagnosed with CLL and 172 diagnosed with MCC. Six patients diagnosed with both diseases were found; CLL was the first diagnosis in four cases and MCC in two. The standardised incidence ratio (SIR) for CLL after the diagnosis of MCC was highly elevated, 17.9 (95% confidence interval (CI), 2.2-64.6; P<0.001), and the SIR for MCC after the diagnosis of CLL was also elevated, 15.7 (3.2-46.0, P<0.01). Merkel-cell polyomavirus DNA was present in all five MCCs with tumour tissue available for analysis.
We conclude that patients diagnosed with CLL have a substantially increased risk for MCC, and vice versa. Merkel-cell polyomavirus DNA is frequently present in MCCs that occur in CLL patients. Immunosuppression related with CLL and viral infection might explain the association between CLL and MCC.
Merkel cell carcinoma (MCC) is the eponym for primary cutaneous neuroendocrine carcinoma. Recently, a new polyoma virus has been identified that is clonally integrated in the genome of the majority of MCCs, with truncating mutations in the viral large T antigen gene. We examined the presence of Merkel cell polyomavirus (MCV) in a set of 17 frozen tumor samples by quantitative polymerase chain reaction; 15 of them (88%) were positive. Sections from corresponding archival material were analyzed by immunohistochemistry (IHC) with the novel monoclonal antibody CM2B4, generated against a predicted antigenic epitope on the MCV T antigen, and tested for the expression of cytokeratin 20 (CK20). Sufficient archival material for IHC was available in only 15 of the 17 cases whose frozen tissue samples had been studied by polymerase chain reaction. Of the 15 tumors analyzed immunohistochemically, 10 (67%) showed positive labeling with CM2B4, 14 (93%) expressed CK20. A tissue microarray of 36 MCCs, 7 combined squamous and neuroendocrine carcinomas of the skin, and 26 pulmonary neuroendocrine carcinomas were also examined by IHC. Of the 36 MCCs assembled on a microarray, 32 (89%) tumors expressed CK20, and 27 (75%) were immunoreactive with CM2B4. The skin tumors with a combined squamous and neuroendocrine phenotype and all pulmonary neuroendocrine carcinomas failed to react with CM2B4. Our study shows that CM2B4 is a useful reagent for the diagnosis of MCC. It labels the majority of MCCs, but fails to react with pulmonary neuroendocrine carcinomas. We also found that neuroendocrine carcinomas of the skin arising in association with a squamous cell carcinoma seem to be independent of MCV.
We investigated whether Merkel cell carcinoma (MCC) patients in France carry Merkel cell polyomavirus (MCPyV) and then identified strain variations. All frozen MCC specimens and 45% of formalin-fixed and paraffin-embedded specimens, but none of the non-MCC neuroendocrine carcinomas specimens, had MCPyV. Strains from France and the United States were similar.
Merkel cell polyomavirus (MCV) is a recently discovered human virus closely related to African green monkey lymphotropic polyomavirus. MCV DNA is integrated in approximately 80% of Merkel cell carcinomas (MCC), a neuroendocrine skin cancer linked to lymphoid malignancies such as chronic lymphocytic leukemia (CLL). To assess MCV infection and its association with human diseases, we developed a monoclonal antibody that specifically recognizes endogenous and transfected MCV large T (LT) antigen. We show expression of MCV LT protein localized to nuclei of tumor cells from MCC having PCR quantified MCV genome at an average of 5.2 (range 0.8-14.3) T antigen DNA copies per cell. Expression of this putative viral oncoprotein in tumor cells provides the mechanistic underpinning supporting the notion that MCV causes a subset of MCC. In contrast, although 2.2% of 325 hematolymphoid malignancies surveyed also showed evidence for MCV infection by DNA PCR, none were positive at high viral copy numbers, and none of 173 lymphoid malignancies examined on tissue microarrays expressed MCV LT protein in tumor cells. As with some of the other human polyomaviruses, lymphocytes may serve as a tissue reservoir for MCV infection, but hematolymphoid malignancies associated with MCC are unlikely to be caused by MCV.
Merkel cell carcinoma (MCC) is an aggressive neuroendocrine skin cancer with poorly characterized genetics. We performed high resolution comparative genomic hybridization on 25 MCC specimens using a high-density oligonucleotide microarray. Tumors frequently carried extra copies of chromosomes 1, 3q, 5p, and 6 and lost chromosomes 3p, 4, 5q, 7, 10, and 13. MCC tumors with less genomic aberration were associated with improved survival (P=0.04). Tumors from 13 of 22 MCC patients had detectable Merkel cell polyomavirus DNA, and these tumors had fewer genomic deletions. Three regions of genomic alteration were of particular interest: a deletion of 5q12-21 occurred in 26% of tumors, a deletion of 13q14-21 was recurrent in 26% of tumors and contains the well-characterized tumor suppressor RB1, and a previously unreported focal amplification at 1p34 was present in 39% of tumors and centers on L-Myc (MYCL1). L-Myc is related to the c-Myc proto-oncogene, has transforming activity, and is amplified in the closely related small cell lung cancer. Normal skin showed no L-Myc expression, whereas 4/4 MCC specimens tested expressed L-Myc RNA in relative proportion to the DNA copy number gain. These findings suggest several genes that may contribute to MCC pathogenesis, most notably L-Myc.
Merkel cell polyomavirus (MCV) is a virus discovered in our laboratory at the University of Pittsburgh that is monoclonally integrated into the genome of ≈80% of human Merkel cell carcinomas (MCCs). Transcript mapping was performed to show that MCV expresses transcripts in MCCs similar to large T (LT), small T (ST), and 17kT transcripts of SV40. Nine MCC tumor-derived LT genomic sequences have been examined, and all were found to harbor mutations prematurely truncating the MCV LT helicase. In contrast, four presumed episomal viruses from nontumor sources did not possess this T antigen signature mutation. Using coimmunoprecipitation and origin replication assays, we show that tumor-derived virus mutations do not affect retinoblastoma tumor suppressor protein (Rb) binding by LT but do eliminate viral DNA replication capacity. Identification of an MCC cell line (MKL-1) having monoclonal MCV integration and the signature LT mutation allowed us to functionally test both tumor-derived and wild type (WT) T antigens. Only WT LT expression activates replication of integrated MCV DNA in MKL-1 cells. Our findings suggest that MCV-positive MCC tumor cells undergo selection for LT mutations to prevent autoactivation of integrated virus replication that would be detrimental to cell survival. Because these mutations render the virus replication-incompetent, MCV is not a “passenger virus” that secondarily infects MCC tumors.
• Merkel cell carcinoma
• pRB interaction
• viral integration
• virus replication
• helicase
The p73 gene has been mapped to 1p36.33, a region which is frequently deleted in a wide variety of neoplasms including tumours of neuroectodermal origin. The p73 protein shows structural and functional homology to p53. For these reasons, p73 was considered as a positional and functional candidate tumour suppressor gene. Thus far, mutation analysis has provided no evidence for involvement of p73 in oligodendrogliomas, lung carcinoma, oesophageal carcinoma, prostatic carcinoma and hepatocellular carcinoma. In neuroblastoma, two mutations have been observed in a series of 140 tumours. In view of the occurrence of 1p deletions in Merkel cell carcinoma (MCC) and the location of p73 we decided to search for mutations in the p73 gene in five MCC cell lines and ten MCC tumours to test potential tumour suppressor function for this gene in MCC. In view of the possible complementary functions of p73 and TP53 we also examined the status of the TP53 gene. Sequence analysis of the entire coding region of the p73 gene revealed previously reported polymorphisms in four MCCs. In one MCC tumour, a mis-sense mutation located in the NH2-terminal transactivation region of the p73 gene was found. These results show that p73, analogous to neuroblastoma, is infrequently mutated in MCC. This is also the first report in which the role of TP53 in MCC has been investigated by sequencing the entire coding region of TP53. TP53 mis-sense mutations and one non-sense mutation were detected in three of 15 examined MCCs, suggesting that TP53 mutations may play a role in the pathogenesis or progression of a subset of MCCs. Moreover, typical UVB induced C to T mutations were found in one MCC cell line thus providing further evidence for sun-exposure in the aetiology of this rare skin cancer.
Ataxia telangiectasia is an autosomal recessive disease with a striking predisposition of lymphoid malignancies. ATM mutations have been reported in adult sporadic lymphoma and leukaemia. The aim of this study was to investigate the possible involvement of the ATM gene in the carcinogenesis of Hodgkin disease in children. Tumours were obtained from 23 patients and were subjected to mutation screening and loss of heterozygosity analysis. Eight base substitutions were identified in seven patients. Of them, Y54Y, a silent change, was observed in two patients and a known polymorphism, D1853N, in three patients. Of the other two patients, one harboured a combined genotype P604S/F1463C, identified previously in two patients with Hodgkin lymphoma, and the other a novel missense mutation, V595A. The alterations were present in the germ line, and both had a more aggressive disease. In all, 100 matched normal ethnic controls were screened for these mutations and P604S/F1463C was identified in one healthy control. Loss of heterozygosity was identified in four patients and in three of them it was located centromeric to the ATM gene, and, in one, it spanned a large region, indicating the involvement of other tumour-suppressor genes in this disease. Missense variants of the ATM gene are a rare event in childhood Hodgkin disease.
Simian virus 40 (SV40) large T antigen (T Ag) interacts with the tumor suppressor p53 and the transcriptional coactivators
CBP and p300. Binding of these cellular proteins in a ternary complex has been implicated in T Ag-mediated transformation.
It has been suggested that the ability of CBP/p300 to modulate p53 function underlies p53's regulation of cell proliferation
and tumorigenesis. In this study, we provide further evidence that CBP activity may be mediated through its synergistic action
with p53. We demonstrate that SV40 T Ag is acetylated in vivo in a p53-dependent manner and T Ag acetylation is largely mediated
by CBP. The acetylation of T Ag is dependent on its interaction with p53 and on p53's interaction with CBP. We have mapped
the site of acetylation on T Ag to the C-terminal lysine residue 697. This acetylation site is conserved between the T antigens
of the human polyomaviruses JC and BK, which are also known to interact with p53. We show that both JC and BK T antigens are
also acetylated at corresponding sites in vivo. While other proteins are known to be acetylated by CBP/p300, none are known
to depend on p53 for acetylation. T Ag acetylation may provide a regulatory mechanism for T Ag binding to a cellular factor
or play a role in another aspect of T Ag function.
The small DNA tumor viruses encode proteins that subvert many of the pivotal growth regulatory pathways within the cell to facilitate their own replication. The cell responds to viral infection/proteins by activating the p53 tumor suppressor pathway. Activation of p53 could impair a productive viral infection at many levels, including the inhibition of viral DNA replication and/or the premature death of infected cells. Therefore, DNA viruses encode proteins that inactivate the p53 tumor suppressor pathway. Understanding how DNA viral proteins activate/inactivate the p53 pathway has provided invaluable insights into tumorigenesis. Recent studies with polyoma virus have identified a viral protein (PyST) that inhibits ARF-mediated activation of p53, and revealed a novel role for PP2A in the regulation of the ARF-p53 tumor suppressor pathway.
The transformation potential of Simian Virus 40 depends on the activities of large T-antigen (LTag), which interacts with several cellular tumor suppressors including the important "guardian" of the genome, p53. Inhibition of p53 function by LTag is necessary for both efficient viral replication and cellular transformation. We determined the crystal structure of LTag in complex with p53. The structure reveals an unexpected hexameric complex of LTag binding six p53 monomers. Structure-guided mutagenesis of LTag and p53 residues supported the p53-LTag interface defined by the complex structure. The structure also shows that LTag binding induces dramatic conformational changes at the DNA-binding area of p53, which is achieved partially through an unusual "methionine switch" within p53. In the complex structure, LTag occupies the whole p53 DNA-binding surface and likely interferes with formation of a functional p53 tetramer. In addition, we showed that p53 inhibited LTag helicase function through direct complex formation.
Analyses of cancer cell lines and of anal cancers suggest an inverse correlation between infection with human papillomavirus (HPV) and somatic mutation of the p53 tumour-suppressor gene. We have investigated this association in primary cervical tumours. Tumour-tissue samples from 28 women with primary cancer of the cervix were analysed for presence of HPV sequences and for somatic mutations of the p53 gene. Southern blot analysis and the polymerase chain reaction (PCR) showed that 25 of the tumours contained HPV sequences; 20 were HPV16 positive and 5 HPV18 positive. 17 tumours subjected to restriction fragment length polymorphism analysis for the short arm of chromosome 17 showed no evidence of allelic deletion. Sequencing of the entire coding region of the p53 gene by asymmetric PCR detected heterozygous point mutations in only 3 HPV-negative tumours. By contrast, in 21 HPV-positive cancers the p53 sequence was wild-type throughout. Our data indicate that loss of wild-type p53 function is important in the pathology of cervical cancer and that in the absence of an HPV-encoded gene product that mediates loss of p53 function, somatic mutation of the gene is required. This pattern of p53 mutation may partly explain the apparently worse prognosis of HPV-negative cervical cancers.
In the general population Merkel's cell carcinoma (MCC) is an aggressive neuroendocrine skin cancer. More than 600 cases have been reported. MCC seems to be common in transplant recipients, with 41 cases being reported to the Cincinnati Transplant Tumor Registry, and another 11 in the transplant literature. In the general population, it is a disease of older adults, with only 5% of cases occurring below the age of 50 years. In transplant patients, the mean age at diagnosis was 53 (range 33-78) years, and 29% of recipients were <50 years old. The tumor appeared from 5 to 286 (mean 91.5) months after the transplant. Of 44 lesions that occurred in 41 patients, the distribution was similar to that seen in the general population, with 36% occurring on the head and neck, 32% on the upper extremities, 16% on the trunk, 9% at unknown sites, and 7% on the lower extremities. Twenty of the patients (49%) had 22 other malignancies, the great majority of which (91%) were other skin cancers. Treatment depended on the stage of the disease and included wide surgical excision, radical lymph node dissection, radiation therapy, and chemotherapy. In transplant patients, MCC probably proved to be more aggressive than in the general population in that 68% of patients developed lymph node metastases and 56% died of their malignancies. Furthermore, one third of surviving patients still have active cancers from which they may die. Also, follow-up of survivors has been relatively short, with a mean of only 18 (range 0-135) months.
The two most commonly used methods to analyze data from real-time, quantitative PCR experiments are absolute quantification and relative quantification. Absolute quantification determines the input copy number, usually by relating the PCR signal to a standard curve. Relative quantification relates the PCR signal of the target transcript in a treatment group to that of another sample such as an untreated control. The 2(-DeltaDeltaCr) method is a convenient way to analyze the relative changes in gene expression from real-time quantitative PCR experiments. The purpose of this report is to present the derivation, assumptions, and applications of the 2(-DeltaDeltaCr) method. In addition, we present the derivation and applications of two variations of the 2(-DeltaDeltaCr) method that may be useful in the analysis of real-time, quantitative PCR data. (C) 2001 Elsevier science.
The aim of the present study was to assess a possible role of the tumour suppressor genep53 in neuroendocrine (Merkel cell) carcinoma of the skin with regard to tumour development and tumour progression. p53 was investigated in a series of routinely processed Merkel cell carcinomas, with application of four different p53 antibodies (CM-l, PAb1801, D07, and PAb240) to 25 carcinomas and screening forp53 mutations of exons 4–8 by single-strand conformation polymorphism (SSCP) analysis in 9 cases. All 25 tumours in the present series showed the characteristic microscopic and immunohistochemical features of Merkel cell carcinoma of the skin. In 5 of the 25 Merkel cell carcinomas investigated 5–10% of tumour cell nuclei showed a positive p53 reaction with at least one anti-p53 antibody. A few scattered p53 positive nuclei were found in an additional 9 cases. The remaining 11 cases completely lacked p53 immunostaining. SSCP analysis of exons 4–8 revealed no significant alterations in the mobility shift of the single strand DNAs in the five cases with 5–10% p53-immunoreactive tumour nuclei or in five cases lacking p53 accumulation significant. Our results suggest that alterations of the p53 gene play only a minor part in the development or progression of Merkel cell carcinoma of the skin.
Although next-generation sequencing (NGS) has been the domain of large genome centers, it is quickly becoming more accessible to general pathology laboratories. In addition to finding single-base changes, NGS allows for the detection of larger structural variants, including insertions/deletions, translocations, and viral insertions. We describe the use of targeted NGS on DNA extracted from formalin-fixed, paraffin-embedded (FFPE) tissue, and show that the short read lengths of NGS are ideally suited to fragmented DNA obtained from FFPE tissue. Further, we describe a novel method for performing hybrid-capture target enrichment using PCR-generated capture probes. As a model, we captured the 5.3-kb Merkel cell polyomavirus (MCPyV) genome in FFPE cases of Merkel cell carcinoma using inexpensive, PCR-derived capture probes, and achieved up to 37,000-fold coverage of the MCPyV genome without prior virus-specific PCR amplification. This depth of coverage made it possible to reproducibly detect viral genome deletions and insertion sites anywhere within the human genome. Out of four cases sequenced, we identified the 5' insertion sites in four of four cases and the 3' sites in three of four cases. These findings demonstrate the potential for an inexpensive gene targeting and NGS method that can be easily adapted for use with FFPE tissue to identify large structural rearrangements, opening up the possibility for further discovery from archival tissue.
Recent studies have demonstrated a high frequency of detection of Merkel cell polyomavirus in Merkel cell carcinoma. However, most of these studies are from European or North American centers that have relatively low sun exposure and may have a higher incidence of virus-driven oncogenesis compared with the highly sun-exposed but predominantly fair-skinned Australian population. We performed immunohistochemistry for Merkel cell polyomavirus on 104 cases of Merkel cell carcinoma and 74 cases of noncutaneous small cell-undifferentiated carcinoma from 3 major Australian centers. Nineteen (18.3%) cases of Merkel cell carcinoma showed positive staining for Merkel cell polyomavirus versus 1 (1.3%) of small cell-undifferentiated carcinoma. All 15 cases (14.3%) of Merkel cell carcinoma with areas of mixed squamous differentiation showed negative staining. We found positive staining in only 3 (7.7%) of 39 Merkel cell carcinoma from the head and neck (the most sun-exposed area) versus 16 (24.6%) of 65 of tumors from other sites (P < .05). Our findings support the concept of a Merkel cell polyomavirus-driven and a non-Merkel cell polyomavirus-driven (primarily sun-dependent) pathway in Merkel cell carcinoma carcinogenesis, with the latter being significantly more frequent in Australia and in mixed squamous-Merkel cell carcinoma (which is also more frequent in Australia). Although immunohistochemistry for Merkel cell polyomavirus seems to be highly specific in all populations, the low incidence of Merkel cell polyomavirus-positive Merkel cell carcinoma in a highly sun-exposed population limits its diagnostic utility in this setting.
Merkel cell carcinoma (MCC) is a polyomavirus-associated skin cancer that is frequently lethal and lacks established prognostic biomarkers. This study sought to identify biomarkers that improve prognostic accuracy and provide insight into MCC biology.
Gene expression profiles of 35 MCC tumors were clustered based on prognosis. The cluster of genes overexpressed in good-prognosis tumors was tested for biologic process enrichment. Relevant mRNA expression differences were confirmed by quantitative polymerase chain reaction and immunohistochemistry. An independent set of 146 nonoverlapping MCC tumors (median follow-up, 25 months among 116 living patients) was employed for biomarker validation. Univariate and multivariate Cox regression analyses were performed.
Immune response gene signatures were prominent in patients with good prognoses. In particular, genes associated with cytotoxic CD8+ lymphocytes were overexpressed in tumors from patients with favorable prognoses. In the independent validation set, cases with robust intratumoral CD8+ lymphocyte infiltration had improved outcomes (100% MCC-specific survival, n = 26) compared with instances characterized by sparse infiltration (60% survival, n = 120). Only stage and intratumoral CD8 infiltration (but not age, sex, or CD8+ lymphocytes localized to the tumor-stroma interface) were significant in both univariate and multivariate Cox regression analyses. Notably, traditional histologic identification of tumor-infiltrating lymphocytes was not a significant independent predictor of survival.
Intratumoral CD8+ lymphocyte infiltration can be readily assessed on paraffin-embedded tissue, is independently associated with improved MCC-specific survival, and therefore, may provide prognostic information that enhances established MCC staging protocols.
Most Merkel cell carcinomas (MCCs) contain Merkel cell polyomavirus (MCPyV) DNA, and the virus likely has a pivotal role in tumor pathogenesis. p53 and the KIT receptor tyrosine kinase have also been implicated in MCC pathogenesis, but little is known about their association with MCPyV infection. We identified 207 patients diagnosed with MCC in Finland in 1979-2004 and reviewed the histological diagnoses. Adequate clinical information, tumor tissue and DNA were available from 87 confirmed MCC cases. Presence of MCPyV DNA was assessed using quantitative PCR; p53, KIT, phospho-KIT, stem cell factor (SCF) and PDGFRα expression using immunohistochemistry and presence of mutations in KIT exons 9, 11, 13 and 17 and PDGFRA exons 10, 12, 14 and 18 using DNA sequencing. Most (77.0%) of the 87 tumors contained MCPyV DNA and 37 (42.5%) expressed KIT, whereas PDGFRα, p53, SCF and pKIT expression was less common (31.9, 22.8, 8.6 and 4.8%, respectively). No KIT or PFGFRA mutations were detected, but 10 (12.5%) of the 80 tumors studied harbored common PDGFRA exon 10 S478P substitution. Tumor p53 and KIT expression were associated with absence of MCPyV DNA (p = 0.01 and 0.009, respectively). Tumor p53 expression was associated with unfavorable MCC-specific survival (p = 0.021) and overall survival (p = 0.046), but tumor KIT expression only when stratified by presence of MCPyV DNA. The results suggest that p53 and KIT expression are associated with absence of MCPyV DNA in MCC, and that the molecular pathogenesis of MCC is multifactorial.
Merkel cell carcinoma is one of the most aggressive primary cutaneous malignancies. Because some Merkel cell carcinomas express the receptor tyrosine kinase KIT, we aimed to evaluate the correlation of KIT expression with the outcome and the presence of activating mutations in the KIT gene in Merkel cell carcinoma. A total of 49 tumors from 40 patients with a diagnosis of Merkel cell carcinoma were identified, of which 30 cases from 21 patients were used in the study. KIT expression was assessed by immunohistochemistry on formalin-fixed, paraffin-embedded material. Cases were divided into low expressors (0-1+ staining intensity) and high expressors (2-3+ staining intensity). Direct sequencing of exons 9, 11, 13, 17, and 18 of the KIT gene spanning the extracellular, juxtamembrane, and tyrosine kinase domains was performed for cases with high KIT expression. Thirty tumors from 21 patients were analyzed for KIT expression. High KIT expression was seen in 67% of the patients. Five-year survival rates in tumors expressing high versus low levels of KIT were 0% versus 57.8%, respectively; however, this dramatic difference did not reach statistical significance (P = .07). A total of 4 point mutations were identified in 18 tumors analyzed. Two of these were silent mutations involving exons 17 and 18, and 2 involved intron 16-17. Two of the identified mutations may represent novel polymorphisms. Our work suggests a correlation between KIT expression and a worse prognosis in Merkel cell carcinoma patients, raising the possibility of an active role of this receptor in tumor progression and metastasis. However, we did not identify KIT activating mutations in any of the tumors analyzed.
Merkel Cell Virus (MCV) is a newly discovered polyomavirus, recently found in a rare skin cancer, Merkel cell carcinoma (MCC). However, MCV has also been detected in some normal tissue samples. We tested and compared the relative quantity of the MCV in a set of diverse human tissue samples with the MCC samples. The levels of MCV in MCCs were over 60 times higher than the highest values in all other tissues. Low quantities of MCV were detected in diverse tissue samples independently of malignant or benign histologic status. Higher levels of the virus were found in the upper aerodigestive tract, digestive system, and saliva compared to the lung and genitourinary system samples. These results confirm that MCV is widespread in the human body and suggest a possible fecal-oral transmission route similar to the Hepatitis A virus. Despite widespread presence of the virus, it appears that only neuroendocrine skin cells are susceptible to transformation by MCV.
Merkel cell carcinoma (MCC), a skin tumour with neuroendocrine features, was recently found to be associated with a new type of human polyomavirus, called Merkel cell virus (MCV). We investigated the specificity of this association as well as a causal role of MCV in oncogenesis. DNA and RNA from ten cases of MCC were analysed using PCR and RT-PCR. DNA from 1241 specimens of a wide range of human tumours was also analysed. The DIPS technique was used to identify the integration locus of viral DNA sequences. Array CGH was performed to analyse structural alterations of the cell genome. MCV DNA sequences were found in all ten cases of MCC and in none of the 1241 specimens of other tumour types. Clonal integration of MCV into the host genome was seen in all MCC cases and was checked by FISH in one case. A recurrent pattern of conserved viral sequences which encompassed the replication origin, the small tumour (ST), and the 5' part of the large tumour (LT) antigen DNA sequences was observed. Both ST and LT viral sequences were found to be significantly expressed in all MCCs. Neither recurrent site of integration nor alteration of cellular genes located near the viral sequences was observed. The tight association of MCV with MCC, the clonal pattern of MCV integration, and the expression of the viral oncoproteins strongly support a causative role for MCV in the tumour process. This information will help the development of novel approaches for the assessment and therapy of MCC and biologically related tumours.
Analyses of cancer cell lines and of anal cancers suggest an inverse correlation between infection with human papillomavirus (HPV) and somatic mutation of the p53 tumour-suppressor gene. We have investigated this association in primary cervical tumours. Tumour-tissue samples from 28 women with primary cancer of the cervix were analysed for presence of HPV sequences and for somatic mutations of the p53 gene. Southern blot analysis and the polymerase chain reaction (PCR) showed that 25 of the tumours contained HPV sequences; 20 were HPV16 positive and 5 HPV18 positive. 17 tumours subjected to restriction fragment length polymorphism analysis for the short arm of chromosome 17 showed no evidence of allelic deletion. Sequencing of the entire coding region of the p53 gene by asymmetric PCR detected heterozygous point mutations in only 3 HPV-negative tumours. By contrast, in 21 HPV-positive cancers the p53 sequence was wild-type throughout. Our data indicate that loss of wild-type p53 function is important in the pathology of cervical cancer and that in the absence of an HPV-encoded gene product that mediates loss of p53 function, somatic mutation of the gene is required. This pattern of p53 mutation may partly explain the apparently worse prognosis of HPV-negative cervical cancers.
The authors have recently identified a new cytokeratin (CK) polypeptide, CK 20, whose expression is almost entirely confined to the gastric and intestinal epithelium, urothelium, and Merkel cells. Seven monoclonal antibodies (MAbs) specific for CK 20 were raised and characterized by applying immunoblotting and immunocytochemical screening. All of them reacted on frozen tissue sections. A further MAb, IT-Ks20.8, recognized CK 20 in sections of formalin-fixed, paraffin-embedded tissue samples. A total of 711 cases of primary and metastatic cancer, mostly carcinomas, were analyzed immunohistochemically for CK-20 expression, using CK-20 specific guinea-pig antibodies and MAbs. The expression spectrum of CK 20 in carcinomas resembled that seen in the corresponding normal epithelia of origin. CK-20 positivity was seen in the vast majority of adenocarcinomas of the colon (89/93 cases), mucinous ovarian tumors, transitional-cell and Merkel-cell carcinomas and frequently also in adenocarcinomas of the stomach, bile system, and pancreas. Most squamous cell carcinomas in general and most adenocarcinomas from other sites (breast, lung, endometrium), nonmucinous tumors of the ovary, and small-cell lung carcinomas were essentially or completely negative. The authors propose to use CK 20 as a diagnostic marker valuable in distinguishing different types of carcinomas, notably when presenting as metastases.
The cytoskeletons of various human neuroendocrine (NE) tumors were analyzed immunohistochemically using antibodies against intermediate-filament (IF) proteins as well as by two-dimensional gel electrophoresis of proteins from microdissected tissue samples. All of the tumors studied were found to contain cytokeratin filaments and are therefore referred to as 'NE tumors of the epithelial type'. In addition, neurofilaments were found in most cutaneous and some pulmonary NE tumors, as well as in medullary carcinomas of the thyroid and in pancreatic islet cell tumors. The neurofilament staining was frequently concentrated in cytoplasmic IF aggregates. Gel-electrophoretic analyses showed that all NE tumors examined synthesize 'simple epithelium-type' cytokeratin polypeptides, cytokeratins nos. 8 and 18 being the most prominent ones, whereas cytokeratin no. 19 was found in variable and usually minor amounts. A new cytoskeletal protein, designated IT protein, with a relative molecular weight of 46,000 and an isoelectric pH value of approximately 6.1 (in 9.5 M urea) was detected in all 9 cases of cutaneous NE tumors ('Merkel-cell carcinomas'), including 2 lymph-node metastases, but was not found in any of the 17 cases of pulmonary NE tumors. In addition, 2 medullary carcinomas of the thyroid, 2 islet cell tumors of the pancreas, and 1 intestinal carcinoid tumor also seemed to lack this protein. A protein indistinguishable from IT protein by electrophoresis and tryptic peptide mapping was found in cytoskeletal preparations of mucosal cells of human intestine and in cultured human colon carcinoma cells of line HT-29. A possible relationship between IT protein and the type-I subfamily of cytokeratin polypeptides is discussed. Our study shows that the co-expression of cytokeratin filaments and neurofilaments may provide a criterion which is useful for the recognition of some NE tumors but which does not distinguish between NE tumors of different types and origins. In contrast, IT protein seems to be present specifically in cutaneous NE tumors, but absent in pulmonary NE tumors. The implications of these findings for the elucidation of the histogenesis of cutaneous NE tumors and for the histopathological differential diagnosis of NE tumors of cutaneous and pulmonary origin are discussed.
Cytokeratin 20 (CK20) is a low-molecular-weight cytokeratin (CK) that shows restricted expression in the gastrointestinal epithelium, urothelium, and Merkel cell. Recent studies have suggested that since Merkel cell (primary cutaneous neuroendocrine) carcinomas are consistently CK20-positive, this feature may help to distinguish it from pulmonary small cell carcinomas. However, only limited numbers of these tumors have been studied, and the pattern of CK20 expression in other small cell carcinomas has not been established. Therefore, we studied CK20 expression in small cell carcinomas from a wide variety of sites. Immunohistochemical study was performed on paraffin sections using CK20 antibody, coupled with antigen retrieval by pressure cooking in citrate buffer. The cases included 34 Merkel cell carcinomas and 89 small cell carcinomas from various sites (pulmonary, 37; gastrointestinal tract, nine; pharynx and tongue, two; sinonasal tract, three; salivary gland, five; larynx, nine; breast, two; thymus, three; uterine cervix and corpus, 12, prostate, three; urinary bladder, two; kidney, one; pancreas, one). In addition, all cases were immunostained with pan-CK (MNF-116) and low-molecular-weight CK (CAM5.2) antibodies to ascertain their epithelial nature. With the exception of one case, all Merkel cell carcinomas were CK20-positive; and 30 of the 33 cases showed a punctate pattern. Almost 100% of tumor cells were positive, except for two cases that showed staining of 10% and 30% of tumor cells, respectively. Among the other small cell carcinomas, only five cases were CK20-positive, including one of 37 pulmonary (40% cells positive in punctate pattern), one of 11 cervical (10% cells positive), and three of five salivary gland (100% cells positive). We conclude that CK20-positivity in a small cell carcinoma of uncertain origin strongly predicts a diagnosis of Merkel cell carcinoma, especially if the majority of tumor cells are positive. A negative CK20 reaction can practically rule out Merkel cell carcinoma, provided that an effective antigen retrieval technique is used and appropriate staining is obtained with other cytokeratin antibodies. The frequent CK20 positivity observed in salivary gland small cell carcinomas in this series suggests that at least some of them may be more closely related biologically to Merkel cell carcinoma than to pulmonary-type small cell carcinoma. This may explain why they are far less clinically aggressive than other small cell carcinomas.
The aim of the present study was to assess a possible role of the tumour suppressor gene p53 in neuroendocrine (Merkel cell) carcinoma of the skin with regard to tumour development and tumour progression. p53 was investigated in a series of routinely processed Merkel cell carcinomas, with application of four different p53 antibodies (CM-1, PAb1801, DO7, and PAb240) to 25 carcinomas and screening for p53 mutations of exons 4-8 by single-strand conformation polymorphism (SSCP) analysis in 9 cases. All 25 tumours in the present series showed the characteristic microscopic and immunohistochemical features of Merkel cell carcinoma of the skin. In 5 of the 25 Merkel cell carcinomas investigated 5-10% of tumour cell nuclei showed a positive p53 reaction with at least one anti-p53 antibody. A few scattered p53 positive nuclei were found in an additional 9 cases. The remaining 11 cases completely lacked p53 immunostaining. SSCP analysis of exons 4-8 revealed no significant alterations in the mobility shift of the single strand DNAs in the five cases with 5-10% p53-immunoreactive tumour nuclei or in five cases lacking p53 accumulation significant. Our results suggest that alterations of the p53 gene play only a minor part in the development or progression of Merkel cell carcinoma of the skin.
Azathioprine and cyclosporin have been used as immunosuppressants for many years, but long-term use has also been associated with neoplasia. We report three cases of rapidly fatal Merkel cell carcinoma in patients who had been treated with azathioprine for many years either for rheumatoid arthritis or following organ transplantation. Two of these patients had also received cyclosporin. We suggest that Merkel cell carcinoma may be seen more commonly in immunosuppressed patients than in the normal population and that the oncogenic potential of azathioprine and cyclosporin should be borne in mind when prescribing these drugs.
The authors describe a case of cutaneous neuroendocrine (Merkell cell) carcinoma in a patient previously treated for Chronic Lymphocytic Leukaemia (CLL). The authors discuss some of the mechanisms concerning the increased frequency of a second tumour in patients with CLL and focus attention on the high incidence in CLL of secondary tumours, especially skin tumours, of which Merkell cell carcinoma is a rare example. The authors consider the possible therapeutic approaches, reported in the literature, for the treatment of this particular skin carcinoma, which on account of its aggressiveness and the preexistence of a leukaemic process requires a particularly careful therapeutic approach.
Merkel cell carcinoma (MCC) is a rare skin cancer, probably of neuroendocrine origin, with approximately 470 new cases diagnosed in the United States annually. It affects mainly Caucasian individuals, in whom the tumor development is likely related to sun exposure and chronic immunosuppression. It is an aggressive tumor, and survival is dependent on tumor stage at presentation. Histologically, MCC is a "small blue cell" tumor, differentiated from small cell lung cancer (SCLC) and the small cell variant of melanoma by immunohistochemistry, using S-100, CK20, CK7, and TTF-1. While several genetic abnormalities have been reported, no strong pathogenetic correlation has been identified. The diagnostic evaluation includes CT imaging; octreotide and PET scans may be helpful in diagnosis and staging. Wide surgical excision with tumor-free margins is the primary mode of treatment for nonmetastatic disease, and sentinel lymph node biopsy is recommended for the staging of the disease. Adjuvant radiation therapy at 45-50 Gy to the primary site and involved lymph nodes can prevent local recurrences and may improve survival rates. Chemotherapy, patterned after regimens for SCLC, leads to tumor regression in up to 70% of cases with metastatic disease, but has no established role in the adjuvant setting.
The two most commonly used methods to analyze data from real-time, quantitative PCR experiments are absolute quantification and relative quantification. Absolute quantification determines the input copy number, usually by relating the PCR signal to a standard curve. Relative quantification relates the PCR signal of the target transcript in a treatment group to that of another sample such as an untreated control. The 2(-Delta Delta C(T)) method is a convenient way to analyze the relative changes in gene expression from real-time quantitative PCR experiments. The purpose of this report is to present the derivation, assumptions, and applications of the 2(-Delta Delta C(T)) method. In addition, we present the derivation and applications of two variations of the 2(-Delta Delta C(T)) method that may be useful in the analysis of real-time, quantitative PCR data.
Merkel cell carcinoma (MCC) is a rare skin cancer that occurs more frequently after organ transplantation or B-cell malignancy, conditions of suppressed or disordered immunity. To assess further whether immune suppression increases MCC risk, we studied its occurrence in a cohort of 309365 individuals with acquired immunodeficiency syndrome (AIDS) by using linked AIDS and cancer registries. We identified six cases of MCC, corresponding to a relative risk of 13.4 (95% CI 4.9-29.1) compared with the general population. These results suggest that immune suppression induced by the human immunodeficiency virus increases MCC risk.
Merkel cell carcinomas (MCCs) express the tyrosine kinase receptor KIT. However, it is not known if MCCs have activating mutations in KIT that would make them responsive to treatment with imatinib mesylate. The purpose of this article is to describe the KIT immunohistological staining pattern (CD117) of MCCs and analyze those MCCs for mutations in areas of KIT where mutations are found in gastrointestinal stromal cell tumors.
We evaluated KIT immunostaining in nine MCCs from nine patients. In addition, we extracted DNA from the same MCCs, performed PCR amplification of C-KIT exons 9, 11, 13, and 17, and sequenced those gene products for mutations.
Eight of nine (88.8%) MCCs expressed KIT. No mutations were found.
The majority of MCCs express KIT but do not contain activating mutations in exons 9, 11, 13, or 17 of KIT. Imatinib mesylate is unlikely to provide effective therapy in MCC unless activating mutations in other areas of KIT or activating mutations in other related genes can be detected.