Dichotomous metabolism of Enterococcus faecalis induced by haematin starvation modulates colonic gene expression

Muchmore Laboratories for Infectious Disease Research, Department of Veterans Affairs Medical Center, Oklahoma City, OK 73104, USA.
Journal of Medical Microbiology (Impact Factor: 2.25). 11/2008; 57(Pt 10):1193-204. DOI: 10.1099/jmm.0.47798-0
Source: PubMed
ABSTRACT
Enterococcus faecalis is an intestinal commensal that cannot synthesize porphyrins and only expresses a functional respiratory chain when provided with exogenous haematin. In the absence of haematin, E. faecalis reverts to fermentative metabolism and produces extracellular superoxide that can damage epithelial-cell DNA. The acute response of the colonic mucosa to haematin-starved E. faecalis was identified by gene array. E. faecalis was inoculated into murine colons using a surgical ligation model that preserved tissue architecture and homeostasis. The mucosa was exposed to haematin-starved E. faecalis and compared with a control consisting of the same strain grown with haematin. At 1 h post-inoculation, 6 mucosal genes were differentially regulated and this increased to 42 genes at 6 h. At 6 h, a highly significant biological interaction network was identified with functions that included nuclear factor-kappaB (NF-kappaB) signalling, apoptosis and cell-cycle regulation. Colon biopsies showed no histological abnormalities by haematoxylin and eosin staining. Immunohistochemical staining, however, detected NF-kappaB activation in tissue macrophages using antibodies to the nuclear localization sequence for p65 and the F4/80 marker for murine macrophages. Similarly, haematin-starved E. faecalis strongly activated NF-kappaB in murine macrophages in vitro. Furthermore, primary and transformed colonic epithelial cells activated the G2/M checkpoint in vitro following exposure to haematin-starved E. faecalis. Modulation of this cell-cycle checkpoint was due to extracellular superoxide produced as a result of the respiratory block in haematin-starved E. faecalis. These results demonstrate that the uniquely dichotomous metabolism of E. faecalis can significantly modulate gene expression in the colonic mucosa for pathways associated with inflammation, apoptosis and cell-cycle regulation.

Full-text

Available from: Xingmin Wang
Dichotomous metabolism of Enterococcus faecalis
induced by haematin starvation modulates colonic
gene expression
Toby D. Allen,
1,2
Danny R. Moore,
1,2
Xingmin Wang,
1,2
Viviana Casu,
1,2
Randal May,
2
Megan R. Lerner,
3
Courtney Houchen,
2
Daniel J. Brackett
3,4
and Mark M. Huycke
1,2
Correspondence
Mark M. Huycke
mark-huycke@ouhsc.edu
1
Muchmore Laboratories for Infectious Disease Research, Department of Veterans Affairs Medical
Center, Oklahoma City, OK 73104, USA
2
Department of Medicine, University of Oklahoma Health Sciences Center, Oklahoma City, OK
73104, USA
3
Department of Surgery, University of Oklahoma Health Sciences Center, Oklahoma City, OK
73104, USA
4
Research Service, Department of Veterans Affairs Medical Center, Oklahoma City, OK 73104, USA
Received 4 December 2007
Accepted 10 June 2008
Enterococcus faecalis is an intestinal commensal that cannot synthesize porphyrins and only
expresses a functional respiratory chain when provided with exogenous haematin. In the absence
of haematin, E. faecalis reverts to fermentative metabolism and produces extracellular superoxide
that can damage epithelial-cell DNA. The acute response of the colonic mucosa to haematin-
starved E. faecalis was identified by gene array. E . faecalis was inoculated into murine colons
using a surgical ligation model that preserved tissue architecture and homeostasis. The mucosa
was exposed to haematin-starved E. faecalis and compared with a control consisting of the same
strain grown with haematin. At 1 h post-inoculation, 6 mucosal genes were differentially regulated
and this increased to 42 genes at 6 h. At 6 h, a highly significant biological interaction network
was identified with functions that included nuclear factor-kB (NF-kB) signalling, apoptosis and
cell-cycle regulation. Colon biopsies showed no histological abnormalities by haematoxylin and
eosin staining. Immunohistochemical staining, however, detected NF-kB activation in tissue
macrophages using antibodies to the nuclear localization sequence for p65 and the F4/80 marker
for murine macrophages. Similarly, haematin-starved E. faecalis strongly activated NF-kBin
murine macrophages in vitro. Furthermore, primary and transformed colonic epithelial cells
activated the G
2
/M checkpoint in vitro following exposure to haematin-starved E. faecalis.
Modulation of this cell-cycle checkpoint was due to extracellular superoxide produced as a result
of the respiratory block in haematin-starved E. faecalis. These results demonstrate that the
uniquely dichotomous metabolism of E. faecalis can significantly modulate gene expression in the
colonic mucosa for pathways associated with inflammation, apoptosis and cell-cycle regulation.
INTRODUCTION
For several decades, the colonic microbiota has been
postulated to play a role in the aetiology of sporadic
colorectal cancer (CRC) (Augenlicht et al., 2002; McGarr
et al., 2005; Rowland, 1995). This hypothesis is based on
the observation that intestinal cancers occur almost
exclusively in the colon where metabolically active bacteria
are in direct proximity to mucosal surfaces at densities of
10
11
c.f.u. (g faecal material)
21
. Several epidemiological
studies have attempted to identify associations between at-
risk populations for CRC and colonic bac teria (Benno et al.,
1986; Moore & Moore, 1995). This approach has been
hampered, however, by the enormous complexity of the
colonic microbiota and inadequate understanding of what
constitutes exposure risks for commensals (Eckburg et al.,
2005). Despite these limitations, a credible rationale
remains for studying the role of colonic commensals in
CRC carcinogenesis.
Abbreviations: CRC, colorectal cancer; DAPI, 49,6-diamidino-2-phenyl-
indole; FBS, fetal bovine serum; FITC, fluorescein isothiocyanate; HRP,
horseradish peroxidase; IL, interleukin; MnSOD, manganese superoxide
dismutase; NF-kB, nuclear factor-kB; NLS, nuclear localization
sequence; p.i. post-inoculation; qRT-PCR, quantitative real-time RT-PCR.
Journal of Medical Microbiology (2008), 57, 1193–1204 DOI 10.1099/jmm.0.47798-0
47798 Printed in Great Britain 1193
Page 1
Perhaps the best evidence supporting a role for colonic
commensals in CRC derives from genetically engineered
mice that develop intestinal tumours when conventionally
colonized but have fewer tumours or no pathology when
housed in pathogen-free or germ-free environments
(Balish & Warner, 2002; Chu et al., 2004; Dove et al.,
1997; Engle et al., 2002; Kado et al., 2001; Kim et al., 2005;
Maggio-Price et al., 2006). The mechanisms by which
commensals trigger inflamma tion or initiate genomic
instability (a characteristic feature of sporadic CRC)
remain uncertain. Commensals can modulate the intestinal
mucosa through the metabolism of faecal steroids, by
producing short-chain fatty acids and by inducing host
genes (Augenlicht et al., 2002; Ba
¨
ckhed et al., 2005;
Debruyne et al., 2001; McGarr et al., 2005). None of these
effects, however, is known to initiate or promote genomic
or epigenetic changes in epithelial cells as antecedents to
oncogenic transformation. Commensals that cause epithe-
lial-cell DNA damage, in contrast, ar e more likely to
initiate chromosomal instability than bacteria that modu-
late epithelial-cell metabolism but are otherwise not
mutagenic.
Enterococcus faecalis is a Gram-positi ve minority constitu -
ent of the colonic microbiota that can directly damage
epithelial-cell DNA (Huycke et al., 2002), promote
chromosomal instability through a macrophage-induced
bystander effect (Wang & Huycke, 2007) and trigger colitis
and cancer in interleukin (IL)-10 knockout mice (Balish &
Warner, 2002; Kim et al., 2005). The bystander effect refers
to oxidatively stressed or irradiated cells that produce
chromosomal instability in neighbouring cells through the
production of diffusible mutagens (Lorimore & Wright,
2003). These effects are derived in part from the redox-
active phenotype of E. faecalis that occurs when this micro-
organism is grown without haematin. E. faecalis cannot
synthesize porphyrins and requires this nutrient to form
functional cytochrome bd, establish a proton gradient and
respire (Bryan-Jones & Whittenbury, 1969; Ritchey &
Seeley, 1974). In con trast, growth of E. faecalis in the
absence of haematin leads to a block in respiration and the
production of superoxide, hydrogen peroxide and hydroxyl
radical (Huycke et al., 2001, 2002). These reactive oxygen
species are known to damage DNA (Marnett, 2000),
although it remains to be determined whether this redox-
active phenotype promotes inflammation and colon cance r
in IL-10 knockout mice that are monoassociated with E.
faecalis.
To explore further the effect of E. faecalis on the colonic
mucosa, we developed an in vivo colonic ligation model to
examine host gene expression in wild-type mice. This
model preserves tissue architecture and homeostasis, and
permits an analysis of gene expression in stromal and
epithelial-cell compartments. We compared E. faecalis
supplied with haematin with E. faecalis grown without
haematin to determine the effect of altered bacterial
metabolism on colonic mucosal gene expression. We
believe this comparison reflects the naturally occurring
potential dichotomous metabolism of E. faecalis in the
intestinal environment. We found the induction and
suppression of a small subset of genes involved in cell-
cycle regulation, apoptosis and nuclear factor-
kB (NF-kB)
signalling by haematin-starved E. faecalis. These findings
indicate that the colonic mucosa rapidly responds to
alternate metabolisms of E. faecalis and suggest novel
mechanisms by which this commensal may promote
inflammatory or potentially transforming events.
METHODS
Bacteria, growth conditions and superoxide assay. E. faecalis
strain OG1RF is a human oral isolate that produces extracellular
superoxide (~20
mmol min
21
per 10
9
c.f.u. in vitro), promotes
chromosomal instability, and produces colonic inflammation and
cancer when monoassociated with IL-10 knockout mice (Balish &
Warner, 2002; Huycke & Moore, 2002; Kim et al., 2005; Wang &
Huycke, 2007). E. faecalis was grown overnight in closed tubes using
brain heart infusion broth (BD Diagnostics) with or without 10
mM
haematin (Sigma), and washed in sterile PBS before use in
experiments. E. faecalis cannot synthesize porphyrins and is unable
to form functional cytochrome bd unless supplied with exogenous
haematin (Huycke, 2002). Cytochrome bd is one of two terminal
quinol oxidases expressed by E. faecalis that, when active, allows
oxidative phosphorylation, promotes growth and suppresses extra-
cellular superoxide (Huycke et al., 2001). Growth with haematin
attenuates superoxide production by .10-fold, an effect that persists
for .6hin vitro. For all experiments, haematin-replete growth of E.
faecalis was confirmed by measuring the attenuation of superoxide
using a ferricytochrome c assay as described previously (Huycke et al.,
1996). Unless otherwise specified, all chemicals were of analytical or
molecular biology grade from Sigma.
Murine colonic ligation model. To assess the short-term effects of
haematin-starved E. faecalis on the intact colonic mucosa, we
developed an intestinal ligation model. The technique is analogous
to the ileal loop model used to investigate diarrhoeal toxins.
Conventionally housed and fed 25–28 g adult male BALB/c mice
(Jackson Laboratory) were anaesthetized using 1–2 % isoflurane in a
carrier gas composed of 95 % O
2
and 5 % CO
2
. Through a 5 mm
midline abdominal incision, the proximal colon was identified at its
juncture with the caecum. Two ligatures 0.5 cm apart were placed
around the colon and a 2 mm incision was made into the colon. A
gavage needle was inserted into the colon and the contents were
completely flushed through the rectum using sterile PBS. The rectum
was closed with a purse-string ligature and the colon backfilled with
1.0 ml PBS alone or PBS containing enterococci at a concentration of
1610
8
c.f.u. ml
21
. Immediately preceding instillation, D-glucose was
added to the PBS or the bacterial inoculum to a final concentration of
5 mM. This sugar initiates extracellular superoxide production by E.
faecalis, but not for bacteria grown with haematin (Huycke et al.,
2001). Following inoculation, both colonic ligatures were tied to
prevent backflow of enterococci and peritoneal contamination from
proximal intestinal contents. Care was taken to preserve blood flow to
the colon. The surgical area was washed with sterile PBS, the colon
was gently returned to the peritoneal cavity, the abdominal incision
was closed and mice were allowed to recover.
At 1 or 6 h post-inoculation (p.i.), mice were anaesthetized, the
abdomens reopened and the colons surgically removed. The surgical
manipulations were well tolerated, with only one mouse not surviving
to the end of the protocol. Contents were cultured for enterococci as
described previously (Huycke et al., 1992). Colon biopsies of 5 mm
were obtained for histopathology and immunohistochemistry.
T. D. Allen and others
1194 Journal of Medical Microbiology 57
Page 2
Biopsies were examined using haematoxylin and eosin staining, and a
modified Brown and Brenn stain. The remaining colon segments were
opened longitudinally and the mucosal surfaces scraped with sterile
razors for RNA extraction. Biopsies were fixed in formalin and
scrapings were snap frozen in liquid nitrogen. Mice (n520) were
exposed to E. faecalis or PBS (n56) with independent experiments
analysed by group (1 and 6 h p.i.) for mice exposed to haematin-
starved E. faecalis (n55 per group), E. faecalis grown with haematin
(n55 per group) or PBS (n53 per group). The animal protocol was
approved by the Animal Studies Subcommittee of the Veterans Affairs
Research and Development Committee.
Gene expression, network response and transcriptional reg-
ulatory element analyses.
Total RNA was isolated from colonic
scrapings for mice exposed to haematin-replete or haematin-starved
E. faecalis at 1 and 6 h p.i. using an Atlas pure total RNA labelling
system (BD Biosciences Clontech). Probes were synthesized by reverse
transcription using
[
a-
33
P
]
dATP. As the quantities of mucosal
scrapings from individual colons were small, each sample was used
in its entirety for probe synthesis. Extracted and labelled cDNA
probes were hybridized overnight to 5000 cDNA murine arrays (BD
Biosciences Clontech). Separate arrays (n55 per group for a total of
20 arrays) were used for each probe prepared from colon scrapings.
After high-stringency washes, membranes were quantified (Storm 820
PhosphorImager; Amersham Biosciences) and expression of indi-
vidual genes was determined as absorbance readings minus
background (ArrayVision software; Imaging Research). Significantly
upregulated and downregulated genes were analysed using
GeneSpring software version 6.2 (Silicon Genetics). After background
subtraction, raw signals were normalized per spot and by array, using
an intensity-dependent Lowess protocol. Signal intensities were
normalized to the 50th percentile, and comparisons between array
results at the 1 and 6 h time points were made using Student’s t-test
with P,0.005 considered significant. Fold changes were calculated
using the GeneSpring fold change filter option. The Benjamini–
Hochberg method was used to correct for multiple testing and to
minimize false discovery rates.
Biologically relevant response networks for significantly modulated
genes were constructed using Ingenuity Pathways Analysis (Ingenuity
Systems; www.ingenuity.com). The Ingenuity Pathways Knowledge
Base is the largest curated database on mammalian biology in the
published literature. Findings on genes in human, mouse and rat
studies from peer-reviewed publications are encoded into an ontology
by content and modelling experts. Manual extraction and curation
identifies specific interactions that result in fewer false positives than
automated methods. Networks are algorithmically generated based on
their connectivity, and pathways of highly interconnected genes are
identified by statistical likelihood testing (Calvano et al., 2005).
In silico analysis of differentially expressed genes was performed for
transcription factor-binding sites using the web-based Promoter
Analysis and Interaction Network Tool software (Vadigepalli et al.,
2003). Comparisons were carried out using all genes on the murine
array as the reference library.
Immunohistochemistry. Immunohistochemical analysis of the p65
component of NF-
kB was performed on serial sections of paraffin-
embedded murine colon tissue. Antigen retrieval of deparaffinized
sections was performed using a decloaking chamber (Biocare
Medical) with citrate buffer or 0.1 % pronase (Dako) and processed
using the Sequenza staining method (Thermo Scientific). Endogenous
peroxidase activity was quenched using peroxidase-blocking reagent
(Dako) followed by a blocking step with buffer containing 1 % BSA
(Jackson ImmunoResearch), 1 % normal horse serum (Jackson
ImmunoResearch), coldwater fish gelatin and Tween 20. Sections
were stained using nuclear localization sequence (NLS)-specific
anti-p65 antibody (diluted 1 : 300; Rockland Immunochemicals) or
anti-F4/80 mAb (diluted 1 : 150; AbD Serotec). The former antibody
recognizes the NLS on p65 that is masked by I
kB. The F4/80 antigen is
a surface marker expressed by mature murine macrophages (Austyn
& Gordon, 1981). After primary incubation with NLS-specific anti-
p65 antibody, sections were incubated in horseradish peroxidase
(HRP)-labelled EnVision+ (Dako). Sections stained with anti-F4/80
antibody were developed using anti-rat secondary antibody (diluted
1 : 1000; Jackson ImmunoResearch), followed by incubation with
ready-to-use streptavidin–HRP solution (Dako). Following incuba-
tion, sections were developed with 3,3-diaminobenzidine substrate or
Bajoran Purple (Biocare Medical) and counterstained with haema-
toxylin (Biocare Medical). The distribution of positive cells per field
(magnification 1006) between groups was assessed in a randomized
and blind fashion, and compared using ridit analysis, with P,0.05
considered significant (Fleiss, 1981). This method assumes that
discrete measures represent intervals in an underlying continuous
distribution without any assumptions about the distribution. Ridits
range from 0 to 1 and the ridit for the control (or comparator)
distribution is 0.50. A mean ridit is .0.50 when more than half of the
time randomly selected measures from the experimental distribution
have a value greater than randomly selected measures from the
control distribution.
Colon sections were processed for netrin-1 immunohistochemistry
using UltraVision LP detection system HRP polymer and AEC
chromogen (LabVision). Sections were blocked with H
2
O
2
for 10 min
to inhibit endogenous peroxidase activity, followed by washes in Tris-
buffered saline with Tween 20 at pH 8.0. Following antigen retrieval,
Ultra V block (Dako) was applied for 5 min followed by a 1 : 20
dilution of rabbit anti-netrin-1 (Ab-1) primary antibody or control
peptide following the manufacturer’s instructions (Calbiochem).
Sections were counterstained with Immuno* master haematoxylin
(American Master*Tech Scientific).
Cell lines. Chromosomally stable HCT116 colonic epithelial
cells (AmericanTypeCultureCollection) were grown in 5 % CO
2
at
37 uC using McCoy’s 5A medium modified by
L-glutamine
and 25 mM HEPES (Invitrogen) and supplemented with 10 %
fetal bovine serum (FBS). RAW264.7 murine macrophages
(American Type Culture Collection) were grown under the same
conditions using Dulbecco’s modified Eagle’s medium modified with
4.5 g glucose l
21
and L-glutamine (Invitrogen) and supplemented
with 10 % FBS. For experiments involving co-incubation with E.
faecalis, bacteria were diluted to 1610
9
c.f.u. ml
21
in fresh medium
without FBS. YAMC cells are a non-transformed intestinal epithelial
cell line derived from healthy tissue and were a gift from the Ludwig
Institute for Cancer Research (Whitehead et al., 1993). These cells
were grown in 5 % CO
2
at 33 uC using RPMI 1620 (Invitrogen)
supplemented with 5 % FBS, 5 U recombinant murine gamma
interferon (PeproTech) ml
21
and ITS Premix (BD) according to
the manufacturer’s instructions. After treatment, cells were washed
with PBS and complete medium was added containing gentamicin
(10
mgml
21
) and penicillin (100 U ml
21
) to kill any remaining
extracellular bacteria. For H
2
O
2
-treated cells, catalase (1200 U ml
21
)
was also included in the complete medium to eliminate residual
H
2
O
2
.
Immunofluorescent assay. To visualize NF-kB activation, E.
faecalis-treated RAW264.7 cells and HCT116 cells grown on
chambered slides were fixed with paraformaldehyde and incubated
with polyclonal anti-p65 IgG (diluted 1 : 100; Santa Cruz
Biotechnology). A fluorescein isothiocyanate (FITC)-conjugated IgG
(diluted 1 : 200; Santa Cruz Biotechnology) was used as the secondary
antibody and nuclei were counterstained with 49,6-diamidino-2-
phenylindole (DAPI) prior to laser-scanning confocal microscopy
(LSM-510 META; Zeiss).
E. faecalis modulates mucosal gene expression
http://jmm.sgmjournals.org 1195
Page 3
NF-kB–luciferase reporter assay. To verify NF-kB activation,
RAW264.7 cells were transfected with the pNF
kB-Luc reporter vector
(Clontech) using Lipofectin reagent (Invitrogen). Transfected cells
were treated with E. faecalis for 1 h and further incubated for 24 h.
LPS treatment (10
mgml
21
) served as a control. Cell lysates were
prepared using reporter lysis buffer according to the manufacturer’s
instructions (Promega). Luciferase activity was measured using a
luciferase assay system (Promega) and a TD-20/20 luminometer
(Turner Designs). Values were normalized to protein concentration.
Cell-cycle and apoptosis assays. The ability of E. faecalis to
activate colonic epithelial-cell checkpoints or initiate apoptosis was
assessed by flow cytometry. Following a 1 h treatment with E. faecalis,
HCT116 or YAMC cells were incubated in fresh medium containing
FBS, gentamicin and penicillin. Cells were fixed overnight with 70 %
ethanol and stained with propidium iodide (0.02 mg ml
21
) contain-
ing 0.1 % Triton X-100 and 0.2 mg RNase A ml
21
. Stained cells were
analysed using a FACSCalibur flow cytometer (BD Immunocytometry
Systems). Apoptotic cells were stained using the Annexin V FITC
apoptosis detection kit according to the manufacturer’s instructions
(Calbiochem, EMD Biosciences) and quantified by flow cytometry.
Data were analysed using CellQuest Pro software. Statistical analyses
were performed using ModFit version 2.2 software (Verity Software
House). For each sample, .10 000 events were collected and groups
were compared using Student’s t-test with P,0.05 considered
significant.
Quantitative real-time RT-PCR (qRT-PCR) and gene silencing.
Total mRNA was isolated from E. faecalis-treated cells using a
NucleoSpin RNA II kit (BD Biosciences) and 2
mg was reverse-
transcribed with an iScript cDNA synthesis kit according to the
manufacturer’s instructions (Bio-Rad Laboratories). qRT-PCR was
performed using an Mx3005P Q-PCR System following the manu-
facturer’s instructions (Stratagene). Primers used to assess expression
of genes identified in the array experiment (Table 1) were purchased
from Integrated DNA Technologies. The gene for netrin-1 was
silenced by RNA interference using siGENOME SMARTpool reagent
specific for human NTN1 or with an siCONTROL non-targeting
siRNA pool (Dharmacon). Transient transfections were performed
using DharmaFECT 4 transfection reagent (Dharmacon) according to
the manufacturer’s protocol and gene silencing was confirmed by
qRT-PCR. Groups were compared using Student’s t-test with P,0.05
considered significant.
Western blotting. Total protein was extracted from cells and equal
amounts were analysed by SDS-PAGE before transfer to PVDF
membranes (Amersham Biosciences). Assays for netrin-1 were
performed using goat polyclonal anti-human netrin-1 antibody and
alkaline phosphatase-conjugated rabbit anti-goat IgG as the secondary
antibody (Santa Cruz Biotechnology) and antibody binding was
detected using an ECF Western blotting detection system (Amersham
Biosciences) according to the manufacturer’s instructions.
RESULTS AND DISCUSSION
E. faecalis activates NF-kB in colonic
macrophages
To assess the short-term effects of haematin-starved E.
faecalis on colonic gene expression, we developed an in vivo
ligation model that preserved mucosal architecture and
homeostasis. The mean con centrations of E. faecalis
recovered from luminal contents at 1 and 6 h p.i. were
approximately 10-fold lower than the initial inocula but
were not significantly different for mice administered
haematin-starved E. faecalis compared with haematin-
replete E. faecalis. No histo logical abnormalities were noted
for colon biopsies at either time point for any group. In
addition, epithelial or submucosal cocci were not visi ble by
a tissue Gram stain, indicating that an acute mucosal
infection had not occurred (data not shown).
As haematin-starved E. faecalis induces COX-2 expression
in macrophages in vitro (Wang & Huycke, 2007) and COX-
2 is regulated via NF-
kB (Karin & Greten, 2005), we
initially determined whether E. faecalis activated this
redox-sensitive signalling pathway in the colon. NF-
kB
was detected using an NLS-specific anti-p65 antibody that
detects p65 only after it dissociates from I
kB. p65 is a
member of the canonical NF-
kB pathway and is activated
by many stimuli including redox stress and exposure to
bacteria (Karin & Greten, 2005). We found significantly
increased numbers of cells with p65 nuclear staining in
colons exposed to E. faecalis at 6 h compared with PBS
controls (ridit50.57, P50.008). Although an increase in
NF-
kB activation was found for colons exposed to
haematin-starved compared with haematin-replete E.
faecalis, this difference was not statistically significant
(ridit50.52, P50.25). To identify mucosal cells with NF-
kB activation, we stained serial colon sections with the
NLS-specific anti-p65 antibody and an anti-F4/80 mAb.
Nearly all cells positive for p65 also stained positive for
F4/80, indicating that this redox-sensitive si gnalling
pathway had been activated in tissue macrophages
(Fig. 1a, b). In contrast, no staining for the NLS of p65
was noted in epithelial cells.
To determine whether E. faecalis activated NF-
kB in vitro,
we exposed macrophage and epithelial cell lines to
haematin-starved bacteria. Strong nuclear staining, along
Table 1. Primer pairs for qRT-PCR
Target gene Forward primer (5§A3§) Reverse primer (5§A3§)
NTN1 (human) CCCTGCATAAAGATCCCTGT CAGTCTTCAGGCTCCTCCAC
Ntn1 (murine) TTGCATCAAGATTCCTGTGG GGCCTTGCAATAGGAGTCAC
C3ar1 (human, murine) TCCTCTGCTGCCTCTCCTT CAGGAAGACACTGGCAAACA
Cyr61 (human, murine) GAATCTACCAAAACGGGGAAA GTTCTTGGGGACACAGAGGA
Akap8l (human, murine) TGGGTATGGTATGGCCACTT ATAAAACGGAATCGGCACTG
ActB (human, murine) TGCCGACAGGATGCAGAAG CTCAGGAGGAGCAATGATCTTGAT
T. D. Allen and others
1196 Journal of Medical Microbiology 57
Page 4
with cytoplasmic staining, was noted in macrophages by
laser-scanning confocal microscopy (Fig. 1c). NF-
kB
activation was noted as early as 3 h p.i. and persisted for
.48 h. In comparison, HCT116 cells exposed to E. faecalis
did not lead to nuclear localization of p65 (data not shown).
To verify NF-
kB activation in macrophages, we transfected
RAW264.7 cells with the pNF
kB-Luc reporter plasmid.
Compared with the control, there was a .25-fold increase in
NF-
kB activation at 24 h following exposure to haematin-
starved E. faecalis (Fig. 1d). Furthermore, manganese
superoxide dismutase (MnSOD) significantly reduced NF-
kB activation (P50.005), indicating that extracellular
superoxide from haematin-starved bacteria contributed to
this effect. The addition of catalase did not further decrease
NF-
kB activation by haematin-starved E. faecalis, although
H
2
O
2
alone activated NF-kB in these cells.
NF-
kB regulates genes involved in cellular proliferation,
immunity and apoptosis (Karin & Greten, 2005).
Activation of NF-
kB requires the phosphorylation of IkB
by I
kB kinase. This results in IkB degradation and
release of NF-
kB homo- and heterodimers to translocate
into the nucleus. NF-
kB promotes tumorigenesis by inhibi-
ting apoptosis, dysregulating tumour-specific immune
responses and producing reactive oxygen species that can
damage genomic DNA. Our findings indicate that
haematin-starved E. faecalis activates NF-
kB, in part, by
producing extracellular superoxide. Although reactive
oxygen species (including superoxide) can activate NF-
kB, this effect is unpredictable and typically cell-dependent
(Gloire et al., 2006). Many studies use H
2
O
2
as an oxidative
stress, although superoxide should also be considered as it
may lead to dissimilar effects. For example, superoxide is
required for IL-1-dependent NF-
kB activation in chon-
drocytes (Mendes et al., 2003), enhances LPS-dependent
NF-
kB activation in macrophages (Khadaroo et al., 2003)
and initiates NF-
kB activat ion in neutrophils (Mitra &
Abraham, 2006). In this study, MnSOD significantly
Fig. 1. Haematin-starved E. faecalis activates NF-kB in macrophages. Serial sections of colon exposed to E. faecalis for 6 h
were stained with NLS-specific anti-p65 antibody (a) and anti-F4/80 mAb (b). NF-kB activity was localized to F4/80-positive
tissue macrophages (indicated by arrows, magnification 40¾). (c) RAW264.7 cells treated with E. faecalis (1 h, 1¾10
9
c.f.u.
ml
1
) exhibited cytoplasmic and nuclear localization of p65 (stained green with FITC; magnification 63¾) by laser-scanning
confocal microscopy at 24 h post-treatment, whereas untreated cells primarily exhibited cytoplasmic staining (nuclei stained
blue with DAPI). (d) pNFkB-Luc-transfected macrophages showed increased NF-kB induction following treatment with E.
faecalis; MnSOD significantly decreased E. faecalis-dependent NF-kB induction, whilst catalase caused no further reduction
(see Methods for details). Data are means±
SEM for at least six experiments. *, P50.005; **, P50.01; ***, P,0.0002 compared
with E. faecalis.
E. faecalis modulates mucosal gene expression
http://jmm.sgmjournals.org 1197
Page 5
decreased E. faecalis-dependent induction of NF-kBin
RAW264.7 cells, confirming that this anionic radical can
potentiate NF-
kB activation beyond that seen with H
2
O
2
alone.
Colonic mucosal gene response to haematin-
starved E. faecalis
To determine how broadly the haematin-starved physi-
ology of E. faecalis modulated gene expression in the
colonic mucosa, we compared mRNA from mice for
.5000 genes following exposure to haematin-starved E.
faecalis with mRNA following exposure to haematin-
replete E. faecalis. At 1 h p.i., six colonic mucosal genes
were differentially regulated (Sod2, Sod3, Agtrl1, Vav1,
Car4 and Nme6; P,0.01 for each). At 6 h, 25 genes were
significantly downregulated and 17 genes upregulated
(Table 2). Of the differentially regulated genes at the 1 h
time point, only Sod3 and Car4 were still differentially
regulated at 6 h. For the 42 colonic mucosal genes
differentially expressed by haematin-starved E. faecalis,
nine (21 %) were related to inflammatory or stress
responses and ten (24 %) involved pathw ays for cell-cycle
control, signalling and apoptosis. In addition, several were
expressed by immune effector cells, suggesting that acute
colonic mucosal responses to haematin-starved E. faecalis
involve innate and/or adaptive immunity.
To identify potential biological interaction networks for
these differentially regulated genes, we subjected genes at
the 6 h time point to Ingenuity Pathways Analysis. Only
one highly significant mucosal response network was
identified (Fig. 2; P,0.0001). Functions within this
network included cell-cycle regulation, inositol phosphate
metabolism, NF-
kB signalling (RelA or p65), ERK/MAPK
signalling, chemokines, T-cell receptors, integrins and
fibroblast growth factor. Exploration of potential regula-
tory responses within the network was performed using in
silico transcriptional regulatory element analysis. One
hundred and eleven transcriptional regulatory elem ents
were associated with the forty-two differentially regulated
genes. When we compared the frequency of these elements
with elements for all genes on the murine array, there were
only five significantly over-represented elements: three for
NF-
kB (including the sequence for p65 binding), HEN1
and GATA-1. In addition, 66 (59 %) of the 111
transcriptional regulatory elements were significantly
under-represented. Overall, these findings indicate that
haematin-starved E. faecalis acutely activates NF-
kB
signalling in the colonic mucosa.
These in silico analyses identified a single response network
with seven upregulated mucosal genes. p65 was the major
transcription factor in this network, and in biopsies NF-
kB
activity localized to tissue macrophages. The mechanism by
which E. faecalis contacts tissue macrophages w as not
investigated, but may involve translocation of enterococci
through follicle-associated M cells in the colon
(Kraehenbuhl & Neutra, 2000). These specialized epithelial
cells facilitate uptake of luminal bacteria and coordinate
their interaction with innate and adaptive immune effector
cells. Enterococci readily translocate across the intact
intestinal epithelium and, in murine models, are often
recovered from the liver, spleen and mesenteric lymph
nodes (Wells et al., 1990). This phenomenon may derive, in
part, from ineffective killing of E. faecalis by macrophages
(Gentry-Weeks et al., 1999). In the colonic ligation model,
the concentration of luminal bacteria at 6 h was 10-fold
lower than the original inoculum. Epithelial translocation
is one possible explanation for a decrease in colony counts.
Several genes within the mucosal response network were
associated with NF-
kB signalling including C3ar1, Cyr61
and Akap8l. C3AR1 (complement component 3a receptor
1) induces NF-
kB activation when coupled to Ga
16
(Yang
et al., 2001). Similarly, Cyr61 (cysteine-rich protein 61) is
associated with NF-
kB signalli ng, inflammation and
angiogenesis (Klein et al., 2002), as well as anti-apoptotic
effects when overexpressed in breast cancer (Lin et al.,
2004). Although CYR61 has been implicated in the
progression of breast cancer (Xie et al., 2001), it can also
act as a tumour suppressor (Chien et al., 2004). Finally,
AKAP8L (nuclear protein kinase A anchoring protein) can
bind NF-
kB, although the significance of this interaction is
unclear (Bouwmeester et al., 2004). Several other genes in
the mucosal response network have been implicated in
cancer biology. For example, MCM2 (minichromosome
maintenance 2 protein) binds to the nuclear scaffold
created by AKAP8L and promotes apoptosis in cancer cells
(Feng et al., 2003). In contrast, TIMP2 (inhibitor of matrix
metalloproteinase 2) inhibits apoptosis and allows tumour
growth (Egeblad & Werb, 2002), although its overexpres-
sion is inhibitory (Gomez et al., 1997). The net long-term
effect of haematin-starved E. faecalis on the colonic mucosa
cannot be discerned from this study, although the
complexity of the early response is apparent.
E. faecalis blocks G
2
/M transition in intestinal
epithelial cells
As the mucosal response network indic ated differential
expression of genes involved in apoptosis and because
reactive oxygen species from E. faecalis can damage colonic
epithelial-cell DNA to initiate programmed cell death
(Huycke et al., 2002), we investigated the effect of
superoxide on cell-cycle checkp oints and apoptosis. Both
HCT116 and YAMC cells exposed to haema tin-starved E.
faecalis for 1 h developed marked arrest at the G
2
/M
transition by 48 h (Fig. 3a, b, c, d). This effect was partially
reversed with MnSOD and completely abolished when
MnSOD and catalase were both added to bac teria-treated
cells. The effect of catalase sugges ted that H
2
O
2
, whi ch
spontaneously arises from the disproportionation of
superoxide, also contributed to activation of the G
2
/M
checkpoint. Treatment of HCT116 cells with H
2
O
2
alone is
known to cause this arrest (Chang et al., 2003), but our
findings showed a greater proportion of arrested cells
T. D. Allen and others
1198 Journal of Medical Microbiology 57
Page 6
Table 2. Colonic mucosal genes with significantly altered expression following a 6 h exposure to haematin-starved E. faecalis
compared with E. faecalis grown with haematin
Gene symbol Gene product Fold change P value
Inflammation and stress response
C3ar1* Complement component 3a receptor 1 +6.1 0.005
Prdx3 Peroxiredoxin 3 +6.1 0.001
Tnfsf10 Tumour necrosis factor (ligand) superfamily, member 10 283.3 3.7610
25
Xrcc6 X-ray repair complementing defective repair in Chinese
hamster cells 6
266.7 1.5610
24
Cxcl2 Chemokine (CXC) ligand 2 250 5.5610
24
Tnfaip6 Tumour necrosis factor-induced protein 6 250 7.6610
24
Sod3D Superoxide dismutase 3, extracellular 243.5 0.002
F2rl1 Coagulation factor II (thrombin) receptor-like 1 238.5 8.9610
24
Hspa4 Heat-shock protein 4 229.4 0.005
Cell-cycle regulation, apoptosis and cell signalling
Mcm2* Minichromosome maintenance deficient 2 mitotin
(Saccharomyces cerevisiae)
+6.1 0.002
Ntn1* Netrin 1 +5.3 0.004
Gja10 Gap junction membrane channel protein
a10 +4.9 1.2610
25
Cyr61* Cysteine-rich protein 61 +4.6 0.004
Timp2* Tissue inhibitor of metalloproteinase 2 +3.7 9.6610
24
Gpc3* Glypican 3 +3.7 0.005
Efna4 Ephrin A4 271.4 1.0610
24
Cdc2l1 Cell division cycle 2-like 1 252.6 0.001
Ptp4a1 Protein tyrosine phosphatase 4a1 241.7 0.002
Mapk6 Mitogen-activated protein kinase 6 234.5 0.002
Transcriptional regulation and DNA binding
Tal2 T-cell acute lymphocytic leukaemia 2 +4.6 5.5610
24
Nr2c1 Nuclear receptor superfamily 2, group C, member 1 252.6 1.2610
24
Arnt2 Aryl hydrocarbon receptor nuclear translocator 2 250 6.4610
24
Hoxd8 Homeobox D8 247.6 0.004
Gcl Germ cell-less homologue (Drosophila) 245.5 0.005
Meox2 Mesenchyme homeobox 2 240 5.2610
24
Six6 Sine oculis-related homeobox 6 homologue (Drosophila) 235.7 0.002
Ddx3x DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 3, X-linked 234.5 0.001
Signal transduction
Gnaq Guanine nucleotide-binding protein,
aq polypeptide 266.7 1.7610
24
Arl4 ADP-ribosylation factor-like 4 258.8 3.3610
24
Gpr34 G protein-coupled receptor 34 222.2 0.005
Calcium ion binding and transport
Fbln1* Fibulin 1 +6.2 0.001
Nptx1 Neuronal pentraxin 1 +5.8 0.004
Cacnb3 Calcium channel, voltage dependent,
b3 subunit +5.2 0.001
Metabolism
Yme1l1 YME1-like 1 (S. cerevisiae) +5.6 0.003
Car4D Carbonic anhydrase 4 +2.4 7.3610
26
Psmb2 Proteasome (prosome, macropain) subunit, b type 2 211.6 5.1610
24
Mlycd Malonyl-CoA decarboxylase 29.8 0.004
Structural and miscellaneous
Tekt1 Tektin 1 +9.2 0.002
Akap8l* A-kinase (PRKA) anchor protein 8-like +3.0 0.002
Ppp3cc Protein phosphatase 3, catalytic subunit,
c isoform +2.2 1.8610
24
Nte Neuropathy target esterase 220.8 0.003
Gdi1 Guanosine diphosphatase dissociation inhibitor 1 24.2 0.007
*Genes that are part of the mucosal response network induced by haematin starvation (see Fig. 2).
DGenes also differentially regulated at the 1 h time point.
E. faecalis modulates mucosal gene expression
http://jmm.sgmjournals.org 1199
Page 7
following exposure to haematin-starved E. faecalis than
H
2
O
2
alone.
To determine whether G
2
/M checkpoint activation by
haematin-starved E. faecalis was associated with an increase
in apoptosis, we examined HCT116 cells for early apoptotic
cells and noted no increase at 24 and 48 h compared with
no-treatment controls (Fig . 3e). In contrast, HCT116 cells
exposed to H
2
O
2
showed significantly increase d apoptosis
at 24 h. These findings did not involve NF-kB, as nuclear
localization of p65 was not found by laser-scanning
confocal microscopy at 6, 24, 48 or 72 h (data not shown).
In contrast to transformed HCT116 cells, the primary non-
transformed YAMC cells showed significantly increased
apoptosis at 48 h following exposure to haematin-starved
E. faecalis or H
2
O
2
treatment (Fig. 3f).
We demonstrated previously that E. faecalis can damage
colonic epithelial-cell DNA (Huycke et al., 2002). In the
current study, we found that extracellular superoxide from
E. faecalis activates the G
2
/M checkpoint in HCT116 and
YAMC cells. This effect was partially reversed by MnSOD
and completely eliminated when both MnSOD and catalase
were used, suggesting that extracellular superoxide and
H
2
O
2
each contributed to cell-cycle modulation. Arrest at
the G
2
/M transition can be triggered by DNA double-
strand breaks to activate pathways that allow mitosis to
proceed after DNA repair or, alternatively, to initiate
apoptosis (Nougayrede et al., 200 6; Taieb et al., 2006).
Differing outcomes following exposure to haematin-
starved E. faecalis were apparent for HCT116 and YAMC
cells, and demonstrated how cellular responses to DNA
damage vary by cell type. Finally, we noted in a prior study
that a minority of cells exposed to haematin-starved
E. faecalis failed to repair DNA damage or to initiate
apoptosis and subsequently developed chromosomal
instability (Wang & Huycke, 2007).
The DNA-damaging effects of commensals on the colonic
mucosa may not be limited to E. faecalis. Pathogenic and
commensal strains of E. coli express hybrid peptide–
polyketide and cytolethal distending toxins that produce
DNA double-strand breaks, arrest at the G
2
/M transition
and cell death (Nougayrede et al., 2006; Taieb et al., 2006).
Other examples include commensal bacteria that utilize
sulfate as an oxidant (in the assimilatory pathway) or
terminal electron acceptor (in the dissimilatory pathway)
to dispose of hydrogen-reducing equivalents (Gibson et al.,
1988). The net result of this metabolism is hydrogen sulfide
that, like superoxide, can be genotoxic to epithelial cells
(Attene-Ramos et al., 2006). DNA double-strand breaks
created by reactive oxygen species, hydrogen sulfide or
other clastogens should activate DNA damage repair
responses and activate the G
2
/M checkpoint (Su, 2006).
Ongoing DNA damage could lead to the accumulation of
Fig. 2. Colonic mucosal response network. Genes significantly upregulated by haematin-starved E. faecalis at 6 h p.i. are
highlighted in bold and the network was identified by Ingenuity Pathways Analysis. Direct interaction refers to gene products
with direct effects on targets; indirect interaction refers to gene product effects on targets through intermediate effectors.
T. D. Allen and others
1200 Journal of Medical Microbiology 57
Page 8
mutations important to oncogenic transformation.
Investigations are underway in our laboratory to explore
these issues.
Regulation of netrin-1 by extracellular superoxide
from E. faecalis
To investigate further the gen e response network in vitro,
we screened HCT116, YAMC and RAW264.7 cells by qRT-
PCR for differential regulation of selected upregulated
genes in the network known to be transcriptionally
regulated by NF-
kB or involved in apoptosis (Table 1).
Of these, only NTN1 in HCT116 cells was significantly
upregulated by haematin-starved E. faecalis (Fig. 4). The
inability to detect similar changes in gene expression in
vitro using these cells compared with the in vivo model
probably represents inherent differences between trans-
formed cells and complex multicellular tissues in living
animals (Waddell et al., 2007). Indeed, the rationale for the
in vivo model was to avoid oversimplification of host–
commensal interactions found in homogeneous in vitro
culture systems.
Netrin-1 is an extracellular liga nd secreted by inte stinal
epithelial cells that binds basolateral epithelial receptors
such as DCC (Arakawa, 2004). When left unbound, these
50
30
10
_
10
_
30
_
50
_
70
1
Change in G
1
phase (%)
2
24 h 48 h
34 1234
50
30
10
_
10
_
30
_
50
_
70
1
Early apoptotic cells (%)
10
8
6
4
2
Control
(c)
(e)
(d)
(f)
(b)
(a)
1234
Control
Control
**
H
2
O
2
(200 mM)
1234
Control 1 2 3 4
Control 1 2 3 4
2
24 h 48 h
34 1234
50
30
10
_
10
_
30
_
50
_
70
1
Change in G
2
/M phase (%)
2
24 h 48 h
34 1234
50
30
10
_
10
_
30
_
50
_
70
12
24 h
24 h 48 h
48 h
34 1234
50
30
10
_
10
_
30
_
50
_
70
1
Change in S phase (%)
2
24 h 48 h
34 1234
50
30
10
_
10
_
30
_
50
_
70
12
24 h 48 h
34 1234
E. faecalis
Early apoptotic cells (%)
40
30
20
10
Control
***
*
H
2
O
2
(200 mM)
E. faecalis
Fig. 3. Haematin-starved E. faecalis alters the epithelial cell cycle and fails to induce apoptosis in colonic epithelial cells. (a, b)
Changes in the HCT116 (a) and YAMC (b) cell cycle at 24 and 48 h following a 1 h exposure to E. faecalis, and (c, d)
representative histograms from HCT116 (c) and YAMC (d) cells demonstrating a pattern of arrest at the G
2
/M transition.
Treatments: 1, H
2
O
2
(200 mM); 2, E. faecalis (1¾10
9
c.f.u. ml
1
); 3, as in treatment 2 plus MnSOD (1200 U ml
1
); 4, as in
treatment 3 plus catalase (1200 U ml
1
). Data are the means±SD of at least three experiments. (e, d) The percentage of early
apoptotic cells in HCT116 (e) and YAMC (f) cells at 24 h (white bars) and 48 h (black bars) following 1 h exposure to E.
faecalis or H
2
O
2
(200 mM) compared with untreated cells. Data are the means±SD of at least five experiments. *, P50.03; **,
P,0.002; ***, P,0.0001 compared with the control at each time point.
E. faecalis modulates mucosal gene expression
http://jmm.sgmjournals.org 1201
Page 9
receptors initiate signalling pathways that lead to apopto-
sis. The role of netrin-1 in tumorigenesis was established
using Apc
+/1638N
mice where overexpression led to
intestinal hyperplasia and high-grade tumours (Mazelin
et al., 2004). Addition of MnSOD reduced E. faecalis-
induced NTN1 expression by 2.5-fold (P5 0.001), indic-
ating that extracellular superoxide was partially responsible
(Fig. 4).
Although we detected abundant expression of netrin-1 in
the murine colonic mucosa by immunohistochemistry, no
significant differences in immunoreactivity were found for
any group of mice. The lack of differential staining may
have been due to insufficient time for tissue protein
concentrations to change (i.e. only 6 h). To determine
whether increased netrin-1 expression in HCT116 cells
explained the lack of increased apoptosis in HCT116 cells
following exposure to E. faecalis (Fig. 3e), we used short
interfering RNA to knock down NTN1 expression. Gene
silencing led to an 83–90 % reduction in NTN1 mRNA for
cells exposed to haematin-starved E. faecalis compared with
untransfected controls or cells transfected with scrambled
short interfering RNA. The propo rtion of cells undergoing
apoptosis in NTN1-si lenced cells, however, proved no
different than for untransfected controls (data not shown).
This result could have been due to a lack of functional
receptors for netrin-1 on HCT116 cells or to defects in the
secretion of netrin-1. When We stern blots were performed,
netrin-1 was not detected (data not shown), implying that
other mechanisms are responsible for the inhibition of
apoptosis in these cells following exposure to haematin-
starved E. faecalis.
Several factors merit consideration when interpreting the
results of this study. Because cDNA from mucosal
scrapings were used, by necessity, in their entirety to
synthesize probes, we cou ld not check changes in gene
expression for arrays by qRT-PCR. To overcome this
limitation, we performed ten arrays per time point to
increase the number of independent replicates. This
resulted in a robust dataset for the identification of genes
with differing expression. Furthermore, we defined altered
gene expression using conservative rules in order to
identify only those genes that were highly likely to have
undergone induction or repression by haematin-starved E.
faecalis. Additional genes may have been identified using
less rigorous cut-offs. This, in turn, could have expanded
the gene response network or identi fied other networks,
but would not have changed the primary conclusion of this
study, which is that the metabolic activity of intestinal
commensals can acutely alter colonic mucosal gene
expression. The short-term nature of our colonic ligation
model only permitted an examination of early-response
genes. Longer-term studies will require intestinal coloniza-
tion or a gnotobiotic design. Finally, although superoxide
from haematin-starved E. faecalis induced NTN1, knock-
down of this gene had no affect on apoptosis, as secretion
of this ligand appeared defective in these cells.
In summary, we found that the uniquely dichotomous
metabolism of E. faecalis, a colonic commensal with a
rudimentary respiratory chain that requires exogenous
haematin for oxidative phosphorylation, can significantly
modulate gene expression in the colonic mucosa. In vivo, in
silico and in vitro analyses identified genes and signalling
pathways that are associated with in flammation, apoptosis
and cell-cycle regulation. Overall, these results suggest
mechanisms by which E. faecalis might enhance epithelial-
cell susceptibility to DNA damage through the activation of
tissue macrophages and by modulating apoptosis in
epithelial cells.
ACKNOWLEDGEMENTS
This work was supported by a grant from the Office of Research and
Development, Medical Research Service, Department of Veterans
Affairs Medical Center and Frances Duffy Endowment. Special thanks
to Richardo Saban and Robert Hurst for helpful advice, Stanley
Lightfoot for assistance with histopathology, Wei-Qun Ding for the
plasmid construct pNF
kB-Luc, Jim Henthorn at the University of
Oklahoma Health Sciences Center Cytometry Laboratory and Ben
Fowler at the Oklahoma Medical Research Foundation Core Imaging
Facility.
REFERENCES
Arakawa, H. (2004). Netrin-1 and its receptors in tumorigenesis. Nat
Rev Cancer 4, 978–987.
Attene-Ramos, M. S., Wagner, E. D., Plewa, M. J. & Gaskins, H. R.
(2006).
Evidence that hydrogen sulfide is a genotoxic agent. Mol
Cancer Res 4, 9–14.
Augenlicht, L. H., Mariadason, J. M., Wilson, A., Arango, D., Yang, W.,
Heerdt, B. G. & Velcich, A. (2002).
Short chain fatty acids and colon
cancer. J Nutr 132, 3804S–3808S.
Austyn, J. M. & Gordon, S. (1981). F4/80, a monoclonal antibody
directed specifically against the mouse macrophage. Eur J Immunol
11, 805–815.
8
6
*
*
4
2
Relative NTN1 induction
(fold change control ± SD)
E. faecalis
E. faecalis
+ MnSOD
Fig. 4. Extracellular superoxide from haematin-starved E. faecalis
induces NTN1 expression in HCT116 cells. qRT-PCR of NTN1,
after normalizing the values to b-actin mRNA, showed significantly
greater upregulation at 24 h (P50.001) following a 1 h exposure
to E. faecalis (1¾10
9
c.f.u. ml
1
) compared with cells exposed to
E. faecalis with MnSOD (1200 U ml
1
). Data are the means±SD
for six experiments. *, P,0.0001 compared with control.
T. D. Allen and others
1202 Journal of Medical Microbiology 57
Page 10
Ba
¨
ckhed, F., Ley, R. E., Sonnenburg, J. L., Peterson, D. A. & Gordon,
J. I. (2005). Host–bacterial mutualism in the human intestine. Science
307, 1915–1920.
Balish, E. & Warner, T. (2002). Enterococcus faecalis induces
inflammatory bowel disease in interleukin-10 knockout mice. Am J
Pathol 160, 2253–2257.
Benno, Y., Suzuki, K., Suzuki, K., Narisawa, K., Bruce, W. R. &
Mitsuoka, T. (1986).
Comparison of the fecal microflora in rural
Japanese and urban Canadians. Microbiol Immunol 30, 521–532.
Bouwmeester, T., Bauch, A., Ruffner, H., Angrand, P. O., Bergamini, G.,
Croughton, K., Cruciat, C., Eberhard, D., Gagneur, J. & other authors
(2004).
A physical and functional map of the human TNF-a/NF-kB
signal transduction pathway. Nat Cell Biol 6,97105.
Bryan-Jones, D. G. & Whittenbury, R. (1969). Haematin-dependent
oxidative phosphorylation in Streptococcus faecalis. J Gen Microbiol 58,
247–260.
Calvano, S. E., Xiao, W., Richards, D. R., Felciano, R. M., Baker, H. V.,
Cho, R. J., Chen, R. O., Brownstein, B. H., Cobb, J. P. & other authors
(2005). A network-based analysis of systemic inflammation in
humans. Nature 437, 1032–1037.
Chang, D. K., Goel, A., Ricciardiello, L., Lee, D. H., Chang, C. L.,
Carethers, J. M. & Boland, C. R. (2003). Effect of H
2
O
2
on cell cycle
and survival in DNA mismatch repair-deficient and -proficient cell
lines. Cancer Lett 195, 243–251.
Chien, W., Kumagai, T., Miller, C. W., Desmond, J. C., Frank, J. M.,
Said, J. W. & Koeffler, H. P. (2004). Cyr61 suppresses growth of
human endometrial cancer cells. J Biol Chem 279, 53087–53096.
Chu, F. F., Esworthy, R. S. & Doroshow, J. H. (2004). Role of Se-
dependent glutathione peroxidases in gastrointestinal inflammation
and cancer. Free Radic Biol Med 36, 1481–1495.
Debruyne, P. R., Bruyneel, E. A., Li, X., Zimber, A., Gespach, C. &
Mareel, M. M. (2001). The role of bile acids in carcinogenesis. Mutat
Res 480–481, 359–369.
Dove, W. F., Clipson, L., Gould, K. A., Luongo, C., Marshall, D. J.,
Moser, A. R., Newton, M. A. & Jacoby, R. F. (1997).
Intestinal
neoplasia in the Apc
Min
mouse: independence from the microbial and
natural killer (beige locus) status. Cancer Res 57, 812–814.
Eckburg, P. B., Bik, E. M., Bernstein, C. N., Purdom, E., Dethlefsen, L.,
Sargent, M., Gill, S. R., Nelson, K. E. & Relman, D. A. (2005). Diversity
of the human intestinal microbial flora. Science 308, 1635–1638.
Egeblad, M. & Werb, Z. (2002). New functions for the matrix
metalloproteinases in cancer progression. Nat Rev Cancer 2, 161–174.
Engle,S.J.,Ormsby,I.,Pawlowski,S.,Boivin,G.P.,Croft,J.,Balish,E.&
Doetschman,T.(2002).Elimination of colon c ancer in germ-free transfor-
ming growth factor beta 1-deficient mice. Cancer Res 62, 6362–6366.
Feng, D., Tu, Z., Wu, W. & Liang, C. (2003). Inhibiting the expression
of DNA replication-initiation proteins induces apoptosis in human
cancer cells. Cancer Res 63, 7356–7364.
Fleiss, J. L. (1981). The comparison of proportions from several
independent samples: ridit analysis. In Statistical Methods for Rates
and Proportions , pp. 150–157. New York: John Wiley & Sons.
Gentry-Weeks, C. R., Karkhoff-Schweizer, R., Pikis, A., Estay, M. &
Keith, J. M. (1999).
Survival of Enterococcus faecalis in mouse
peritoneal macrophages. Infect Immun 67, 2160–2165.
Gibson, G. R., Macfarlane, G. T. & Cummings, J. H. (1988).
Occurrence of sulphate-reducing bacteria in human faeces and the
relationship of dissimilatory sulphate reduction to methanogenesis in
the large gut. J Appl Bacteriol 65, 103–111.
Gloire, G., Legrand-Poels, S. & Piette, J. (2006). NF-kB activation by
reactive oxygen species: fifteen years later. Biochem Pharmacol 72,
1493–1505.
Gomez, D. E., Alonso, D. F., Yoshiji, H. & Thorgeirsson, U. P. (1997).
Tissue inhibitors of metalloproteinases: structure, regulation and
biological functions. Eur J Cell Biol 74, 111–122.
Huycke, M. M. (2002). Physiology of enterococci. In Enterococci:
Pathogenesis, Molecular Biology and Antibiotic Resistance, pp. 133–175.
Edited by M. S. Gilmore. Washington, DC: American Society for
Microbiology.
Huycke, M. M. & Moore, D. R. (2002). In vivo production of hydroxyl
radical by Enterococcus faecalis colonizing the intestinal tract using
aromatic hydroxylation. Free Radic Biol Med 33, 818–826.
Huycke, M. M., Gilmore, M. S., Jett, B. D. & Booth, J. L. (1992).
Transfer of pheromone-inducible plasmids between Enterococcus
faecalis in the Syrian hamster gastrointestinal tract. J Infect Dis 166,
1188–1191.
Huycke, M. M., Joyce, W. & Wack, M. F. (1996). Augmented
production of extracellular superoxide production by blood isolates
of Enterococcus faecalis. J Infect Dis 173, 743–746.
Huycke, M. M., Moore, D., Shepard, L., Joyce, W., Wise, P., Kotake, Y.
& Gilmore, M. S. (2001).
Extracellular superoxide production by
Enterococcus faecalis requires demethylmenaquinone and is attenuated
by functional terminal quinol oxidases. Mol Microbiol 42, 729–740.
Huycke, M. M., Abrams, V. & Moore, D. R. (2002). Enterococcus faecalis
produces extracellular superoxide and hydrogen peroxide that
damages colonic epithelial cell DNA. Carcinogenesis 23, 529–536.
Kado, S., Uchida, K., Funabashi, H., Iwata, S., Nagata, Y., Ando, M.,
Onoue, M., Matsuoka, Y., Ohwaki, M. & Morotomi, M. (2001).
Intestinal microflora are necessary for development of spontaneous
adenocarcinoma of the large intestine in T-cell receptor
b chain and
p53 double-knockout mice. Cancer Res 61, 2395–2398.
Karin, M. & Greten, F. R. (2005). NF-kB: linking inflammation and
immunity to cancer development and progression. Nat Rev Immunol
5, 749–759.
Khadaroo, R. G., Kapus, A., Powers, K. A., Cybulsky, M. I., Marshall,
J. C. & Rotstein, O. D. (2003).
Oxidative stress reprograms
lipopolysaccharide signaling via Src kinase-dependent pathway in
RAW 264.7 macrophage cell line. J Biol Chem 278, 47834–47841.
Kim, S. C., Tonkonogy, S. L., Albright, C. A., Tsang, J., Balish, E. J.,
Braun, J., Huycke, M. M. & Sartor, R. B. (2005).
Variable phenotypes
of enterocolitis in IL-10 deficient mice monoassociated with two
different commensal bacteria. Gastroenterology 128, 891–906.
Klein, S., de Fougerolles, A. R., Blaikie, P., Khan, L., Pepe, A., Green,
C. D., Koteliansky, V. & Giancotti, F. G. (2002).
a5b1 integrin activates
an NF-
kB-dependent program of gene expression important for
angiogenesis and inflammation. Mol Cell Biol 22, 5912–5922.
Kraehenbuhl, J.-P. & Neutra, M. R. (2000). Epithelial M cells:
differentiation and function. Annu Rev Cell Dev Biol 16, 301–332.
Lin, M. T., Chang, C. C., Chen, S. T., Chang, H. L., Su, J. L., Chau, Y. P.
& Kuo, M. L. (2004).
Cyr61 expression confers resistance to apoptosis
in breast cancer MCF-7 cells by a mechanism of NF-
kB-dependent
XIAP up-regulation. J Biol Chem 279, 24015–24023.
Lorimore, S. A. & Wright, E. G. (2003). Radiation-induced genomic
instability and bystander effects: related inflammatory-type responses to
radiation-induced stress and injury? A review. Int J Radiat Biol 79,1525.
Maggio-Price, L., Treuting, P., Zeng, W., Tsang, M., Bielefeldt-
Ohmann, H. & Iritani, B. M. (2006).
Helicobacter infection is required
for inflammation and colon cancer in SMAD3-deficient mice. Cancer
Res 66, 828–838.
Marnett, L. J. (2000). Oxyradicals and DNA damage. Carcinogenesis
21, 361–370.
Mazelin, L., Bernet, A., Bonod-Bidaud, C., Pays, L., Arnaud, S.,
Gespach, C., Bredesen, D. E., Scoazec, J. Y. & Mehlen, P. (2004).
E. faecalis modulates mucosal gene expression
http://jmm.sgmjournals.org 1203
Page 11
Netrin-1 controls colorectal tumorigenesis by regulating apoptosis.
Nature 431, 80–84.
McGarr, S. E., Ridlon, J. M. & Hylemon, P. B. (2005). Diet, anaerobic
bacterial metabolism, and colon cancer: a review of the literature. J
Clin Gastroenterol 39, 98–109.
Mendes, A. F., Caramona, M. M., Carvalho, A. P. & Lopes, M. C.
(2003). Differential roles of hydrogen peroxide and superoxide in
mediating IL-1-induced NF-
kB activation and iNOS expression in
bovine articular chondrocytes. J Cell Biochem 88, 783–793.
Mitra, S. & Abraham, E. (2006). Participation of superoxide in
neutrophil activation and cytokine production. Biochim Biophys Acta
1762, 732–741.
Moore, W. E. C. & Moore, L. H. (1995). Intestinal floras of populations that
have a high risk of colon cancer. Appl Environ Microbiol 61, 3202–3207.
Nougayrede, J. P., Homburg, S., Taieb, F., Boury, M., Brzuszkiewic z, E.,
Gottschalk, G., Buchrieser, C., Hacker, J., Dobrindt, U. & Oswald, E.
(2006).
Escherichia coli induces DNA double-strand breaks in eukaryotic
cells. Science 313, 848–851.
Ritchey, T. W. & Seeley, H. W. (1974). Cytochromes in Streptococcus
faecalis var. zymogenes grown in a haematin-containing medium. J Gen
Microbiol 85, 220–228.
Rowland, I. R. (1995). Toxicology of the colon: role of the intestinal
microflora. In Human Colonic Bacteria: Role in Nutrition, Physiology,
and Pathology, pp. 155–174. Edited by G. R. Gibson & G. T.
Macfarlane. Boca Raton, FL: CRC Press.
Su, T. T. (2006). Cellular responses to DNA damage: one signal,
multiple choices. Annu Rev Genet 40, 187–208.
Taieb, F., Nougayrede, J. P., Watrin, C., Samba-Louaka, A. & Oswald,
E. (2006). Escherichia coli cyclomodulin Cif induces G
2
arrest of the
host cell cycle without activation of the DNA-damage checkpoint-
signalling pathway. Cell Microbiol 8, 1910–1921.
Vadigepalli, R., Chakravarthula, P., Zak, D. E., Schwaber, J. S. &
Gonye, G. E. (2003).
PAINT: a promoter analysis and interaction
network generation tool for gene regulatory network identification.
OMICS J Integr Biol 7, 235–252.
Waddell, S. J., Butcher, P. D. & Stoker, N. G. (2007). RNA profiling in
host–pathogen interactions. Curr Opin Microbiol 10, 297–302.
Wang, X. & Huycke, M. M. (2007). Extracellular superoxide
production by Enterococcus faecalis promotes chromosomal instability
in mammalian cells. Gastroenterology 132, 551–561.
Wells, C. L., Jechorek, R. P. & Erlandsen, S. L. (1990). Evidence for
the translocation of Enterococcus faecalis across the mouse intestinal
tract. J Infect Dis 162, 82–90.
Whitehead, R. H., VanEeden, P. E., Noble, M. D., Ataliotis, P. & Jat,
P. S. (1993). Establishment of conditionally immortalized epithelial
cell lines from both colon and small intestine of adult H-2K
b
-tsA58
transgenic mice. Proc Natl Acad Sci U S A 90, 587–591.
Xie, D., Miller, C. W., O’Kelly, J., Nakachi, K., Sakashita, A., Said, J. W.,
Gornbein, J. & Koeffler, H. P. (2001).
Breast cancer. Cyr61 is
overexpressed, estrogen-inducible, and associated with more
advanced disease. J Biol Chem 276, 14187–14194.
Yang, M., Sang, H., Rahman, A., Wu, D., Malik, A. B. & Ye, R. D.
(2001). Ga
16
couples chemoattractant receptors to NF-kB activation. J
Immunol 166, 6885–6892.
T. D. Allen and others
1204 Journal of Medical Microbiology 57
Page 12
  • Source
    • "When this occurs, the production of superoxides is arrested, as reducing equivalents are routed to the respiration chain (74). These differential properties, which depend on hemin availability, are suspected to contribute to E. faecalis commensalism and pathogenicity (2,75,76). We pursued the characterization of Ref RNAs in northern blot experiments by visualizing their expression in bacterial growth conditions where oxygen and hemin were differentially available. "
    [Show abstract] [Hide abstract] ABSTRACT: Enterococcus faecalis is a commensal bacterium and a major opportunistic human pathogen. In this study, we combined in silico predictions with a novel 5′RACE-derivative method coined ‘5′tagRACE’, to perform the first search for non-coding RNAs (ncRNAs) encoded on the E. faecalis chromosome. We used the 5′tagRACE to simultaneously probe and characterize primary transcripts, and demonstrate here the simplicity, the reliability and the sensitivity of the method. The 5′tagRACE is complementary to tiling arrays or RNA-sequencing methods, and is also directly applicable to deep RNA sequencing and should significantly improve functional studies of bacterial RNA landscapes. From 45 selected loci of the E. faecalis chromosome, we discovered and mapped 29 novel ncRNAs, 10 putative novel mRNAs and 16 antisense transcriptional organizations. We describe in more detail the oxygen-dependent expression of one ncRNA located in an E. faecalis pathogenicity island, the existence of an ncRNA that is antisense to the ncRNA modulator of the RNA polymerase, SsrS and provide evidences for the functional interplay between two distinct toxin–antitoxin modules.
    Full-text · Article · Apr 2011 · Nucleic Acids Research
  • Source
    • "Further exploration of the consequences of this change revealed substantial changes in gene expression in the colonic mucosa, the internal lining of the intestine. These changes affect inflammation, apoptosis (or cell death) and cell-cycle regulation (Allen et al. 2008) and there is a natural suggestion that these phenomena may be implicated in colon cancers. But crucially, this is not a case of invasion by hostile alien organisms, but a potentially pathological behaviour of organisms that are a normal, and generally desirable part of the overall system. "
    [Show abstract] [Hide abstract] ABSTRACT: This paper will begin with some very broad and general considerations about the kind of biological entities we are. This exercise is motivated by the belief that the view of what we—multicellular eukaryotic organisms—are that is widely assumed by biologists, medical scientists and the general public, is an extremely limited one. It cannot be assumed a priori that a more sophisticated view will make a major difference to the science or practice of medicine, and there are areas of medicine to which it is probably largely irrelevant. However, in this case there are important implications for medicine, or so I shall argue. In particular, it enables us to appreciate fully the potential medical significance of some of the most exciting contemporary advances in general biology, in such fields as epigenetics, metagenomics, and systems biology; and part of this significance is that these advances have raised serious doubts about how we should understand the biological individuals that medicine is generally assumed to aim to treat. KeywordsOrganism-Disease-Gut bacteria-Symbiosis-Epigenetics-Metagenomics
    Full-text · Article · Jan 2011 · European Journal for Philosophy of Science
  • Source
    • "Enterococci are intrinsically resistant to several groups of antibiotics and often acquire antibiotic resistance and virulence determinants via horizontal gene transfer (Gilmore et al., 2002; Paulsen et al., 2003; McBride et al., 2007). Virulence factors associated with clinical isolates include gelatinase (GelE), serine protease (SprE) (Hancock and Perego, 2004), cytolysin (Haas et al., 2002; Coburn et al., 2004), enterococcal surface protein (Esp) (Tendolkar et al., 2004), aggregation substance, adhesin to collagen (Nallapareddy et al., 2000; Hirt et al., 2002), enterococcal polysaccharide antigen (Teng et al., 2002), capsular polysaccharide (Hancock and Gilmore, 2002), lipoteichoic acid (Schlievert et al., 1998 ) and toxic metabolites (Wang and Huycke, 2007; Allen et al., 2008). The combination of antibiotic resistance and virulence determinants makes enterococcal infections increasingly difficult to clinically treat. "
    [Show abstract] [Hide abstract] ABSTRACT: The prevalence of gelatinase activity and biofilm formation among environmental enterococci was assessed. In total, 396 enterococcal isolates from swine and cattle faeces and house flies from a cattle farm were screened for gelatinase activity. The most prevalent phenotype on Todd-Hewitt agar with 1.5% skim milk was the weak protease (WP) (72.2% of isolates), followed by the strong protease (SP) 18.7%, and no protease (NP) (9.1%). The majority of WP isolates was represented by Enterococcus hirae (56.9%), followed by Enterococcus faecium (25.9%), Enterococcus casseliflavus (10.4%), Enterococcus gallinarum (5.2%) and Enterococcus saccharolyticus (1.7%). All WP isolates were negative for gelE (gelatinase) and sprE (serine protease) as well as the fsrABDC operon that regulates the two proteases, and only four isolates (7.0%) formed biofilms in vitro. All SP isolates were Enterococcus faecalis positive for the fsrABDC, gelE, sprE genes and the majority (91.2%) formed a biofilm. Diversity of NP isolates was relatively evenly distributed among E. hirae, E. faecium, E. casseliflavus, E. gallinarum, Enterococcus durans, E. saccharolyticus and Enterococcus mundtii. All NP isolates were negative for the fsr operon and only four E. hirae (11.1%) formed a biofilm. Of further interest was the loss of the gelatinase phenotype (18.9% of isolates) from SP isolates after 4 month storage at 4-8 degrees C and several passages of subculture. Results of reverse transcription PCR analysis indicated that mRNA was produced for all the genes in the frs operon and sequencing of the gelE gene did not reveal any significant mutations. However, gelatinase was not detectable by Western blot analysis. Our study shows that E. faecalis with the complete fsr operon and the potential to form a biofilm are relatively common in the agricultural environment and may represent a source/reservoir of clinically relevant strains. In addition, many environmental enterococci, especially E. hirae, produce an unknown WP that can hydrolyse casein but does not contribute to biofilm formation. The stability of the gelatinase phenotype in E. faecalis and its regulation will require additional studies.
    Full-text · Article · Mar 2009 · Environmental Microbiology
Show more