ArticlePDF Available

Characterizing the Mechanism of Action of Double-Stranded RNA Activity against Western Corn Rootworm (Diabrotica virgifera virgifera LeConte)

Authors:
  • The Climate Corporation

Abstract and Figures

RNA interference (RNAi) has previously been shown to be effective in western corn rootworm (WCR, Diabrotica virgifera virgifera LeConte) larvae via oral delivery of synthetic double-stranded RNA (dsRNA) in an artificial diet bioassay, as well as by ingestion of transgenic corn plant tissues engineered to express dsRNA. Although the RNAi machinery components appear to be conserved in Coleopteran insects, the key steps in this process have not been reported for WCR. Here we characterized the sequence of events that result in mortality after ingestion of a dsRNA designed against WCR larvae. We selected the Snf7 ortholog (DvSnf7) as the target mRNA, which encodes an essential protein involved in intracellular trafficking. Our results showed that dsRNAs greater than or equal to approximately 60 base-pairs (bp) are required for biological activity in artificial diet bioassays. Additionally, 240 bp dsRNAs containing a single 21 bp match to the target sequence were also efficacious, whereas 21 bp short interfering (si) RNAs matching the target sequence were not. This result was further investigated in WCR midgut tissues: uptake of 240 bp dsRNA was evident in WCR midgut cells while a 21 bp siRNA was not, supporting the size-activity relationship established in diet bioassays. DvSnf7 suppression was observed in a time-dependent manner with suppression at the mRNA level preceding suppression at the protein level when a 240 bp dsRNA was fed to WCR larvae. DvSnf7 suppression was shown to spread to tissues beyond the midgut within 24 h after dsRNA ingestion. These events (dsRNA uptake, target mRNA and protein suppression, systemic spreading, growth inhibition and eventual mortality) comprise the overall mechanism of action by which DvSnf7 dsRNA affects WCR via oral delivery and provides insights as to how targeted dsRNAs in general are active against insects.
Content may be subject to copyright.
Characterizing the Mechanism of Action of Double-
Stranded RNA Activity against Western Corn Rootworm
(
Diabrotica virgifera virgifera
LeConte)
Renata Bolognesi
1
, Parthasarathy Ramaseshadri
1
*, Jerry Anderson
1
, Pamela Bachman
2
, William Clinton
1
,
Ronald Flannagan
1
, Oliver Ilagan
1
, Christina Lawrence
2
, Steven Levine
2
, William Moar
2
,
Geoffrey Mueller
2
, Jianguo Tan
2
, Joshua Uffman
2
, Elizabeth Wiggins
1
, Gregory Heck
1
, Gerrit Segers
1
1Biotechnology Division, Monsanto Company, Chesterfield, Missouri, United States of America, 2Regulatory Division, Monsanto Company, St. Louis, Missouri, United
States of America
Abstract
RNA interference (RNAi) has previously been shown to be effective in western corn rootworm (WCR, Diabrotica virgifera
virgifera LeConte) larvae via oral delivery of synthetic double-stranded RNA (dsRNA) in an artificial diet bioassay, as well as
by ingestion of transgenic corn plant tissues engineered to express dsRNA. Although the RNAi machinery components
appear to be conserved in Coleopteran insects, the key steps in this process have not been reported for WCR. Here we
characterized the sequence of events that result in mortality after ingestion of a dsRNA designed against WCR larvae. We
selected the Snf7 ortholog (DvSnf7) as the target mRNA, which encodes an essential protein involved in intracellular
trafficking. Our results showed that dsRNAs greater than or equal to approximately 60 base-pairs (bp) are required for
biological activity in artificial diet bioassays. Additionally, 240 bp dsRNAs containing a single 21 bp match to the target
sequence were also efficacious, whereas 21 bp short interfering (si) RNAs matching the target sequence were not. This
result was further investigated in WCR midgut tissues: uptake of 240 bp dsRNA was evident in WCR midgut cells while a
21 bp siRNA was not, supporting the size-activity relationship established in diet bioassays. DvSnf7 suppression was
observed in a time-dependent manner with suppression at the mRNA level preceding suppression at the protein level when
a 240 bp dsRNA was fed to WCR larvae. DvSnf7 suppression was shown to spread to tissues beyond the midgut within 24 h
after dsRNA ingestion. These events (dsRNA uptake, target mRNA and protein suppression, systemic spreading, growth
inhibition and eventual mortality) comprise the overall mechanism of action by which DvSnf7 dsRNA affects WCR via oral
delivery and provides insights as to how targeted dsRNAs in general are active against insects.
Citation: Bolognesi R, Ramaseshadri P, Anderson J, Bachman P, Clinton W, et al. (2012) Characterizing the Mechanism of Action of Double-Stranded RNA Activity
against Western Corn Rootworm (Diabrotica virgifera virgifera LeConte). PLoS ONE 7(10): e47534. doi:10.1371/journal.pone.0047534
Editor: Subba Reddy Palli, University of Kentucky, United States of America
Received August 16, 2012; Accepted September 12, 2012; Published October 11, 2012
Copyright: ß2012 Bolognesi et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits
unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: The authors have no support or funding to report.
Competing Interests: All authors are affiliated to Monsanto Company, USA. This does not alter the authors’ adherence to all the PLOS ONE policies on sharing
data and materials.
* E-mail: pprama1@monsanto.com
Introduction
RNA interference (RNAi) is a gene silencing mechanism
triggered by double-stranded RNA (dsRNA) [1]. The RNAi
pathway is essential for protection against viral infections [2,3] and
for regulation of eukaryotic gene expression. The RNAi pathway
has been described and used to study gene function in classical
genetic model organisms for over a decade. In insects, multiple
studies have confirmed the existence of the RNAi pathway by
injection of dsRNAs [4,5,6].
More recently, RNAi via ingestion has been suggested as a
potential tool for insect control. Several studies have demonstrated
that dsRNAs can be successfully fed to insects either through
artificial diet or expressed in transgenic host plants, resulting in
mortality of the targeted species [7,8]. Much focus has been on
economically important pests, including western corn rootworm
(WCR, Diabrotica virgifera virgifera), southern corn rootworm (SCR,
Diabrotica undecimpunctata howardii), Colorado potato beetle (Leptino-
tarsa decemlineata) [7], cotton bollworm (Helicoverpa armigera) [9], beet
armyworm (Spodoptera exigua) [10] and brown planthopper
(Nilaparvata lugens) [11]. Other recent studies examined the
potential to use RNAi to control household/structural pests such
as termites [12] and insect vectors of disease such as Tse-tse flies
and mosquitos [13,14]. Once the dsRNA is ingested by these
insects, it is thought to be taken up by midgut cells and processed
by the native RNAi machinery. The RNAi pathway is initiated by
cleavage of dsRNA into short interfering (si)RNAs by the nuclease
Dicer [1]. The siRNAs then bind to a complex of proteins known
as RNA induced silencing complex (RISC) which leads to specific
suppression of the target mRNA. This specific suppression can
cause lethality if the target mRNA encodes a protein with an
essential function within the insect.
One of the factors that can influence RNAi efficiency in insects
is the capacity of cells to uptake dsRNA. A primary route of
exposure for dsRNA is oral ingestion, however, ingestion is not
synonymous with uptake; the dsRNA must enter cells of the target
insect for the dsRNA to interact with the RNAi pathway, resulting
in downstream effects [15]. In some organisms, cells have the
PLOS ONE | www.plosone.org 1 October 2012 | Volume 7 | Issue 10 | e47534
ability to uptake dsRNA from the extracellular environment and
spread the effect to neighboring cells [16,17]. This process, called
non-cell autonomous RNAi, was first described in C. elegans [1],
where several genes have been implicated in dsRNA uptake and
subsequent spreading. There are several models explaining
dsRNA entry and initiation of RNAi silencing in different
organisms [18,19,20,21]. Systemic RNAi has also been docu-
mented in WCR [22] and other insects [23,24] via dsRNA
injection; however the mechanism(s) of dietary uptake of dsRNAs
and systemic spreading of RNAi have yet to be fully characterized
in an insect model.
Other factors can also influence the efficiency of RNAi in
insects, including dsRNA concentration, potency and efficacy
against the target, sequence and length of the dsRNA, persistence
of gene silencing, and the insect life-stage [7,8,25,26]. In general,
long dsRNAs that incorporate a high degree of sequence match to
mRNAs in the target insect have greater potential for efficacy as a
result of the number of siRNAs that can be produced. [7].
The results described herein characterize the mechanism of
action of dsRNA in WCR upon ingestion, including (1) cellular
uptake of dsRNA; (2) non-cell autonomous spread and target
mRNA and protein suppression and (3) growth inhibition
preceding lethality of the WCR larvae. The data also provide
insights into the relationship between the time of exposure to
dsRNA and concentration effects of dsRNA on WCR larval
survival. Taken together, the results presented here provide a more
complete understanding of the events that result in mortality from
a dietary exposure to a dsRNA targeting an insect mRNA.
The WCR Snf7 ortholog (DvSnf7) is a component of the
ESCRT-III complex (endosomal sorting complex required for
transport), which is involved in essential biological processes
including sorting of cell membrane receptors [27,28,29]. Due to its
vital cellular function resulting in WCR mortality at relatively low
concentrations when targeted by dsRNA [7], DvSnf7 was selected
as the target mRNA to investigate the molecular mechanisms
leading to WCR mortality after feeding on dsRNA. The data
gathered in this study on the overall mechanism of action of
DvSnf7 dsRNA by oral delivery to WCR, suggest the possibility of
using DvSnf7 as a potential RNAi target for the control of WCR
via transgenic approaches.
Results
Toxicity of dsRNA against the target organism
To assess efficacy of an ingested dsRNA against WCR larvae, a
240 bp dsRNA targeting DvSnf7 was fed continuously to second
instar larvae at 1 mg dsRNA/mL diet. The larvae fed on DvSnf7
dsRNA showed noticeable growth inhibition 5 days after feeding
(Fig. 1A), when compared to control larvae fed Green Fluorescent
Protein (GFP) dsRNA. To fully characterize the response of WCR
to DvSnf7, time- and concentration–response assays were
performed in 12-day artificial diet incorporation bioassays.
Additionally, concentration-response assays were conducted with
the closely related species SCR, to compare responses and to
evaluate the use of SCR as a surrogate for WCR. The SCR
240 bp Snf7 ortholog shares .98% sequence match (data not
shown) to WCR 240 bp DvSnf7 dsRNA and in our facility SCR
has proven to be more amenable to laboratory bioassays than
WCR. Mean LC
50
values from a combined analysis with results
from three independently replicated WCR and SCR differed by
three-to-four fold with mean LC
50
values of 4.3 and 1.2 ng
DvSnf7 dsRNA/mL diet, respectively, and comparable slopes for
concentration responses (Table 1).
To characterize the relationship between duration of exposure
and levels of effect, WCR larvae were exposed separately to two
240 bp DvSnf7 dsRNA concentrations representing approximate-
ly 10 and 225 times the mean 12-day LC
50
value for WCR
(Table 1), and then transferred to untreated diet at specific time
points over 12-days. At a concentration of 50 ng DvSnf7 dsRNA/
mL diet, a 2 h initial feeding period resulted in no mortality of
WCR larvae in the 12 day assay, whereas increasing the feeding
duration to 3 h at the same concentration resulted in .20%
mortality (Figure 1B). As exposure duration increased, there was a
concomitant increase in percent mortality. The longest exposure
durations of 12 and 24 h resulted in .50% mortality at 12 days,
establishing an inverse relationship between duration of exposure
and time required to reach 50% corrected mortality (Figure 1B).
In comparison, at the higher concentration of 1000 ng DvSnf7
dsRNA/mL diet, exposure duration and time to reach 50%
mortality was considerably shortened, and all exposure durations
resulted in .50% WCR mortality (Figure 1C).
DsRNA size versus activity relationship
To characterize the size-activity relationship of dsRNA against
corn rootworm, a dsRNA size series experiment was performed
against SCR. A series of 9 different embedded dsRNA sequence
lengths (27 bp of DvSnf7 embedded in artificial carrier) and 7
different embedded dsRNA sequence lengths (21 bp of DvSnf7
embedded in artificial carrier) as mentioned in the Size-activity
relationships assays in methods section were tested to evaluate their
biological activity against SCR in 12-day diet bioassays. From
these bioassays, a size-activity relationship was established:
significant SCR mortality was only detected with sequence lengths
$60 bp (p.0.05; Table 2). In addition, at a total length of
$70 bp, SCR mortality was $95% at a concentration of 23 ng of
DvSnf7 dsRNA/mL diet, representing approximately 20-times the
12-day SCR LC
50
value. These bioassay results suggest that a size
cut-off of approximately 60 bp for a dsRNA is required to achieve
significant activity against corn rootworm. A similar level of
biological activity against SCR was obtained in separate bioassays
with the series of 21 bp embedded in a 240 bp length sequence.
All 21 bp sequences embedded in a carrier of total length of
240 bp demonstrated similar activity, whereas ingestion of a 21 bp
siRNA (21.3) not embedded in a carrier sequence did not result in
significant mortality at the highest concentration tested (p.0.05;
Table 3).
Uptake of dsRNA into WCR midgut cells
A WCR midgut tissue culture was developed to evaluate
whether dsRNA and siRNAs were effectively taken up by insect
midgut cells. 240 bp DvSnf7 dsRNA and DvSnf7 siRNA (21.3,
Table 3) were labeled with Cy3 dye to allow for microscopic
visualization. The labeled molecules were then incubated with
WCR midgut tissue culture. The 240 bp Cy3-dsRNA was
localized inside the cells, while Cy3-siRNAs were not (Fig. 2A).
Controls with insect medium containing unincorporated Cy3 dye
showed no fluorescence (Fig. 2A). Additional controls with
unlabeled dsRNA and siRNA molecules co-incubated with
unincorporated Cy3, as well as insect medium, showed no
fluorescence (data not shown). Both 240 bp dsRNA and siRNAs
were used in WCR diet overlay bioassays (at 100 ng/mL diet) to
confirm that Cy3–labeling did not interfere with the RNAi
response. There was no difference in activity between unlabeled
and Cy3-labeled 240 bp dsRNAs (Fig. 2B). Additionally, DvSnf7
mRNA levels were measured in midgut tissues exposed to both
Cy3-labeled and unlabeled dsRNA/siRNA for 24 h by real-time
PCR. DvSnf7 mRNA levels were suppressed 2-fold only in
RNAi Mechanisms in Western Corn Rootworm
PLOS ONE | www.plosone.org 2 October 2012 | Volume 7 | Issue 10 | e47534
midguts exposed to labeled/unlabeled 240 bp dsRNA but not in
midguts exposed to labeled/unlabeled siRNA (Fig. 2C), confirm-
ing that the 240 bp dsRNA is still active upon cellular uptake.
These results suggest that a size selection mechanism is present at
the cellular uptake level, allowing for the effective uptake of
relatively long dsRNA molecules and excludes siRNAs.
Target suppression and systemic RNAi effect in WCR
To verify the efficiency of target suppression, DvSnf7 mRNA
levels were measured by real-time RT-PCR. DvSnf7 transcript
levels were significantly reduced as early as one day after DvSnf7
dsRNA feeding, and target suppression was even more pro-
nounced in insects feeding on DvSnf7 dsRNA for five days
(Figure 3A). To evaluate if DvSNF7 protein levels also decreased,
an anti-SNF7 antibody was generated and used to detect DvSNF7
protein in these larval samples by Western blot and ELISA.
Immunoprecipitation of DvSNF7 protein from a WCR protein
extract followed by mass spectrophotometry confirmed the
specificity of the anti-SNF7 antibody (data not shown). Fig. 3B–
D shows that DvSNF7 protein levels were not altered in larvae
feeding on DvSnf7 dsRNA for 1 day of exposure. However,
DvSNF7 protein levels were significantly reduced in larvae after
5 days of feeding on DvSnf7 dsRNA.
Figure 1. dsRNA DvSnf7 direct toxicity in Western Corn Rootworm (WCR,
Diabrotica virgifera virgifera
) larvae. A) Growth inhibition in
second instar larvae fed on diet overlaid with 1000 ng/mL DvSnf7 dsRNA for 5 days compared to larvae fed with control diet containing similar
concentration of GFP dsRNA. Scale bar = 1 mm. Mortality of WCR larvae to varying exposure times of DvSnf7 dsRNA incorporated into diet bioassay
at B) 50 ng and C) 1000 ng of dsRNA/mL diet. Open columns represents the mortality of 12-day continuous feeding.
doi:10.1371/journal.pone.0047534.g001
Table 1. Western Corn Rootworm (WCR, Diabrotica virgifera virgifera) and Southern Corn Rootworm (SCR, Diabrotica
undecimpunctata howardi)LC
50
values in 12-day diet incorporation bioassays.
Insect
1
LC
50
Values and 95% Confidence Intervals
(ng DvSnf7 dsRNA/mL diet)
Slope and 95% Confidence
Intervals
Chi-Square for Significance of
Concentration Response
WCR 4.3 (2.7–6.2) 3.1 (2.3–3.9) p,0.0001
SCR 1.2 (0.6–1.9) 3.5 (2.3–4.7) p,0.0001
1
Replicate assays were performed on three different days with three separate batches of insects.
doi:10.1371/journal.pone.0047534.t001
RNAi Mechanisms in Western Corn Rootworm
PLOS ONE | www.plosone.org 3 October 2012 | Volume 7 | Issue 10 | e47534
To test whether the DvSnf7 suppression effect is systemic or
limited to the midgut (the primary tissue in contact with dsRNA
via feeding), insect midgut and carcass tissues were isolated and
DvSnf7 mRNA levels were measured by real-time RT-PCR.
Results showed that DvSnf7 mRNA levels were high in both
tissues of pre-exposure treatment and GFP dsRNA fed larvae, and
were statistically significant from the levels in the counterpart
tissues of DvSnf7 dsRNA fed larvae (Fig. 4). DvSnf7 mRNA levels
reduced in both midgut and carcass as early as one day after
ingestion of DvSnf7 dsRNA, although suppression was more
pronounced in the midgut (10-fold) than in the carcass (4-fold).
Suppression was almost similar in both tissues by the third day
post-feeding (13-fold) and it increased in the carcass tissue (29-fold)
when compared to the midgut tissue (22-fold) by fifth day post-
feeding (Fig. 4). These results indicate that the RNAi response acts
non-cell autonomously, spreading from the midgut to other WCR
tissues.
Discussion
The RNAi pathway is a well conserved mechanism in insects
[30] that holds high potential as an insect control technology, as
many insects have been found to be susceptible to orally ingested
dsRNA. Although the ability to successfully achieve efficacy with
dsRNA via oral ingestion appears wide-spread for insects, it is not
universal and there is a wide range in sensitivities across taxa [31].
Huvenne and Smagghe [25] listed multiple factors influencing
the efficiency of RNAi, including concentration, sequence, and
length of the dsRNA. Our data provide empirical support for the
suggestions made in Huvenne and Smagghe [25] on several fronts.
We have demonstrated a clear concentration–response in two
Diabrotica species, WCR and SCR (Coleoptera: Chrysomelidae)
that share 98% sequence identity of the 240 bp dsRNA targeted to
the Snf7 ortholog, and exhibited comparable sensitivity. The
relatively small increase in sensitivity of SCR to DvSnf7 dsRNA
compared to WCR is similar to our observations with Bt proteins
such as Cry3Bb1 (JU, personal observation) which may reflect
overall physiological differences such as food consumption and
relative growth rate (SL, personal observation). Not only are
sequence identity and concentration determinants of dsRNA
efficiency, but also the temporal nature of exposure. For example,
a concentration of 1000 ng DvSnf7 dsRNA/mL diet resulted in an
earlier onset of lethality and greater overall WCR toxicity
compared to a concentration of 50 ng DvSnf7 dsRNA/mL diet.
After 2 h of exposure, there was .50% WCR mortality at
1000 ng DvSnf7 dsRNA/mL diet, whereas at 50 ng DvSnf7
dsRNA/mL diet a 12 h exposure was required to reach .50%
mortality. These data indicate that only a short duration of feeding
on dsRNA targeted to a vital cellular function may be required to
achieve a high degree of efficacy in WCR and this result is
consistent with the high level of Snf7 mRNA suppression observed
after one day of exposure.
Induction of RNAi via an oral route of exposure requires
efficient uptake of dsRNAs by midgut cells followed by suppression
of the target mRNA leading to significant effects on growth,
development and survival. Studies utilizing fluorescently labeled
dsRNA as a means of investigating uptake in insects are currently
Table 2. Summary of synthesized dsRNA used to determine
the biological activity of different sized molecules at an
exposure concentration of 23 ng DvSnf7 dsRNA/mL in 12-day
diet bioassays with Southern Corn Rootworm, (SCR, Diabrotica
undecimpunctata howardi).
dsRNA
Tested Description
Percent
Mortality
1, 2
27 27 bp without carrier 0
27_40 27 bp in neutral carrier to
40 bp
0
27_50 27 bp in neutral carrier to
50 bp
16
27_60 27 bp in neutral carrier to
60 bp
68*
27_70 27 bp in neutral carrier to
70 bp
95*
27_80 27 bp in neutral carrier to
80 bp
95*
27_90 27 bp in neutral carrier to
90 bp
95*
27_100 27 bp in neutral carrier to
100 bp
95*
27_150 27 bp in neutral carrier to
150 bp
96*
27_240 27 bp in neutral carrier to
240 bp
95*
240 bp DvSnf7 full 240 bp, no
carrier
95*
240 Filler Neutral carrier sequence,
240 bp
0
1
Mortality was corrected using Abbott’s formula.
2
Values with an asterisk were determined to have significantly higher mortality
compared to the control (water-only) with a one-sided Fisher’s Exact Test
(p.0.05).
doi:10.1371/journal.pone.0047534.t002
Table 3. Comparison of LC
50
values for siRNA and dsRNAs in
12 day Southern Corn Rootworm, (SCR, Diabrotica
undecimpunctata howardi) diet bioassays.
dsRNA
Tested
1
Description
LC
50
Values
(ng/mL)
2
21.3 21 bp 21.3 without carrier .100
3
21.1 21.1 bp in neutral carrier to
240 bp
13.8 (10.4–18.7)
4
21.2 21.2 bp in neutral carrier to
240 bp
15.1 (10.9–23.1)
21.3 21.3 bp in neutral carrier to
240 bp
16.9 (9.40–23.00)
21.4 21.4 bp in neutral carrier to
240 bp
20.3 (15.6–29.3)
21.5 21.5 bp in neutral carrier to
240 bp
14.5 (9.7–25.1)
21.6 21.6 bp in neutral carrier to
240 bp
13.8 (8.9–26.4)
21.7 21.7 bp in neutral carrier to
240 bp
8.0 (4.7–14.6)
240 DvSnf7 full 240 bp, no
carrier
1.2 (0.5–2.7)
1
See supplemental materials for individual sequences.
2
Slopes for each of the dsRNAs tested were not significantly different (p.0.05)
with a shared slope 6standard error of 2.3860.22. All concentration reponse
curves showed a significant concentration-effect relationship p,0.001.
3
A concentration response was not observed.
4
Diet concentrations bracketing the LC
50
value are provided as an estimate of
the 95% confidence intervals.
doi:10.1371/journal.pone.0047534.t003
RNAi Mechanisms in Western Corn Rootworm
PLOS ONE | www.plosone.org 4 October 2012 | Volume 7 | Issue 10 | e47534
lacking, and have been recommended in a recent review on RNAi
in insects for pest control purposes [32]. This investigation utilized
fluorescently-labeled dsRNA to examine for the first time the
uptake of a specific dsRNA by WCR. Our WCR tissue culture
experiments demonstrated effective uptake of the 240 bp dsRNA
along with suppression of the intended target mRNA. They also
confirmed the lack of activity of siRNAs against WCR by
demonstrating that 21 bp siRNAs are not taken up into midgut
cells, suggesting that the dsRNA length plays an essential role in
the effectiveness of the RNAi response in WCR larvae. These
results were complemented with the evaluation of the dsRNA size-
activity relationship. siRNA/dsRNA molecules of 21 and 27 bps
were not effective against corn rootworm larvae in diet bioassays.
In addition, ingested dsRNAs $60 bp, containing an active 27 bp
sequence, were shown to be efficacious in 12-day bioassays against
SCR, while dsRNAs ,60 bp did not result in relatively high
mortality in 12-day bioassays. This absence of activity for dsRNAs
,60 bps is not attributed to a lack of stability in the insect diet.
Borgio & Upadhyay et al. [33,34] demonstrated that 21 bp
siRNAs are stable in an insect diet for seven days and we have
confirmed stability of the DvSnf7 dsRNA in SCR diet when
evaluated for time periods up to 14 days (data not reported). These
experiments also showed that a 240 bp dsRNA with 100%
complementarity to the target mRNA is more efficacious
compared to the same length dsRNA with only 21 bp of sequence
match to the target WCR mRNA, and is at least three orders of
magnitude more toxic than Bt Cry3Bb1 against WCR [35]. This
could be due to the fact that the processing of long dsRNAs with
100% match with the target mRNA by the RNAi machinery will
result in multiple target-specific siRNAs which would provide a
greater number of siRNAs available to cause target mRNA
suppression and increase mortality. Additionally, because a 240 bp
dsRNA would produce 1009s of siRNA’s, the likelihood of
rootworm developing resistance to this molecule via SNP’s in
the target DvSnf7 mRNA, is greatly reduced [36].
Data from Drosophila S2 cells support our results; long dsRNAs
are efficiently taken up but siRNAs are only taken up with the aid
of transfection reagents [19]. In contrast, Kumar et al. [37]
reported efficient suppression of acetylcholinesterase in the
Helicoverpa armigera via incorporation of siRNAs in diet, however,
this study did not report on the effect of dsRNA. Not all insect
orders exhibit the same response to orally ingested dsRNAs [25].
Lepidopteran responses to either injected or oral dsRNA delivery
are highly variable, which may indicate that Lepidoptera possess a
Figure 2. Uptake of dsRNA by Western Corn Rootworm (WCR,
Diabrotica virgifera virgifera
) by midgut cells. (A) Cy3-labeled 240 bp
DvSnf7 dsRNA is taken up by WCR midgut cells (b–c), while DvSnf7 siRNAs are not (e–f, h–i). Nuclei DAPI staining was used to visualize midgut cells (a,
d, g, j). Controls with Cy-3 dye alone do not show intracellular incorporation (k–l); Scale Bar: 50 mm.(B) Diet bioassays confirmed that labeled 240 bp
dsRNA retains activity, while siRNAs are inactive. Percent mortality was determined 12 days after continuous exposure of WCR neonates to 100 ng/
mL of dsRNA/siRNA. (C) Real-time RT-PCR of midgut tissue cultures exposed to 1 mg/100 mL of insect medium of dsRNA/siRNA. Snf7 mRNA levels are
reduced after exposure to DvSnf7 240 bp dsRNA, while no mRNA reduction is observed after tissue incubation with siRNAs or control medium. Stars
represent values significantly different from controls (p = 0.05; t-test).
doi:10.1371/journal.pone.0047534.g002
RNAi Mechanisms in Western Corn Rootworm
PLOS ONE | www.plosone.org 5 October 2012 | Volume 7 | Issue 10 | e47534
high degree of plasticity (high variation among species) in their
uptake mechanisms and RNAi response [15,33]. Additionally,
specific gene silencing by siRNA treatment was observed via oral
route in sucking pests such as white flies [33]. Hence, the
differences in uptake selectivity seen between our studies and those
of Kumar et al. [37] and Upadhayay et al. [33] may be a factor of
the test species used as well as the gene target. Although we have
demonstrated that long dsRNAs are successfully taken up by
WCR midgut cells and siRNAs are not, the mechanism of uptake
at the cellular level is still unknown. Further molecular and
bioinformatics studies are required to understand whether dsRNA
uptake occurs via SID-like receptors, receptor-mediated endocy-
tosis, an unknown mechanism, or a combination of uptake
mechanisms.
Once dsRNA has crossed the cell membrane, it is processed by
the RNAi machinery ultimately leading to mRNA degradation.
Bioassays with WCR exposed to a DvSnf7 dsRNA concentration
approximating the 12-day LC
99
in WCR diet bioassays showed
that DvSnf7 transcript levels started to decrease 1 day after
neonate larvae started feeding on diet containing dsRNA, and by
the fifth day the suppression was greater than 80%. Although
DvSNF7 protein levels were steady 1 day after feeding, they were
significantly reduced (80% decrease) after 5 days compared to pre-
exposure levels. Because mortality started to occur in WCR after
5 days, it was not feasible to collect sufficient tissue for later time
points to assess whether complete suppression occurred. Never-
theless, because SNF7 is involved in many essential biological
functions, perturbation in the level of this protein is likely enough
to result in a cascade of events leading to mortality. A recent
publication examining vATPase subunit A mRNA knockdown in
adult WCR demonstrates a similar pattern in protein suppression
[38]. Specifically, Rangasamy & Siegfried [38] showed that
mRNA levels decreased within 24 hours of ingestion of a dsRNA
targeting WCR vATPase, while protein levels decreased only after
three days of feeding. Even though complete suppression of the
vATPase protein was not achieved, the RNAi effect still resulted in
mortality.
Although systemic RNAi has been previously described for
insects of different orders via dsRNA injection [22,23,24] or
ingestion [39,40], this is the first report of systemic RNAi effect via
ingestion of dsRNA in a Coleopteran insect. By quantifying
mRNA levels in isolated tissues such as midgut and carcass, we
Figure 3. DvSnf7 mRNA and DvSNF7 protein suppression by RNAi. DvSnf7 dsRNA causes suppression at mRNA (A) and protein (B–D) levels
in Western Corn Rootworm (WCR, Diabrotica virgifera virgifera). (A) Real-time RT-PCR results showing significant decrease in DvSnf7 mRNA expression
in insects fed with 60 ng/mL of DvSnf7 240 bp dsRNA continuously for one and five days. Insects fed with control diets containing water or GFP
dsRNA do not show mRNA suppression. (B) Western blot results using anti-SNF7 antibody showed DvSNF7 protein suppression in insects fed with
DvSnf7 240 bp dsRNA after 5 days, which was confirmed by quantification of the Western blot by densitometry (C) as well as ELISA (D). Stars
represent values significantly different from controls (p = 0.05; t-test).
doi:10.1371/journal.pone.0047534.g003
RNAi Mechanisms in Western Corn Rootworm
PLOS ONE | www.plosone.org 6 October 2012 | Volume 7 | Issue 10 | e47534
were able to demonstrate the RNAi effect in WCR as systemic
which agrees with the requirement of longer exposure of relatively
low concentrations of DvSnf7 dsRNA to cause demonstrable
toxicity. Significant target suppression was obtained in both
midgut and carcass tissues after 24 hours. In addition, DvSnf7
mRNA levels decreased faster in the midgut than in the carcass.
This is not surprising as the midgut is one of the first tissues that
come into contact with the dsRNA upon ingestion. Hence,
because the silencing signal is exported from intestinal cells to
other cells (in the carcass for example) resulting in target
suppression in distant cells, it may likely be associated with a
higher likelihood in RNAi efficacy leading to insect death.
By combining the data from the diet bioassays, molecular
studies and tissue culture assays, a profile of the course of events
that leads to mortality in WCR upon ingestion of a dsRNA
emerges. Significant suppression of DvSnf7 mRNA in midgut and
carcass tissues was evident 1 day after exposure to the long DvSnf7
dsRNA, though DvSNF7 protein levels were unaffected and no
mortality was observed. However three days after the initiation of
feeding, DvSnf7 mRNA suppression stabilized in both tissues and
continued to spread more in the carcass tissues by five days post
exposure. Concomitantly, DvSNF7 protein levels were significant-
ly reduced by five days of expusre to DvSnf7 dsRNA. The timing
of suppression and systemic spreading coincides with the onset of
mortality in WCR larvae as observed in the diet bioassays.
Therefore the general mechanism of action that leads to WCR
death upon DvSnf7 dsRNA ingestion includes dsRNA uptake,
target mRNA/protein suppression and systemic spread. This work
also characterizes the relationship between dsRNA size in regards
to uptake and efficacy. In addition, the results presented here,
although obtained with a specific mRNA target (DvSnf7), suggests
extrapolation to other lethal targets due to the conserved nature of
the RNAi machinery. Further studies are underway that will
reveal the unique cellular and physiological defects that lead to
WCR death upon suppression of the DvSnf7 ortholog [41].
Materials and Methods
Insects
For all bioassays, WCR and SCR eggs were received from Crop
Characteristics (Farmington, MN). Upon receipt, eggs were
maintained at a target temperature of 10uCto25uC depending
on desired hatch time prior to disinfection. Near-hatching eggs
were washed and dispensed into plastic containers prior to
hatching. Newly hatched neonates (,30 hours post hatch) or
second instar larvae were used in all bioassays.
WCR bioassays
Bioassays were performed using either diet-overlay or diet
incorporation methodology. For diet-overlay, WCR diet was
prepared according to manufacturer’s guidelines for SCR diet
(Bio-Serv, Frenchtown, NJ) with a few adjustments, including the
addition of Formalin at 0.06% (v/v), 10% KOH (v/v) to increase
pH to 9, and lyophilized corn root tissue at 0.62% (w/v). 200 mlof
molten diet was pipetted into 24 wells of 96 well plates (Falcon),
allowed to solidify at room temperature and 20 mL’s of dsRNA
solution or water control was overlaid in each well. Plates were air
dried and one larvae (,30 hours post hatch) was added per well.
Plates were sealed with mylar, ventilation holes added to each well
with a #1or#2 insect pin, and plates incubated at 27uC for
12 days. For diet incorporation assays, dsRNA treatments were
prepared by mixing a dosing solution and purified RNAse free
water with Bio Serv diet described above by vortex-mixing until
homogeneous. A repeat pipettor was used to aliquot 1 mL of diet
into individual wells of 48-well plates (Falcon). Plates were allowed
to air dry and one larvae (,30 hours post hatch) was added per
well with a target number of 72 larvae used for control treatments
in each assay, and a target number of 24 larvae for each dsRNA
treatment replicate. Plates were sealed with mylar and incubated
at 27uC for 12 days, unless otherwise stated.
Growth inhibition and dsRNA uptake
Diet bioassays for growth inhibition and uptake studies were
conducted with WCR. For the growth inhibition study, 10 WCR
larvae were fed a single concentration of 1000 ng dsRNA/mL diet
Figure 4. RNAi effect spreads to other tissues beyond the midgut in Western Corn Rootworm (WCR,
Diabrotica virgifera virgifera
).
DvSnf7 mRNA levels were decreased in isolated midgut and carcass tissues of second instar larvae fed for 24 hours with 1000 ng/mL diet of DvSnf7
240 bp dsRNA, as assessed by Real-time RT-PCR. Further mRNA suppression is observed in the carcass and midgut at days 3 and 5 post-feeding.
Means followed by same letter are not significantly different (p = 0.05; t-test).
doi:10.1371/journal.pone.0047534.g004
RNAi Mechanisms in Western Corn Rootworm
PLOS ONE | www.plosone.org 7 October 2012 | Volume 7 | Issue 10 | e47534
in a diet overlay bioassay for a period of 5 days. Growth inhibition
was determined against an equal number of WCR larvae fed GFP
dsRNA as a control. For the uptake studies, WCR larvae were fed
Cy-3 labeled dsRNA DvSnf7 240 bp and the siRNA (21.3) at
100 ng dsRNA/mL diet for 12 days. Control and treatment
groups contained a target number of 24 larvae each.
Concentration-Response Relationship Bioassays
A series of diet incorporation bioassays were conducted to
characterize concentration-response relationships and estimate
LC
50
values for dsRNA DvSnf7 against WCR and SCR. Three
replicates over time were conducted for each species. For each
replicate assay, approximately 24 larvae were infested at each
concentration and 72 larvae in negative control. Each bioassay
consisted of a buffer control and a geometric series of concentra-
tion levels to estimate LC
50
values. RNAse-free water was used as
a control and individual bioassays were deemed acceptable if
control mortality was less than 20%.
Exposure duration bioassays
WCR neonate larvae were fed 50 ng or 1000 ng of DvSnf7
dsRNA/mL diet for 2, 3, 6, 12 and 24 hours followed by exposure
to control diet for a total duration of 12 days. Additionally,
separate WCR neonates were exposed continuously to the same
concentrations for the entire 12 day assay period using artificial
diet as described above. In order to expose a large number of
larvae, and facilitate removal of subsamples at different time
points, Petri dishes (100 mm) were used as exposure chambers.
For each treatment concentration, 20 mL of diet was added to
each Petri dish and a target number of 100 newly-hatched WCR
larvae were added in each dish with a fine haired paintbrush. At
each sampling time, 30 to 36 WCR larvae were removed from
each DvSnf7 treatment and placed onto 250 mL of untreated diet
in 48-well plates. For continuous exposure treatments, larvae were
directly added onto diets containing DvSnf7 at 50 or 1000 ng
dsRNA/mL diet in 48-well plates. Mortality was recorded daily
for the duration of the assay.
Size-Activity Relationship Studies
Ten dsRNA fragment lengths that contained an active 27 base
pair (bp) dsRNA sequence were incorporated into inert carrier
sequences with total lengths of 27 (no additional carrier): 40, 50,
60, 70, 80, 90, 100, 150, and 240 bp, and tested against SCR in
diet incorporation bioassays (see File S1). The 27 bp size fragment
was chosen over a smaller 21 bp fragment due to its ability to
provide a better substrate for the dicer enzyme, allowing for
efficient cleaving of dsRNA into siRNAs [42]. Additionally, there
is 100% sequence match for this 27 bp fragment between WCR
and SCR. This 27 bp segment was chosen based upon demon-
strated high efficacy against WCR when included as part of longer
dsRNAs (data not shown), The chosen 27 bp fragment can be
diced into seven different 21 bp fragments (see File S1). In order to
compare the activity of the individual 21 bp fragments comprising
the 27 bp fragment, each of the seven synthetic 21 bp were also
embedded into an inert carrier sequence for a total of 240 bp and
fed to SCR in 12-day artificial diet bioassays. Details of dsRNA
synthesis method are described in the dsRNA synthesis session below.
The inert (neutral) carrier sequence was designed according to
strict criteria, including: (1) a standard sequence selection process
for inverted repeat transformation constructs (i.e. no 21-mer
matches to corn or human), and ideally even fewer matches to
WCR sequences (e.g., no 18 out of 21-mer matches or even more
stringent); (2) little homology to corn or WCR sequence; (3) similar
GC content as the original DvSnf7 240 bp; and (4) little coding
capacity (no ATGs in beginning of the sequence, no more than 20
potential amino acids in all six-frames).
SCR larvae for the size series assays were continuously exposed
at 23 ng DvSnf7 dsRNA/mL diet for each dsRNA fragment
length. Controls for each assay included negative water-only
treatments as well as the neutral carrier sequence at 23 ng/mL.
To compare the activity of the seven different 21 bp fragments,
each of the seven synthetic 21 bp were tested in concentration-
response assays with concentrations ranging from 0.24 to 23 ng
DvSnf7 dsRNA/mL diet. Control and treatment groups contained
a target number of 72 and 24 larvae, respectively, and mortality
was evaluated after 12 days. Positive control for the assays was the
DvSnf7 240 bp construct. Diet used in these studies was standard
SCR diet (Bio-Serve, Frenchtown, NJ) prepared according to the
manufacturers guidelines. Dispensing of diet and infesting of SCR
larvae was performed as described for WCR above. Bioassay trays
were incubated at a target temp of 27uC and 70% relative
humidity in complete darkness.
Snf7 mRNA and protein suppression studies
Diet incorporation bioassays were conducted to expose WCR
larvae (#30 hours old) to the 240 bp DvSnf7 dsRNA to generate
tissues for Western Blot, ELISA and real-time RT-PCR analysis.
Larvae were exposed to dsRNA continuously and sampled after
0 days (no exposure), one day, and five days. The exposure
procedure was followed as described under Exposure Duration
Bioassays section. To ensure toxicity of DvSnf7 to WCR, 60 ng/
mL of dsRNA was incorporated into the diet. This value
represents the 12-day LC
99
for DvSnf7 against WCR as
determined by concentration-response bioassays (data not shown).
Control treatments of GFP dsRNA and water were performed
concurrently with DvSnf7 treatment. Tissue samples were
collected and held at 280uC until processed and analyzed for
DvSnf7 mRNA and protein suppression.
Systemic spread studies
Diet-overlay bioassays were conducted to expose 2
nd
instar
WCR larvae to the 240 bp DvSnf7 dsRNA and dissect midgut and
carcass tissues for real-time RT-PCR analysis. Larvae were
exposed to dsRNA continuously and sampled after 0 days (no
exposure), one day, three days and five days. The exposure
procedure was followed as described under Exposure Duration
Bioassays section. Because a higher concentration of dsRNA is
required for 2
nd
instar larvae compared to first instar larvae (data
not shown), 1000 ng dsRNA/mL diet was overlaid onto diet. A
control treatment with GFP dsRNA was performed concurrently
with DvSnf7. Isolated tissue samples were collected and held at
280uC until processed and analyzed for DvSnf7 mRNA.
dsRNA synthesis
The WCR DvSnf7 target cDNA (Supplementary Information
S1) was amplified out of a WCR neonate cDNA library prepared
using SuperScript
TM
First-Strand Synthesis System (Invitrogen),
using total RNA extracted with TRIzol reagent (Invitrogen) as
template. Primers containing a T7 polymerase promoter region
(TAATACGACTCACTATAGGG) at the 59end were used to
amplify the DvSnf7 240 bp region by PCR (Supplementary
Information Table S1). PCR products were cloned into pUC19
(New England Biolabs) between EcoRI and HindIII restriction sites
and sequences confirmed. Plasmid DNA was linearized using
HindIII restriction enzyme and used as template for dsRNA
synthesis using the MEGAscript kit (Ambion), according to the
manufacturer’s protocol.
RNAi Mechanisms in Western Corn Rootworm
PLOS ONE | www.plosone.org 8 October 2012 | Volume 7 | Issue 10 | e47534
GFP target (Supplementary Information S1) cloned into pBTA2
was amplified using gene specific primers (Supplementary
Information Table S1) containing the T7 polymerase recognition
region at the 59end. The PCR product was used as template to
synthesize dsRNA with the MEGAscript kit (Ambion) following
the manufacturer’s protocol.
To investigate the effect of dsRNA length on WCR activity, a
27 bp sequence from WCR DvSnf7 (TAGATGGAACCCTTA-
CAACTATTGAAA) was embedded into an artificial sequence
(filler) (Supplementary Information S1), resulting in a 240 bp
product. Various dsRNA sizes were made by successively paring
down each end of the artificial sequence to create a range of
dsRNA sizes (40, 50, 60, 70, 80, 90, 100 and 150 bp) in which the
DvSnf7 27 bp sequence was located in the middle of each dsRNA.
All seven possible 21 bp fragments from the 27 bp sequence were
synthesized and embedded into the inert sequence to form 240 bp
fragments. Nucleotides adjacent to the 21 bp that matched the
DvSnf7 sequence (including G-U pairings) were mismatched to
prevent production of an embedded 22 bp. DNA fragments of the
desired sequences containing a single T7 polymerase promoter
region (TAATACGACTCACTATAG GG) were cloned into
pUC19 (New England Biolabs) between EcoRI and HindIII
restriction sites and their sequences confirmed. Two separate
clones with the same target region in sense or antisense
orientations were used as template for dsRNA synthesis using
the MEGAscript kit (Ambion), according to manufacturer’s
protocol.
To ensure the quality and integrity for the characterization of
the dsRNA samples, the following criteria were followed: 1) DNA
templates for in vitro transcription reactions of dsRNA test
materials contained the expected nucleotide sequences, confirmed
via DNA sequencing and alignment; 2) dsRNAs had near 100%
purity, based on spectrophotometric analysis, in addition to
agarose gel results; 3) individual dsRNA fragment lengths matched
the expected lengths, confirmed via agarose gel electrophoresis; 4)
the final concentration of each dsRNA material was determined
via spectrophotometric analysis.
Labeling of dsRNA/siRNA
One of the seven possible siRNAs (21 bp; Supplementary
Information S1) within the 27 bp dsRNA, 21.3 was selected based
on the criteria described in [43]. The siRNA 39end was modified
to dTdT to inhibit nuclease activity during midgut incubation in
tissue culture medium. Cy-3 labeled and unlabeled versions of
these siRNAs were purchased from Sigma. Cy3-labeling of 240 bp
DvSnf7 dsRNA was performed using the Silencer siRNA labeling
kit (Ambion), according to manufacture’s instructions. Adequate
labeling of dsRNA was confirmed by loading both labeled and
unlabeled dsRNAs onto a 1% agarose gel. The gel was stained
with 1 mg/mL ethidium bromide in 1X TBE (Roche). Bands were
visualized using a UV transilluminator (Bio-Rad).
Midgut tissue culture assays
Second-instar WCR larvae grown on artificial diet were
transferred to 24-well plates containing 1.5 cm filter paper circles
wetted with sterile 1X PBS (Phosphate buffered saline (Roche)
+0.5% gentamicin (Sigma) +0.1% 100X antibiotic-antimycotic
solution (Sigma)) for 2–3 h. This step was included to minimize the
presence of gut contents. Larvae were surface sterilized by
immersion in successive 2-min washes of 70% ethanol and 0.1%
Clorox solution, and washed twice in sterile 1X PBS. Midguts
were dissected under aseptic conditions in a horizontal laminar
airflow work station in sterile 1X PBS. Midguts were rinsed in
sterile 1X PBS twice to eliminate gut contents, then washed in
sterile 1X PBS followed by sterile Insect 420 medium (Sigma) at
1:3 ratio, and finally into sterile Insect 420 medium (with 100 mg/
mL gentamicin and 1X antibiotic-antimycotic solution (Sigma)).
Midguts were subsequently incubated in batches of 3–5 per well in
96-well plates containing 100 mL sterile insect medium for 4 h at
25uC. Labeled and unlabeled dsRNA and siRNAs were added at
1mg/100 mL insect medium and incubated for 15 h at 25uC
protected from direct light. Unincorporated Cy3 dye was used as a
control at 1:100 in insect medium. The entire experiment was
performed in triplicate containing 3–5 midguts per replicate.
Midguts were retrieved from culture plates, washed twice with 1X
PBS and fixed in 4% Paraformaldehyde for 1 h at room temp.
Midguts were washed three times with 1X PBST (PBS +0.1%
Tween) for 5 minutes each and counterstained with DAPI (Sigma,
10 mg/mL of stock diluted to 1:1000) for 5 min. Finally, midguts
were washed once in 1X PBST and mounted onto a glass slide
containing Slow fade antifade solution (Invitrogen). Images were
captured using a 550 nm (Cy3) and 360 nm (DAPI) laser for
excitation and 570 nm (Cy3) and 450–460 nm (DAPI) for
emission filter sets, under a confocal microscope. Scanned images
were processed using LSM (Carl Zeiss AIM; version 4.2) and
Adobe Photoshop (CS5 software; version 12.0632) software.
Real-time RT-PCR
RNA was extracted from insect tissues using TRIzol reagent
(Invitrogen) following manufacturers’ instructions. RNA was
quantified using a spectrophotometer (Nanodrop), diluted to
50 ng in RNAse free water and used as template for real-time
RT-PCR using the CFX manager software (Biorad), according to
manufacture’s instructions. Reactions included 1 mL RNA (50 ng/
mL), 6.25 mL of SYBR Green mix (Iscript one-step RT-PCR kit,
BioRad), 0.5 mL 10 pmol forward and reverse primers, 0.25 mL
reverse transcriptase (BioRad) and 4.0 mL RNAse free water, for a
total volume of 12 mL. Reactions were set-up in 96-well Microseal
PCR plates (Biorad) in triplicate. Appropriate controls including
no-template control (NTC) and no reverse transcriptase control
(NRT) were included. Tubulin (endogenous control; reference
gene, Supplementary Information S1) primers were used simul-
taneously for normalization. Standard curves were generated using
known concentrations of DvSnf7 plasmid clone DNA. Relative
expression levels were determined using the standard curve.
Western blots and ELISA
Full length His-tagged DvSNF7 protein was produced in E. coli
and the N-terminal His-tagged protein was purified by sequential
Ni-NTA and size exclusion chromatography. Concentrations were
determined by amino-acid analysis. Purity was .95% and identity
was confirmed by mass spectrophotometry. This sample was used
for antibody generation and as protein standard in western blots
and ELISA. Polyclonal antibodies were raised in New Zealand
White rabbits against the N-terminal His-tagged full length
DvSNF7 protein. IgG was Protein A (Bio-Rad) affinity-purified
from sera and biotinylated (Thermo) for use as detection antibody
in ELISA experiments.
WCR neonate extracts were prepared in PBST containing
protease inhibitors (Sigma) and total protein levels measured by
BCA total protein assay (Pierce). Extracts were prepped with 2X
LDS buffer (Invitrogen) containing DTT as a reducing agent and
heated at 70uC for 5 min. Equal amounts of total protein (30 mg)
were loaded onto 10% Bis-Tris gels (Invitrogen) and run in MOPS
running buffer at 150 V. Proteins were transferred to a 0.2 mM
nitrocellulose membrane (Bio-Rad) at 100 V for one hour in
transfer buffer (Invitrogen) containing 20% methanol and blocked
overnight at 4uC with PBST containing 2% nonfat dry milk. Blots
RNAi Mechanisms in Western Corn Rootworm
PLOS ONE | www.plosone.org 9 October 2012 | Volume 7 | Issue 10 | e47534
were probed with rabbit anti-DvSNF7 IgG at 1 mg/mL at room
temp for 1 hour and washed 465 minutes in PBST. A goat anti-
rabbit-HRP secondary antibody (Thermo, 1:200,000 dilution) was
used to probe blots for one hour at room temp. Blots were washed
465 minutes in PBST. Upon incubation with chemiluminescent
substrate (Thermo), the signal was detected by exposure to film
(Roche). Band densities were measured using a Bio-Rad GS-800
densitometer. Densitometry results were obtained from an average
of three replicates per treatment and time-point, loaded on
duplicate gels.
Expression levels of DvSNF7 were also measured via a double
antibody sandwich (DAS) ELISA. ELISA plates (Thermo) were
coated overnight at 4uC with rabbit anti-DvSNF7 polyclonal
antibody at 5 mg/mL. Plates were washed four times with PBST
between each step, with a BioTek ELX405HT2S plate washer. All
incubations were performed for one hour at 37uC. WCR extracts
were prepared in PBST and loaded at 15 mg/well (total protein). A
biotin labeled anti-DvSNF7 antibody followed by neutravidin-
HRP (Thermo) and TMB substrate (Sigma) was used for
detection. Reactions were stopped with 3 M phosphoric acid
and absorbance measured at 450 nm. Quantification of DvSNF7
levels was performed using standard DvSNF7 protein as reference.
DvSNF7 expression levels were measured for three replicates per
treatment and time point, loaded on duplicate plates.
Statistical Analyses
Comparisons of mortality among treatments groups was
performed with a one-sided Fisher’s Exact Test (p = 0.05). The
standard PROBIT model, under PROC PROBIT in SAS (SAS
9.2, SAS Institute Inc., Cary, NC, USA) was used to estimate the
LC
50
values using the OPTC function to correct for control
mortality. Significance of concentration-response curves was
evaluated with a Chi-square test (p = 0.05). In one case where
PROC PROBIT did not provide a 95% confidence interval for a
given LC
50
value, the diet concentrations bracketing the LC
50
value are provided as an estimate of the 95% confidence intervals.
Slopes for concentration response curves were compared with an
extra sum-of-squares F-test (p = 0.05) or 95% confidence intervals
are reported. For gene expression studies analysis of variance
(ANOVA) was run following a complete randomized design and
the samples were compared with each other using the mean
separation technique which provides the letter grouping based on
the pair-wise t test from SAS PROC GLIMMIX at the
significance level of alpha = 0.05 (SAS 9.2, SAS Institute Inc.,
Cary, NC, USA).
Supporting Information
File S1 Details of gene sequences used in the study.
(DOCX)
Table S1 Primer sequences used in the study.
(DOCX)
Author Contributions
Conceived and designed the experiments: RB GS PR SL GH CL.
Performed the experiments: JA PB EW. Analyzed the data: RB PR PB RF
CL WM. Contributed reagents/materials/analysis tools: WC OI GM JT
JU. Wrote the paper: RB.
References
1. Fire A, Xu SQ, Montgomery MK, Kostas SA, Driver SE, et al. (1998) Potent
and specific genetic interference by double-stranded RNA in Caenorhabditis
elegans. Nature 391: 806–811.
2. Waterhouse PM, Wang MB, Lough T (2001) Gene silencing as an adaptive
defence against viruses. Nature 411: 834–842.
3. Wang XH, Aliyari R, Li WX, Li HW, Kim K, et al. (2006) RNA interference
directs innate immunity against viruses in adult Drosophila. Science 312: 452–454.
4. Brown SJ, Mahaffey JP, Lorenzen MD, Denell RE, Mahaffey JW (2009) Using
RNAi to investigate orthologous homeotic gene function during development of
distantly related insects. Evolution and Development 1: 11–15.
5. Amdam GV, Simoes ZLP, Guidugli KR, Norberg K, Omholt SW (2003)
Disruption of vitellogenin gene function in adult honeybees by intra-abdominal
injection of double-stranded RNA. Bmc Biotechnology 3: 1–8.
6. Suazo A, Gore C, Schal C (2009) RNA interference-mediated knock-down of
Bla g 1 in the German cockroach Blattella germanica L., implicates this allergen-
encoding gene in digestion and nutrient absorption. Insect Molecular Biology
18: 727–736.
7. Baum JA, Bogaert T, Clinton W, Heck GR, Feldmann P, et al. (2007) Control of
coleopteran insect pests through RNA interference. Nat Biotechnol 25: 1322–
1326.
8. Whyard S, Singh AD, Wong S (2009) Ingested double-stranded RNAs can act as
species-specific insecticides. Insect Biochemistry and Molecular Biology 39: 824–
832.
9. Mao YB, Cai WJ, Wang JW, Hong GJ, Tao XY, et al. (2007) Silencing a cotton
bollworm P450 monooxygenase gene by plant-mediated RNAi impairs larval
tolerance of gossypol. Nat Biotechnol 25: 1307–1313.
10. Zhu JQ, Liu SM, Ma Y, Zhang JQ, Qi HS, et al. (2012) Improvement of Pest
Resistance in Transgenic Tobacco Plants Expressing dsRNA of an Insect-
Associated Gene EcR. Plos One 7.
11. Zha WJ, Peng XX, Chen RZ, Du B, Zhu LL, et al. (2011) Knockdown of
Midgut Genes by dsRNA-Transgenic Plant-Mediated RNA Interference in the
Hemipteran Insect Nilaparvata lugens. Plos One 6.
12. Zhou XG, Wheeler MM, Oi FM, Scharf ME (2008) RNA interference in the
termite Reticulitermes flavipes through ingestion of double-stranded RNA. Insect
Biochemistry and Molecular Biology 38: 805–815.
13. Walshe DP, Lehane SM, Lehane MJ, Haines LR (2009) Prolonged gene
knockdown in the tsetse fly Glossina by feeding double stranded RNA. Insect
Molecular Biology 18: 11–19.
14. Coy MR, Sanscrainte ND, Chalaire KC, Inberg A, Maayan I, et al. (2012) Gene
silencing in adult Aedes aegypti mosquitoes through oral delivery of double-
stranded RNA. Journal of Applied Entomology. doi: 10.1111/j.1439-
0418.2012.01713.x.
15. Terenius O, Papanicolaou A, Garbutt JS, Eleftherianos I, Huvenne H, et al.
(2011) RNA interference in Lepidoptera: An overview of successful and
unsuccessful studies and implications for experimental design. Journal of Insect
Physiology 57: 231–245.
16. Palauqui JC, Elmayan T, Pollien JM, Vaucheret H (1997) Systemic acquir ed
silencing: Transgene-specific post-transcriptional silencing is transmitted by
grafting from silenced stocks to non-silenced scions. Embo Journal 16: 4738–
4745.
17. Voinnet O, Baulcombe DC (1997) Systemic signalling in gene silencing. Nature
389: 553–553.
18. Winston WM, Sutherlin M, Wright AJ, Feinberg EH, Hunter CP (200 7)
Caenorhabditis elegans SID-2 is required for environmental RNA interference.
Proceedings of the National Academy of Sciences of the United States of
America 104: 10565–10570.
19. Saleh MC, van Rij RP, Hekele A, Gillis A, Foley E, et al. (2006) The endocytic
pathway mediates cell entry of dsRNA to induce RNAi silencing. Nature Cell
Biology 8: 793–U719.
20. Ulvila J, Parikka M, Kleino A, Sormune n R, Ezekowitz RA, et al. (2006)
Double-stranded RNA is internalized by scavenger receptor-mediated endocy-
tosis in Drosophila S2 cells. Journal of Biological Chemistry 281: 14370–14375.
21. Rocha JJE, Korolchuk VI, Robinson IM, O’Kane CJ (2011) A Phagocytic
Route for Uptake of Double-Stranded RNA in RNAi. Plos One 6.
22. Alves AP, Lorenzen MD, Beeman RW, Foster JE, Siegfried BD (2010) RNA
interference as a method for target-site screening in the western corn rootworm,
Diabrotica virgifera virgifera. Journal of Insect Science 10: 162.
23. Bucher G, Scholten J, Klinger M (2002) Parental RNAi in Tribolium (Coleopte ra)
Current Biology 12. R85–R86.
24. Tomoyasu Y, Den ell RE (2004) Larval RNAi in Tribolium (Coleoptera) for
analyzing adult development. Development Genes and Evolution 214: 575–578.
25. Huvenne H, Smagghe G (2010) Mechanisms of dsRNA uptake in insects and
potential of RNAi for pest control: a review. J Insect Physiol 56: 227–235.
26. Kumar P, Pandit SS, Baldwin IT (2012) Tobacco Rattle Virus Vector: A Rapid
and Transient Means of Silencing Manduca sexta Genes by Plant Mediated RNA
Interference. Plos One 7.
27. Sweeney NT, Brenman JE, Jan YN, Gao FB (2006) The coiled-coil protein
shrub controls neuronal morphogenesis in Drosophila. Curr Biol 16: 1006–1011.
28. Vaccari T, Rusten TE, Menut L, Nezis IP, Brech A, et al. (2009) Comparative
analysis of ESCRT-I, ESCRT-II and ESCRT-III function in Drosophila by
efficient isolation of ESCRT mutants. J Cell Sci 122: 2413–2423.
RNAi Mechanisms in Western Corn Rootworm
PLOS ONE | www.plosone.org 10 October 2012 | Volume 7 | Issue 10 | e47534
29. Kim DW, Sung H, Shin D, Shen H, Ahnn J, et al. (2011) Differential
physiological roles of ESCRT complexes in Caenorhabditis elegans. Mol Cells 31:
585–592.
30. Belles X (2010) Beyond Drosoph ila: RNAi in vivo and functional genomics in
insects. Annu Rev Entomol 55: 111–128.
31. Whangbo JS, Hunter CP (2008) Environmental RNA interference. Trends in
Genetics 24: 297–305.
32. Swevers L, Smagghe G, editors (2012) Use of RNAi for Control of Insect Crop
Pests. Dordercht, The Netherlands: Springer-Verlag. 177–197 p.
33. Upadhyay SK, Chandrashekar K, Thakur N, Verma PC, Borgio JF, et al. (2011)
RNA interference for the control of whiteflies (Bemisia tabaci) by oral route.
Journal of Biosciences 36: 153–161.
34. Borgio JF (2010) RNAi mediated gene knockdown in sucking and chewing insect
pests. J Biopesticides 3: 386–393.
35. Siegfried BD, Vaughn TT, Spencer T (2005) Baseline susceptibility of western
corn rootworm (Coleoptera: Chrysomelidae) to Cry3Bb1 Bacillus thuringiensis
toxin. Journal of Economic Entomology 98: 1320–1324.
36. Auer C, Frederick R (2009) Crop improvement using small RNAs: applications
and predictive ecological risk assessments. Trends in Biotechnology 27: 644–651.
37. Kumar M, Gupta GP, Rajam MV (2009) Silencing of acetylcholinesterase gene
of Helicoverpa armigera by siRNA affects larval growth and its life cycle. Journal of
Insect Physiology 55: 273–278.
38. Rangasamy M, Siegfried BD (2012) Validation of RNA interference in western
corn rootworm Diabrotica virgifera virgifera LeConte (Coleoptera: Chrysomelidae)
adults. Pest Management Science 68: 587–591.
39. Tian HG, Peng H, Yao Q, Chen HX, Xie Q, et al. (2009) Developmenta l
Control of a Lepidopteran Pest Spodoptera exigua by Ingestion of Bacteria
Expressing dsRNA of a Non-Midgut Gene. Plos One 4.
40. Turner CT, Davy MW, MacDiarmid RM, Plummer KM, Birch NP, et al.
(2006) RNA interference in the light brown apple moth, Epiphyas postvittana
(Walker) induced by double-stranded RNA feeding. Insect Molecular Biology
15: 383–391.
41. Ramaseshadri P, Segers G, R F, Clinton W, Oliver I, et al. (2012) Suppression of
a component of the ESCRT-III pathway (Snf7) by oral RNAi disrupts
endosomal-autophagic pathway in the western corn rootworm (Diabrotica virgifera
virgifera) larvae Plos One. Under review.
42. Behlke MA (2006) 27mer RNA Duplexes as triggers of RNAi. BIOforum
Europe 6: 25–27.
43. Yamaguchi J, Mizoguchi T, Fujiwara H (2011) siRNAs Induce Efficient RNAi
Response in Bombyx mori Embryos. Plos One 6.
RNAi Mechanisms in Western Corn Rootworm
PLOS ONE | www.plosone.org 11 October 2012 | Volume 7 | Issue 10 | e47534
... This was considered to be a robust system since the previous experiments only reported changes seen in embryos and embryonic RNAi does not persist in the later stages of the insect life cycle [47,48]. Overall, there appears to be a wide range of experimental success rates for different species, with larvae, having injections performed on or between segments, while it was convenient to inject adults under the wings [49]. Although there are many successful cases of injection dsRNA delivery triggering RNAi, it cannot be denied that different microinjection protocols can significantly affect the experimental success rate. ...
... There is also the potential to injure the cuticle at the injection site which has necessitated the shift to oral administration of dsRNA [50]. It has been speculated to be a combination of several elements, including the insect's life stage, injected concentration, and injected dsRNA quantity [49]. ...
... The first demonstration of dsRNA ingestion in rootworms was been studied and documented, with Dvsnf7 dsRNA being fed to western corn rootworm (WCR-Diabrotica virgifera virgifera). At 24 h post feeding of larvae resulting in them showing high absorbance to 60 bp dsRNA and the rootworm began to die after showing developmental retardation [49]. Similar results had been found in Sri Lanka weevil, a highly polyphagous pest [51]. ...
Full-text available
Article
Insects and ectoparasites are causes for major concern throughout the world due to their economic and welfare impacts on livestock agriculture. Current control measures involve chemicals such as acaricides which pose challenges like chemical resistance and longer withholding periods. To enable more sustainable agriculture practices, it is important to develop technologies that combine targeted effectiveness with minimal environmental footprint. RNA interference (RNAi) is a eukaryotic process in which transcript expression is reduced in a sequence-specific manner. This makes it a perfect tool for developing efficient and effective biological control against pests and pathogens. Double-stranded RNA (dsRNA) is the key trigger molecule for inducing RNAi; this concept is widely studied for development of RNA-based biopesticides as an alternative to chemical controls in crop protection for targeting pests and pathogens with accuracy and specificity. In this review, we discuss key advances made using RNAi technology and how they can be applied to improve health in livestock industries. This includes research focused on different delivery mechanisms of dsRNA, important developments in regulatory frameworks, and risk identification, that will enable the future adoption of RNAi technologies to improve animal health.
... Possible explanations for failure may be multiple and could include 1) dsRNA injection dose: Another difference between our study and that of Xu et al. (2018) is the dsRNA sequences and the length of these sequences (our sequences were much longer), since the dsRNA sequence and the dsRNA fragment size appear to be important factors for cell uptake and the effectiveness of the silencing (Huvenne et al. 2010;Bolognesi et al. 2012). At last, the aphid genotype used is different and the presence of symbionts in their aphid line was not tested. ...
Thesis
Symbiosis is omnipresent in nature. In these intimate and prolonged associations between different organisms, the effect of gene expression from one partner on the other can lead to the appearance of new phenotypes, a concept called "extended phenotype". My thesis focuses on the study of host-parasitoid-symbiont interactions in aphids, mainly the pea aphid Acyrthosiphon pisum, which has become a model for its obligatory nutritional symbiosis with Buchnera aphidicola and facultative with one or more symbiotes, the most common being Hamiltonella defensa (Hd), Regiella insecticola (Ri) and Serratia symbiotica (Ss). My work addresses ecological and physiological aspects of facultative symbiosis in aphids. Aphids are hosts for a complex community of parasitoids that fit in the Performance-Preference Hypothesis (PPH) suggesting that females will preferentially lay eggs in hosts that maximize the survival and performance of their offspring. The PPH evaluation classifies parasitoids in terms of degree of specialization. I participated in the determination of the PPH of three parasitoids (Aphelinus abdominalis, Aphidius ervi and Diaeretiella rapae) using 12 aphid species (6 Aphidini and 6 Macrosiphini) maintained on different host plants and whose symbiotic status was established. A. abdominalis and D. rapae appeared as generalists and A. ervi as a moderate specialist. All species showed low selectivity towards the host regardless of the host plant or symbiont, but parasitic success was impacted by some symbionts. I then studied the effect of host genotype, genotypes (host x symbiont) on parasitoid success using artificially infected clones of the aphid Sitobion avenae with a protective strain of Ri. Infected lines are better hosts for Aphelinus asychis but not Aphidius gifuensis, compared to the same infection-free clones. The Ri effect is therefore dependent on the parasitoid species, indicating that the cost/benefit of a symbiont is context-dependent. In the second part of my thesis, I focused on the host's immune system as a central aspect in the establishment and evolution of interactions between organisms. The annotation of different aphid genomes shows a reduced immunity that could be due to their adaptation to a symbiotic life. Hemocytes and phenoloxidase activity, two major immune components, have been described in aphids. I have developed molecular tools to analyze the expression of genes encoding both phenoloxidases (PO) of A. pisum (PO2 and PO2-X1) and to estimate their amount in the hemolymph. I used clones from different genetic backgrounds without secondary symbiont (LL01, YR2-Amp, T3-8V1-Amp) and natural or artificial lines YR2 or T3-8V1 infected with Hd, Ri or Ss. I have demonstrated that: i) both genes are expressed and their products are present in circulating form in the hemolymph, ii) gene expression, amount and activity of PO are highly correlated and depend on the genetic background of the host and iii) these three markers are significantly decreased by the presence of Hd and Ri. I observed a correlation between the impact of stressors on the aphid's life traits and the presence of some symbionts (and therefore the amount of PO in aphids), but no correlation with the variation in PO after stress. This work therefore shows a strong interaction between the host's immune capacity and the symbiotic status of the aphid, and can explain the success or failure of some parasitoids that are not highly specialized for the host they attack.
... Long dsRNA seems to be more efficient to be internalization than short dsRNA molecules. In D. virgifera virgifera, the 240 bp Cy3-dsRNAs could be observed in midgut cells while the 21 bp Cy3-siRNAs were barely detectable (Bolognesi et al., 2012). In Drosophila S2 cells, transfection reagents were needed to aid the efficient cellular uptake of siRNA (Saleh et al., 2006). ...
Full-text available
Article
The limitations of conventional pesticides have raised the demand for innovative and sustainable solutions for plant protection. RNA Interference (RNAi) triggered by dsRNA has evolved as a promising strategy to control insects in a species-specific manner. In this context, we review the methods for mass production of dsRNA, the approaches of exogenous application of dsRNA in the field, and the fate of dsRNA after application. Additionally, we describe the opportunities and challenges of using nanoparticles as dsRNA carriers to control insects. Furthermore, we provide future directions to improve pest management efficiency by utilizing the synergistic effects of multiple target genes. Meanwhile, the establishment of a standardized framework for assessment and regulatory consensus is critical to the commercialization of RNA pesticides.
... Recently, a highly species-specific and environmentally friendly dsRNA was developed as a useful tool to control pests, indicating that RNAibased pesticides have significant potential in pest management [11,12]. Currently, scientists focus on developing biopesticides based on RNAi technology to control worldwide pests, including Diabrotica virgifera virgifera [13,14], Leptinotarsa decemlineata [15], Henosepilachna vigintioctopunctata [16,17], Aphis gossypii [18], Myzus persicae [19], and other pests. ...
Full-text available
Article
The striped flea beetle, Phyllotreta striolata, is one of the most destructive pests of Cruciferae crops worldwide. RNA interference (RNAi) is a promising alternative strategy for pest biological control, which overcomes the weakness of synthetic insecticides, such as pest resistance, food safety problems and toxicity to non-target insects. The homolog of Spt16/FACT, dre4 plays a critical role in the process of gene transcription, DNA repair, and DNA replication; however, the effects of dre4 silencing in P. striolata remain elusive. In this study, we cloned and characterized the full-length dre4 from P. striolata and silenced Psdre4 through microinjection and oral delivery; it was found that the silencing of dre4 contributed to the high mortality of P. striolata in both bioassays. Moreover, 1166 differentially regulated genes were identified after Psdre4 interference by RNA-seq analysis, which might have been responsible for the lethality. The GO analysis indicated that the differentially regulated genes were classified into three GO functional categories, including biological process, cellular component, and molecular function. The KEGG analysis revealed that these differentially regulated genes are related to apoptosis, autophagy, steroid hormone biosynthesis, cytochrome P450 and other signaling pathways. Our results suggest that Psdre4 is a fatal RNAi target and has significant potential for the development of RNA pesticides for P. striolata management.
... In a transgenic strategy aiming at the expression of dsRNA molecules to trigger the RNAi in the target herbivore insect, it is sought that the dsRNA molecules expressed in the plant system have the following characteristics: long dsRNAs resistant to processing by the gene silencing machinery of plants, in order to create molecules with greater RNAi bioavailability for the target insect [30,72]. In coleopterans, dsRNA molecules larger than 70 bp are essential to trigger the action of RNAi [73,74]. To endow dsRNA with these characteristics, we turned to nature to find the design template for a dsRNA molecule. ...
Full-text available
Article
Cotton is the most important crop for fiber production worldwide. However, the cotton boll weevil (CBW) is an insect pest that causes significant economic losses in infested areas. Current control methods are costly, inefficient, and environmentally hazardous. Herein, we generated transgenic cotton lines expressing double-stranded RNA (dsRNA) molecules to trigger RNA interference-mediated gene silencing in CBW. Thus, we targeted three essential genes coding for chitin synthase 2, vitellogenin, and ecdysis-triggering hormone receptor. The stability of expressed dsRNAs was improved by designing a structured RNA based on a viroid genome architecture. We transformed cotton embryos by inserting a promoter-driven expression cassette that overexpressed the dsRNA into flower buds. The transgenic cotton plants were characterized, and positive PCR transformed events were detected with an average heritability of 80%. Expression of dsRNAs was confirmed in floral buds by RT-qPCR, and the T1 cotton plant generation was challenged with fertilized CBW females. After 30 days, data showed high mortality (around 70%) in oviposited yolks. In adult insects fed on transgenic lines, chitin synthase II and vitellogenin showed reduced expression in larvae and adults, respectively. Developmental delays and abnormalities were also observed in these individuals. Our data remark on the potential of transgenic cotton based on a viroid-structured dsRNA to control CBW.
... In the study dsRNA was isolated and imaged, showing the product to be intact hpRNA and Dicer processed siRNAs (21-24 nt in length). As previously mentioned, siRNA is not active for RNAi when ingested by insect pests, and dsRNA of lengths <60 bp have limited uptake (Bolognesi et al., 2012). However, as some hpRNA was available, despite being processed by the host's RNAi machinery, uptake was achieved by the target pest and RNAi activity was observed, with the insects demonstrating signs of impaired growth and development. ...
Full-text available
Article
Current crop pest control strategies rely on insecticidal and fungicidal sprays, plant genetic resistance, transgenes and agricultural practices. However, many insects, plant viruses, and fungi have no current means of control or have developed resistance against traditional pesticides. dsRNA is emerging as a novel sustainable method of plant protection as an alternative to traditional chemical pesticides. The successful commercialisation of dsRNA based biocontrols for effective pest management strategies requires the economical production of large quantities of dsRNA combined with suitable delivery methods to ensure RNAi efficacy against the target pest. A number of methods exist for the production and delivery of dsRNA based biocontrols and here we review alternative methods currently employed and emerging new approaches for their production. Additionally, we highlight potential challenges that will need to be addressed prior to widespread adoption of dsRNA biocontrols as novel sustainable alternatives to traditional chemical pesticides.
... The reduction of target gene expression upon the application of the environmental dsRNA is typically used as experimental evidence for the effectiveness of RNAi. In many insects, 70-90% of transcript knockdown of constitutively-expressed genes is common 14,[19][20][21][45][46][47] . However, silencing mite homologs of ubiquitously-expressed Tribolium sensitive RNAi targets led to partial transcript knockdown, ranging from 20 to 50%, when assessed at the whole mite level (Figs. 2 and 4). ...
Full-text available
Article
Environmental RNAi has been developed as a tool for reverse genetics studies and is an emerging pest control strategy. The ability of environmental RNAi to efficiently down-regulate the expression of endogenous gene targets assumes efficient uptake of dsRNA and its processing. In addition, its efficiency can be augmented by the systemic spread of RNAi signals. Environmental RNAi is now a well-established tool for the manipulation of gene expression in the chelicerate acari, including the two-spotted spider mite, Tetranychus urticae. Here, we focused on eight single and ubiquitously-expressed genes encoding proteins with essential cellular functions. Application of dsRNAs that specifically target these genes led to whole mite body phenotypes—dark or spotless. These phenotypes were associated with a significant reduction of target gene expression, ranging from 20 to 50%, when assessed at the whole mite level. Histological analysis of mites treated with orally-delivered dsRNAs was used to investigate the spatial range of the effectiveness of environmental RNAi. Although macroscopic changes led to two groups of body phenotypes, silencing of target genes was associated with the distinct cellular phenotypes. We show that regardless of the target gene tested, cells that displayed histological changes were those that are in direct contact with the dsRNA-containing gut lumen, suggesting that the greatest efficiency of the orally-delivered dsRNAs is localized to gut tissues in T. urticae.
Article
Specific gene silencing by RNA interference (RNAi) involving exogenous double stranded RNA (dsRNA) delivery has potential in Helicoverpa armigera control, a resistant insect pest. Here, ionotropically synthesized cationic chitosan nanoparticles (CNPs, 95 nm size, +36 mV charge) showed efficient dsRNA loading (95%) and effective protection from insect gut nucleases and pH degradation. The CNPs were tagged with fluorescence and found to be stable on leaf surface (24 h) and were internalized by columnar insect gut cells. A single dose of CNPs:dsRNA complex (containing 0.1 μg dsRNA) ingested by H. armigera larvae via artificial/leaf feed effectively silenced lipase and chitinase target genes (2–2.7 fold downregulation) and suppressed their respective enzyme activities (2–5.3 fold). RNAi caused reduced pupation (5-fold) and impaired moth emergence. RNAi effects correlated significantly with 100% insect mortality (PCA 0.97–0.99). Furthermore, specific dsRNA did not affect non-target insects Spodoptera litura and Drosophila melanogaster. Developed CNPs:dsRNA complexes towards RNAi targets can serve as a safe, targeted insecticide for sustainable crop protection.
Article
Bioinsecticides are naturally-occurring substances from different sources that control insect pests. Ideal bioinsecticides should have low toxicity to non-target organisms. They should also be easily degraded in sewage treatment works and natural environments, highly effective in small quantities and affect target pests only. Public concerns about possible side-effects of synthetic pesticides have accelerated bioinsecticide research and development. However, to develop bioinsecticides into mainstream products, their high production costs, short shelf-life and often uncertain modes of action need to be considered. This review summarizes current progress on bioinsecticides which are categorized as biochemical insecticides and their derivatives, plant-incorporated protectants, and microbial bioinsecticides. The current constraints that prevent bioinsecticides from being widely used are discussed and future research directions are proposed.
Full-text available
Chapter
RNA interference (RNAi) refers to double-stranded RNA (dsRNA)-mediated gene silencing. Since its discovery, it has developed as a powerful tool in functional genomics, and to date it is widely used in insect genetic research. It is certain that the discovery of RNAi has augmented our understanding of ~20–30 nucleotide non-coding small RNA as critical regulators of gene expression and genome stability. Besides, gene silencing through RNAi has revolutionized the study of gene function, particularly in non-model and non-genome sequenced insect species, which is the case for most agricultural pest insects. Without doubt, it contains great potential for diverse applications in fundamental and applied research, for instance in gene therapy in medicine and disease control. More recent, a new hot point is to find a feasible way to use RNAi as an alternative method for practical application of crop protection to combat pest insects.
Full-text available
Article
RNA interference (RNAi) describes the ability of double-stranded RNA (dsRNA) to inhibit homologous gene expression at the RNA level. The specificity is sequence-based and depends on the sequence of one strand of the dsRNA corresponding to part or all of a specific gene transcript. In general, RNAi is a post-transcriptional control mechanism involving degradation of a target mRNA by dicers, mediated through the production of small interfering RNAs or short interfering RNAs (siRNAs). No effective Bt toxins are known against sap-sucking homopteran pests such as aphids, leafhoppers etc. With this view in mind, in the current study, RNAi has been applied to block different proteins biosynthesis by sucking insect pests. To achieve the objectives, clones were selected and transcribed to dsRNA. The transcribed dsRNAs were digested with RNase III to prepare siRNAs. Fifty micro liter volumes of test samples containing either control reagent or siRNA in varying quantities were mixed with the insect diet (1ml and 1g for sucking and chewing pests). Five different concentrations, 40, 20, 10, 5, 1 μg/ml of siRNA from a gene were applied to find out the concentration required to kill 50% of insects. The current investigation has explored the utility of RNAi as a tool for specific and strong silencing of various genes in adult sucking pest and larval chewing pest to examine their potential as candidates target genes for pest management. This report says observations of gene knockdown in sucking pests using siRNAs synthesized from different genes through RNAi technology for the first time. The same siRNA treatment resulted in specific gene silencing (not significant) and consequently brought very less mortality percentage. The present results suggest that feeding of siRNAs through an artificial diet can be exploited for the screening of siRNAs for insect pests control and functional genomic studies in both sucking and chewing insect pests.
Full-text available
Article
The adoption of pest-resistant transgenic plants to reduce yield loss and pesticide utilization has been successful in the past three decades. Recently, transgenic plant expressing double-stranded RNA (dsRNA) targeting pest genes emerges as a promising strategy for improving pest resistance in crops. The steroid hormone, 20-hydroxyecdysone (20E), predominately controls insect molting via its nuclear receptor complex, EcR-USP. Here we report that pest resistance is improved in transgenic tobacco plants expressing dsRNA of EcR from the cotton bollworm, Helicoverpa armigera, a serious lepidopteran pest for a variety of crops. When H. armigera larvae were fed with the whole transgenic tobacco plants expressing EcR dsRNA, resistance to H. armigera was significantly improved in transgenic plants. Meanwhile, when H. armigera larvae were fed with leaves of transgenic tobacco plants expressing EcR dsRNA, its EcR mRNA level was dramatically decreased causing molting defects and larval lethality. In addition, the transgenic tobacco plants expressing H. armigera EcR dsRNA were also resistant to another lepidopteran pest, the beet armyworm, Spodoptera exigua, due to the high similarity in the nucleotide sequences of their EcR genes. This study provides additional evidence that transgenic plant expressing dsRNA targeting insect-associated genes is able to improve pest resistance.
Full-text available
Article
Background: RNAi can be achieved in insect herbivores by feeding them host plants stably transformed to express double stranded RNA (dsRNA) of selected midgut-expressed genes. However, the development of stably transformed plants is a slow and laborious process and here we developed a rapid, reliable and transient method. We used viral vectors to produce dsRNA in the host plant Nicotiana attenuata to transiently silence midgut genes of the plant's lepidopteran specialist herbivore, Manduca sexta. To compare the efficacy of longer, undiced dsRNA for insect gene silencing, we silenced N. attenuata's dicer genes (NaDCL1- 4) in all combinations in a plant stably transformed to express dsRNA targeting an insect gene. Methodology/principal findings: Stable transgenic N. attenuata plants harboring a 312 bp fragment of MsCYP6B46 in an inverted repeat orientation (ir-CYP6B46) were generated to produce CYP6B46 dsRNA. After consuming these plants, transcripts of CYP6B46 were significantly reduced in M. sexta larval midguts. The same 312 bp cDNA was cloned in an antisense orientation into a TRV vector and Agro-infiltrated into N. attenuata plants. When larvae ingested these plants, similar reductions in CYP6B46 transcripts were observed without reducing transcripts of the most closely related MsCYP6B45. We used this transient method to rapidly silence the expression of two additional midgut-expressed MsCYPs. CYP6B46 transcripts were further reduced in midguts, when the larvae fed on ir-CYP6B46 plants transiently silenced for two combinations of NaDCLs (DCL1/3/4 and DCL2/3/4) and contained higher concentrations of longer, undiced CYP6B46 dsRNA. Conclusions: Both stable and transient expression of CYP6B46 dsRNA in host plants provides a specific and robust means of silencing this gene in M. sexta larvae, but the transient system is better suited for high throughput analyses. Transiently silencing NaDCLs in ir-CYP6B46 plants increased the silencing of MsCYP6B46, suggested that insect's RNAi machinery is more efficient with longer lengths of ingested dsRNA.
Full-text available
Article
Short interference RNA (siRNA) is widely used in mammalian cells. In insects, however, reports concerning the suitablility of siRNA in vivo is very limited compared with that of long dsRNA, which is thought to be more effective. There is insufficient information on the essential rules of siRNA design in insects, as very few siRNAs have been tested in this context. To establish an effective method of gene silencing using siRNA in vivo in insects, we determined the effects of siRNA on seven target genes. We designed siRNAs according to a new guideline and injected them into eggs of Bombyx mori. At the mRNA level, the expression of most of these genes was successfully silenced, down to less than half the constitutive level, which in some cases led to the development of distinctive phenotypes. In addition, we observed stronger effect of siRNA both on the mRNA level and the phenotype than that of long dsRNA under comparable conditions. These results indicate that direct injection of siRNA is an effective reverse-genetics tool for the analysis of embryogenesis in vivo in insects.
Full-text available
Article
Endosomal sorting complex required for transport (ESCRT) complexes are involved in endosomal trafficking to the lysosome, cytokinesis, and viral budding. Extensive genetic, biochemical, and structural studies on the ESCRT system have been carried out in yeast and mammalian systems. However, the question of how the ESCRT system functions at the whole organism level has not been fully explored. In C. elegans, we performed RNAi experiments to knock-down gene expression of components of the ESCRT system and profiled their effects on protein degradation and endocytosis of YP170, a yolk protein. Targeted RNAi knock-down of ESCRT-I (tsg-101 and vps-28) and ESCRT-III (vps-24, and vps-32.2) components interfered with protein degradation while knock-down of ESCRT-II (vps-25 and vps-36) and ESCRT-III (vps-20 and vps-24) components hampered endocytosis. In contrast, the knockdown of vps-37, another ESCRT-I component, showed no defect in either YP170 uptake or degradation. Depletion of at least one component from each complex - ESCRT-0 (hgrs-1), ESCRT-I (tsg-101, vps-28, and vps-37), ESCRT-II (vps-36), ESCRT-III (vps-24), and Vps4 (vps-4) - resulted in abnormal distribution of embryos in the uterus of worms, possibly due to abnormal ovulation, fertilization, and egglaying. These results suggest differential physiological roles of ESCRT-0, -I, -II, and -III complexes in the context of the whole organism, C. elegans.
Article
The induction of the naturally occurring phenomenon of RNA interference (RNAi) to study gene function in insects is now common practice. With appropriately chosen targets, the RNAi pathway has also been exploited for insect control, typically through oral delivery of dsRNA. Adapting current methods to deliver foreign compounds, such as amino acids and pesticides, to mosquitoes through sucrose solutions, we tested whether such an approach could be used in the yellow fever mosquito, Aedes aegypti. Using a non‐specific dsRNA construct, we found that adult Ae. aegypti ingested dsRNA through this method and that the ingested dsRNA can be recovered from the mosquitoes post‐feeding. Through the feeding of a species‐specific dsRNA construct against vacuolar ATPase, subunit A, we found that significant gene knockdown could be achieved at 12, 24 and 48 h post‐feeding.
Article
RNA interference (RNAi) is commonly used in insect functional genomics studies and usually involves direct injection of double-stranded RNA (dsRNA). Only a few studies have involved exposure to dsRNAs through feeding. For western corn rootworm (Diabrotica virgifera virgifera) larvae, ingestion of dsRNA designed from the housekeeping gene, vacuolar ATPase (vATPase) triggers RNAi causing growth inhibition and mortality; however, the effect of dsRNA feeding on adults has not been examined. In this research, WCR adults were fed with vATPase-dsRNA-treated artificial diet containing a cucurbitacin bait, which is a proven feeding stimulant for chrysomelid beetles of the subtribe Diabroticina to which rootworms belong. Real-time PCR confirmed suppression of vATPase expression and western blot analysis indicated reduced signal of a protein that cross-reacted with a vATPase polyclonal antiserum in WCR adults exposed to artificial diet treated with dsRNA and cucurbitacin bait. Continuous feeding on cucurbitacin and dsRNA-treated artificial diet resulted in more than 95% adult mortality within 2 weeks while mortality in control treatments never exceeded 20%. This research clearly demonstrates the effect of RNAi on WCR adults that have been exposed to dsRNA by feeding and establishes a tool to screen dsRNAs of potential target genes in adults. This technique may serve as an alternative to target screening of larvae which are difficult to maintain on artificial diets.