Comparing Nose-Throat Swabs and Nasopharyngeal Aspirates Collected From Children With Symptoms for Respiratory Virus Identification Using Real-Time Polymerase Chain Reaction

Article (PDF Available)inPEDIATRICS 122(3):e615-20 · October 2008with203 Reads
DOI: 10.1542/peds.2008-0691 · Source: PubMed
Abstract
The objective of this study was to calculate sensitivity values for the detection of major respiratory viruses of childhood by using combined nose-throat swabs and nasopharyngeal aspirates. Children who had symptoms and presented to a pediatric teaching hospital and had a diagnostic respiratory specimen collected were enrolled, and paired nose-throat swab and nasopharyngeal aspirate specimens were collected. Parents were asked to collect the nose-throat swab specimen in the first instance but could defer to a health care worker if unwilling. Nose-throat swab collectors were asked to rate perceived quality of collection. All nasopharyngeal aspirates were collected by a health care worker by using a standard protocol. Real-time polymerase chain reaction for 8 respiratory viruses was performed in our hospital's diagnostic laboratory. Paired nose-throat swab/nasopharyngeal aspirate specimens were collected during 303 illnesses, with at least 1 respiratory virus identified in 186 (61%). For the major pathogens of childhood, influenza A virus and respiratory syncytial virus, collection by using the nose-throat swab had a sensitivity of 91.9% and 93.1%, respectively. A health care worker collected 219 (72%) of the nose-throat swab specimens; concordance with the nasopharyngeal aspirate was not related to health care worker collection or perceived quality of collection. Nose-throat swab specimens, in combination with sensitive molecular testing, are a less invasive diagnostic respiratory specimen with adequate sensitivity for use in the clinic and hospital outpatient settings and large-scale community studies through parent collection. For children who present to a hospital in which an avian or pandemic strain of influenza virus is reasonably part of the differential diagnosis, nasopharyngeal aspirates or a similar collection technique (eg, nasal washes) should continue to be used.

Full-text (PDF)

Available from: Theodorus P. Sloots, Aug 14, 2014
DOI: 10.1542/peds.2008-0691
; originally published online August 25, 2008;Pediatrics
M. Canavan, Cheryl Bletchly, David J. Siebert, Theo P. Sloots and Michael D. Nissen
Stephen B. Lambert, David M. Whiley, Nicholas T. O'Neill, Emily C. Andrews, Fiona
Polymerase Chain Reaction
Children With Symptoms for Respiratory Virus Identification Using Real-Time
Comparing Nose-Throat Swabs and Nasopharyngeal Aspirates Collected From
http://pediatrics.aappublications.org/content/early/2008/08/25/peds.2008-0691.citation
located on the World Wide Web at:
The online version of this article, along with updated information and services, is
of Pediatrics. All rights reserved. Print ISSN: 0031-4005. Online ISSN: 1098-4275.
Boulevard, Elk Grove Village, Illinois, 60007. Copyright © 2008 by the American Academy
published, and trademarked by the American Academy of Pediatrics, 141 Northwest Point
publication, it has been published continuously since 1948. PEDIATRICS is owned,
PEDIATRICS is the official journal of the American Academy of Pediatrics. A monthly
by guest on June 6, 2013pediatrics.aappublications.orgDownloaded from
ARTICLE
Comparing Nose-Throat Swabs and Nasopharyngeal
Aspirates Collected From Children With Symptoms
for Respiratory Virus Identification Using Real-Time
Polymerase Chain Reaction
Stephen B. Lambert, MBBS
a,b
, David M. Whiley, PhD
a,b
, Nicholas T. O’Neill, BNurs
a
, Emily C. Andrews, BNurs
a
, Fiona M. Canavan, BNurs
a
,
Cheryl Bletchly, PhD
c
, David J. Siebert, MBBS
c
, Theo P. Sloots, PhD
a,b,c,d
, Michael D. Nissen, MBBS
a,b,c,d
a
Queensland Paediatric Infectious Diseases Laboratory, Sir Albert Sakzewski Virus Research Centre, Royal Children’s Hospital and Health Service District, Herston,
Queensland, Australia;
b
Clinical Medical Virology Centre and
d
Department of Paediatrics and Child Health, University of Queensland, Brisbane, Queensland, Australia;
c
Microbiology Division, Clinical and Statewide Services Division, Pathology Queensland, Royal Brisbane Hospital Campus, Herston, Queensland, Australia
The authors have indicated they have no financial relationships relevant to this article to disclose.
What’s Known on This Subject
There is little published information about the use of less-invasive respiratory specimens
for clinical diagnosis of viruses by using sensitive molecular methods. These methods
are also being used in clinical and community-based research without comparative
sensitivity data.
What This Study Adds
This study provides the first sensitivity values for this less-invasive specimen type in
comparison with nasopharyngeal aspirates. These data have direct clinical application
and will be useful for influenza pandemic planning and in planning community-based
research by using parentally collected specimens.
ABSTRACT
OBJECTIVES. The objective of this study was to calculate sensitivity values for the
detection of major respiratory viruses of childhood by using combined nose-throat
swabs and nasopharyngeal aspirates.
METHODS. Children who had symptoms and presented to a pediatric teaching hos-
pital and had a diagnostic respiratory specimen collected were enrolled, and
paired nose-throat swab and nasopharyngeal aspirate specimens were collected.
Parents were asked to collect the nose-throat swab specimen in the first instance
but could defer to a health care worker if unwilling. Nose-throat swab collectors
were asked to rate perceived quality of collection. All nasopharyngeal aspirates
were collected by a health care worker by using a standard protocol. Real-time
polymerase chain reaction for 8 respiratory viruses was performed in our hospi-
tal’s diagnostic laboratory.
RESULTS. Paired nose-throat swab/nasopharyngeal aspirate specimens were collected
during 303 illnesses, with at least 1 respiratory virus identified in 186 (61%). For the
major pathogens of childhood, influenza A virus and respiratory syncytial virus,
collection by using the nose-throat swab had a sensitivity of 91.9% and 93.1%,
respectively. A health care worker collected 219 (72%) of the nose-throat swab
specimens; concordance with the nasopharyngeal aspirate was not related to health
care worker collection or perceived quality of collection.
CONCLUSIONS. Nose-throat swab specimens, in combination with sensitive molecular
testing, are a less invasive diagnostic respiratory specimen with adequate sensitivity
for use in the clinic and hospital outpatient settings and large-scale community
studies through parent collection. For children who present to a hospital in which an avian or pandemic strain of
influenza virus is reasonably part of the differential diagnosis, nasopharyngeal aspirates or a similar collection
technique (eg, nasal washes) should continue to be used. Pediatrics 2008;122:e615–e620
IN A NUMBER of areas, the use of more sensitive molecular diagnostics allows for the collection of a less invasive
clinical specimen while increasing sensitivity of diagnosis for viruses and other fastidious organisms. Fur-
thermore, there remains a relative absence of recent community epidemiology and transmission data by using
molecular methods for the identification of respiratory viruses in the literature. This lack is highlighted by the
need to use historical data about influenza transmission, collected without the benefit of sensitive molecular
methods, to populate a mathematical model for containment interventions in the event of an influenza
pandemic.1
www.pediatrics.org/cgi/doi/10.1542/
peds.2008-0691
doi:10.1542/peds.2008-0691
Key Words
respiratory viruses, real-time PCR,
diagnostic methods, children
Abbreviations
NTS—nose-throat swab
NPA—nasopharyngeal aspirate
ARI—acute respiratory infection
PCR—polymerase chain reaction
RSV—respiratory syncytial virus
PIV—parainfluenza virus
CI— confidence interval
NAAT—nucleic acid–amplification test
Accepted for publication Apr 30, 2008
Address correspondence to Stephen Lambert,
MBBS, Queensland Paediatric Infectious
Diseases Laboratory, Royal Children’s Hospital,
Herston Queensland 4029, Australia. E-mail:
sblambert@uq.edu.au
PEDIATRICS (ISSN Numbers: Print, 0031-4005;
Online, 1098-4275). Copyright © 2008 by the
American Academy of Pediatrics
PEDIATRICS Volume 122, Number 3, September 2008 e615
by guest on June 6, 2013pediatrics.aappublications.orgDownloaded from
We previously conducted a community-based cohort
study to examine the epidemiology and costs of common
respiratory viruses in preschool-aged children.2–4 The
specimen type used in that study was a parent-collected
combined nose-throat swab (NTS). It was beyond the
scope of that study to include a head-to-head compari-
son of the NTS with nasopharyngeal aspirates (NPAs) for
virus detection. With this study, we sought to fill that
gap and determine the clinical utility of a less invasive
specimen by comparing sensitivity values for common
viruses by using NTS specimens and NPAs collected from
children who had acute respiratory illnesses (ARIs) and
presented to a pediatric teaching hospital.
METHODS
We sought to enroll any child who presented to our
hospital who had an ARI and for whom an NPA was
judged to be clinically indicated and collect a combined
NTS at the same time. NTS specimens were collected
before NPAs, with the throat swab collected first fol-
lowed by an anterior nares swab from a single nostril. No
instruction was provided regarding the use of different
nares for the NPA and NTS collection. Both the nose and
throat swabs (Dryswab woodstick shaft in labeled tube
[Medical Wire & Equipment, Corsham, Wiltshire, En-
gland]) were pooled in a single tube of 1.8 mL of viral
transport medium (bioMe´rieux, Baulkham Hills, New
South Wales, Australia). We asked parents to collect the
NTS in the first instance, but when they were unwilling
or unable to do so but were happy for the extra specimen
to be collected, a clinical staff member did this. NTS
collectors reported the perceived quality of their collec-
tion technique as very good, good, or poor. These cate-
gories were assessed entirely subjectively by collectors
without additional instruction. We collected basic demo-
graphic and illness information at the time of collection.
All NPAs were collected by clinical staff in accordance
with a standard protocol. All specimens were trans-
ported and processed along with other routine diagnos-
tic material.
Since 2004, the onsite pathology service for our hos-
pital (Molecular Diagnostic Unit, Clinical and Statewide
Services Division, Pathology Queensland, Herston,
Queensland, Australia) has routinely conducted real-
time polymerase chain reaction (PCR) testing on naso-
pharyngeal aspirates and other respiratory specimens for
8 respiratory viruses: influenza A, influenza B, respira-
tory syncytial virus (RSV), parainfluenza virus I (PIV I),
PIV II, PIV III, adenovirus, and human metapneumovi-
rus. The assays for influenza B, PIV I, and PIV II were
developed in our laboratory and have been validated for
use in a routine diagnostic setting (unpublished data).
Testing was performed using the Qiagen One-Step RT-
PCR Kit (Qiagen, Doncaster, Victoria, Australia) in 4
PCRs that comprised 3 multiplex reactions and 1 mono-
plex reaction (Table 1). Amplification and detection
were performed on an ABI7500 instrument (Applied
Biosystems, Scoresby, Victoria, Australia). As well as a
positive control for each of the targeted viruses, each test
run included 3 no-target controls that consisted of reac-
tion mixture and 5
L of PCR-grade water. Test runs
were assumed to be contaminated and deemed invalid
when any of the 3 no-target controls produced positive
amplification curves. Our laboratory does not routinely
TABLE 1 Details of PCR assays used to identify respiratory viruses
Reaction
Mix
Virus Target Primer, Probe Sequences (5–3), and Fluorophores Source
1 Influenza A Matrix protein CTTCTAACCGAGGTCGAAACGTA
GGTGACAGGATTGGTCTTGTCTTTA
fam-TCAGGCCCCCTCAAAGCCGAG-bhq1
Whiley and Sloots20
Influenza B Matrix protein GCATCTTTTGTTTTTTATCCATTCC
CACAATTGCCTACCTGCTTTCA
joe-GCTAGTTCTGCTTTGCCTTCTCCATCTTCT-bhq1
This study
2 Parainfluenza I Hemagglutinin-neuraminidase TTTAAACCCGGTAATTTCTCATACCT
CCCCTTGTTCCTGCAGCTATT
fam-TGACATCAACGACAACAGGAAATCATGTTCTG-bhq1
This study
Parainfluenza II Nucleocapsid AGAGTTCCAACATTCAATGAATCAGT
CTCAAGAGAAATGTCATTCCCATCT
joe-CCTCTGTATTGCTCATGCATAGCACGGA-bhq1
This study
Parainfluenza III Nucleocapsid CGGTGACACAGTGGATCAGATT
AGGTCATTTCTGCTAGTATTCATTGTTATT
Cy5-TCAATCATGCGGTCTCAACAGAGCTTG-bhq2
Whiley and Sloots21
3 RSV Polymerase (L) AGTAGACCATGTGAATTCCCTGC
GTCGATATCTTCATCACCATACTTTTCTGTTA
fam-TCAATACCAGCTTATAGAAC-mgb-bhq1
Whiley and Sloots22
Adenovirus Hexon protein GCCACGGTGGGGTTTCTAAACTT
GCCCCAGTGGTCTTACATGCACAT
joe-TGCACCAGACCCGGGCTCAGGTACTCCGA-bhq1
Heim et al23
4 hMPV Nucleocapsid CATATAAGCATGCTATATTAAAAGAGTCTC
CCTATTTCTGCAGCATATTTGTAATCAG
fam-TGYAATGATGAGGGTGTCACTGCGGTTG-bhq1
Maertzdorf et al24
bhq indicates black hole quencher; mgb, minor groove binder.
e616 LAMBERT et al by guest on June 6, 2013pediatrics.aappublications.orgDownloaded from
perform viral culture or antigen detection for respiratory
viruses, and these tests were not done in parallel with
molecular testing for this study.
The specificity of real-time PCR for any virus by using
either an NPA or an NTS specimen is likely to be 100%
or very close to this value.5Given this, similar to previ-
ous studies,6we used a consensus standard to assess
sensitivity of each testing method: we considered a spec-
imen positive by either method for any virus to repre-
sent a true-positive. This approach means that the spec-
ificity of either specimen type for any virus will be, by
definition, 100%. Using this standard, we calculated
sensitivity with 95% confidence intervals (CIs) using
Stata 9.2 for Windows (Stata Corp, College Station, TX).
Ethics committee approval for the study was granted by
the Royal Children’s Hospital and Health Services Dis-
trict Ethics Committee, and informed consent was
obtained from a parent or guardian before study par-
ticipation.
RESULTS
Between July 2006 and August 2007, we collected 303
sets of paired NPA/NTS specimens, with most collected
during our winter/spring seasons. These specimens were
collected from 295 children: 6 children provided 2 paired
specimens, and 1 child provided 3 paired specimens.
Study participants were more likely to be male (189;
62%), and most were from younger age groups: 136
(45%) 12 months; 130 (43%) 12 months to 5 years;
27 (9%) 5 years to 10 years; and 7 (2%) 10 years.
The median age of study children was 1.1 years (range:
5 days to 17.5 years). Out-of-home child care or school
was reported for 141 (37%) children. The emergency
department was the site of collection for 284 (94%) of
the paired specimens. Hospital admission occurred for
124 (41%) presentations, with a mean length of stay of
3.9 days (median: 3 days; range: 1–19 days).
The median delay between paired specimen collec-
tion and testing was 16 hours. PCR results for 270 (89%)
paired specimens were concordant, with the same result
in the NPA and NTS specimens (Table 2). By either
collection method, there was at least 1 virus detected in
186 ARIs (61%): 163 with 1 virus and 23 with 2 viruses.
This left 117 (39%) ARIs with no virus identified in
either specimen.
For most viruses, the sensitivity of NPAs was equal to
or higher than that for the NTS specimens (Table 3). The
only virus for which this was not the case was influenza
B: for 1 ARI of 10 for which influenza B was identified,
the NPA was negative and the NTS positive. For the
major respiratory viruses of childhood, influenza A and
RSV, the sensitivity of NTS specimens was 91.9% and
93.1%, respectively. For adenoviruses, NTS specimens
had a markedly lower sensitivity than NPAs: 65.9%
compared with 93.2%.
A health care worker collected the NTS specimen in
219 (72%) instances. The remaining 84 NTS specimens
were collected by a parent (mother: 66; father: 16),
grandmother (1), and interestingly, self by one 10-year-
old. The concordance between NPA and NTS specimens
TABLE 2 NPA and NTS Concordance
Parameter n%
Concordant NPA/NTS paired specimens 270 89.1
No virus identified 117 38.6
Single virus identified 142 46.9
Influenza A 30 9.9
Influenza B 7 2.3
RSV 55 18.2
PIV I 1 0.3
PIV II 3 1.0
PIV III 14 4.6
Adenovirus 20 6.6
hMPV 12 4.0
Two viruses identified 11 3.6
Discordant NPA/NTS paired specimens 33 10.9
Discordance as a result of adenovirus-positive NPA,
negative NTS (single virus identified: 10; 2
viruses identified: 5)
15 5.0
Discordance as a result of adenovirus-negative NPA,
positive NTS (single virus identified: 2; 2 viruses
identified: 1)
3 1.0
Other virus/viruses positive NPA, negative NTS (single
virus identified: 6; 2 viruses identified: 4)
10 3.3
Other virus/viruses negative NPA, positive NTS (single
virus identified: 3; 2 viruses identified: 1)
4 1.3
Different single virus in NPA (hMPV) and NTS
(Influenza B) (2 viruses identified: 1)
1 0.3
hMPV indicates human metapneumovirus.
TABLE 3 Sensitivity for the Detection of Different Viruses According to Specimen Type
Virus ARIs With Virus
Identified
a
NPA NTS
Sensitivity 95% CI
b
Sensitivity 95% CI
b
Influenza A 37 100.0 90.5–100.0 91.9 78.1–98.3
Influenza B 10 90.0 55.5–99.7 100.0 69.2–100.0
RSV 72 97.2 90.3–99.7 93.1 84.5–97.7
PIV I 3 100.0 29.2–100.0 100.0 29.2–100.0
PIV II 3 100.0 29.2–100.0 100.0 29.2–100.0
PIV III 20 95.0 75.1–99.9 85.0 62.1–96.8
Adenovirus 44 93.2 81.3–98.6 65.9 50.1–79.5
hMPV 20 95.0 75.1–99.9 90.0 68.3–98.8
hMPV indicates human metapneumovirus.
a
Column total (209) adds to more than the number of ARIs with any virus present (186), because illnesses with 2 viruses identified are recorded
in 2 cells (23).
b
Where sensitivity is 100%, a 1-sided, 97.5% lower CI is provided.
PEDIATRICS Volume 122, Number 3, September 2008 e617
by guest on June 6, 2013pediatrics.aappublications.orgDownloaded from
for health care workers was 89% and for non– health
care workers was 88% (P.73). We asked the NTS
collectors to report their perceived quality of specimen
collection. Concordance for NPA and NTS specimens by
reported quality of NTS collection was 84% for very
good (109 of 129), 92% for good (154 of 167), and
100% (7 of 7) for poor.
DISCUSSION
This study provides sensitivity values for NPA and NTS
specimens for the identification of respiratory viruses by
using a real-time PCR method. The findings demonstrate
that for the major viruses of childhood, influenza A and
RSV, sensitivity using an NTS specimen was 90%. It
confirms previous data that showed that non– health
care workers with simple training can collect the mini-
mally invasive NTS specimen2and that concordance
with the more sensitive NPA specimen did not seem to
be related to collector perception of quality.4
There are a number of clinical implications of this
work. Depending on the setting, the NTS specimen
could reasonably replace the NPA as an outpatient
procedure for children who are not being admitted to
hospital (59% of our study sample). For children who
are being admitted to hospital, who may occasionally
end up in intensive care, may receive unnecessary
antibiotic therapy, or be subject to additional diagnos-
tic, interventions after an initially negative PCR result,
we believe an NPA, because of its improved sensitiv-
ity, is still the collection method of choice. The data
from this study informed pandemic influenza plan-
ning at our hospital: with an 8% likelihood of a
false-negative result for children who presented to the
hospital and had an influenza A infection, the NTS
was not considered a suitable test where an avian (or
pandemic) strain virus was reasonably part of the
differential diagnosis; however, during a pandemic,
home-based self- or parent-collected respiratory spec-
imens that are transported to a central laboratory
could provide adequate diagnostic sensitivity and al-
low for improved infection control and a reduction in
community-based transmission by decreasing expo-
sure of infected individuals to others in health care
facilities.
Home-collected respiratory specimens, either par-
ents’ collecting from children or adults’ collecting
from themselves or each other, combined with sensi-
tive molecular methods provide the means to collate
previously unavailable data about viral infections and
their household transmission. Reports from the Seat-
tle Virus Watch project conducted in the second half
of last century described home collection of respira-
tory specimens by a trained parent or other household
member, when a study nurse could not arrange a
home visit.7In the articles from this project, there is
no additional analysis or discussion about the quality
of home specimen collection or success in terms of
virus detection. A recent study8reported in an article
from Finland demonstrated the utility of parent-col-
lected and self-collected nose swabs for the identifica-
tion of rhinoviruses in children who were hospitalized
with a positive rhinovirus PCR result and their house-
hold contacts. In that study, parent-collected nasal
specimens were used to demonstrate the simultaneous
presence in households of different rhinovirus strains
in individuals with and without symptoms. There is
also some evidence to suggest that using parent col-
lection at home is more likely to result in a specimen’s
being collected, compared with requiring parents to be
available for a home visit or to present for a clinic visit
with a child with symptoms.9This study showed that
although parent collection and home-visited house-
holds identified a similar number of symptomatic pe-
riods during the study (47 and 49, respectively), these
illness periods in parent collection households were
approximately twice as likely to result in specimen
collection, although this finding did not reach statis-
tical significance (43% and 24%, respectively; P
.07). Parent-collected specimens may also be more
likely to be positive for a virus by virtue of being
collected at an earlier point in illness.10 Home-col-
lected specimens were positive for any virus 80% of
the time, compared with 67% of clinic-collected spec-
imens (P.44).9In our previous community-based
study of preschool-aged children, we received a spec-
imen from a previously trained parent in 74% of ARIs
identified2but were able to convince only 28% of
parents in this study to collected an NTS specimen.
The proximity of a health care worker may have re-
duced the likelihood of parent collection. It may also
be the case that our parent collection results are biased
as a result of self-selection, with only confident parent
collectors volunteering; however, in this and the pre-
vious study,2we found that self-report of collection
quality did not seem to be associated with the likeli-
hood of virus detection. Use of parent collection tech-
niques could fill gaps in knowledge about virus epide-
miology and provide more robust and timely
parameter estimates for use in event models, such as
for an influenza pandemic.
Nucleic acid–amplification tests (NAATs) may over-
come previously documented issues of specimen type
and RSV identification.6,11 Both of these studies showed
an approximately one-third reduction in sensitivity for
RSV detection comparing a less invasive collection
method (nasal swabs) with NPAs when an antigen de-
tection technique was used. Despite this, the authors of
the Guinea-Bissau article considered that for larger epi-
demiologic studies, the benefits of reduced costs and the
ability to collect from a population-based sample might
outweigh this lower sensitivity.6Improved sensitivity
has been seen using less invasive and self-collected spec-
imens in combination with NAATs for sexually transmit-
ted infections.12–14 Our data show that the wide differen-
tial in sensitivity for RSV as a result of specimen type
seems to be largely overcome by the use of molecular
methods.
Adenoviruses were the single virus group responsible
for the highest proportion of discordant findings as a
result of the decreased sensitivity of virus detection seen
using the NTS specimen. Our results do not provide any
clarification as to why this discordance is seen. These
e618 LAMBERT et al by guest on June 6, 2013pediatrics.aappublications.orgDownloaded from
findings may be attributable to the different nature of
adenoviruses (nonenveloped, DNA viruses) compared
with the other respiratory viruses that we tested for, all
of which are RNA viruses. They may also fit with the
concept that the more invasive the respiratory specimen,
the more likely a positive PCR result represents adeno-
viral persistence,15 rather than an acute infection.4More
work is needed to assess properly the predictive value of
a positive adenovirus PCR result from a variety of respi-
ratory specimens for detecting acute adenoviral infec-
tions, particularly in children.16
Picornaviruses are not part of the routine panel that
our hospital’s diagnostic laboratory uses for respira-
tory specimens. There remains some uncertainty
about the meaning of a positive rhinovirus PCR result
in children with respiratory symptoms.17–19 It is possi-
ble that if PCR testing for picornaviruses or rhinovi-
ruses were used, approximately half of the virus-neg-
ative ARIs in our study would have been positive.2
Our previous work showed that picornaviruses were
identified with a similar frequency in nose-only swabs
and combined NTS specimens collected from the same
population.4
CONCLUSIONS
This study provides comparative sensitivity values of
NTS specimens and NPAs for common respiratory vi-
ruses. These values confirm that NTS specimens com-
bined with PCR are suitable for diagnostic purposes in
clinic and outpatient settings, as well as in community-
based studies that are designed to provide current data
about the epidemiology and burden of respiratory vi-
ruses; however, when a child is unwell enough to re-
quire hospital admission or where avian or a pandemic
strain of influenza is reasonably suspected on the basis of
history, we believe that an NPA is still the test of choice.
Just as with sexually transmitted infections, using
NAATs for respiratory virus detection seems to over-
come the previously observed sensitivity reduction seen
when less invasive specimens were combined with con-
ventional, non–amplification-based laboratory tests.
ACKNOWLEDGMENTS
Dr Lambert received a clinical fellowship funded by the
Royal Children’s Hospital Foundation to conduct this
research.
We thank the parents and children who volun-
teered to participate in this study. The study would
not have been possible without the excellent support
from clinical staff from the emergency department and
Paterson and Robertson wards at the Royal Children’s
Hospital, Brisbane, and the laboratory staff from the
Molecular Diagnostic Unit, Clinical and Statewide Ser-
vices Division, Pathology, Queensland. Aaron Buck-
ner, Ria Halstead, Lisa Mulhearn, and Jane Yunus
from the Queensland Pediatric Infectious Diseases
Laboratory provided clinical and administrative sup-
port for this study.
REFERENCES
1. Ferguson NM, Cummings DA, Fraser C, Cajka JC, Cooley PC,
Burke DS. Strategies for mitigating an influenza pandemic.
Nature. 2006;442(7101):448 – 452
2. Lambert SB, Allen KM, Druce JD, et al. Community epide-
miology of human metapneumovirus, human coronavirus
NL63, and other respiratory viruses in healthy preschool-
aged children using parent-collected specimens. Pediatrics.
2007;120(4). Available at: www.pediatrics.org/cgi/content/
full/120/4/e929
3. Lambert SB, Allen KM, Carter RC, Nolan TM. The cost of
community-managed viral respiratory illnesses in a cohort of
healthy preschool-aged children. Respir Res. 2008;9:11
4. Lambert SB, Allen KM, Nolan TM. Parent-collected respiratory
specimens: a novel method for respiratory virus and vaccine
efficacy research. Vaccine. 2008;26(15):1826 –1831
5. Ratcliff RM, Chang G, Kok T, Sloots TP. Molecular diagnosis of
medical viruses. Curr Issues Mol Biol. 2007;9(2):87–102
6. Stensballe LG, Trautner S, Kofoed PE, et al. Comparison of
nasopharyngeal aspirate and nasal swab specimens for de-
tection of respiratory syncytial virus in different settings in a
developing country. Trop Med Int Health. 2002;7(4):317–321
7. Fox JP, Cooney MK, Hall CE, Foy HM. Rhinoviruses in Seattle
families, 1975–1979. Am J Epidemiol. 1985;122(5):830 – 846
8. Peltola V, Waris M, Osterback R, Susi P, Ruuskanen O, Hyypia
T. Rhinovirus transmission within families with children: inci-
dence of symptomatic and asymptomatic infections. J Infect Dis.
2008;197(3):382–389
9. van der Zalm MM, Uiterwaal CS, de Jong BM, Wilbrink B, van
der Ent CK. Viral specimen collection by parents increases
response rate in population-based virus studies. J Allergy Clin
Immunol. 2006;117:955–956, author reply 956 –957
10. Poland GA. Patterns of respiratory illness among elderly
persons: the value of communitywide surveillance studies for
influenza. Arch Fam Med. 1997;6(5):466 – 467
11. Macfarlane P, Denham J, Assous J, Hughes C. RSV testing in
bronchiolitis: which nasal sampling method is best? Arch Dis
Child. 2005;90(6):634 – 635
12. Mahony JB, Jang D, Chong S, et al. Detection of Chlamydia
trachomatis,Neisseria gonorrhoeae,Ureaplasma urealyticum, and
Mycoplasma genitalium in first-void urine specimens by mul-
tiplex polymerase chain reaction. Mol Diagn. 1997;2(3):
161–168
13. Morre´ SA, van Valkengoed IG, de Jong A, et al. Mailed, home-
obtained urine specimens: a reliable screening approach for
detecting asymptomatic Chlamydia trachomatis infections. J Clin
Microbiol. 1999;37(4):976 –980
14. Knox J, Tabrizi SN, Miller P, et al. Evaluation of self-collected
samples in contrast to practitioner-collected samples for detec-
tion of Chlamydia trachomatis,Neisseria gonorrhoeae, and
Trichomonas vaginalis by polymerase chain reaction among
women living in remote areas. Sex Transm Dis. 2002;29(11):
647– 654
15. Echavarria M, Maldonado D, Elbert G, Videla C, Rappaport R,
Carballal G. Use of PCR to demonstrate presence of adenovirus
species B, C, or F as well as coinfection with two adenovirus
species in children with flu-like symptoms. J Clin Microbiol.
2006;44(2):625– 627
16. Ota WK, Bang FB. A continuous study of viruses in the respi-
ratory tract in families of a Calcutta bustee: II—family patterns
of infection and illness in a crowded environment. Am J Epi-
demiol. 1972;95(4):384 –391
17. Nokso-Koivisto J, Kinnari TJ, Lindahl P, Hovi T, Pitkaranta A.
Human picornavirus and coronavirus RNA in nasopharynx of
children without concurrent respiratory symptoms. J Med Virol.
2002;66(3):417– 420
18. van Benten I, Koopman L, Niesters B, et al. Predominance of
PEDIATRICS Volume 122, Number 3, September 2008 e619
by guest on June 6, 2013pediatrics.aappublications.orgDownloaded from
rhinovirus in the nose of symptomatic and asymptomatic in-
fants. Pediatr Allergy Immunol. 2003;14(5):363–370
19. Wright PF, Deatly AM, Karron RA, et al. Comparison of results
of detection of rhinovirus PCR and viral culture in human
nasal wash specimens from subjects with and without clinical
symptoms of respiratory illness. J Clin Microbiol. 2007;45(7):
2126 –2129
20. Whiley DM, Sloots TP. A 5-nuclease real-time reverse tran-
scriptase-polymerase chain reaction assay for the detection of a
broad range of influenza A subtypes, including H5N1. Diagn
Microbiol Infect Dis. 2005;53(4):335–337
21. Whiley DM, Sloots TP. Clinic