Content uploaded by Lutfi Jaber
Author content
All content in this area was uploaded by Lutfi Jaber on May 25, 2015
Content may be subject to copyright.
Mitochondrial DNA Injury and Mortality in
Hemodialysis Patients
Madhumathi Rao, Lijun Li, Caren Demello, Daqing Guo, Bertrand L. Jaber,
Brian J.G. Pereira, Vaidyanathapuram S. Balakrishnan, and the HEMO Study Group
Division of Nephrology, Department of Medicine, Tufts-New England Medical Center Hospitals, Boston,
Massachusetts
ABSTRACT
The role of mitochondrial injury in the pathogenesis of complications of uremia is incompletely defined,
although diminished bioenergetic capacity and the accumulation of mitochondrial DNA (mtDNA) muta-
tions have been reported. This study was undertaken to evaluate the prevalence of mtDNA injury in 180
patients who had ESRD and were enrolled into the baseline phase of the HEMO study and to relate these
markers to all-cause mortality. The mitochondrial injury markers studied in peripheral blood mononuclear
cells were the mtDNA copy number per cell, measured by quantitative PCR, and the presence of the
mtDNA
4977
mutation. After frequency-matching healthy control subjects for age, mtDNA copy number
was lower among older dialysis patients compared with older healthy subjects (P⫽0.01). A one-log
increase in mtDNA copy number was independently associated with a decreased hazard for mortality
(adjusted hazard ratio 0.64; 95% confidence interval 0.46 to 0.89). The mtDNA
4977
deletion was present
in 48 (31%) patients and was independently associated with a decreased hazard for mortality (adjusted
hazard ratio 0.33; 95% confidence interval 0.19 to 0.56). In summary, the mtDNA
4977
seems to predict
survival in ESRD, but a reduced mitochondrial copy number seems to predict a poor outcome. Although
further exploration of these associations is needed, evaluation of mitochondrial DNA copy number and
somatic mtDNA mutations may provide simple genomic biomarkers to predict clinical outcomes among
patients with ESRD.
J Am Soc Nephrol 20: 189–196, 2009. doi: 10.1681/ASN.2007091031
The uremic syndrome is characterized by abnor-
malities in energy metabolism, manifest as changes
in basal metabolic rate, relative catabolism, negative
nitrogen balance, protein energy malnutrition, in-
sulin resistance, and dyslipidemia.
1
Mitochondria
are integral to these metabolic processes, which
they probably influence through cytokine- and adi-
pokine-mediated mechanisms.
2
Early studies with
31-phosphorus nuclear magnetic resonance dem-
onstrated that mitochondrial oxidative capacity
was diminished in muscle of patients established on
dialysis.
3
More recent studies showed a high preva-
lence of somatic mitochondrial DNA (mtDNA)
mutations, specifically the “common deletion” (a
4977-bp deletion between nucleotide positions
8470 and 13,447 [mtDNA
4977
]) in skeletal muscle
of patients with ESRD.
4
Human mtDNA is partic-
ularly prone to oxidant injury because mitochon-
dria generate reactive oxygen species during ATP
production.
5
mtDNA injury may be qualitative—
deletion or point mutations— or quantitative—ab-
normalities of mtDNA copy number per cell,
mtDNA being polyploid.
6
mtDNA mutations are
classically studied in skeletal muscle tissue, but re-
cent observations suggested that the use of periph-
Received September 24, 2007. Accepted June 11, 2008.
Published online ahead of print. Publication date available at
www.jasn.org.
Correspondence: Dr. Madhumathi Rao, Tufts-New England
Medical Center, 35 Kneeland Street, Boston, MA 02111; Phone:
617-636-0562; Fax: 617-636-1355; E-mail: mrao@tufts-nemc.org
Copyright 䊚2009 by the American Society of Nephrology
CLINICAL RESEARCH www.jasn.org
J Am Soc Nephrol 20: 189–196, 2009 ISSN : 1046-6673/2001-189 189
eral blood mononuclear cells (PBMC) may be informative as
well.
7
This study was a preliminary evaluation of mtDNA injury in
PBMC obtained from patients on maintenance hemodialysis
(HD) to evaluate the prevalence of the mtDNA
4977
mutation
and the distribution of mtDNA copy number per cell. We hy-
pothesized that both of these markers were independent pre-
dictors of future all-cause mortality (ACM) among HD pa-
tients.
RESULTS
Genomic DNA samples were available for 180 patients with
ESRD and 36 healthy control subjects. Of the patients with
ESRD, 173 were randomly assigned in accordance with the
protocol of the parent study, forming four roughly equal
groups by the 2 ⫻2 combinations of dialysis dosage and flux
categories. The mean age of the ESRD cohort was 62.2 ⫾12.3
yr, and median (interquartile range [IQR]) duration on HD
was 2.1 (0.8 to 4.6) years; 46% (83 of 180) were male, 54% (97
of 180) were white, 44% (79 of 180) had diabetes, and 66%
(115 of 180) had cardiovascular disease. The mean (⫾SD) se-
rum albumin was 3.6 ⫾0.34 g/dl (36.0 ⫾4.0 g/L), and hemat-
ocrit was 33.0 ⫾4.5%. The mean age of the healthy control
subjects was 42.6 ⫾16.7 yr, 75% were female, and 36% were
older than 50 yr (versus 81% in the ESRD cohort).
mtDNA Copy Number
The overall median (IQR) mtDNA copy number per cell was
586 (401 to 817). The corresponding value in healthy control
subjects was 914 (445 to 1262), significantly different from
patients with ESRD (Mann Whitney test, P⫽0.002). Figure 1
shows the distribution of mtDNA copy number per cell by age
in the study population versus healthy control subjects. Among
older individuals (ⱖ50 yr), the copy number was significantly
higher in healthy subjects; no significant difference was seen
between younger individuals with and without ESRD. The me-
dian copy number increased with age among healthy subjects
(by a factor of 1.14 [95% confidence interval (CI) 1.02 to 1.25]
for each 10-yr increase in age; P⫽0.02). No such increase was
seen among patients with ESRD.
mtDNA copy number did not differ by age, gender, race,
number of years spent on HD, Index of Co-Existing Diseases
(ICED) score, the presence of diabetes or vascular disease,
smoking history, or plasma C-reactive protein (CRP) levels.
The copy number was lower among patients who subsequently
died during the follow-up period (median [IQR] 524 [352 to
733] versus 642 [486 to 925]; Mann Whitney test, P⫽0.003).
mtDNA
4977
Genotyping was carried out for 157 patients with satisfactory
DNA quality (Figure 2). The mtDNA
4977
deletion was present
in 48 (31%) patients. Among patients for whom genotyping
was carried out, patients with the deletion mutation were older
(64.6 ⫾10.6 versus 61.2 ⫾12.9 yr), but the difference was
statistically insignificant. They had started dialysis at an older
age (62.1 ⫾11.7 versus 57.4 ⫾14.5 yr; P⫽0.05) and had been
on HD for a shorter span of years (median 1.6 versus 2.4 yr; P⫽
0.01 after log transformation). The prevalence of the mutation
was higher among patients with diabetes (37 versus 26%; P⫽
0.08) and those with preexisting vascular disease (35 versus
22%; P⫽0.08), but the differences again were not statistically
significant. Patients with the mutation also had lower plasma
levels of CRP (median [IQR] 9.9 [2.0 to 17.6] versus 5.8 [4.1 to
22.2]
g/ml; Mann Whitney test, P⫽0.10), but the difference
did not reach statistical significance. Notably, patients with the
mutation had a higher copy number than patients without, but
this again did not reach statistical significance (median [IQR]
657 [520 to 814] versus 540 [420 to 825]; Mann-Whitney test,
P⫽0.08).
MtDNA copy number
P=0.24
P=0.001
Age <50 years
Age >50 years
Figure 1. Box plots showing the relative difference in distribu-
tion of mtDNA copy number per cell between patients with ESRD
and healthy control subjects frequency matched for age. (Top) No
significant difference (age ⬍50 yr) between the two groups but in
older individuals (age ⱖ50 yr) (bottom), healthy control subjects
showed a higher mtDNA copy number than did patients with
ESRD (P⫽0.001)
Figure 2. Agarose gel electrophoresis of the PCR products. Lane
1, a 100-bp molecular weight ladder; lanes 2 through 9, co-
amplification products; lanes 6, 7, and 9, two products, the upper
band (326 bp) represents wild-type mtDNA and the lower band
(301 bp) represents mtDNA
4977
. In lanes 2 through 5 and 8, the
lower band is absent, indicating that there is hardly any
mtDNA
4977
.
CLINICAL RESEARCH www.jasn.org
190 Journal of the American Society of Nephrology J Am Soc Nephrol 20: 189–196, 2009
Relationship between mtDNA Copy Number per Cell
and All-Cause Mortality
Over the median (IQR) follow up of 980 (510 to 1445) days in
173 patients, there were 102 (59%) deaths. The median (95%
CI) survival was 1165 (983 to 1347) days. A one-log increase in
mtDNA copy number per cell was associated with a significant
decrease in the hazard for mortality (hazard ratio [HR] 0.63;
95% CI 0.48 to 0.83) in univariate analysis. Adjustment for
covariates did not affect the relationship (adjusted HR 0.64;
95% CI 0.46 to 0.89; Figure 3A). In a separate model that in-
cluded (log) CRP and the dosage and flux grouping of the
parent study and that was subjected to backward selection,
there was a strengthening of the relationship between (log)
mtDNA copy number per cell and ACM; variables retained in
the model were age, number of years spent on dialysis, smok-
ing, and diabetes (Table 1). Figure 4A shows the Kaplan-Meier
survival curves for patients with mtDNA copy number per cell
dichotomized about the median.
Relationship between mtDNA
4977
Deletion Mutation
and All-Cause Mortality
Of 157 patients included in this analysis, 150 underwent ran-
domization in the parent study and had follow-up informa-
tion. There were a total of 85 (57%) deaths during follow-up.
In univariate analysis, the presence of the mutation was asso-
ciated with a significant decrease in the hazard for mortality
(HR 0.51; 95% CI 0.31 to 0.82). Adjustment for covariates
(without the inclusion of plasma levels of CRP in the model)
strengthened the association considerably (adjusted HR 0.33;
95% CI 0.19 to 0.56). Addition of mtDNA copy number to the
model showed that both markers were independent predictors
of mortality in this subgroup, without appreciable alteration in
their respective estimates (mtDNA
4977
HR 0.35 [95% CI 0.21
to 0.60]; mtDNA copy number, per log, HR 0.69 [95% CI 0.49
to 0.97]; Figure 3B). The final model after backward selection
of variables including plasma CRP levels and the dialysis and
flux grouping of the parent study is shown in Table 1. Figure 4B
shows the Kaplan-Meier survival curves for patients with and
without the mtDNA
4977
deletion mutation.
Relative Predictive Ability of mtDNA Copy Number
and mtDNA
4977
for Mortality
Table 2 shows the relative predictive ability of mtDNA copy num-
ber per cell and the presence of the mtDNA
4977
deletion mutation
for ACM compared with the other variables in the respective
models. The full model provided a c value ⱖ0.7. When examined
alone, the contribution of mtDNA copy number per cell was as
strong as smoking history, although less strong than age or dura-
tion spent on HD. When both variables were examined together
in the second model, the presence of the mutation alone was
stronger than diabetes and smoking, as strong as duration spent
on HD but less strong than age. Both markers together seemed to
add a discriminative ability comparable to age.
Relationship between mtDNA Injury and Other Markers
Plasma 8-OHDG levels were measured as a marker of oxidative
stress but showed no relationship to either the mtDNA copy
number or the presence of the deletion mutation. Plasma lactate
was measured as a crude indicator of redox status and there-
fore mitochondrial function. The mean
plasma lactate level was 1.3 ⫾0.8 mmol/L.
There was an NS negative correlation be-
tween plasma lactate and mtDNA copy
number (r⫽⫺0.12, P⫽0.13) that im-
proved after adjustment for age, diabetes,
and (log) CRP (r⫽⫺0.17, P⫽0.04).
Plasma lactate levels did not differ by pres-
ence of the deletion mutation.
Sensitivity Analysis
For patients with missing data, the tech-
nique of multiple imputation was used to
impute values that were missing at base-
line for serum cholesterol (18%) and
plasma CRP (7%). Cox regression models
were re-run with ACM as the outcome for
analyses with mtDNA copy number,
mtDNA
4977
, and both, and estimates ob-
tained after inclusion of imputed values
did not differ from the original results.
DISCUSSION
This study, of a cohort of prevalent
maintenance HD patients, showed that
Hazard ratio for mortality Hazard ratio for mortality
Entire cohort (n=172) Subset with mtDNA4977 genotyping available (n=150)
*
AB
Figure 3. Bars in the left panel (A) represent HR for mtDNA copy number (per log),
unadjusted and adjusted for all other variables in the model. Bars in the right panel (B)
represent HR of mtDNA4977, unadjusted and adjusted for other variables in the model,
except for bar marked with *, which represents HR for mtDNA copy number (per log)
adjusted for all other variables in the model. The multivariate analysis sequentially
adjusted for age, gender, race, duration spent on dialysis, diabetes, comorbidity, and
smoking. Comorbidity was expressed as the ICED score.
CLINICAL RESEARCHwww.jasn.org
J Am Soc Nephrol 20: 189–196, 2009 mtDNA Injury and Mortality in Hemodialysis Patients 191
markers of mtDNA injury were powerful predictors of ACM.
The markers evaluated were the copy number of mtDNA per
cell and the presence of the mtDNA
4977
deletion mutation. A
higher copy number was strongly protective from risk for
death, and the presence of the deletion mutation (rather than
absence) was strongly protective from risk for death. These
relationships were not affected appreciably by adjustment for
covariates and indeed with regard to the mutation actually
strengthened by adjustment. The mtDNA copy number did
not have a significant association with other variables, includ-
ing age, duration spent on HD, or diabetes. It showed a weak
albeit significant inverse relationship with plasma lactate levels
after adjustment for age, diabetes, and inflammatory status.
The deletion mutation was more frequent among older indi-
viduals and those who were older at the onset of HD and was
associated with a shorter duration spent on HD. Among pa-
tients with the mutation, a higher proportion had diabetes or
preexisting vascular disease, lower plasma CRP levels, and, in-
terestingly, a higher mtDNA copy number, but none of these
differences reached statistical significance. Compared with
healthy control subjects frequency matched for age, the
mtDNA copy number among patients with ESRD was signifi-
cantly lower among older individuals
and seemed to have markedly wider
variability. The age-associated increase
in copy number that was apparent
among healthy control subjects was not
seen among patients with ESRD.
mtDNA is polyploid (unlike nuclear
DNA, which is diploid), indicating that
there are multiple copies of mtDNA
within a cell. mtDNA replication is inde-
pendent of nuclear DNA replication but
involves coordinated expression of
genes in the nucleus and mitochondria.
The number of copies and the rate of
replication vary by cell type. mtDNA
replication is usually associated with but
not necessary to the process of mito-
chondrial biogenesis, which is responsible for maintaining mi-
tochondrial mass and volume during states of normal and al-
tered homeostasis.
8
Classically, mtDNA depletion syndromes
are associated with myopathies
6
; recent literature has alluded
to a link between decreased mitochondrial biogenesis and di-
abetes
9–11
and the cardiovascular risk associated with the met-
abolic syndrome.
12
mtDNA abundance has been associated
with a beneficial muscle response to endurance exercise as well
as senescence and states of oxidative stress.
13–15
It is indeed
conceivable that an increase in mtDNA copy number in the
latter situations could occur as a feedback response that com-
pensates for defective mitochondria or mutated mtDNA.
Several acquired mtDNA mutations (point mutations and
deletion mutations) have been associated with conditions such
as atrial fibrillation, atherosclerosis, senescence, type 2 diabetes,
and neurodegenerative diseases such as Alzheimer’s and Par-
kinson’s diseases.
16–19
mtDNA mutations are heteroplasmic
(i.e., both normal and mutant mtDNA are present in the same
cell), the phenotype reflecting the proportion of mutant
mtDNA molecules and the extent to which the cell type relies
on mitochondrial function.
5,6
The most frequently encoun-
tered mutation is a 4977-bp deletion between nucleotide posi-
Table 1. Cox regression models showing the relationship between mtDNA copy number and mtDNA
4977
to ACM
Parameter HR 95% CI P
Entire cohort (n⫽173)
mtDNA copy number (per log) 0.60 0.44 to 0.82 0.001
age (per year) 1.04 1.02 to 1.07 ⬍0.001
duration on HD (per log-years) 1.46 1.21 to 1.76 ⬍0.001
smoking 1.90 1.23 to 2.90 0.003
diabetes 1.48 0.96 to 2.28 0.077
Subset with mtDNA
4977
genotyping available (n⫽150)
mtDNA
4977
0.35 0.20 to 0.59 ⬍0.001
mtDNA copy number (per log) 0.67 0.47 to 0.94 0.020
age (per year) 1.06 1.03 to 1.09 ⬍0.001
duration on HD (per log-years) 1.62 1.27 to 2.08 ⬍0.001
smoking 2.23 1.41 to 3.54 ⬍0.001
diabetes 1.86 1.16 to 2.98 0.010
Figure 4. Kaplan-Meier survival curves for patients dichotomized as having mtDNA copy
number above and below the median (A) and for patients with and without the
mtDNA
4977
deletion mutation (B).
CLINICAL RESEARCH www.jasn.org
192 Journal of the American Society of Nephrology J Am Soc Nephrol 20: 189–196, 2009
tions 8470 and 13,447, referred to as the common deletion
(mtDNA
4977
). mtDNA
4977
has been established as the most
common and abundant large-scale deletion of mtDNA in var-
ious human tissues, accounting for 30 to 50% of all deletions,
and has been commonly used as an indicator of somatic
mtDNA injury. The 4977-bp deleted region encodes for seven
of 13 polypeptides that are essential subunits for the respira-
tory chain enzyme complexes of the oxidative phosphorylation
pathway.
20
Lim et al. found that the mtDNA
4977
deletion mu-
tations were highly prevalent in skeletal muscle of patients with
ESRD and correlated positively with the 8-hydroxy 2⬘deox-
yguanosine (8-OHDG) content (a marker of nucleic acid oxi-
dation) of total skeletal muscle DNA.
4
Liu et al.
21
also showed
that the incidence and proportion of mtDNA with the 4977
deletion in hair follicles both were significantly higher among
patients with ESRD on HD compared with age-matched
healthy control subjects; however, there has been no systematic
investigation of the relationship between markers of mtDNA
injury and clinical outcomes among patients with ESRD, and
we believe this report is the first to address this area.
Our results, although preliminary, suggest that a higher
mtDNA copy number among HD patients is associated with
better survival. The observation that the presence of the
mtDNA
4977
deletion mutation is associated with better sur-
vival is counterintuitive. It is possible that a higher mtDNA
copy number is needed as a compensatory response to ongoing
mitochondrial injury in uremia and therefore is protective.
8
Indeed, we did observe that copy number tended to be higher
among patients positive for the mtDNA
4977
mutation, al-
though statistical significance was not reached. We also ob-
served that plasma lactate levels tended to be higher among
patients with lower mtDNA copy number. The absence of an
increase in copy number with age among patients with ESRD
as was seen with healthy control subjects may also be an indi-
cator of a failed compensatory response. Although the litera-
ture is sparse and conflicting, animal studies have shown an
increase in mtDNA copy number with age in several or-
gans.
22–24
Regarding the mtDNA
4977
mutation, one might speculate
that it may be a marker of either survival or aging. Although
there is a large body of literature associating the mutation with
aging and age-related pathology, there is little or no evidence to
impute a causal role.
18,25,26
The mtDNA
4977
mutation may
therefore identify individuals who are older and possibly sur-
vivors. Alternatively, the mutation may identify less lethal in-
jury to mtDNA, and patients who genotyped negative for this
mutation may have had more lethal undiscovered mutations.
A mechanistic explanation may be that cells with the mutation
produced fewer reactive oxygen species, considering its loca-
tion in the region encoding the respiratory chain enzyme com-
plexes of the oxidative phosphorylation pathway. Alterna-
tively, accumulation of mutated DNA may reflect deficient or
suppressed autophagic mechanisms in uremia, to allow for in-
creased biogenesis.
25,27,28
It must be emphasized, however, that
the observational nature of this study precludes any definitive
inference as to the functional impact of the deletion mutation.
The impact of mitochondrial mass and mtDNA mutations, as
well HD treatment itself, on key parameters and regulators of
mitochondrial function such as mitochondrial calcium
uniporter and mitochondrial Na
⫹
-Ca
2⫹
exchanger needs to be
explored in future studies.
Although this report is preliminary and the study is explor-
atory, there are several aspects that help strengthen our obser-
vations. The source of DNA was homogeneous, obtained from
harvested PBMC, and eliminated platelet contamination.
Genotyping and mutation discovery may be accomplished
with DNA from whole-blood samples but not quantification;
our results were therefore specific to mononuclear cells. The
study included a sizable cohort of stable HD patients with
long-term follow-up and detailed and accurate ascertainment
of both baseline variables and outcomes. Previous patient-level
studies of mtDNA injury markers have been relatively smaller
and descriptive.
4,21
Finally, chronic kidney disease and ESRD
are states in which there is dissociation between chronological
age and physiologic age, and several uremic complications
mimic an accelerated aging process. ESRD is associated with
increased levels of oxidative stress similar to senescence and
may provide a relevant model to study the significance of mi-
tochondrial injury. We were unable, however, to demonstrate
a relationship to serum levels of 8-OHDG; it is possible that
levels of this marker in genomic DNA may show a closer rela-
tionship to mtDNA copy number or mutations.
The limitations of this study include the secondary nature
of the analysis from a preexisting interventional study. Al-
though the gold standard of target tissue to study mitochon-
Table 2. Relative contribution of each variable to the final
Cox model shown in Table 1
Parameter ⴚ2LL AUC
Entire cohort (nⴝ173)
full model 852 0.70
effect of withholding variable on model
a
diabetes 856 0.70
smoking 862 0.68
mtDNA copy number (per log) 863 0.68
duration on HD (per log-years) 868 0.66
age (per year) 871 0.65
Subset with mtDNA
4977
genotyping available
(nⴝ150)
full model 662 0.74
effect of withholding variable on model
a
diabetes 669 0.75
mtDNA copy number (per log) 668 0.74
smoking 674 0.72
mtDNA
4977
679 0.71
duration on HD (per log-years) 678 0.71
age (per year) 691 0.69
both mtDNA
4977
and mtDNA copy number
(per log)
688 0.70
a
A higher ⫺2LL and lower area under the curve (AUC) suggest greater
contribution of the variable to the discriminative ability of the model because
this is the effect of leaving the variable out of the model.
CLINICAL RESEARCHwww.jasn.org
J Am Soc Nephrol 20: 189–196, 2009 mtDNA Injury and Mortality in Hemodialysis Patients 193
dria is skeletal muscle, such sampling is invasive. The use of
lymphocytes may also be acceptable because they are long-
lived cells with low turnover and may allow mutations to ac-
cumulate.
7
To offset any bias that may have occurred as a result
of missing data, we used the statistical technique of multiple
imputations to impute missing values and estimates obtained
after inclusion of imputed values did not differ from the orig-
inal results.
In summary, our observations raise intriguing questions as
to the role of mitochondrial injury in the genesis of uremic
complications and clinical outcomes. Clearly, our observa-
tions on somatic mtDNA mutations and mtDNA copy num-
ber need to be replicated in a larger patient population, includ-
ing those with less advanced chronic kidney disease.
CONCISE METHODS
Subjects
The study cohort consisted of 180 patients who had ESRD and were
on maintenance HD and were recruited to the baseline phase of the
Hemodialysis (HEMO) Study from two Boston centers. This ancillary
study was approved by the Human Investigation Review Committee,
and all participants provided written informed consent.
The details of the National Institutes of Health–sponsored HEMO
Study have been published elsewhere.
29,30
Briefly, this study, initiated
in 1995, was sponsored by the National Institute of Diabetes and
Digestive and Kidney Diseases and was a multicenter, prospective,
randomized clinical trial designed to evaluate the effect of dialyzer
urea and

2-microglobulin clearances on morbidity and mortality.
Eligible patients were between the ages of 18 and 80 yr, were receiving
long-term HD three times per week, and had residual renal urea clear-
ance ⬍1.5 ml/min per 35 L of urea distribution volume. Patients who
were in acute or chronic care hospitals; had active malignancy or
decompensated cardiac, hepatic, or pulmonary disease; had serum
albumin ⬍2.5 g/dl; were pregnant, or had a scheduled or recently (⬍6
mo) failed transplant were excluded. Eligible patients were randomly
assigned in a 1:1 ratio with a two-by-two factorial design to either a
standard-dosage (single-pool Kt/V of 1.25) or a high-dosage (single-
pool Kt/V of 1.65) goal and to dialysis with either a low-flux (mini-
mum values for ultrafiltration coefficient ⱕ14 ml/h per mmHg and
first-use

2-microglobulin clearance ⬍10 ml/min) or a high-flux di-
alyzer (minimum values for ultrafiltration coefficient ⬎14 ml/h per
mmHg and first-use

2-microglobulin clearance ⬎20 ml/min). The
planned follow-up ranged from 1 to 6.5 yr depending on the time of
randomization.
Data Procurement
Clinical Data. Demographic, medical, and socioeconomic informa-
tion was obtained in the baseline phase of the study. HD prescription
and monitoring of routine laboratory parameters followed the proto-
col of the HEMO study. Comorbidities were catalogued using the
ICED.
31
The highest scores of Index of Disease Severity and Index of
Physical Impairment were combined to create the ICED score, from 0
to 3 (0 indicating the absence of disease, and increasing values indi-
cating increasing severity of the disease), and diabetes-related scores
were excluded from the final severity scores.
Outcome. The primary outcome was time to death from any cause
(ACM).
Blood Samples
Baseline blood samples were obtained before dialysis within 1 mo of
enrollment. Heparinized blood samples (30 ml) were immediately
placed on ice and transported to the laboratory.
Healthy Control Subjects.Blood samples were also obtained from
healthy adult subjects to provide a reference for mtDNA quantifica-
tion compared with patients with ESRD.
PBMC Isolation and DNA Extraction. Isolated PBMC aliquots were
used for DNA extraction and genotyping for this study. PBMC were
harvested from whole blood as described previously using Ficoll-
Hypaque density gradient separation technique.
32
Cells (2.5 ⫻10
6
PBMC/ml) were resuspended in RPMI 1640 cell culture medium sup-
plemented with L-glutamine, NaHCO
3
, HEPES, penicillin, and strep-
tomycin and stored at ⫺80°C until DNA extraction.
Genomic DNA was extracted using a spin-column method
(QIAamp DNA Mini Kit; Qiagen, Valencia, CA). In brief, 2.5 ⫻10
6
PBMC were treated with 20
l of proteinase K (Qiagen), followed by
the addition of 200
l of SDS to lyse the cells. The homogeneous
solution was incubated at 56°C for 10 min, and 200
l of 100% etha-
nol was added to precipitate DNA. The mixture was then applied to
the QIAamp spin column, and after two washes with 500
l of wash
buffer, genomic DNA was eluted by the addition of 200
l of elution
buffer. Final DNA concentrations were 50 to 200 ng/ml determined
by minigel electrophoresis.
Mitochondrial copy number was estimated by determining rela-
tive amounts of nuclear DNA and mtDNA by quantitative real-time
PCR (Stratagene Mx4000Multiplex QPCR System; Stratagene, La
Jolla, CA).
33
The ratio of mtDNA to nuclear DNA reflects the tissue
concentration of mitochondria per cell. A 120-bp-long mtDNA frag-
ment within the ND1 gene and a 120-bp region of the lipoprotein
lipase gene (LPL) were amplified. The ND1 forward primer used was
(5⬘to 3⬘) CCCTAAAACCCGCCACATCT, and reverse primer was
GAGCGATGGTGAGAGCTAAGGT. The LPL (accession no.
NM_000237) forward primer used was CGAGTCGTCTTTCTCCT-
GATGAT and reverse primer was TTCTGGATTCCAATGCTTCGA.
The quantification assay was performed in a total reaction volume of
25
l containing 12.5
lof2⫻SYBR Green, 1.25
l of each primer, 1
l of sample DNA, and 9
l of water. Amplification and detection
were performed in a Stratagene Mx4000 Multiplex Quantitative PCR
System. PCR was initiated with 15 min at 95°C, followed by 40 cycles
of 15 s at 95°C, 30 s at 49°C, and 30 s at 72°C, followed by 1 min at 95°C
and 41 cycles starting at 49°C for 30 s, escalating by 1°C per cycle. Each
sample was assayed in triplicate, and fluorescence spectra were con-
tinuously monitored by the Mx4000 system and sequence detection
software. Data analysis was based on measurement of the cycle thresh-
old (CT), and the difference in CT values was used as the measure of
relative abundance: CT(ND1) ⫺CT(LPL) or ⌬CT, a quantitative
measure of the mitochondrial genome. Results were expressed as the
copy number of mtDNA/cell, provided by 2 ⫻2
⫺⌬CT
and, being a
ratio, was unitless.
CLINICAL RESEARCH www.jasn.org
194 Journal of the American Society of Nephrology J Am Soc Nephrol 20: 189–196, 2009
Genotyping. The common deletion (mtDNA
4977
) was genotyped
in a subset of 157 patients for whom DNA was of sufficient quality,
using a nested PCR protocol.
16
The amplification target was the seg-
ment between 8224 and 13501 bp. The primer pairs for mtDNA
4977
and wild-type mtDNA were used in the same tube of reaction (co-
amplification). In the presence of the deletion mutation, two products
were obtained: A 301-bp product from mtDNA
4977
and a 326-bp
product from wild-type mtDNA. Figure 2 shows the agarose gel elec-
trophoresis of the PCR products.
Plasma levels of CRP were measured using a commercially avail-
able high-sensitivity immunoassay (Hemagen Diagnostics, Colum-
bia, MD).
Levels of 8-OHDG and lactate were measured in plasma using
commercially available assays. Plasma 8-OHDG was quantified using
a competitive enzyme immunoassay (Cell Biolabs, San Diego, CA).
Briefly, plasma samples or 8-OHDG standards are first added to an
8-OHDG/BSA conjugate preabsorbed enzyme immunoassay plate.
After a brief incubation, an anti– 8-OHDG mAb is added, followed by
an horseradish peroxidase– conjugated secondary antibody. The
8-OHDG content in the plasma samples was then determined by
comparison with the 8-OHDG standard curve. The assay has a detec-
tion sensitivity range of 100 pg/ml to 20 ng/ml. Lactate levels were
measured with a colorimetric assay (BioVision Research Products,
Mountain View, CA).
For each individual patient, samples from each time point were
analyzed in the same assay. All samples for a given assay were tested
simultaneously, in duplicate and in appropriate dilutions.
Statistical Analysis
Analysis was performed using SAS 9.1 (SAS Institute, Cary, NC). Data
were expressed as means and SD for continuous variables that were
normally distributed and medians and ranges for non-normally dis-
tributed data (mtDNA copy number per cell, CRP levels, duration of
HD, and body mass index). Categorical data were expressed as pro-
portions. The unadjusted relationships of either mtDNA copy num-
ber per cell or the mtDNA
4977
deletion mutation to patient character-
istics including relationship to plasma CRP levels were examined
using nonparametric statistics or correlation, with transformed data
as applicable.
Cox proportional hazards regression was used to evaluate the ef-
fect of mtDNA copy number per cell on ACM outcome. Data were
censored at the time of transplantation, but, in keeping with the in-
tention-to-treat principle of the parent study, data were not censored
when patients left the study because of transfer to a nonparticipating
center or alternative method of dialysis. The proportional hazards
assumption was tested using Schoenfeld residuals, a time-varying co-
efficient model, and by examination of log (⫺log survival) curves for
parallelism and was met for all covariates except diabetes. The covari-
ates explored were age, gender, race (white versus black), diabetes,
duration on HD, the ICED score as a measure of comorbidity, body
mass index, smoking history, and the dialysis dosage and flux group-
ing of randomization. The effect of adding plasma CRP level as a
covariate was subsequently studied in a separate model. The final
models were arrived at by backward selection of variables to limit the
number of variables and avoid overfitting in the models.
Cox models were also run for the subset of patients for whom
genotyping data for the deletion mutation mtDNA
4977
were available
to examine its relationship to ACM outcome. An additional model
was constructed whereby the effect of mtDNA
4977
on ACM outcome
was adjusted for mtDNA copy number per cell. Both unadjusted es-
timates and estimates adjusted for covariates selected as described
previously were generated and a separate model was constructed with
the inclusion of plasma CRP level.
The relative predictive ability of mtDNA copy number per cell and
the presence of the mtDNA
4977
deletion mutation for ACM compared
with other known risk variables were tested using the likelihood ratio
2
statistic as the change in ⫺2log likelihood of each model upon
addition of each marker. The concordance statistic (area under the
curve, or “c index”) was used as a measure of discrimination by each
marker for mortality outcome. The discriminative ability indicates
how well a model can distinguish between patients with different
survival expectations. The c statistic for survival data estimates the
probability that for a randomly chosen pair of patients, the one having
the higher predicted survival is the one who survives longer. A predictive
model withacof0.5hasnopredictive value, whereas a model with a
c of 1.0 discriminates perfectly between patients differing in survival.
Because data were complete for 93 and 82% of the study popula-
tion for the baseline covariates plasma CRP and serum cholesterol,
respectively, the technique of multiple imputation was used to impute
missing values for these variables. Cox regression models were re-run,
and estimates were compared with those from the models without
imputed data in the form of a sensitivity analysis.
All tests were two-tailed, and P⬍0.05 was considered significant.
All CI were calculated at the 95% level.
ACKNOWLEDGMENTS
This study was supported by a grant from the National Institutes of
Health (DK 2819-O1A1). Additional support was provided by a grant
from Satellite Healthcare.
This study was presented at the annual meeting of the American
Society of Nephrology; November 2 through 5, 2007; San Francisco,
CA.
DISCLOSURES
None.
REFERENCES
1. Kalantar-Zadeh K: Recent advances in understanding the malnutrition-
inflammation-cachexia syndrome in chronic kidney disease patients:
What is next? Semin Dial 18: 365–369, 2005
2. Heilbronn L, Smith SR, Ravussin E: Failure of fat cell proliferation,
mitochondrial function and fat oxidation results in ectopic fat storage,
insulin resistance and type II diabetes mellitus. Int J Obes Relat Metab
Disord Suppl 4: S12–S21, 2004
3. Thompson CH, Kemp GJ, Taylor DJ, Ledingham JG, Radda GK,
Rajagopalan B: Effect of chronic uraemia on skeletal muscle metabo-
lism in man. Nephrol Dial Transplant 8: 218–222, 1993
CLINICAL RESEARCHwww.jasn.org
J Am Soc Nephrol 20: 189–196, 2009 mtDNA Injury and Mortality in Hemodialysis Patients 195
4. Lim PS, Ma YS, Cheng YM, Chai H, Lee CF, Chen TL, Wei YH:
Mitochondrial DNA mutations and oxidative damage in skeletal mus-
cle of patients with chronic uremia. J Biomed Sci 9: 549–560, 2002
5. Wei Y: Mitochondrial DNA alterations as ageing-associated molecular
events. Mutat Res 275: 145–155, 1992
6. Rotig A, Munnich A: Genetic features of mitochondrial respiratory
chain disorders. J Am Soc Nephrol 14: 2995–3007, 2003
7. Mohamed SA, Wesch D, Blumenthal A, Bruse P, Windler K, Ernst M,
Kabelitz D, Oehmichen M, Meissner C: Detection of the 4977 bp
deletion of mitochondrial DNA in different human blood cells. Exp
Gerontol 39: 181–188, 2004
8. Chabi B, Adhihetty PJ, Ljubicic V, Hood DA: How is mitochondrial
biogenesis affected in mitochondrial disease? Med Sci Sports Exerc
37: 2102–2110, 2005
9. Heilbronn LK, Gan SK, Turner N, Campbell LV, Chisholm DJ: Markers
of mitochondrial biogenesis and metabolism are lower in overweight
and obese insulin-resistant subjects. J Clin Endocrinol Metab 92:
1467–1473, 2007
10. Rolo AP, Palmeira CM: Diabetes and mitochondrial function: Role of
hyperglycemia and oxidative stress. Toxicol Appl Pharmacol 212:
167–178, 2006
11. Ukropcova B, Sereda O, de Jonge L, Bogacka I, Nguyen T, Xie H, Bray
GA, Smith SR: Family history of diabetes links impaired substrate
switching and reduced mitochondrial content in skeletal muscle. Dia-
betes 56: 720–727, 2007
12. Nisoli E, Clementi E, Carruba MO, Moncada S: Defective mitochon-
drial biogenesis: A hallmark of the high cardiovascular risk in the
metabolic syndrome? Circ Res 100: 795–806, 2007
13. Hood DA, Saleem A: Exercise-induced mitochondrial biogenesis in
skeletal muscle. Nutr Metab Cardiovasc Dis 17: 332–337, 2007
14. Menshikova EV, Ritov VB, Fairfull L, Ferrell RE, Kelley DE, Goodpaster BH:
Effects of exercise on mitochondrial content and function in aging human
skeletal muscle. J Gerontol A Biol Sci Med Sci 61: 534–540, 2006
15. Rasbach KA, Schnellmann RG: Signaling of mitochondrial biogenesis
following oxidant injury. J Biol Chem 282: 2355–2362, 2007
16. Lai LP, Tsai CC, Su MJ, Lin JL, Chen YS, Tseng YZ, Huang SK: Atrial
fibrillation is associated with accumulation of aging-related common
type mitochondrial DNA deletion mutation in human atrial tissue.
Chest 123: 539–544, 2003
17. Botto N, Berti S, Manfredi S, Al-Jabri A, Federici C, Clerico A, Ciofini
E, Biagini A, Andreassi MG: Detection of mtDNA with 4977 bp dele-
tion in blood cells and atherosclerotic lesions of patients with coronary
artery disease. Mutat Res 570: 81–88, 2005
18. Pieczenik SR, Neustadt J: Mitochondrial dysfunction and molecular
pathways of disease. Exp Mol Pathol 83: 84–92, 2007
19. Wallace DC, Schoffner JM, Trounce I, Brown MD, Ballinger SW, Cor-
ral-Debrinski M, Horton T, Jun AS, Lott MT: Mitochondrial DNA mu-
tations in human degenerative diseases and aging. Biochim Biophys
Acta 1271: 141–151, 1995
20. Anderson S, Bankier AT, Barrell BG, de Bruijn MH, Coulson AR, Drouin
J, Eperon IC, Nierlich DP, Roe BA, Sanger F, Schreier PH, Smith AJ,
Staden R, Young IG: Sequence and organization of the human mito-
chondrial genome. Nature 290: 457–465, 1981
21. Liu CS, Ko LY, Lim PS, Kao SH, Wei YH: Biomarkers of DNA damage
in patients with end-stage renal disease: Mitochondrial DNA mutation
in hair follicles. Nephrol Dial Transplant 16: 561–565, 2001
22. Frahm T, Mohamed SA, Bruse P, Gemu¨ nd C, Oehmichen M, Meissner
C: Lack of age-related increase of mitochondrial DNA amount in brain,
skeletal muscle and human heart. Mech Ageing Dev 126: 1192–1200,
2005
23. Masuyama M, Iida R, Takatsuka H, Yasuda T, Matsuki T: Quantitative
change in mitochondrial DNA content in various mouse tissues during
aging. Biochim Biophys Acta 1723: 302–308, 2005
24. Miller FJ, Rosenfeldt FL, Zhang C, Linnane AW, Nagley P: Precise
determination of mitochondrial DNA copy number in human skeletal
and cardiac muscle by a PCR-based assay: Lack of change of copy
number with age. Nucleic Acids Res 31: e61, 2003
25. Krishnan KJ, Greaves LC, Reeve AK, Turnbull DM: Mitochondrial DNA
mutations and aging. Ann N Y Acad Sci 1100: 227–240, 2007
26. McKenzie D, Bua E, McKiernan S, Cao Z, Aiken JM, Wanagat J:
Mitochondrial DNA deletion mutations: A causal role in sarcopenia.
Eur J Biochem 269: 2010–2015, 2002
27. Jin S: Autophagy, mitochondrial quality control, and oncogenesis.
Autophagy 2: 80–84, 2006
28. Kim I, Rodriguez-Enriquez S, Lemasters JJ: Selective degradation of
mitochondria by mitophagy. Arch Biochem Biophys 462: 245–253,
2007
29. Eknoyan G, Beck GJ, Cheung AK, Daugirdas JT, Greene T, Kusek JW,
Allon M, Bailey J, Delmez JA, Depner TA, Dwyer JT, Levey AS, Levin
NW, Milford E, Ornt DB, Rocco MV, Schulman G, Schwab SJ, Teehan
BP, Toto R, Hemodialysis (HEMO) Study Group: Effect of dialysis dose
and membrane flux in maintenance hemodialysis. N Engl J Med 347:
2010–2019, 2002
30. Greene T, Beck GJ, Gassman JJ, Gotch FA, Kusek JW, Levey AS, Levin
NW, Schulman G, Eknoyan G: Design and statistical issues of the
hemodialysis (HEMO) study. Control Clin Trials 21: 502–525, 2000
31. Miskulin DC, Athenites N, Yan G, Martin AA, Ornt DB, Kusek JW,
Meyer KB, Levey AS; Hemodialysis (HEMO) Study Group: Comorbid-
ity assessment using the Index of Coexistent Diseases in a multicenter
clinical trial. Kidney Int 60: 1498–1510, 2001
32. Poutsiaka DD, Clark BD, Vannier E, Dinarello CA: Production of inter-
leukin-1 receptor antagonist and interleukin-1 beta by peripheral
blood mononuclear cells is differentially regulated. Blood 78: 1275–
1281, 1991
33. He L, Chinnery PF, Durham SE, Blakely EL, Wardell TM, Borthwick GM,
Taylor RW, Turnbull DM: Detection and quantification of mitochon-
drial DNA deletions in individual cells by real-time PCR. Nucleic Acids
Res 30: e68, 2002
CLINICAL RESEARCH www.jasn.org
196 Journal of the American Society of Nephrology J Am Soc Nephrol 20: 189–196, 2009
