The association of ACE, ACTN3 and PPARA gene variants with strength phenotypes in middle school-age children

Abstract

The aim of the study was to determine the association between ACE I/D, ACTN3 R577X and PPARA intron 7 G/C gene polymorphisms and strength-related traits in 457 middle school-age children (219 boys and 238 girls; aged 11 ± 0.4 years). The assessment of different phenotypes was conducted with a number of performance tests. Gene polymorphisms were determined by PCR. The ACE D allele was associated with high results of standing long-jump test in boys [II 148.3 (16.3) cm, ID 152.6 (19.6) cm, DD 158.2 (19.1) cm; P = 0.037]. The ACTN3 R allele was associated with high results of performance tests in males only in combination with other genes (standing long-jump test: P = 0.021; handgrip strength test: P \\ 0.0001). Furthermore, the male carriers of the PPARA gene C allele demonstrated the best results of handgrip strength testing than GG homozygotes [GG 14.6 (4.0) kg, GC/CC 15.7 (4.3) kg; P = 0.048]. Thus, the ACE, ACTN3 and PPARA gene variants are associated with strength-related traits in physically active middle school-age boys.

Full text

ORIGINAL PAPER
The association of ACE,ACTN3 and PPARA gene variants
with strength phenotypes in middle school-age children
Ildus I. Ahmetov •Dmitry N. Gavrilov •Irina V. Astratenkova •
Anastasiya M. Druzhevskaya •Alexandr V. Malinin •
Elena E. Romanova •Victor A. Rogozkin
Received: 14 July 2012 / Accepted: 30 August 2012
ÓThe Physiological Society of Japan and Springer 2012
Abstract The aim of the study was to determine the
association between ACE I/D, ACTN3 R577X and PPARA
intron 7 G/C gene polymorphisms and strength-related
traits in 457 middle school-age children (219 boys and 238
girls; aged 11 ±0.4 years). The assessment of different
phenotypes was conducted with a number of performance
tests. Gene polymorphisms were determined by PCR. The
ACE D allele was associated with high results of standing
long-jump test in boys [II 148.3 (16.3) cm, ID 152.6 (19.6)
cm, DD 158.2 (19.1) cm; P=0.037]. The ACTN3 R allele
was associated with high results of performance tests in
males only in combination with other genes (standing long-
jump test: P=0.021; handgrip strength test: P\0.0001).
Furthermore, the male carriers of the PPARA gene C allele
demonstrated the best results of handgrip strength testing
than GG homozygotes [GG 14.6 (4.0) kg, GC/CC 15.7
(4.3) kg; P=0.048]. Thus, the ACE,ACTN3 and PPARA
gene variants are associated with strength-related traits in
physically active middle school-age boys.
Keywords Polymorphism Gene Genetics 
Physiological development Strength
Introduction
It has long been recognized that the inter-individual vari-
ability of physical performance traits and the ability to
become an elite athlete have a strong genetic basis. The
genetic factors that influence these phenotypes are now
being sought [1,2]. Several family, twin, case–control and
cross-sectional studies suggest an important role of genet-
ics along with epigenetic (i.e. stable and heritable changes
in gene expression caused by mechanisms other than
changes in the underlying DNA sequence such as DNA
methylation and histone deacetylation) and environmental
factors in the determination of individual differences in
physical performance and training responses.
It is now very well established that a genetic component of
the variance in any phenotype (i.e. height, muscle mass,
strength, athlete status, etc.) is determined by small changes
in the structure of DNA, which are called polymorphisms.
There are no less than 50 million polymorphic variants in the
human genome, which make all individuals different. The
most common types of DNA sequence variants are single-
nucleotide and insertion/deletion (I/D) polymorphisms.
Genetic variations can affect the amount and structure of
mRNA/protein, and therefore may account for the main
share of genetic factors in human phenotypic variability.
The heritability of muscle strength has been shown to
range from approximately 30 to 80 % [3,4]. Muscle
strength/power phenotypes are accepted to be polygenic in
nature—that is, multiple genetic factors influence the
observed phenotype. To date, over 20 genetic variants have
been associated with strength and power-related pheno-
types [1,5], of which the ACE,ACTN3 and PPARA gene
polymorphisms are three of the most studied.
The I/D polymorphism of the angiotensin I-converting
enzyme (ACE) gene denotes a substantial individual
I. I. Ahmetov (&)
Sport Technology Education Research Laboratory,
Volga Region State Academy of Physical Culture, Sport
and Tourism, 33, Universiade Village, Kazan 420138, Russia
e-mail: genoterra@mail.ru
I. I. Ahmetov D. N. Gavrilov I. V. Astratenkova 
A. M. Druzhevskaya A. V. Malinin E. E. Romanova 
V. A. Rogozkin
St Petersburg Research Institute of Physical Culture,
56 E, Ligovsky Ave, St Petersburg 191040, Russia
123
J Physiol Sci
DOI 10.1007/s12576-012-0233-8

variation in renin–angiotensin system activity with the D
allele being associated with higher ACE activity. Circu-
lating ACE activity is significantly correlated with iso-
metric and isokinetic quadriceps muscle strength [6]. Such
an effect may depend upon increased ACE-mediated acti-
vation of the growth factor angiotensin II, and increased
degradation of growth-inhibitory bradykinin. Accordingly,
greater training-related increases in quadriceps muscle
strength [7,8], peak elbow flexor muscle strength and
biceps muscle cross-sectional area [9] have been associated
with the D allele. Similarly, several studies have shown the
D allele to be associated with greater strength and muscle
volumes at baseline [10–12]. In addition, the D allele was
associated with elite power athlete status [13]. On the other
hand, the ACE I allele was reported to be associated with
endurance athlete status and endurance-related phenotypes
such as proportion of slow-twitch type I muscle fibres,
VO
2max
, fatigue resistance and cardiac output (reviewed in
[1]). However, it should be noted that few studies have
reported conflicting results (i.e. no relationship between the
ACE I/D polymorphism and strength/power phenotypes or
the presence of association of the ACE I allele with
strength/power phenotypes) [13].
The a-actinins constitute the predominant protein com-
ponent of the sarcomeric Z line in skeletal muscle fibres,
where they form a lattice structure that anchors together
actin containing thin filaments and stabilizes the muscle
contractile apparatus [14]. Expression of the a-actinin-3
(ACTN3) is limited to fast muscle fibres responsible for
generating force at high velocity. A common genetic var-
iation in the ACTN3 gene that results in the replacement of
an arginine with a stop codon at amino acid 577
(rs1815739 C/T polymorphism in exon 16; R577X) has
been identified. The X allele contains a sequence change
that completely prevents the production of functional
a-actinin-3 protein. Several case–control studies reported
that ACTN3 RR genotype is over-represented or ACTN3
XX genotype is under-represented in strength/sprint ath-
letes in comparison with controls [14–16]. Although some
contradictory results exist [14], the meta-analysis of nine
studies confirmed this kind of association [15]. The
hypothesis that ACTN3 R allele may confer some advan-
tage in power performance was also supported by several
cross-sectional studies [17–22].
Peroxisome proliferator-activated receptor a(PPARa)is
a ligand-activated transcription factor that regulates the
expression of genes involved in fatty acid uptake and
oxidation, glucose and lipid metabolism, left ventricular
growth and control of body weight. Jamshidi et al. [23]
have shown that British army recruits homozygous for the
rare PPARA C allele of the intron 7 G/C (rs4253778)
polymorphism had a 3-fold greater increase in LV mass in
response to training than G allele homozygotes. The
hypothesis that intron 7 C allele is associated with the
hypertrophic effect due to influences on cardiac and skel-
etal muscle substrate utilization was supported by the
findings that the PPARA C allele is over-represented
in Russian power-oriented athletes and associated with
an increased proportion of fast-twitch muscle fibres in
m. vastus lateralis of physically active healthy men [24].
Twin studies have shown that genes play a larger role in
younger age groups, as the environment may be more
homogeneous and has had less time to take effect [25–27].
Consequently, in these age groups, there is expected to be a
proportionately higher genetic contribution to phenotypic
variation and more readily recognisable interactions
between genetic and environmental components. At pres-
ent, there are two studies related to the search of the
associations of gene polymorphisms with physical, physi-
ological and skill parameters in children. In these studies,
Moran and colleagues showed an association between the
ACE gene I/D polymorphism and both handgrip strength
and vertical jump in female Greek adolescents [28], as well
as a relationship between the ACTN3 gene R577X poly-
morphism and 40-m sprint time in male Greek adolescents
[29].
The aim of the present study was to investigate indi-
vidually, and in combination, the associations of ACE
(I/D), ACTN3 (R577X) and PPARA (intron 7 G/C) gene
polymorphisms with several anthropometrical and perfor-
mance traits in middle school-age Russian children and to
replicate the findings of previous studies. We have there-
fore tested the hypothesis that the ACE D, ACTN3 R and
PPARA C alleles would be associated with better results of
handgrip strength and standing long-jump testing.
Materials and methods
Subjects
Four hundred and fifty-seven healthy physically active
pupils (219 boys and 238 girls; aged 11 ±0.4 years) from
five different schools were studied. All subjects were
Caucasians, and unrelated citizens of Naberezhnye Chelny,
Russia. The Russian Federal Agency for Physical Culture
and Sports approved the study and written informed con-
sent was obtained from each participant’s parents.
Phenotyping
All measurements were carried out by two well-trained
investigators. Children’s strength-related traits were
assessed with two performance tests, including handgrip
J Physiol Sci
123

strength and standing long-jump test [30]. The hand
dynamometer (DK-140; Russia) was used for the handgrip
strength testing. The strength of both the left and right
hands was measured thrice each in a standing position
(with the arm in complete extension without touching any
part of the body with the dynamometer), and the best score
of the dominant hand (kg) was used in the analysis. When
performing the standing long-jump test, the subject was
instructed to push off vigorously and jump as far as pos-
sible trying to land with both feet together. The score (cm)
was the distance from the take-off line to the point where
the back of the heel nearest to the take-off line lands on the
mat (measured with a 5-m tape). The subjects were allowed
to perform three trials in each test (the best result was
chosen for analysis). Furthermore, the subjects underwent
anthropometry [height (cm), weight (kg) and body mass
index (BMI; kg/m
2
)].
Genotyping
Molecular genetic analysis was performed with DNA
samples obtained from epithelial mouth cells using a DNK-
sorb-A sorbent kit according to the manufacturer’s
instructions (Central Research Institute of Epidemiology,
Moscow, Russia). Genotyping for the ACE I/D, ACTN3
R577X and PPARA intron 7 G/C polymorphisms was
performed by polymerase chain reaction (PCR) on a Ter-
cyk thermal cycler (DNA Technology, Moscow, Russia)
according to the previously described methods [31–33].
Briefly, PCR primers for the ACE I/D polymorphism
were forward CTGGAGACCACTCCCATCCTTTCT and
reverse GATGTGGCCATCACATTCGTCAGAT. D and I
alleles of the ACE gene were determined by the presence of
190- or 490-bp fragments, respectively. PCR primers for
the ACTN3 R577X polymorphism were forward CTGTT
GCCTGTGGTAAGTGGG and reverse TGGTCACAGTA
TGCAGGAGGG, generating a fragment of 290 bp. PCR
products were further digested with BstDEI(SibEnzyme,
Russia) for 12 h at 60 °C. PCR primers for the PPARA
intron 7 G/C polymorphism were forward ACAATCACT
CCTTAAATATGGTGG and reverse AAGTAGGGACAG
ACAGGACCAGTA, generating a fragment of 266 bp.
PCR products were further digested with TaqI (SibEn-
zyme, Russia) for 12 h at 65 °C. All PCR and restriction
products were separated by 8 % polyacrylamide gel elec-
trophoresis, stained with ethidium bromide, and visualized
in UV light. All genotyping analyses were conducted blind
to subject identity.
Statistical analysis
Genotype distribution and allele frequencies between dif-
ferent groups of children were compared using v
2
tests.
Differences in performance phenotypes (handgrip strength,
standing long-jump test) between groups with different
genotypes (or combinations of genotypes) were analyzed
using ANOVA (when three genotypes were compared) or
unpaired ttests (when two genotypes were compared). All
values are means (standard deviation; SD). Pvalues \0.05
were considered statistically significant. Bonferroni’s cor-
rection for multiple testing was performed by dividing the
Pvalue (0.05) with the number of tests (overall 35 tests).
The squared correlation coefficient R
2
was used as a
measure of explained variance. Statistical analyses were
conducted using GrathPad Instat software.
Results
ACE,ACTN3 and PPARA genotype distributions amongst
subjects were in Hardy–Weinberg equilibrium. No signif-
icant differences were found in genotype and allele fre-
quencies between boys and girls (Tables 1,2). ACE D,
ACTN3 R, PPARA C alleles’ frequencies in boys and girls
were 48.4, 61.0 and 16.7, and 53.6, 59.3 and 13.2 %,
respectively.
Girls were significantly taller [147.6 (6.7) vs. 146.0
(7.1) cm; P=0.018], but not heavier [37.4 (7.6) vs. 36.9
(8.6) kg; P=0.56] than boys. On the other hand, boys had
better results of handgrip strength testing [15.1 (4.1) vs.
12.7 (3.7) kg; P\0.0001] and standing long-jump results
[152.3 (17.7) vs. 136.7 (16.5) cm; P\0.0001] than girls.
We therefore performed all analyses separately for each
sex group.
Tables 1and 2demonstrate the basic results of anthro-
pometric and performance testing in different genotype
groups of boys and girls, respectively. Genotype–pheno-
type associations were shown only for boys. For our
genotype combination analysis, we used the genotypic data
of 2 (ACE ?ACTN3 or ACE ?PPARA or ACTN3 ?
PPARA) or all 3 genes (Table 3). Due to the small number
of individuals in the PPARA CC homozygous group, we
performed a combined GC ?CC versus GG analysis.
According to the hypothesis, the male carriers of DD-RR
(n=17), DD-GC/CC (n=12), RR-GC/CC (n=25) and
DD-RR-GC/CC (n=3) genotype combinations should
possess a greater genetic potential for strength and power-
oriented performance than carriers of the opposite combi-
nations [II-XX (n=9), II-GG (n=40), XX-GG (n=22)
and II-XX-GG (n=8), respectively].
Height
None of the genetic polymorphisms were separately asso-
ciated with the height of boys and girls. The mean height
J Physiol Sci
123

values in the group of boys that carry DD-RR-GC/CC
combination (associated with a greater hypertrophic
potential) were higher than in II-XX-GG combination
carriers [159.3 (8.4) vs. 140.6 (7.2) cm; P=0.0049]. The
similar association was found when the RR-GC/CC com-
binations carriers were compared with the XX-GG com-
bination carriers [148.4 (8.1) vs. 142.1 (6.1) cm;
P=0.0048].
Table 1 Physical and physiological characteristics and ACE,ACTN3 and PPARA genotypes of male subjects (n=219)
Trait ACE genotype ACTN3 genotype PPARA genotype
II ID DD RR RX XX GG GC CC
n(%) 53 (24.2) 120 (54.8) 46 (21.0) 79 (36.2) 108 (49.6) 31 (14.2) 153 (69.9) 59 (26.9) 7 (3.2)
Height (cm) 146.0 (7.1) 145.9 (6.7) 145.8 (7.8) 146.4 (7.2) 146.6 (7.0) 143.4 (6.4) 145.8 (6.4) 146.4 (8.6) 147.0 (6.3)
Weight (kg) 36.1 (6.9) 36.5 (7.4) 37.1 (8.8) 37.6 (8.4) 36.9 (8.0) 33.9 (6.3)
&
37.0 (7.9) 36.5 (8.0) 38.6 (11.1)
BMI (kg/m
2
) 16.8 (2.2) 17.1 (2.8) 17.3 (3.1) 17.4 (3.1) 17.3 (2.9) 16.4 (2.4) 17.3 (3.0) 16.9 (2.4) 17.6 (3.6)
Standing long-
jump (cm)
148.3 (16.3) 152.6 (19.6) 158.2 (19.1)* 152.6 (18.4) 151.8 (17.6) 153.9 (16.7) 152.9 (17.2) 151.2 (19.0) 147.9 (20.2)
Handgrip
strength (kg)
14.3 (3.6) 15.0 (3.6) 15.6 (4.8) 15.5 (4.3) 15.2 (4.2) 14.0 (3.5) 14.6 (4.0) 15.8 (4.3) 14.9 (4.8)
#
Values are means (SD)
*P=0.037 differences between male subjects with different ACE genotypes (II vs. ID vs. DD)
&
P=0.0215 differences between male subjects with different ACTN3 genotypes (RR/RX vs. XX)
#
P=0.048 differences between male subjects with different PPARA genotypes (GG vs. GC/CC)
Table 2 Physical and physiological characteristics and ACE,ACTN3 and PPARA genotypes of female subjects (n=238)
Trait ACE genotype ACTN3 genotype PPARA genotype
II ID DD RR RX XX GG GC CC
n(%) 50 (21.0) 121 (50.8) 67 (28.2) 84 (35.4) 113 (47.7) 40 (16.9) 180 (75.6) 53 (22.3) 5 (2.1)
Height (cm) 146.8 (6.3) 147.5 (6.8) 148.2 (6.8) 146.8 (6.0) 148.1 (7.3) 147.6 (6.4) 147.5 (6.8) 147.6 (6.5) 149.4 (4.2)
Weight (kg) 37.2 (7.4) 37.2 (7.7) 37.8 (7.8) 36.0 (5.6) 37.9 (8.2) 38.6 (9.2) 37.3 (7.8) 37.3 (7.5) 40.8 (3.6)
BMI (kg/m
2
) 17.2 (2.7) 17.0 (2.9) 17.1 (2.7) 16.6 (2.1) 17.2 (2.6) 17.7 (4.1) 17.1 (2.9) 17.0 (2.6) 18.2 (0.9)
Standing long-
jump (cm)
138.5 (17.4) 137.3 (16.6) 134.2 (15.4) 136.0 (17.2) 136.8 (15.5) 137.9 (17.8) 136.3 (16.1) 138.4 (17.6) 132.4 (15.3)
Handgrip
strength (kg)
13.0 (3.0) 12.8 (3.9) 12.3 (3.7) 12.2 (3.2) 12.9 (4.1) 13.1 (3.5) 12.7 (3.6) 12.9 (3.9) 10.8 (3.8)
Values are means (SD). No statistically significant differences in the measurements were found in girls with different genotypes
Table 3 Physical and physiological characteristics in male carriers of different genotype combinations
Trait ACE-ACTN3 genotype
combinations
ACE-PPARA genotype
combinations
ACTN3-PPARA genotype
combinations
ACE-ACTN3-PPARA
genotype combinations
DD-RR II-XX DD-GC/CC II-GG RR-GC/CC XX-GG DD-RR-GC/CC II-XX-GG
n(%) 17 (7.8) 9 (4.1) 12 (5.5) 40 (18.3) 25 (11.4) 22 (10.0) 3 (1.4) 8 (3.7)
Height (cm) 145.8 (9.4) 140.6 (7.2) 150.8 (11.4) 146.2 (6.5) 148.4 (8.1) 142.1 (6.1)** 159.3 (8.4) 140.6 (7.2)**
Weight (kg) 36.0 (9.5) 31.1 (4.5) 42.3 (12.2) 36.9 (6.5)* 38.6 (8.6) 32.8 (5.4)** 50.0 (10.1) 31.1 (4.5)**
BMI (kg/m
2
) 16.7 (2.9) 15.7 (1.7) 18.3 (3.9) 17.2 (2.1) 17.4 (2.6) 16.2 (2.3) 19.8 (4.8) 15.7 (1.7)*
Standing long-
jump (cm)
161.8 (17.0) 144.8 (15.6)* 154.4 (20.2) 150.4 (15.8) 151.4 (22.1) 154.1 (18.7) 154.8 (26.3) 142.9 (15.5)
Handgrip
strength (kg)
17.3 (5.7) 12.1 (1.7)* 17.3 (5.7) 12.1 (1.7)* 15.9 (4.3) 13.1 (2.7)* 22.0 (2.6) 12.1 (1.8)***
Values are means (SD)
*P\0.05, ** P\0.01, *** P\0.0001, statistically significant differences between male subjects with different genotype combinations
J Physiol Sci
123

Body weight
The ACTN3 R allele demonstrated an association with the
body weight value in boys [XX 33.9 (6.3) kg, RR/RX 37.5
(8.1) kg; P=0.0215]. Furthermore, the DD-RR-GC/CC
combination carriers had greater body weight values than
the carriers of the II-XX-GG combination [50.0 (10.1) vs.
31.1 (4.5) kg; P=0.0015]. In addition, an association was
established between the groups of carriers of the DD-GC/
CC and II-GG combinations [42.3 (12.2) vs. 36.9 (6.5) kg;
P=0.048], and also between the groups of carriers of
RR-GC/CC and XX-GG combinations [38.6 (8.6) vs. 32.8
(5.4) kg; P=0.009].
Body mass index
The average BMI was higher in carriers of the DD-RR-GC/
CC combinations (boys only) as compared with the II-XX-
GG combination carriers [19.8 (4.8) vs. 15.7 (1.7) kg/m
2
;
P=0.045].
Handgrip strength
The PPARA gene C allele demonstrated an association with
the results of handgrip strength testing in boys [GG 14.6
(4.0) kg, GC/CC 15.7 (4.3) kg; P=0.048]. Since body
weight of boys was positively correlated with their hand-
grip strength (r=0.48, P\0.0001), we also performed a
relative to body weight analysis. The association of the
PPARA gene C allele with higher results of handgrip
strength testing remained significant after adjustment for
body weight (P=0.037). In addition, any combination of
genotypes of similar (strength and power) effect associated
with the handgrip strength of boys: 17.3 (5.7) kg versus
12.1 (1.7) kg (P=0.016) in a comparison of DD-RR and
II-XX combinations; 17.3 (5.7) kg versus 12.1 (1.7) kg
(P=0.016) in a comparison of DD-GC/CC and II-GG
combinations; 15.9 (4.3) kg versus 13.1 (2.7) kg
(P=0.016) in a comparison of RR-GC/CC and XX-GG
combinations, and 22.0 (2.6) versus 12.1 (1.8) kg
(P\0.0001; after correction for multiple testing, this
finding remained significant) in comparison of DD-RR-
GC/CC and II-XX-GG combinations. The ACE-ACTN3-
PPARA genotype combination explained 61.7 % of the
variation in handgrip strength of boys.
Standing long-jump test
The ACE D allele demonstrated an association with the
standing long-jump results in boys [II 148.3 (16.3) cm, ID
152.6 (19.6) cm, DD 158.2 (19.1) cm; P=0.037]. The
ACTN3 R allele was associated with high results of
standing long-jump test only in combination with ACE
gene: 161.8 (17.0) cm versus 144.8 (15.6) cm (P=0.021)
in a comparison of DD-RR and II-XX combinations.
Discussion
Physical performance is a complex phenotype influenced
by multiple environmental and genetic factors. The ques-
tion is no longer whether or not there is a genetic com-
ponent to athletic potential, and endurance and strength
trainability, but exactly which genes are involved and by
which mechanisms and pathways they exert their effect.
Our current progress towards answering these questions
still represents only the first steps towards a complete
understanding of the genetic factors that influence human
physical performance.
It becomes evident that the level of physical perfor-
mance is inherited by a number of polymorphous genes,
and each of them, taken separately, modestly contributes to
the overall development of human performance-related
traits. This phenomenon may be one of the possible
explanations for the negative results of some studies that
failed to find the influence of individual genes on human
physical performance. Therefore, the influence of gene
polymorphisms on physical performance phenotypes
should be investigated separately as well as in combination.
Of note, it is necessary to consider the impact of combi-
nations of genotypes with homogeneous effects (i.e. those
genotypes associated with strength/power or endurance
performance).
Our data support the hypothesis that the components of
physical performance are inherited by a number of poly-
morphous genes, and each of them, taken separately,
modestly or insignificantly contributes to the overall
development of human performance-related traits. The
discovered associations concerned strength-related vari-
ables (handgrip strength as a measure of maximal isometric
muscle strength and standing long-jump as a measure of
explosive strength), being in agreement with the generally
observed data: the ACE D, ACTN3 R and PPARA C alleles
and their different combinations were associated with the
strength/power performance [4,7–11,15,17–22,24]. Our
findings confirm the polygenic nature of strength perfor-
mance, a classic complex trait, and demonstrate that the
likelihood of showing the best results in handgrip strength
and standing long-jump depends on the number of strength-
related alleles an individual possesses (additive genetic
effect). We also revealed an association between the
combination of the aforementioned alleles and higher
values of height, weight and BMI which is in accordance
with the data regarding the ACE genotype [29]. However, it
should be noted that, after correction for multiple testing,
only one finding remained statistically significant (that is,
J Physiol Sci
123

higher results of handgrip strength testing in the carriers of
DD-RR-GC/CC genotype combinations in comparison
with II-XX-GG).
As is evident from the presented data, the association
between gene polymorphisms and phenotyping data was
discovered only in boys. Sex-specific associations were
also reported in Greek adolescents, that is the ACE gene
I/D polymorphism was associated with handgrip strength
and vertical jump in females [28], and the ACTN3 gene
R577X polymorphism was associated with 40-m sprint
time in males [21].
The limitation of the study was that the tested children
were possibly at different stages of maturation (despite the
same chronological age) which could influence the results
of the association study. It is known that puberty begins at
the age of 11 in the majority of girls (and at the age of 13 in
boys) and causes drastic reconstitution of the organism.
Therefore, one might anticipate that the absence of geno-
type–phenotype associations in girls is related to the
ontogenetic heterogeneity of the cohort: some of the girls
had still not entered puberty, while in others it proceeded at
different stages. However, for ethical and practical reasons,
it was not possible to assess the stage of pubertal devel-
opment of our subjects. Further investigations are required
to clarify the role of genetic and environmental factors in
the development of anthropometric and performance traits
in girls. Another limitation of the study was the use of
handgrip strength testing as a measure of muscle strength.
The results of handgrip strength testing might be influenced
by various anatomical and biomechanical factors such as
different angle of shoulder, elbow, forearm, and wrist,
posture and grip span [30]. However, this type of testing
remains one of the most accessible methods of strength
estimation in mass screening.
In conclusion, the ACE,ACTN3 and PPARA gene
variants are associated with strength-related traits in
physically active middle school-age boys.
Acknowledgments This work was supported by grant from the
Federal Agency for Physical Culture and Sport of the Russian
Federation.
Conflict of interest The authors declare that they have no conflict
of interest.
References
1. Ahmetov II, Rogozkin VA (2009) Genes, athlete status and
training—an overview. Med Sport Sci 54:43–71
2. Bray MS, Hagberg JM, Pe
´russe L, Rankinen T, Roth SM,
Wolfarth B, Bouchard C (2009) The human gene map for per-
formance and health-related fitness phenotypes: the 2006–2007
update. Med Sci Sports Exer 41:35–73
3. Thomis MA, Beunen GP, Van Leemputte M, Maes HH, Blimkie
CJ, Claessens AL, Marchal G, Willems E, Vlietinck RF (1998)
Inheritance of static and dynamic arm strength and some of its
determinants. Acta Physiol Scand 163:59–71
4. Vincent B, De Bock K, Ramaekers M, Van den Eede E, Van
Leemputte M, Hespel P, Thomis MA (2007) ACTN3 (R577X)
genotype is associated with fiber type distribution. Physiol
Genomics 32:58–63
5. Hughes DC, Day SH, Ahmetov II, Williams AG (2011) Genetics
of muscle strength and power: polygenic profile similarity limits
skeletal muscle performance. J Sports Sci 29:1425–1434
6. Williams AG, Day SH, Folland JP, Gohlke P, Dhamrait S,
Montgomery HE (2005) Circulating angiotensin converting
enzyme activity is correlated with muscle strength. Med Sci
Sports Exer 37:944–948
7. Folland J, Leach B, Little T, Hawker K, Myerson S, Montgomery
H, Jones D (2000) Angiotensin-converting enzyme genotype
affects the response of human skeletal muscle to functional
overload. Exp Physiol 85:575–579
8. Giaccaglia V, Nicklas B, Kritchevsky S, Mychalecky J, Messier
S, Bleecker E, Pahor M (2008) Interaction between angiotensin
converting enzyme insertion/deletion genotype and exercise
training on knee extensor strength in older individuals. Int J
Sports Med 29:40–44
9. Pescatello LS, Kostek MA, Gordish-Dressman H, Thompson PD,
Seip RL, Price TB, Angelopoulos TJ, Clarkson PM, Gordon PM,
Moyna NM, Visich PS, Zoeller RF, Devaney JM, Hoffman EP
(2006) ACE ID genotype and the muscle strength and size
response to unilateral resistance training. Med Sci Sports Exer
38:1074–1081
10. Charbonneau DE, Hanson ED, Ludlow AT, Delmonico MJ,
Hurley BF, Roth SM (2008) ACE genotype and the muscle
hypertrophic and strength responses to strength training. Med Sci
Sports Exer 40:677–683
11. Hopkinson NS, Nickol AH, Payne J, Hawe E, Man WD, Moxham
J, Montgomery H, Polkey MI (2004) Angiotensin converting
enzyme genotype and strength in chronic obstructive pulmonary
disease. Am J Respir Crit Care Med 170:395–399
12. Wagner H, Thaller S, Dahse R, Sust M (2006) Biomechanical
muscle properties and angiotensin-converting enzyme gene
polymorphism: a model-based study. Eur J Appl Physiol 98:
507–515
13. Puthucheary Z, Skipworth JR, Rawal J, Loosemore M, Van
Someren K, Montgomery HE (2011) The ACE gene and human
performance: 12 years on. Sports Med 41:433–448
14. Yang N, Garton F, North K (2009) Apha-actinin-3 and perfor-
mance. Med Sport Sci 54:88–101
15. Alfred T, Ben-Shlomo Y, Cooper R, Hardy R, Cooper C, Deary
IJ, Gunnell D, Harris SE, Kumari M, Martin RM, Moran CN,
Pitsiladis YP, Ring SM, Sayer AA, Smith GD, Starr JM, Kuh D,
Day IN; the HALCyon study team (2011) ACTN3 genotype,
athletic status, and life course physical capability: meta-analysis
of the published literature and findings from nine studies. Hum
Mutat 32:1008–1018
16. Druzhevskaya AM, Ahmetov II, Astratenkova IV, Rogozkin VA
(2008) Association of the ACTN3 R577X polymorphism with
power athlete status in Russians. Eur J Appl Physiol 103:631–634
17. Ahmetov II, Druzhevskaya AM, Lyubaeva EV, Popov DV, Vi-
nogradova OL, Williams AG (2011) The dependence of preferred
competitive racing distance on muscle fibre type composition and
ACTN3 genotype in speed skaters. Exp Physiol 96(12):1302–
1310
18. Clarkson PM, Devaney JM, Gordish-Dressman H, Thompson PD,
Hubal MJ, Urso M, Price TB, Angelopoulos TJ, Gordon PM,
Moyna NM, Pescatello LS, Visich PS, Zoeller RF, Seip RL,
Hoffman EP (2005) ACTN3 genotype is associated with
J Physiol Sci
123

increases in muscle strength and response to resistance training in
women. J Appl Physiol 99:154–163
19. Delmonico MJ, Kostek MC, Doldo NA, Hand BD, Walsh S,
Conway JM, Carignan CR, Roth SM, Hurley BF (2007) Alpha-
actinin-3 (ACTN3) R577X polymorphism influences knee
extensor peak power response to strength training in older men
and women. J Gerontol A Biol Sci Med Sci 62:206–212
20. Delmonico MJ, Zmuda JM, Taylor BC, Cauley JA, Harris TB,
Manini TM, Schwartz A, Li R, Roth SM, Hurley BF, Bauer DC,
Ferrell RE, Newman AB, Health ABC and MrOS Research
Groups (2008) Association of the ACTN3 genotype and physical
functioning with age in older adults. J Gerontol A Biol Sci Med
Sci 63:1227–1234
21. Moran CN, Yang N, Bailey ME, Tsiokanos A, Jamurtas A,
MacArthur DG, North K, Pitsiladis YP, Wilson RH (2007)
Association analysis of the ACTN3 R577X polymorphism and
complex quantitative body composition and performance phe-
notypes in adolescent Greeks. Eur J Hum Genet 15:88–93
22. Walsh S, Liu D, Metter EJ, Ferrucci L, Roth SM (2008) ACTN3
genotype is associated with muscle phenotypes in women across
the adult age span. J Appl Physiol 105:1486–1491
23. Jamshidi Y, Montgomery HE, Hense HW, Myerson SG, Torra IP,
Staels B, World MJ, Doering A, Erdmann J, Hengstenberg C,
Humphries SE, Schunkert H, Flavell DM (2002) Peroxisome
proliferator-activated receptor a gene regulates left ventricular
growth in response to exercise and hypertension. Circulation
105:950–955
24. Ahmetov II, Mozhayskaya IA, Flavell DM, Astratenkova IV,
Komkova AI, Lyubaeva EV, Tarakin PP, Shenkman BS, Vdovina
AB, Netreba AI, Popov DV, Vinogradova OL, Montgomery HE,
Rogozkin VA (2006) PPARagene variation and physical per-
formance in Russian athletes. Eur J Appl Physiol 97:103–108
25. Maes HH, Beunen GP, Vlietinck RF, Neale MC, Thomis M,
Vanden Eynde B, Lysens R, Simons J, Derom C, Derom R (1996)
Inheritance of physical fitness in 10-year-old twins and their
parents. Med Sci Sports Exer 28:1479–1491
26. Peeters MW, Beunen GP, Maes HH, Loos RJ, Claessens AL,
Vlietinck R, Thomis MA (2007) Genetic and environmental
determination of tracking in subcutaneous fat distribution during
adolescence. Am J Clin Nutr 86:652–660
27. Silventoinen K, Magnusson PK, Tynelius P, Kaprio J, Rasmussen
F (2008) Heritability of body size and muscle strength in young
adulthood: a study of one million Swedish men. Genet Epidemiol
32:341–349
28. Moran CN, Vassilopoulos C, Tsiokanos A, Jamurtas AZ, Bailey
ME, Montgomery HE, Wilson RH, Pitsiladis YP (2006) The
associations of ACE polymorphisms with physical, physiological
and skill parameters in adolescents. Eur J Hum Genet 14:332–339
29. Moran CN, Vassilopoulos C, Tsiokanos A, Jamurtas AZ, Bailey
ME, Wilson RH, Pitsiladis YP (2005) Effects of interaction
between angiotensin I-converting enzyme polymorphisms and
lifestyle on adiposity in adolescent Greeks. Obes Res 13:1499–1504
30. Ruiz JR, Ortega FB, Gutie
´rrez A, Meusel D, Sjo
¨stro
¨m M, Castillo
MJ (2006) Health-related fitness assessment in childhood and
adolescence: a European approach based on the AVENA, EYHS
and HELENA studies. J Pub Health 14:269–277
31. Flavell DM, Jamshidi Y, Hawe E, Pineda Torra I, Taskinen MR,
Frick MH, Nieminen MS, Kesaniemi YA, Pasternack A, Staels B,
Miller G, Humphries SE, Talmud PJ, Syvanne M (2000) Varia-
tion in the PPARagene is associated with altered function in vitro
and plasma lipid concentrations in type II diabetic subjects.
Diabetologia 43:673–680
32. Mills M, Yang N, Weinberger R, Vander Woude DL, Beggs AH,
Easteal S, North K (2001) Differential expression of the actin-
binding proteins, alpha-actinin-2 and -3, in different species:
implications for the evolution of functional redundancy. Hum
Mol Genet 10:1335–1346
33. Rigat B, Hubert C, Corvol P, Soubrier F (1992) PCR detection of
the insertion/deletion polymorphism of the human angiotensin
converting enzyme gene (DCP1) (dipeptidyl carboxypeptidase 1).
Nucl Acids Res 20:1433
J Physiol Sci
123