ArticlePDF Available

Expression Patterns, Activities and Carbohydrate-Metabolizing Regulation of Sucrose Phosphate Synthase, Sucrose Synthase and Neutral Invertase in Pineapple Fruit during Development and Ripening

Authors:

Abstract

Differences in carbohydrate contents and metabolizing-enzyme activities were monitored in apical, medial, basal and core sections of pineapple (Ananas comosus cv. Comte de paris) during fruit development and ripening. Fructose and glucose of various sections in nearly equal amounts were the predominant sugars in the fruitlets, and had obvious differences until the fruit matured. The large rise of sucrose/hexose was accompanied by dramatic changes in sucrose phosphate synthase (SPS) and sucrose synthase (SuSy) activities. By contrast, neutral invertase (NI) activity may provide a mechanism to increase fruit sink strength by increasing hexose concentrations. Furthermore, two cDNAs of Ac-sps (accession no. GQ996582) and Ac-ni (accession no. GQ996581) were first isolated from pineapple fruits utilizing conserved amino-acid sequences. Homology alignment reveals that the amino acid sequences contain some conserved function domains. Transcription expression analysis of Ac-sps, Ac-susy and Ac-ni also indicated distinct patterns related to sugar accumulation and composition of pineapple fruits. It suggests that differential expressions of multiple gene families are necessary for sugar metabolism in various parts and developmental stages of pineapple fruit. A cycle of sucrose breakdown in the cytosol of sink tissues could be mediated through both Ac-SuSy and Ac-NI, and Ac-NI could be involved in regulating crucial steps by generating sugar signals to the cells in a temporally and spatially restricted fashion.
Int. J. Mol. Sci. 2012, 13, 9460-9477; doi:10.3390/ijms13089460
International Journal of
Molecular Sciences
ISSN 1422-0067
www.mdpi.com/journal/ijms
Article
Expression Patterns, Activities and Carbohydrate-Metabolizing
Regulation of Sucrose Phosphate Synthase, Sucrose Synthase
and Neutral Invertase in Pineapple Fruit during Development
and Ripening
Xiu-Mei Zhang
1,2,†
, Wei Wang
3,†
, Li-Qing Du
1
, Jiang-Hui Xie
1
, Yan-Li Yao
1
and
Guang-Ming Sun
1,
*
1
Key Laboratory of Tropical Fruit Biology, Ministry of Agriculture, South Subtropical Crop
Research Institute, Chinese Academy of Tropical Agricultural Science (CATAS), Zhanjiang
524091, Guangdong, China; E-Mails: asiazhang1975@163.com (X.-M.Z.);
duliqing927618@163.com (L.-Q.D.); xiejhww@163.com (J.-H.X.); yanliyao78@163.com (Y.-L.Y.)
2
Department of Food Science, Lousiana State University, Baton Rouge, LA 70803, USA
3
Laboratory of Plant Genetic & Breeding, Anhui Agricultural University School of Life Science,
130 Changjiang West Road, Hefei 230036, Anhui, China; E-Mail: wangweisys@163.com
These authors contributed equally to this work.
* Author to whom correspondence should be addressed; E-Mail: guangmingsun66@163.com;
Tel.: +86-759-2859205; Fax: +86-759-2858124.
Received: 12 June 2012; in revised form: 14 July 2012 / Accepted: 19 July 2012 /
Published: 26 July 2012
Abstract: Differences in carbohydrate contents and metabolizing-enzyme activities were
monitored in apical, medial, basal and core sections of pineapple (Ananas comosus cv.
Comte de paris) during fruit development and ripening. Fructose and glucose of various
sections in nearly equal amounts were the predominant sugars in the fruitlets, and had
obvious differences until the fruit matured. The large rise of sucrose/hexose was
accompanied by dramatic changes in sucrose phosphate synthase (SPS) and sucrose
synthase (SuSy) activities. By contrast, neutral invertase (NI) activity may provide a
mechanism to increase fruit sink strength by increasing hexose concentrations.
Furthermore, two cDNAs of Ac-sps (accession no. GQ996582) and Ac-ni (accession no.
GQ996581) were first isolated from pineapple fruits utilizing conserved amino-acid
sequences. Homology alignment reveals that the amino acid sequences contain some
conserved function domains. Transcription expression analysis of Ac-sps, Ac-susy and
OPEN ACCESS
Int. J. Mol. Sci. 2012, 13 9461
Ac-ni also indicated distinct patterns related to sugar accumulation and composition of
pineapple fruits. It suggests that differential expressions of multiple gene families are
necessary for sugar metabolism in various parts and developmental stages of pineapple
fruit. A cycle of sucrose breakdown in the cytosol of sink tissues could be mediated
through both Ac-SuSy and Ac-NI, and Ac-NI could be involved in regulating crucial steps
by generating sugar signals to the cells in a temporally and spatially restricted fashion.
Keywords: Ananas comosusr; carbohydrate metabolism; enzyme activties; gene cloning;
transcript expression
1. Introduction
Fruit taste and quality in pineapple (Ananas comosusr) mainly depend upon such factors as sugars,
organic acids, rmness, amino acids and aromatic compounds. Sucrose and its components, glucose
and fructose synthesized in source tissues are one of the most important sugars, which are transported
into sink tissues such as fruit, shoots and other tissues [1]. Sucrose serves an integral role as a source of
carbon and energy for non-photosynthetic tissues, which is central to plant metabolism and the most
dominant metabolite involved in fruit growth and development [2]. Until now, attempts to elucidate
the changes in metabolism that lead to accumulation of sucrose had focused on sucrose-metabolizing
enzymes like sucrose phosphate synthase (SPS, EC 2.1.4.14), sucrose synthase (SuSy, EC 2.4.1.13)
and neutral invertase (NI, EC 3.2.1.26) [3,4].
With the full-length or fragment SPS cDNAs isolated from fewer than 20 plant species from
GenBank database, some functional characteristics of SPS were studied both developmentally and in
response to specific stimuli [5–7]. SPS had also been shown to be regulated posttranslationally by
protein phosphorylation, binding to 14-3-3 proteins, and allosteric regulation [4]. Although there is a
direct correlation between sucrose accumulation and SPS enzymatic activity, the mechanism of its
regulation is unknown during fruit ripening [7].
Some researchers had reported that SuSy activity was correlated with the direction of reversible
sucrose cleavage in plant sink tissues supplied with ample sucrose and with high demand from carbon
biosynthetic and respiratory pathways, cellulose and callose synthesis and sink strength [8]. It plays a
key role in sucrose breakdown for the generation of uridie diphosphate glucose (UDPG) and possible
preservation of energy via uridine diphosphate (UDP) activation of the hexose moiety [9]. In many
species, SuSy had also been identified repeatedly as playing a central role in modulating sink strength
of plants [10].
To keep the balance of sucrose-sink during fruit growth and development, invertases catalyse the
irreversible hydrolysis of sucrose to glucose and fructose. In plant cells, there are three invertase
isoforms each having different biochemical properties and subcellular localisation. Soluble neutral
invertase (NI) and acid invertase (AI) are located in the cytosol and vacuole, respectively, and
insoluble extracellular invertase is bound to the cell wall. By contrast, the physiological roles of plant
NIs have largely remained elusive until recently, and only limited and fragmentary information is
available, mainly because of low enzyme activity and gene expression levels [11].
Int. J. Mol. Sci. 2012, 13 9462
In our previous study, a Ac-SPS gene coding pineapple SPS protein was isolated and might play a
key role in sucrose accumulation during the fruit development [7]. Although the importance of sucrose
metabolism in plant development through the generation of sugar signals had been reviewed [8],
analysis of function and expression of three enzymes had been limited, especially in sucrose- or
hexose-storing fruits such as pineapple. In this study, differences in carbohydrate contents and
activities of the related enzymes were monitored to evaluate changes in sugar metabolism of different
pineapple parts throughout fruit development. Moreover, three cDNAs coding Ac-susy, Ac-ni and
Ac-sps were isolated from the mRNA of pineapple fruit. A comparison of their molecular structures
and phylogenic origin was presented here, and the relationship between sugar accumulation and gene
differential expressions was also investigated in apical, medial, basal and core sections of pineapple fruits.
2. Results and Discussion
2.1. Soluble sugar Contents
Though fruit flavor is related to both taste (e.g., sugar and acid content) and aroma components, the
main component dictating pineapple fruit eating quality is influenced by total sugar content as well as
composition [12]. In this study, three major sugar (fructose, sucrose and glucose) contents of pineapple
fruits were determined throughout development stages.
In the early stages of fruit growth, hexose (fructose and glucose) was the predominant sugar in
nearly equal amounts except for medial section, accounting for ca. 80% of total soluble sugars
(Figure 1a,b). A parallel gradual accumulation of glucose and fructose contents was detected in the
apical and basal sections from 50 DAA to 70 DAA with the exception of core section, and then
decreased in mature fruits. In medial sections, the fructose and glucose of medial sections also
increased dramatically from 50 to 70 DAA and reached the highest levels at 70 DAA
(23.86247 mg·g
1
FW) and 60 DAA (36.37503 mg·g
1
FW), respectively. Diametrically, the dynamic
activities of two sugars are slightly decreased during fruit growth and maturation in core sections,
which may be related to metabolizing-enzyme activities [13–15].
As reported by many researchers, sucrose is the chief contributor to sweetness, and is transported
through sieve elements and can enter into sink organs directly by the plasmodesmata or the apoplastic
space [15–16]. In our study, gradual increases of sucrose contents were detected starting from 20 DAA
up to the end of fruit growth regardless of fruit sections, and reached 7 fold of initial content in basal
section (Figure 1c,d). This may explain why sweet has a certain difference in the various portions
and periods.
However, the variation tendency of sucrose was moderate in different parts of fruit between 50 and
60 DAA, accordingly, hexose (fructose and glucose) contents were sharply increased (Figure 1a,b). It
indicated that the conversion of sucrose to hexoses was indispensable and may have other benefits. For
example, hexose accumulation may function to increase the osmotic potential of the tissues and allow
improved nutrient uptake [17]. Hexoses also play a role in regulating gene expression and therefore,
accumulation in the vacuole would permit hexose storage without adverse effects on gene expression
since the hexoses would be effectively excluded from the cytosol [17].
Int. J. Mol. Sci. 2012, 13 9463
Figure 1. (a) Changes of fructose; (b) glucose; (c) sucrose contents; (d) sucrose/hexose
ratio in the different fruit sections during various development stages. Each point is the
mean of three determinations, and vertical bars are representative of ± S.E. (n = 3).
2.2. Isolation of Ac-Sps, Ac-Ni and Ac-Susy Genes and Sequence Analysis
2.2.1. Multiple Alignments of Three Genes
The present study firstly isolated two cDNAs of Ac-sps and Ac-ni from pineapple fruits utilizing
two pairs of degenerate primers according to the conserved domain of SPS and NI amino acid
sequences from other plant species. Two 1131 bp and 1036 bp cDNA fragments were amplified by
RT-PCR, and named Ac-sps (GenBank ID: GQ996582) and Ac-ni (GenBank ID: GQ996581),
respectively. By alignment, the deduced SPS and NI polypeptides present high-level identities with
corresponding regions of glucosyltransferases and neutral invertase from other plants (data not shown).
In SPS amino acid sequences, the alignment analysis showed that Ac-SPS shared with
amino acid identities of 85%, 84%, 82% and 81% to rice (Oryza sativa, AAQ56529) and
Int. J. Mol. Sci. 2012, 13 9464
green bamboo (Bambusa oldhamii, AAR16190), broomcorn (Sorghum bicolor, XP_002441522),
wheat (Triticum aestivum, AAQ15106) and kiwifruit (Actinidia deliciosa, AAC39434), respectively.
In addition, the encoded NI polypeptide shared 94% identity with rice (O. sativa, EAY86114),
93% identity with broomcorn (S. bicolor, XP002452195) and grape (Vitis vinifera, XP002264960),
88% identity with Arabidopsis (Arabidopsis thaliana, NP197643), respectively. Interestingly, the
amino acid homology of NI is more significant in the carboxyl terminal domain than in the amino
terminal due to the fact that the catalytic domain is concentrated in the carboxyl terminal region within
about 200 residues [11].
As expected, Ac-SuSy reported (GenBank ID: DQ438976) also showed a high degree of similarity
to those of sucrose synthases from other species, and was thus classified among the large group of
dicot susy genes (data not shown). The carboxyl terminal domain was more conserved than that of
amino terminal. By contrast, the deduced amino acid has 87% homolog with rice (O. sativa, ABF95854)
and maize (Zea mays, ACF78506), 86% homolog with broomcorn (S. bicolor, XP002465303) and
84% homology with soybean (Glycine max, XP003521575).
2.2.2. Domain Characteristics and Phylogenetic Analysis of Ac-SPS
By alignment of the SPS amino acid sequences, some functional domains are highly conserved,
which are mostly located in the N-terminal half of the protein including the glucosyltransferase and
SPP-like domains (Figure 2a). The Fru6P binding region (I) is identical in all sequences with the
exception of an isoleucine substitution for valine in SPS2 of Nicotiana tabacum, The regulatory
phosphoserine (SPS-229) involved in 14-3-3 protein and UDPG binding sites have not been conserved (II),
but the suggested recognition elements for the protein kinase are also nearly identical in all sequences.
SPS is modulated by multisite protein phosphorylation in response to light, osmotic stress
(SolSer-424), nitrogen supply, and temperature and also binds 14-3-3 proteins (SolSer-229) [18].
A phylogenetic analysis of plant sps genes had been reported previously within the broader A, B,
and C families, according to the classification of Langenkämper et al. (2002) [19]. Although only one
member (AtSPS4) of the C family was represented in the full-length sequences, A and B-families had
obvious internal splits between the dicot and the monocot in our study. Up to now, none of the known
monocot SPS genes belongs to the C family because of the relative scarcity of SPS sequences from
monocots. Family A has 16 members with well-supported internal splits between the 11
dicotyledonous sequences (subfamily a1) and the six monocotyledonous sequences (subfamily a2).
B family has four members containing two monocotyledons and two dicotyledons, respectively.
Though the Ac-SPS from A. comosus is seemed to be allied with the A family, it is somewhat more
divergent than the rest (Figure 2b). It seemed clear that these three gene families must have arisen
before the separation of the monocots and dicots, which was thought to have occurred about
200 million years ago [20]. Furthermore, Lunn (2002) also found that the conservation of the
exon-intron splice sites within the A, B and C family genes in Arabidopsis, rice and maize were
consistent with all three families having a common origin [21].
Int. J. Mol. Sci. 2012, 13 9465
Figure 2. (a) Conserved regions and phylogenetic analysis of sucrose phosphate synthase
(SPS) protein sequences. (I) some considered function domains were uncovered as the
putative Fru6P binding site; (II) the 14-3-3 regulated phosphoserine and uridie diphosphate
glucose (UDPG) binding domain; (III) the osmotically regulated phosphoserine; (IV, V)
various aspartate-proline pairs determined in either spinach or maize or both [19]. Each
active site of the various motifs was highlighted in capital letters under the alignment.
Numbering of amino acids is according to S. oleracea; (b) the amino acid sequences of the
ORFs were initially aligned and tree was calculated by Neighbor-Joing algorithms and
rooted with Synechocystis. The GenBank accession numbers and name of the sequences
were showed.
Int. J. Mol. Sci. 2012, 13 9466
2.2.3. Domain Characteristics and Phylogenetic Analysis of Ac-NI
The eight conserved regions of the seven NIs identified from different plants were shown including
the A. comosus in our study (Figure 3a). Two residues (Asp
256
and Asp
310
) attributed to the enzyme
active sites were proposed in І and II conserved regions of NI amino acids. Interestingly, this VII
peptide domain was lack of Val
454
and changed Ser
455
with Thr in the conserved peptide sequence.
However, whether the presence of high conserved domains plays a key role in regulating the sugar
metabolism needs to await further analysis.
Thirteen full protein sequences of NI family from 12 organisms were identified from Genbank.
Analysis of the evolution revealed that the NIs of higher plants were classified into the three clades by
comparing the conserved function domains (Figure 3b). The Ac-NI belongs to the clade from
monocots, and is conserved among them sharing about 68%–93% identity between each other. The
other two clades (II, III) are composed of dicots from A. thaliana, Beta vulgaris and V. vinifera, etc.
Ac-NI protein is predicted to be localized in mitochondria, because all proteins from the common
organelles are located in the same cluster divided into two subclusters, plastid- and mitochondria-localized
types [22]. Vargas et al. (2003) suggested that NI homologues were restricted to cyanobacterial species
and plants, and higher plant NIs might have originated from an orthologous ancestral gene after the
endosymbiotic origin of chloroplasts [23]. Though this hypothesis could well explain the presence of
plastid-localized form of neutral invertase, it was difficult to imagine that mitochondrial form in higher
plants occurred from plastid-form by exchanging of targeting sequences to plastids and mitochondria.
2.2.4. Phylogenetic Tree Analysis of Ac-SuSy
In order to explore a comprehensive analysis of evolutionary relationships among SuSy gene
families between pineapple and other plant species, including the twelve isoforms of rice and
Arabidopsis SuSy, a total of 31 plant and one bacteria SuSy amino acid sequences, representing 18
species, were aligned (Figure 4). The phylogenetic tree analysis revealed both relatively deep
evolutionary root and the existence of more recent duplications for the SuSy genes. Using one SuSy
from bacteria as the outgroup, the plant SuSy genes could be subdivided into three clearly distinct
groups, including genes from angiosperms and gymnosperms. These groups were designated class I,
class II and class III, respectively. For pineapple SuSy, it was fallen into this monocot-specific group II,
and clusters together with other monocot genes by forming an independent clade to the exclusion of
dicots genes. As shown in Figure 4, SuSys from dicot and monocotyledonous plants were found in all
the three groups, especially, SuSy proteins in class I can be well classified into two distinct subclades.
In addition, six rice SuSys, six Arabidopsis SuSys and four pea SuSys were also distributed in the
dicot branch of classes I, II, and III (Figure 3). Those results suggested that SuSy evolutionary
divergence originated before the common ancestor of dicots and monocots, and most second
duplication events occurred before the monocot/dicot divergence.
Int. J. Mol. Sci. 2012, 13 9467
Figure 3. Conserved regions and phylogenetic analysis of, neutral invertase (NI) protein
sequences. (a) Large regions of homology are indicated in boxes І-VIII. Putative catalytic
sites (Asp
256
and Asp
310
) are highlighted in І and II conserved regions, respectively. The
numbers above the alignment represent the neutral invertases sequence of L. temulentum;
(b) Phylogenetic dendrogram was generated by the multi-alignment using Molecular
Evolutionary Genetics Analysis (MEGA) 4.0 based on identity and rooted with Cyanothece.
Sequences are designated by accession numbers and name of organisms from GenBank
database.
Int. J. Mol. Sci. 2012, 13 9468
Figure 4. Phylogenetic dendrogram of the deduced amino acid sequences of pineapple
SuSy gene constructed using the Neighbor-Joining method with MEGA software 4.0.
Sequences were designated by accession numbers and name of organisms from
GenBank database.
2.3. Transcript Expression Analysis of Ac-sps, Ac-susy and Ac-ni genes
In order to evaluate the importance of carbohydrate-metabolizing enzymes throughout pineapple
fruit development, the spatial and temporal expression patterns revealed that three genes were
differentially expressed in immature and mature fruits. 18S rRNA expression levels were chosen as
standards for constitutive expression and gave closely similar results. Expression levels of Ac-sps
mRNA revealed some differences in all developmental stages and different parts of pineapple fruits.
Recent evidence suggested that SPS may play a more important role in sucrose synthesis and
accumulation [7,15,17,19], as supported by the transcript characteristics of Ac-sps in sucrose
accumulation (Figure 5a). In contrast to mRNA levels during the initial phase of anthesis, Ac-sps
transcript levels of fruit different sections were nearly devoid in 20 DAA except for medial parts,
which was associated with low levels of sucrose in immature fruit sections, as also observed by
Botha & Black (2000) [24]. They gradually reached two peaks of accumulation with maxima at 30 and
70 DAA in basal and medial sections, respectively, and then were down-regulated up to 80 DAA.
However, a transcript peak of 30 DAA was lost in apical and core sections. This reason may be caused
by the differences of organic acid and secondary metabolites in various fruit sections [17].
Experiments with banana had consistently demonstrated SPS activity increase with accumulation of
sucrose in agreement with our results [25]. Strand et al. also provided the evidence that decreased
Int. J. Mol. Sci. 2012, 13 9469
expression of sps can inhibit sucrose synthesis in transgenic A. thaliana [26]. Though a remarkable rise
is showed along with fruit maturation, there is a significant difference between the core and apical
sections and the basal and medial sections (p < 0.05, n = 3) throughout the ripening process of
pineapple fruits. Zhang et al. (2010) also found that different harvest seasons had serious influence on
the activities of carbohydrate-metabolizing enzymes and sugar component in the different stages of
fruit development [15].
The other most significant contributions of our study are that not only SPS but also SuSy and NI
activities are positively correlated with sugar accumulation. Though SPS activity had also been
implicated in sugar metabolism, the roles of other two enzymes had been less clear [11]. In our
experiments, Ac-susy transcription levels were gradually up-regulated, and exhibited obvious profiles
in the different sections with fruit development (Figure 5b). Thereafter, Ac-susy transcripts in four
different sections showed a marked decrease to basal levels after 70 DAA until harvest. In medial and
basal sections, there are more obvious than the other parts in Ac-susy transcript levels. However, some
studies had attributed sucrose breakdown roles to these two latter enzymes [16], but our study clearly
indicated that activities of SuSy were increased with sucrose accumulation in different sections of
pineapple fruits, rather than the opposite, similar with results detected in watermelon [3] as well as
other fruit [27]. These results indicated Ac-susy transcript was bound up with sucrose increase.
Ciereszko et al. also demonstrated that the sucrose/glucose-dependent SuSy expression was strongly
induced in transgenic Arabidopsis hexokinase-overexpressing plants [28]. Although details of this
regulation are unclear, SuSy activity and expression of the corresponding gene(s) were more or less
related with hexokinase.
Due to low enzyme activity and gene transcription levels, NI was scarcely studied [11].
Nevertheless, higher levels of the Ac-ni transcripts were detected between 30 DAA and 50 DAA with a
transient increase of hexose contents in our study (Figure 5c). On the other hand, though the abundance
of Ac-ni mRNA also increased and had a single peak around 40 DAA regardless of different sections
in the early development of the fruits, Ac-ni expression levels decrease come up more early than that of
Ac-susy and Ac-sps. From 40 to 80 DAA, Ac-ni transcription was down-regulated to a negligible level,
especially in the core and basal sections. These data together suggest the putative role of hexose in
regulating Ac-ni transcription through a negative feedback control had been evaluated. This hypothesis
may be further supported by the Ac-ni transcript levels of different fruit sections, because hexose
accumulation of the basal section analogous to Ac-ni transcript levels precedes the other parts.
Nonis et al. (2007) also reported Ac-ni transcription levels can be improved using the hexokinase
inhibitor NAG [29]. While previous studies on NI revealed small changes in gene expression among
different tissues and during organ development [22], the pineapple NI studied in this article displayed a
highly modulated pattern of expression in response to developmental clues. The major function of the
high and constant transcription activity of Ac-ni in immature pineapple fruit is to maintain the cellular
hexose concentrations. A decreased invertase activity would lead to increases in sucrose/hexose
ratios [30,31]. This emphasizes not only the continuous hydrolysis of sucrose catalysed by invertase,
but also the possibility of continuous sugar exchange between cytosol and vacuole (sucrose influx and
hexose efflux).
Int. J. Mol. Sci. 2012, 13 9470
Figure 5. Transcript expression analysis of (a) Ac-sps; (b) Ac-susy; (c) Ac-ni genes during
fruit development using quantitative PCR.
2.4. Detection of Ac-SPS, Ac-SuSy and Ac-NI Activities
As expected, analogous results had been obtained in a comparison of enzyme activities and gene
transcript levels. Those clearly indicated that sucrose accumulation occurs only in the presence of
threshold activities of the three enzymes directly involved in sucrose metabolism. However, the
dynamic patterns of three enzyme activities and transcripts during fruit development could not
compare directly with each other, because multiple gene families could be differentially expressed in
various parts and developmental stages of plants [18]. SPS, SuSy and NI had been reported in different
flowering plants and database searches supported the existence of many isoforms of these
enzymes [10,19,30]. The enzyme activity is synthetically performed by translations of many isozymes,
but the mRNA transcript is one of the isozymes. Moreover, the protein contents of enzyme increased,
and the increase of transcripts may push up the activity of enzymes.
In some fruits, sucrose is translocated from the source to the fruit and is either apoplastically
hydrolysed to fructose and glucose by invertase, or is cleaved symplastically to fructose and
UDP-glucose by sucrose synthase [31]. In the present work, the Ac-NI activities were very low in
basal and core sections at 20 DAA, but rapidly increased and reached maxima (14-fold and 10-fold,
respectively) at 40 DAA. A pronounced increase was also detected in apical and medial activities from
30 to 40 DAA (Figure 6a). Thereafter, activities of various sections showed similar patterns with a
slight peak at 70 DAA, followed by a gradual decrease towards becoming undetectable at 80 DAA. A
positive correlation between sugar accumulation (Figure 1) and levels of SuSy and SPS activities
(Figure 6b,c) were indicated in fruit different sections during development, which is paralleled with the
transcript characteristics of two genes. These results suggest that sucrose synthase can only cleave the
Int. J. Mol. Sci. 2012, 13 9471
sucrose translocated to fruit tissue at a mature stage, and that NI activity is closely related to the
accumulation of fructose and glucose in immature pineapple fruit. This is consistent with the
suggestion that the two steps of sucrose degradation by SuSy and NI and the re-synthesis by SPS in
fruit could generate a locally increased sucrose concentration gradient in the zone of phloem
unloading, thus favoring sucrose import [17]. The potential capacity for re-synthesis of sucrose by the
action of SPS in fruit is also supported with the presence of SPS activity and transcript of Ac-sps,
which increase until the mature stage in fruit different sections (Figure 6c). A series of actions by SuSy
and SPS during maturation could be important to sink strength in citrus fruit at this stage [5]. Thus, NI
may have a role in supplying materials for growth and cell wall construction, whereas SuSy may
supply SPS with substrates (UDP-glucose and fructose) for the re-synthesis of sucrose [9]. Substantial
progress has been also made in studies on SuSy synthesizing UDPG which is essential for sucrose and
cell wall biosynthesis [32]. Since pineapple fruits have a high capacity to cleave sucrose to glucose and
fructose in immature stages (Figure 1), it seems likely that it is glucose rather than sucrose that serves
as a signal in upregulating Ac-susy expression. Though the physiological role of NI and SuSy in
sucrose metabolism is not completely clear in fruit development, the positive correlation with sucrose
accumulation in our study suggests the need to rethink this step of sucrose metabolism in the context of
sink sugar accumulation.
Figure 6. Activity profiles of (a) NI; (b) SuSy; (c) SPS in crude protein extracts of
different fruit sections during pineapple development. Activities were expressed as μmol
product synthesized g
1
h
1
FW. Each point is the mean of three determinations, and
vertical bars are representative of ± S.E. (n = 3).
Int. J. Mol. Sci. 2012, 13 9472
Figure 6. Cont.
3. Experimental Section
3.1. Plant Materials
Field-grown pineapples (A. comosus cv. Comte de paris) were cultivated in the pineapple resource
bank of South Subtropical Crops Research Institute. The experimental design used in this study was
under the same management conditions such as irrigation, fertilization, soil management, disease
control and pruning. Ninety fruit samples had been selected after the full florescence period from April
to June in 2007. The fruits were randomly sampled every 10 days from the 20th day after anthesis
(DAA) and cut transversely into apical, medial, basal and core sections, after the size and weight of
crowns and fruits were measured. And then, the tissues were immediately frozen in liquid nitrogen and
stored at 80 °C before being analyzed. These sliced fleshes of 30 fruits were pooled together as one
of three replications at each harvesting time.
3.2. Plant Materials Determination of Sugar Content and Composition
For glucose, fructose and sucrose content, the sugars were extracted by grinding flesh tissues (10 g)
in 80% ethanol, adjusted to pH 7.0 with 0.1 M NaOH, and heated for 5 min at 80 °C. The extract
corresponding to 0.5 g fresh weight (FW) was dried in vacuum, redissolved in water and the solution
was passed through an ion-exchange column (Dowex 50W-X8 and Dowex 1-X8). The eluate (10 μL)
was then analyzed by high-performance liquid chromatography (HPLC) [13] (Shimadzu LC-6A;
Kyoto, Japan) equipped with a RI detector and a SP1010 column (Showa Denko K. K., Tokyo, Japan)
at a flow rate of 0.5 mL·min
1
.
Int. J. Mol. Sci. 2012, 13 9473
3.3. Cloning and Expression Analysis of Ac-sps, Ac-susy and Ac-ni
3.3.1. Isolation of Total RNA and Sequence Amplification
Total RNA was extracted with Trizol Reagent (Invitrogen, Carlsbed, CA, USA) from different parts
of pineapple fruits. The purity and integrity of total RNA were verified with a spectrophotometer at
230 nm, 260 nm and 280 nm (NanoDrop, Technologies Inc.) and 1.2% denaturing agarose gels
(Qiagen, RNeasy Mini Handbook). For cloning of the genes related to sugar-metabolizing, SMAR™
PCR cDNA Synthesis Kit (BD Biosciences Clontech, United States) was used for the synthesis of
cDNA starting from 0.5–1 μg of poly (A)
+
RNA according to the instructions of the manufacturer.
Based on conserved amino acids from the available Genbank (http://www.ncbi.nlm.nih.gov/), two
sets of degenerate primers and a pair of specific primers were designed for cloning Ac-sps, Ac-ni and
Ac-susy genes, respectively (Table 1). PCR was carried out in a 25 μL reaction mixture containing
2.5 μL of reaction mixture 10× PCR Buffer II (Takara, Japan), 1.25 mM MgCl
2
, 4 mM dNTP/analog
Mixture, 1 U ExTaq, 2 μL cDNA, 0.8 μM forward and reverse primers. The reaction mixture was
overlaid with a drop of mineral oil and was allowed to run for 30 cycles (95 °C for 30 s, 52 °C, 54 °C
and 55 °C for 30 s, 72 °C for 1.5 min for Ac-sps, Ac-ni, Ac-susy, respectively). PCR products were
visualized on a 1.2 % agarose gel (w/v) including ethidium bromide (1 μg·mL
1
), and then cloned into
the pGEM-T Easy Vector System І (Promega, Madison, WI, USA) with T4 DNA ligase (Takara,
Japan) according to the manufacturer’s instructions. Electro-transformation was used for Escherichia coli
(JM109) with the Gene Pulsersystem (Bio-Rad Laboratories Inc., Hercules, CA, USA) at 1500 V.
Table 1. Primer sets used for PCR amplification and expression analysis.
Primer name Forward and reverse primes (5'-3') Tm (°C)
Ac-sps degenerate primers
GGA(G/A)CTTGG(T/A/G/C)CG(T/G)GATTCTGATA
52
CAGGAAC(A/T/C)TC(A/T)GA(C/T)TG(C/T)TTGTG
Ac-sps specific primers
GCTACGGCGAGCCAACCGAGAT
60
GTGGCCAAGAGCGCCGTCAAC
Ac-susy specific primers
1
GGATGACCGGTCTAAGCCCATCAT
60
CCATTTCACGCAGTTTGGCGCAT
Ac-ni degenerate primers
CAG(T/C)T(T/G/A)CAGAG(C/T)TGGGAGA
55
GTGTC(A/G)TA(A/C)TA(T/C)TCAGGCCA
Ac-ni specific primers
GCTCTGGGGATTTGTCAGTTCAG
60
CGATCAATCATGCACGAGCCGT
18S rRNA specific primers
2
GCCGGCGACGCATCATTCAA
60
CGCGCCTGCTGCCTTCCTTG
1
Oligonucleotides designed based on the Ac-susy sequence from pineapple fruit (GenBank ID: DQ438976);
2
Oligonucleotides designed based on the 18S rRNA sequence from pineapple (GenBank ID: D29786).
3.3.2. Sequence Comparisons
All similarity searches were executed using blastn or blastx algorithms [33]. Multiple alignment and
phylogenetic analysis were carried out using the Clustal W [34] and viewed by the Megalign (DNAstar
Int. J. Mol. Sci. 2012, 13 9474
Inc.). A phylogenetic tree was constructed by the Neighbor-Joining (NJ) method using the NJ algorithm
implemented in the Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0.
3.3.3. Real-Time PCR Analysis of Gene Expressions
Quantitative PCR was performed by using the first strand cDNA as templates on a Lightcycler
(Roche Diagnostics), with the Light Cycler Fast Start Reaction Mix MasterPLUS SYBR Green
according to the manufacturer’s recommendations. Cycling conditions were as follow: 95 °C for
5 min, 40 cycles at 95 °C for 10 s, 60 °C for 10 s, and 72 °C for 30 s. All amplifications were
normalized with an 18S rRNA gene to confirm equal amounts of RNA template. PCR parameters were
analogous to above descriptions using specific primers (Table 1). The data shown represent means of
values obtained from three independent biological replicates.
3.4. The Extraction and Activity Analysis of NI, SPS and SuSy
Sugar-metabolizing enzymes were prepared essentially in frozen flesh tissue as described by
Zhang et al. [15]. Fruit material was homogenised in 10 mL of ice-cold buffer containing 50 mmol·L
1
Hepes-NaOH (pH 7.5), 0.5 mmol·L
1
Na-ethylenediaminetetraacetic acid (EDTA), 2.5 mmol·L
1
DTT,
3 mmol·L
1
diethyldithiocarbamic acid, 0.5% (w/v) bovine serum albumin (BSA) and 1% (w/v)
insoluble polyvinylpyrrolidone (PVP). After centrifugation at 12,000 g for 20 min at 4 °C,
supernatants were dialyzed for approximately 20 h against 25 mmol·L
1
Hepes-NaOH (pH 7.5) and
0.25 mmol·L
1
Na-EDTA and used as the crude soluble enzyme extract. The insoluble pellet was
washed twice in homogenising medium and then incubated with shaking for 4 h in ice-cold
homogenising medium containing 1 mol·L
1
NaCl.
NI activities were assayed in a final volume of 25 mL, containing 0.2 mL of dialyzed enzymatic
extraction, 0.8 mL of reaction solution (pH 4.8 or 7.2, 0.1 mol·L
1
Na
2
HPO
4
, 0.1 mol·L
1
sodium
citrate, 0.1 mol·L
1
sucrose for neutral invertase). The activities were measured by the quantity of
reducing sugars released in the assay media with dinitrosalicylic acid [14].
Activities of SPS were assayed of using 0.15 mL of reaction medium and 0.2 mL of enzyme
sample. The reaction medium is composed of 50 mmol·L
1
Mops-NaOH (pH 7.5), 10 mM MgCl
2
,
5 mmol·L
1
glucose-6-phosphate, 10 mmol·L
1
fructose-6-phosphate and 5 mmol·L
1
UDPG. After the
mixture was incubated for 30 min at 37 °C, the reaction was stopped by adding 0.1 mL 30% (w/v)
NaOH and kept in boiling water for 5 min. When cooled to room temperature, the resorcinol solution
(12%, v/v) of 0.5 mL and HCl (12 mol·L
1
) of 0.5 mL were added into the mixture and held in an
80 °C water bath for 10 min. Blank controls were obtained by adding the sterile water to the reaction
medium containing resorcinol. The procedure for the SuSy assay was identical to that of SPS except
for the reaction mixture, where fructose 6-phosphate or glucose 6-phosphate was replaced by
contained 10 mmol·L
1
fructose.
Int. J. Mol. Sci. 2012, 13 9475
3.5. Statistical Analysis
DPSv3.01 for the variance analysis and the correlation analysis by SAS 9.0 according to different
requirements was done. Quantitative analyses were presented as mean values and the reproducibility of
the results was expressed as standard error (S.E.).
4. Conclusions
In summary, Ac-SPS and Ac-SuSy activities are differentially responsive to sugar dynamic
characteristics and show contrasting expression patterns consistent with different functional roles. The
phenomena are expected to shed further light on the important horticultural phenomenon of sugar
accumulation that determines fruit quality. A cycle of sucrose breakdown in the cytosol of sink tissues
could be mediated to keep the balance of sugars through both Ac-SuSy and Ac-NI. In addition, we also
conclude that Ac-NI could be involved in regulating crucial steps of plant development or at least play
a supportive role to other sugar metabolism enzymes by providing substrates to the cells and by
generating sugar signals in a temporally and spatially restricted fashion.
Conflict of Interest
The authors declare no conflict of interest.
Acknowledgments
Financial support was provided by the Hainan Natural Science Fund of China (808182), Special
Fund for Agro-scientific Research in the Public Interest (3–41), and Basic Scientific Research Project
of Nonprofit Central Research Institutions (200701).
References
1. Itai, A.; Tanahashi, T. Inhibition of sucrose loss during cold storage in Japanese pear (Pyrus
pyrifolia Nakai) by 1-MCP. Postharvest Biol. Technol. 2008, 48, 355–363.
2. Basson, C.E.; Groenewald, J.H.; Kossmann, J.; Cronjé, C.; Bauer, R. Sugar and acid-related
quality attributes and enzyme activities in strawberry fruits: Invertase is the main sucrose
hydrolysing enzyme. Food Chem. 2010, 121, 1156–1162.
3. Yativ, M.; Harary, I.; Wolf, S. Sucrose accumulation in watermelon fruits: genetic variation and
biochemical analysis. J. Plant Physiol. 2009, 167, 589–596
4. Winter, H.; Huber, S.C. Regulation of sucrose metabolism in higher plants: localization and
regulation of activity of key enzymes. Crit. Rev. Biochem. Mol. Biol. 2000, 35, 253–289.
5. Li, M.J.; Feng, F.J.; Cheng, L.L. Expression patterns of genes involved in sugar metabolism and
accumulation during apple fruit development. PLoS One 2012, 7, e33055.
6. Trevanion, S.J.; Castleden, C.K.; Foyer, C.H.; Furbank, R.T.; Quick, W.P.; Lunn, J.E. Regulation
of sucrose-phosphate synthase in wheat (Triticum aestivum) leaves. Funct. Plant Biol. 2004, 31,
685–695.
Int. J. Mol. Sci. 2012, 13 9476
7. Zhang, X.M.; Du L.Q.; Xie, J.H.; Dou, M.A.; Wang, W.; Mo, Y.W.; Sun, G.M. Cloning and
expression of pineapple sucrose phosphate synthase gene during fruit development. Afr. J.
Biotechnol. 2010, 9, 8296–8303.
8. Koch, K.E. Sucrose metabolism: Regulatory mechanisms and pivotal roles in sugar sensing and
plant development. Curr. Opin. Plant Biol. 2004, 7, 235–246.
9. Verma, A.K.; Upadhyay, S.K.; Verma, P.C.; Solomon, S.; Singh, S.B. Functional analysis of
sucrose phosphate synthase (SPS) and sucrose synthase (SS) in sugarcane (Saccharum) cultivars.
Plant Biol. 2011, 13, 325–332.
10. Carlson, S.J.; Chourey, P.S.; Helentjaris, T.; Datta, R. Gene-expression studies on developing
kernels of maize sucrose synthase (SuSy) mutants show evidence for a third SuSy gene. Plant
Mol. Biol. 2002, 49, 15–29.
11. Roitsch, T.; González, M.C. Function and regulation of plant invertases: sweet sensations. Trends
Plant Sci. 2004, 9, 606–613.
12. Keutgen, A.J.; Pawelzik, E. Quality and nutritional value of strawberry fruit under long term salt
stress. Food Chem. 2008, 107, 1413–1420.
13. Zhang, M.F.; Li, Z.L. A comparison of sugar-accumulating patterns and relative compositions in
developing fruits of two oriental melon varieties as determined by HPLC. Food Chem. 2005, 90,
785–790.
14. Qi, X.P.; Wu, Z.C.; Li, J.H.; Mo, X.R.; Wu, S.H.; Chu, J.; Wu, P. AtCYT-INV1, a neutral
invertase, is involved in osmotic stress-induced inhibition on lateral root growth in Arabidopsis.
Plant Mol. Biol. 2007, 64, 575–587
15. Zhang, X.M.; Dou, M.A.; Yao, Y.L.; Du, L.Q.; Li, J.G.; Sun, G.M. Dynamic analysis of sugar
metabolism in different harvest seasons of pineapple (Ananas comosus L. (Merr.)). Afr. J.
Biotechnol. 2010, 10, 2716–2723.
16. Pressman, E.; Shaked, R.; Shen, S.; Altahan, L.; Firon, N. Variations in carbohydrate content and
sucrose-metabolizing enzymes in tomato (Solanum lycopersicum L.) stamen parts during pollen
maturation. Am. J. Plant. Sci. 2012, 3, 252–260.
17. Nguyen-Quoc, B.; Foyer, C.H. A role for “futile cycles” involving invertase and sucrose synthase
in sucrose metabolism of tomato fruit. J. Exp. Bot. 2001, 52, 881–889.
18. Castleden, C.K.; Aoki, N.; Gillespie, V.J.; MacRae, E.A.; Quick, W.P.; Buchner, P.; Foyer, C.H.;
Furbank, R.T.; Lunn, J.E. Evolution and function of the sucrose phosphate synthase gene families
in wheat and other grasses. Plant Physiol. 2004, 135, 1753–1764
19. Langenkämper, G.; Fung, R.W.M.; Newcomb, R.D.; Atkinson, R.G.; Gardner, R.C.; MacRae, E.A.
Sucrose phosphate synthase genes in plants belong to three different families. J. Mol. Evol. 2002,
54, 322–332.
20. Mitchell-Olds, T.; Clauss, M.J. Plant evolutionary genomics. Curr. Opin. Plant Biol. 2002, 5,
74–79.
21. Lunn, J.E. Evolution of sucrose synthesis. Plant Physiol. 2002, 128, 1490–1500.
22. Murayama, S.; Handa, H. Genes for alkaline/neutral invertase in rice: Alkaline/neutral invertases
are located in plant mitochondria and also in plastids. Planta 2007, 225, 1193–1203.
23. Vargas, W.; Andrea, C.; Salerno, G.L. Cyanobacterial alkaline/neutral invertases. Origin of
sucrose hydrolysis in the plant cytosol? Planta 2003, 216, 951–960.
Int. J. Mol. Sci. 2012, 13 9477
24. Botha, F.C.; Black, K.G. Sucrose phosphate synthase and sucrose synthase activity during
maturation of internodal tissue in sugarcane. Funct. Plant Biol. 2000, 27, 81–85.
25. Choudhury, S.R.; Roy, S.; Das, R.; Sengupta, D.N. Differential transcriptional regulation of
banana sucrose phosphate synthase gene in response to ethylene, auxin, wounding, low
temperature and different photoperiods during fruit ripening and functional analysis of banana
SPS gene promoter. Planta 2008, 229, 207–223.
26. Strand, A.; Zrenner, R.; Trevanion, S.; Stitt, M; Gustafsson, P.; Gardeström1 P. Decreased
expression of two key enzymes in the sucrose biosynthesis pathway, cytosolic fructose-1,6-
bisphosphatase and sucrose phosphate synthase, has remarkably different consequences for
photosynthetic carbon metabolism in transgenic Arabidopsis thaliana. Plant J. 2000, 23,
759–770.
27. Itai, A.; Tanahashi, T. Inhibition of sucrose loss during cold storage in Japanese pear (Pyrus
pyrifolia Nakai) by 1-MCP. Postharvest Biol. Technol. 2008, 48, 355–363.
28. Ciereszko, I.; Kleczkowski, L.A. Glucose and mannose regulate the expression of a major sucrose
synthase gene in Arabidopsis via hexokinase-dependent mechanisms. Plant Physiol. Biochem.
2002, 40, 907–911.
29. Nonis, A.; Ruperti, B.; Falchi, R.; Casatta, E.; Enferadi, S.T.; Vizzotto, G. Differential expression
and regulation of a neutral invertase encoding gene from peach (Prunus persica): Evidence for a
role in fruit development. Physiol. Plantarum 2007, 129, 436–446.
30. Yu, X.Y.; Wang, X.F.; Zhang, W.Q.; Qian, T.T.; Tang, G.M.; Guo, Y.K; Zheng, C.C. Antisense
suppression of an acid invertase gene (MAI1) in muskmelon alters plant growth and fruit
development. J. Exp. Bot. 2008, 59, 2969–2977.
31. Basson, C.E.; Groenewald, J.H.; Kossmann, J.; Cronjé, C.; Bauer, R. Sugar and acid-related
quality attributes and enzyme activities in strawberry fruits: Invertase is the main sucrose
hydrolysing enzyme. Food Chem. 2009, 121, 1156–1162.
32. Kleczkowski, L.A.; Kunz, S.; Wilczynska, M. Mechanisms of UDP-Glucose synthesis in plants.
Crit. Rev. Plant Sci. 2010, 29, 191–203.
33. Blast; Available online: http://blast.ncbi.nlm.nih.gov/Blast.cgi (accessed on 12 February 2012).
34. EMBL-EBI. Available online: http://www.ebi.ac.uk/Tools/msa/clustalw2/ (accessed on 12
February 2012).
© 2012 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article
distributed under the terms and conditions of the Creative Commons Attribution license
(http://creativecommons.org/licenses/by/3.0/).
... Pineapple is categorized as a non-climacteric tropical fruit and experiences complex biochemical changes, such as variations in the metabolism of sugar, organic acids, and phenolic compounds during fruit development (Saradhuldhat and Paull, 2007;Zhang et al., 2012;Léchaudel et al., 2018). An assessment of sugars and organic acid levels in mature fruits of 26 pineapple cultivars by high-performance liquid chromatography showed that the predominant sugar was Suc, followed by Glc and Fru, and the prevailing acid was citric acid, accompanied by malic and quinic acids (Lu et al., 2014). ...
... Compared with other horticultural crops, such as apple and peach (Li et al., 2012;Zheng et al., 2020), the information on metabolic modulations and accumulation mechanisms related to sugars and organic acids in pineapple is limited. Although some studies have been reported on the changes in key enzymes and relevant biosynthesis genes linked to sugars and organic acids during pineapple fruit development (Saradhuldhat and Paull, 2007;Zhang et al., 2012Zhang et al., , 2019Wu et al., 2022), the metabolic pathways and genes controlling sugar and organic acid accumulation in pineapple fruit remain largely unknown. ...
... Suc, the main contributor to pineapple sweetness (Zhang et al., 2012(Zhang et al., , 2019, was the predominant soluble sugar of mature fruits in both cultivars. Interestingly, Suc accumulation was strongly negatively associated with the brown (r 2 = -0.92) ...
Article
Full-text available
Pineapple (Ananas comosus L.) is one of the most valuable subtropical fruit crop in the world. The sweet-acidic taste of the pineapple fruits is a major contributor to the characteristic of fruit quality, but its formation mechanism remains elusive. Here, targeted metabolomic and transcriptomic analyses were performed during the fruit developmental stages in two pineapple cultivars (“Comte de Paris” and “MD-2”) to gain a global view of the metabolism and transport pathways involved in sugar and organic acid accumulation. Assessment of the levels of different sugar and acid components during fruit development revealed that the predominant sugar and organic acid in mature fruits of both cultivars was sucrose and citric acid, respectively. Weighted gene coexpression network analysis of metabolic phenotypes and gene expression profiling enabled the identification of 21 genes associated with sucrose accumulation and 19 genes associated with citric acid accumulation. The coordinated interaction of the 21 genes correlated with sucrose irreversible hydrolysis, resynthesis, and transport could be responsible for sucrose accumulation in pineapple fruit. In addition, citric acid accumulation might be controlled by the coordinated interaction of the pyruvate-to-acetyl-CoA-to-citrate pathway, gamma-aminobutyric acid pathway, and tonoplast proton pumps in pineapple. These results provide deep insights into the metabolic regulation of sweetness and acidity in pineapple.
... Transcript levels of SPS increased with sucrose accumulation during ripening in watermelon and banana [19,20]. In addition, the expression pattern of SPS in pineapple and potato all showed that its expression was related to sucrose metabolism [21,22]. Sucrose synthase (SUS) catalyzes both the breakdown of sucrose to UDP glucose and the synthesis of sucrose [17]. ...
... Based on the optimum PH of the enzyme, CWINV and VINV can be classified as acid convertase (AI), while CINV is a neutral invertase (NI) [26]. Numerous studies showed that there is a significant negative correlation between the activity of INV and sucrose accumulation in fruits [12,22,26,27]. In tomato fruits, CWINV and VINV are encoded by LIN and VI, respectively. ...
Article
Full-text available
Wucai (Brassica campestris L.) is a leafy vegetable that originated in China, its soluble sugars accumulate significantly to improve taste quality during maturation, and it is widely accepted by consumers. In this study, we investigated the soluble sugar content at different developmental stages. Two periods including 34 days after planting (DAP) and 46 DAP, which represent the period prior to and after sugar accumulation, respectively, were selected for metabolomic and transcriptomic profiling. Differentially accumulated metabolites (DAMs) were mainly enriched in the pentose phosphate pathway, galactose metabolism, glycolysis/gluconeogenesis, starch and sucrose metabolism, and fructose and mannose metabolism. By orthogonal projection to latent structures-discriminant s-plot (OPLS-DA S-plot) and MetaboAnalyst analyses, D-galactose and β-D-glucose were identified as the major components of sugar accumulation in wucai. Combined with the transcriptome, the pathway of sugar accumulation and the interact network between 26 DEGs and the two sugars were mapped. CWINV4, CEL1, BGLU16, and BraA03g023380.3C had positive correlations with the accumulation of sugar accumulation in wucai. The lower expression of BraA06g003260.3C, BraA08g002960.3C, BraA05g019040.3C, and BraA05g027230.3C promoted sugar accumulation during the ripening of wucai. These findings provide insights into the mechanisms underlying sugar accumulation during commodity maturity, providing a basis for the breeding of sugar-rich wucai cultivars.
... The samples were from two types of pineapple flesh, CK and MS. T glucose, and fructose contents of the flesh were determined by high-perform chromatography (HPLC) in accordance with the method of Zhang et al. [10]. ...
... The samples were from two types of pineapple flesh, CK and MS. The sucrose, glucose, and fructose contents of the flesh were determined by high-performance liquid chromatography (HPLC) in accordance with the method of Zhang et al. [10]. ...
Article
Full-text available
Watercore is a physiological disorder in pineapples, which is expressed as fluid deposition in intercellular spaces and presents as water soaked. This disorder affects the fruit quality and decreases storage life, resulting in enormous commercial losses to growers and restricting the development of the pineapple industry in China. However, the molecular mechanism of watercore remains unclear. In order to elucidate the molecular mechanism of pineapple watercore, the transcriptome analyses of watercored and normal fruits were carried out in pineapples for the first time using de novo RNA-seq technology. High-quality reads of 46.66 and 43.71 M were obtained in the transcriptomes of normal and mildly watercored fruits, respectively. Clean reads of 45.50 and 42.79 M were obtained after filtering the original data. These genes are useful resources in subsequent pineapple watercore research. Fifty genes in phenylpropanoid biosynthesis, glucose metabolism, calcium transport, and cell wall metabolism were considerably different between normal and watercored fruits. Among them, the expressions of the AcPME, AcBGLU43, Ac4CL5, AcPER1, and AcPOD genes were upregulated by 7–21 times in watercored fruit, while the expressions of AcSUS7 were downregulated by 16.61 times, and the expressions of other differential genes were upregulated or downregulated by more than 2 times. A total of 38 differentially expressed transcription factors were obtained by screening. Among these transcription factors, WRKY was the most abundant, followed by MYB. The acquisition of these genes is important for the first understanding of the molecular mechanism of this physiological disorder.
... In our study, AcSUS2 expression was positively correlated with sucrose, glucose, and fructose levels, and may play an important role in sugar accumulation during kiwifruit postharvest ripening. In most plants, sucrose accumulation is related to an increase in SPS activity (Zhang et al., 2012). In kiwifruit, high SPS activity and the presence of glucose and fructose in approximately similar amounts indicate that soluble sugars are formed by sucrose synthesis followed SPS gene overexpression in tomato fruit increases SPS and SUS enzyme activity and the sucrose content (Nguyen-Quoc et al., 1999), and SPS3 is involved in sucrose resynthesis in peach fruit (Vimolmangkang et al., 2016). ...
... Furthermore, the soluble solids content was significantly higher in all harvested clusters of tomatoes in I 0 -treated plants compared to those grown in I 25 and I 50 treatments (Fig. 3A). Sugar accumulation in fruit is associated with enzyme activities, specifically sucrose-metabolizing enzymes (Zhang et al., 2012). Ripoll et al. (2014) reviewed that water deficit stimulates secondary metabolism and enzymatic activities of plants to enhance plant defense mechanism and resulted in soluble solids content increased in fruit. ...
Article
Background: This study examined the impact of reducing the "sink" on the "source" in On-palms with a bunch number greater than eight. The capacity of leaves and fruit, as well as assimilate loading and unloading in phloem, restrict plant growth and yield. The study evaluated yield components, photosynthetic, and hormonal feedback resulting from source-sink relationships. Results: During the mid-Kimri, removing bunches from On-trees stabilized yield components and fruit size, suggesting that On-trees have a sink limitation. Bunch thinning boosted these indicators compared to normal trees with a bunch number between six and eight inclusive, indicating that On-trees had source limitations. In mid-Khalal, the treatments presented a type of source and sink limitation that is opposite to mid-Kimri. The thinning techniques addressed the source-sink limitation by adjusting the additional carbon allocation. This resulted in an increase of non-reducing sugars and starch in different organs, while reducing sugars decreased. These adjustments were made to reduce sucrose-phosphate synthase and sucrose synthase activity, raising invertase activity, lowering IAA, zeatin, GA3 , and ABA hormone levels in fruits, and lowering trehalose production in organs. Levels of hormones, enzymes, and trehalose showed less variation during bunch thinning and source limitation compared to bunch removal and sink limitation. Conclusions: At Rutab, thinning types demonstrated the source limitation of On-trees. Bunch removal and bunch thinning by removing the source-sink limitation had the greatest effect on increasing yield components and fruit size, respectively. To improve the quality and quantity of fruit, it's important to use both thinning techniques simultaneously. This article is protected by copyright. All rights reserved.
Article
Sugars are fundamental to plant developmental processes. For fruits, the accumulation and proportion of sugars play crucial roles in the development of quality and attractiveness. In citrus (Citrus reticulata Blanco.), we found the difference in sweetness between mature fruits of 'Gongchuan' and its bud sport 'Youliang' is related to hexose contents. Expression of a SuS (Sucrose Synthase) gene CitSUS5 and a SWEET (Sugars Will Eventually be Exported Transporter) gene CitSWEET6, characterized by transcriptome analysis at different developmental stages of these two varieties revealed higher expression levels in 'Youliang' fruit. The roles of CitSUS5 and CitSWEET6 were investigated by enzyme activity and transient assays. CitSUS5 promoted the cleavage of sucrose to hexoses, and CitSWEET6 was identified as a fructose transporter. Further investigation identified the transcription factor CitZAT5 (ZINC FINGER OF ARABIDOPSIS THALIANA) that contributes to sucrose metabolism and fructose transportation by positively regulating CitSUS5 and CitSWEET6. The role of CitZAT5 in fruit sugar accumulation and hexose proportion was investigated by homologous transient CitZAT5-overexpression, -VIGS and -RNAi. CitZAT5 modulates the hexose proportion in citrus by mediating CitSUS5 and CitSWEET6 expression, and the molecular mechanism explained the differences in sugar composition of 'Youliang' and 'Gongchuan' fruit.
Article
Sugar beet (Beta vulgaris L.) is a globally important sugar crop that is mainly used to produce sucrose. However, its cultivation is limited by poor growth and seedling necrosis under low night temperatures (LNT). The aim of this study was to investigate the effects of LNT on growth, photosynthetic characteristics, and sucrose accumulation in sugar beet. LNT stress reduced growth, photosynthesis, membrane stability, and dark respiration. Following LNT stress, we observed thicker leaves and a reduction in diameter of the stem vascular bundle. LNT stress also decreased sucrose synthase, resulting in decreased sucrose decomposition. Under low night temperature, the reduction of sucrose decomposition, nocturnal respiratory consumption, and sucrose output from leaves to roots resulted in significant sucrose accumulation in leaves, which in turn inhibited photosynthesis and sucrose phosphate synthase. The sucrose accumulation in leaves subjected to lower night temperature (4 ℃) was higher than that in leaves at 12 ℃, resulting in stronger inhibition of photosynthetic feedback. The results of this study confirmed that LNT stress can decrease photosynthesis via feedback inhibition of sucrose in leaves, providing a theoretical basis for the improvement and cultivation of sugar beet.
Article
Source–sink balancing is crucial for a fruit load capacity in date palm trees. In date palm trees, coordination of suckers as sink strength with berries as source strength is very significant for economic yield production. The purpose of this study was to use the number of fruit bunches in two fruiting conditions of Off (less than 6 bunches) and On (more than 8 bunches) to identify the source-sink limitation in ‘Mazafati’ date palms with a normal fruit load (6≤bunch number≤8) to determine the optimal number of suckers, as active sinks that compete with berries, to be kept on a date palm. In this study, there were two groups, date palms with 4-5 suckers and date palms with 6-7 suckers. The results showed that the stress caused by 6-7 suckers (as compared to 4-5 suckers) limited source; reduced yield, bunch weight, fruit weight, size, and flavor; and increased fruit shedding and biennial bearing. Date palms with 6-7 suckers and a normal fruit load had a higher content of reducing sugars, a lower content of non-reducing sugars, and less starch in the organelles. They also showed higher trehalose metabolism responsive trehalose-6-phosphate synthase (TPS) and trehalose-6-phosphate phosphatases (TPP) genes expression along with lower carbon allocation sucrose-phosphate synthase (SPS1), sucrose synthase (SuSy) and invertase (INV) genes expression and enzymes activity in leaflets, which were in line with changes in yield and yield components. Therefore, the optimal number of suckers to be kept on a date palm with a normal fruit load was determined to be 4-5.
Article
Full-text available
The formation of mature and fertile pollen grains, taking place inside the anther, depends on supply of assimilates, in the form of sucrose, provided mainly by the leaves. Data is limited, however, with respect to the understanding of su-crose metabolism in microspores and the supporting tissues. The aims of the present work were to 1) follow the changes in total and relative concentrations of sucrose, glucose, fructose and starch in the stamen parts and microspores up until anthesis; 2) Follow the activities of sucrose-metabolism-related enzymes, in the anther walls fraction and microspores of the crop plant tomato. Sucrose was found to be partially cleaved in the filament, decreasing by more than twofold in the anther wall layers and the locular fluid, and to accumulate in the mature pollen grains, constituting 80% of total soluble sugars. Thus, sucrose was both the starting sugar, supporting microspore development, and the main carbohy-drate accumulated at the end of the pollen-development program. The major invertase found to be active in both the anther wall layers and in maturing microspores was cell-wall-bound invertase. High fructokinase 2 and sucrose phos-phate synthase activities during pollen maturation coincided with sucrose accumulation. The potential importance of sucrose accumulation during pollen dehydration phase and germination is discussed.
Article
Full-text available
Sucrose synthase (SuSy) is an important enzyme involved in sucrose synthesis/breakdown in all plants. Sus1, a major SuSy gene in Arabidopsis thaliana, was upregulated by sucrose, glucose and D-mannose, but not 3-O-methylglucose, when those compounds were fed to excised leaves. Mannose was more effective than glucose or sucrose in the induction of Sus1, with strong effects observed at a concentration as low as 20 mM. When fed to the excised leaves, N-acetyl-glucosamine, an inhibitor of hexokinase (HXK) enzymatic activity, decreased sucrose-and glucose-dependent, but not mannose-dependent, upregulation of Sus1. The sucrose/glucose-dependent Sus1 expression was strongly induced in transgenic Arabidopsis HXK-overexpressing (OE) plants, whereas mannose-dependent Sus1 expression markedly decreased in OE, but not in HXK-"antisense", Arabidopsis plants. Feeding with sucrose resulted in a marked increase of glucose content in leaves, suggesting that it is glucose rather than sucrose that serves as a signal in upregulating Sus1 expression in sucrose-fed plants. The data suggest that Sus1 is regulated by a HXK-dependent pathway, with glucose and mannose effects differentially sensed/transmitted via the HXK step. © 2002 Éditions scientifiques et médicales Elsevier SAS. All rights reserved.
Article
We present phylogenetic analyses to demonstrate that there are three families of sucrose phosphate synthase (SPS) genes present in higher plants. Two data sets were examined, one consisting of full-length proteins and a second larger set that covered a highly conserved region including the 14-3-3 binding region and the UDPGlu active site. Analysis of both datasets showed a well supported separation of known genes into three families, designated A, B, and C. The genomic sequences of Arabidopsis thaliana include a member in each family: two genes on chromosome 5 belong to Family A, one gene on chromosome 1 to Family B, and one gene on chromosome 4 to Family C. Each of three Citrus genes belong to one of the three families. Intron/exon organization of the four Arabidopsis genes differed according to phylogenetic analysis, with members of the same family from different species having similar genomic organization of their SPS genes. The two Family A genes on Arabidopsis chromosome 5 appear to be due to a recent duplication. Analysis of published literature and ESTs indicated that functional differentiation of the families was not obvious, although B family members appear not to be expressed in roots. B family genes were cloned from two Actinidia species and southern analysis indicated the presence of a single gene family, which contrasts to the multiple members of Family A in Actinidia. Only two family C genes have been reported to date.
Article
Sucrose accumulation rates, sucrose-phosphate synthase (SPS, EC 2.4.1.14) and soluble sucrose synthase (SuSy, EC 2.4.1.13) activities were measured in internodal tissue from a sugarcane (Saccharum species hybrids) variety N19. The sucrose accumulation rate sharply increases between internodes 3 to 11. In the older internodes SPS activity was at least three times higher than the SuSy activity. A highly significant positive correlation was found between SPS activity and sucrose content. In contrast, no significant correlation was observed between SuSy and sucrose content. In agreement, when radiolabelled glucose was fed to internodes with a high sucrose accumulation rate, label was equally distributed in the hexose moieties of sucrose. This clearly indicates that SPS is the major sucrose synthesis activity in the culm of sugarcane. Different kinetic forms of SPS apparently exist in the internodal tissue at different stages of development.
Article
Sucrose accumulation rates, sucrose-phosphate synthase (SPS, EC 2.4.1.14) and soluble sucrose synthase (SuSy, EC 2.4.1.13) activities were measured in internodal tissue from a sugarcane (Saccharum species hybrids) variety N19. The sucrose accumulation rate sharply increases between internodes 3 to 11. In the older internodes SPS activity was at least three times higher than the SuSy activity. A highly significant positive correlation was found between SPS activity and sucrose content. In contrast, no significant correlation was observed between SuSy and sucrose content. In agreement, when radiolabelled glucose was fed to internodes with a high sucrose accumulation rate, label was equally distributed in the hexose moieties of sucrose. This clearly indicates that SPS is the major sucrose synthesis activity in the culm of sugarcane. Different kinetic forms of SPS apparently exist in the internodal tissue at different stages of development.
Article
The regulation of sucrose-phosphate synthase (SPS, E.C.2.4.1.14), a key enzyme of sucrose synthesis, was investigated in wheat (Triticum aestivum L.) leaves. Wheat SPS was activated in the light, with an increased affinity for its substrates and the activator glucose-6-phosphate, reduced sensitivity to inhibition by P-i, but no change in maximum catalytic activity. Based on these properties, assays to measure the total activity and activation state of the enzyme were established and validated using several different wheat cultivars, grown under different environmental conditions. As found in previous studies on other species, e.g. spinach, activation appeared to be linked to the prevailing rate of photosynthesis rather than light per se. Long-term exposure to higher light levels increased total SPS activity in the leaves, and some experiments indicated that this response could occur within 1 h of exposure of low-light-grown plants to high light. However, activation of pre-existing enzyme was a more common short-term response to high light. Wheat, like many important cereal species, stores a large amount of sucrose in its leaves. In contrast with spinach, which stores more starch in its leaves, accumulation of sucrose in wheat leaves did not lead to inactivation of SPS or inhibition of sucrose synthesis. In conclusion, the mechanisms linking the rates of sucrose synthesis and photosynthetic CO2 fixation in wheat leaves appear to be similar to those in other species, but the mechanisms involved in short-term feedback inhibition of sucrose synthesis by sucrose, found in starch-storing species, are lacking in wheat.
Article
Sucrose phosphate synthase (SPS; EC 2.4.1.14) and sucrose synthase (SS; EC 2.4.1.13) are key enzymes in the synthesis and breakdown of sucrose in sugarcane. The activities of internodal SPS and SS, as well as transcript expression were determined using semi-quantitative RT-PCR at different developmental stages of high and low sucrose accumulating sugarcane cultivars. SPS activity and transcript expression was higher in mature internodes compared with immature internodes in all the studied cultivars. However, high sugar cultivars showed increased transcript expression and enzyme activity of SPS compared to low sugar cultivars at all developmental stages. SS activity was higher in immature internodes than in mature internodes in all cultivars; SS transcript expression showed a similar pattern. Our studies demonstrate that SPS activity was positively correlated with sucrose and negatively correlated with hexose sugars. However, SS activity was negatively correlated with sucrose and positively correlated with hexose sugars. The present study opens the possibility for improvement of sugarcane cultivars by increasing expression of the respective enzymes using transgene technology.
Article
Studies on sucrose metabolism during fruit development have shown an important role of acidic (cell wall and vacuolar) invertases (EC 3.2.1.26) in determining fruit sink strength, final fruit growth and sugar accumulation. Little information is available on the role played by neutral (cytoplasmic) invertases on fruit and plant development. In this article, the expression of a gene encoding a neutral invertase (NI) isolated from peach (PpNI1) was studied in relation to sucrose metabolism and mesocarp development in two genotypes (cv. Springcrest and cv. Redhaven) differing for fruit growth, and sugar accumulation dynamics. Real-time reverse transcription-PCR expression analyses showed a differential regulation of the gene during development and a correlation with sucrose, and glucose and fructose mesocarp contents. Only one peak of expression of the gene was found in the early ripening cultivar Springcrest, characterised by a nearly monophasic growth of fruits, while two peaks could be detected in the mid–late ripening cv. Redhaven, displaying a classical biphasic double-sigmoidal fruit growth pattern. Furthermore, PpNI1 transcription appeared to be regulated in response to sugar signals only in the phase of fruit expansion coincident with the onset of sucrose accumulation. These findings point to a relationship between dynamics of fruit growth, sugar metabolism and sensing and the expression of a gene encoding a NI, suggesting a regulatory role in plant development for this class of enzymes.
Article
Sugar-accumulating patterns and compositions were compared between two oriental melon varieties, “Huangjingua” (Cucumis melo var. makuwa Makino) and “Yuegua” (Cucumis melo var. conomon Makino). Sucrose and reducing sugars were measured in different mesocarp tissues of developing fruits. They were all characterized by enhanced accumulation of glucose and fructose during early fruit development with almost no sucrose detectable. However, a transition of sucrose enhancement was accompanied by fruit maturing in the variety “Huangjingua”, while no such transition was observed in the variety “Yuegua” that merely had a sucrose content throughout development. In “Huangjingua”, both sucrose and total sugar gradients were observed, ascending from mesocarp adjacent to pedicle, middle part of mesocarp, and up to mesocarp adjacent to umbilicus. However, no obvious gradient in sucrose accumulation was seen among three mesocarp tissues examined. In terms of sweetness index, fructose is the chief contributor to sugar accumulation in both varieties. Also, the melon variety “Huangjingua” could be comparatively considered as a high-sucrose accumulator and “Yuegua” a minor-sucrose accumulator.
Article
In pineapple fruits, sugar accumulation plays an important role in flavor characteristics, which varies according to the stage of fruit development. Metabolic changes in the contents of fructose, sucrose and glucose and reducing sugar related to the activities of soluble acid invertase (AI), neutral invertase (NI), sucrose synathase (SS) and sucrose-phosphate synthase (SPS) were studied in winter and summer pineapple fruits in this paper. Sucrose was significantly increased in most of the harvesting winter fruits which reached the peak of 64.87 mg·g-1 FW at 130 days after anthesis, while hexose was mainly accumulated at the 90 day of the summer fruits in July. The ratio of hexose to sucrose was 5.92:0.73 from the winter fruit in February. Interestingly, the activities of SPS and SS synthetic direction of the harvested fruits in February were significantly higher than those in July, whereas the invertase activities were exactly opposite. NI activity showed a similar trend to AI, but the amount of NI activity was higher than AI in both months. Therefore, NI appears to be one of the vital enzymes in pineapple fruit development. Conclusively, the enzyme activities related to sugar play key roles in the eating of quality pineapple, which could be improved by cultivation in different seasons. So we can arbitrate different temperature to improve the quality of pineapple fruits according to market demand.