Content uploaded by Shahril Ab Razak
Author content
All content in this area was uploaded by Shahril Ab Razak on Feb 12, 2016
Content may be subject to copyright.
c
Indian Academy of Sciences
ONLINE RESOURCES
Isolation and characterization of novel microsatellite loci for Asian sea
bass, Lates calcarifer from genome sequence survey database
ZULAIHA ABDUL RAHMAN, LAI CHOAY-HOONG, ROZIANA MAT KHAIRUDDIN, SHAHRIL AB RAZAK
and AHMAD SOFIMAN OTHMAN∗
School of Biological Sciences, Universiti Sains Malaysia, 11800 Minden, Penang, Malaysia
[Abdul Rahman Z., Choay-Hoong L., Mat Khairuddin R., Ab Razak S. and Othman A. S. 2012 Isolation and characterization of novel
microsatellite loci for Asian sea bass, Lates calcarifer from genome sequence survey database. J. Genet. 91, e82–e85. Online only: http://www.
ias.ac.in/jgenet/OnlineResources/91/e82.pdf]
Introduction
Asian sea bass, Lates calcarifer is also known as
Barramundi, is an economically important finfish cultured
and marketed in southern Asia. It has an extensive natural
range from India through the Indo–malaysian archipelago,
east to northern Australia and north to southern China
(Greenwood 1976; Moore and Reynolds 1982). In Malaysia,
domestication of Asian sea bass using cage nets has been
established by the Fisheries Department since the 1970s,
although locally produced fry only became available in the
mid 1980s (Awang 1986).
Microsatellite markers are valuable as genetic markers
since they are codominant, highly abundant and have high
levels of polymorphism (McCouch et al. 1997; Hayden and
Sharp 2001). Molecular markers can be divided into type I
(coding) markers which are associated with genes of known
functions and type II (noncoding) markers which are asso-
ciated with anonymous genomic sequences (O’Brien 1991).
In general, most microsatellites represent type II markers.
Nongene sequences are free to mutate, causing high levels
of polymorphism, whereas sequences within protein-coding
regions generally show low levels of polymorphism due to
functional selection pressure (Chistiakov et al. 2006)and
are more difficult to develop (Liu et al. 1999). Large-scale
sequencing projects have generated the genome sequence
survey (GSS) database, offering an alternative means to
develop microsatellites in less time at lower cost. GSS
sequence databases (www.genome.ukm.my/cbass/) provide
a rich source for isolating thousands of sequences con-
taining putative microsatellites, and offer the possibility of
developing hundreds of polymorphic microsatellite markers
(Chistiakov et al. 2006). Microsatellites for this particular
species are extensively available (Yue et al. 2002;Simand
∗For correspondence. E-mail: sofiman@usm.my.
Othman 2005;Zhuet al. 2006), newly identified microsatel-
lites loci may aid in other studies e.g., genome mapping.
We have taken the approach of mining microsatellite mark-
ers from GSS sequences to increase the availability of
microsatellites for L. calcarifer.
Materials and methods
A total of 5607 GSS sequences present in the database
(http://genome.ukm.my/cbass/) were screened for micro-
satellites using Tandem Repeat Finder 2.2 (Benson 1999).
From 5607 GSS sequences, 263 were identified with
microsatellite motifs. Only dinucleotide, trinucleotide, tetra-
nucleotide and pentanucleotide repeats were targeted, with
a minimum length of 20 bp. PRIMER3 (Steve and Helen
2000) was used to design primer for flanking region of each
microsatellite locus, and only a set of 206 microsatellite
primer pairs were designed and synthesized. Microsatellite
motifs that we failed to design as primers were eliminated.
Thirty individuals of L. calcarifer were collected from
the Straits of Malacca (west coast of peninsular Malaysia).
Genomic DNA was isolated from muscle tissues follow-
ing the standard phenol–chloroform method (Taggart et al.
1992) with some modifications. Tissue was homogenized in
500 μL of extraction lyses buffer together with 0.5 μg/mL
proteinase K and incubated at 55◦C. Following phenol :
chloroform : isoamyl alcohol (25 : 24 : 1) extractions, the
supernatants were precipitated by the addition of 2 volumes
of absolute ethanol. DNA was washed with 70% ethanol,
dissolved in distilled water and stored at 20◦C. PCR
amplification was conducted in a total reaction volume
of 25 μL consisting of 1.5 μL of template DNA (∼100 ng),
1×magnesium free Green GoTaq R
Flexi buffer, (1.5–3.0)
mM MgCl2, 2 mM dNTPs mixtures, 10 μmol of each primer
setand1UTaq DNA polymerase (Promega, Wisconsin,
Keywords. genome sequence survey; microsatellite; Lates calcarifer.
Journal of Genetics Vol. 91, Online Resources e82
Isolation and characterization of microsatellite loci for Lates calcarifer
Table 1. Characteristics of 23 polymorphic GSS-derived microsatellites for Lates calcarifer.
Locus Sequence Repeat motif Ta(◦C) Size range NAHOHEPvalue Accession
Lc02G003F04(A) F: GGTGACAGTGCTGCTGAGAA (ATAG)12 45.0 153–181 8 0.533 0.766 0.003 HQ713527
R: TTAGTCCCACAATGGGGAAA
Lc02G003F04(B) F: TTTCCCCATTGTGGGACTAA (TTATC)657.7 151–176 5 0.467 0.592 0.148 HQ713526
R: AAGGGCTGGTAGGTCGTACA
Lc02G042G09 F: GGCCATGACTCACCAGTTTT (AC)12 60.0 178–200 12 0.759 0.883 0.001aHQ713522
R: TGGGTGTAGTTTCGAATGGTG
Lc02G044F11 F: GGCTCTGACCTTCCTCACAG (AC)7A-A(AC)860.0 200–228 6 0.400 0.594 ****aHQ713528
R: TGGAGGGAAAGAGCTGAAAA
Lc02G044H04 F: TGACAACCCCCTGCATTTAT (GT)4AT(G-T)20 62.7 122–146 13 0.929 0.894 ****aHQ713523
R: GGCATCTGCACCACTACTCA
Lc02G045G12 F: CCCACACTATTGCAGCAGAA (GT)20 45.0 195–235 14 0.667 0.912 ****aHQ713533
R: AGCTGCTGTCCCAGAGAGAA
Lc02G047E11 F: CCACCGTGATCTCAGCTTTT (CA)5TAA-A(CA)12 52.5 222–268 14 0.933 0.938 ****aHQ713524
R: TGCCTGTGAGGAAGGACTCT
Lc05G005B05 F: CACTATTCCCTGTGGTGTCG (GA)11 53.9 127–149 10 0.767 0.859 0.004 HG713511
R: CCAGCCAGAGAGGAGCTAGA
Lc05G007G11 F: GAGCTGCTGGGTAACAGAGG (AC)16 59.7 172–190 10 0.767 0.866 ****aHQ713512
R: AGGCGTTCGGTGTGTATTGT
Lc05G010F10 F: ATGGGGAGTTATGGTTCCTT (AC)13 59.7 210–246 17 0.800 0.918 0.010 HQ713529
R: ATGGGTGGCAGTGGTAGAAG
Lc05G017A04 F: GCGTGAAGGACAGCTACCTC (AC)12(TC-AC)3(AC)259.7 217–253 9 0.767 0.859 ****aHQ713514
R: TCCAAGCGCACTATCAAAGA
Lc02G002H09 F: GAGGTGAGGCTCAAAACTGG (AC)14 57.7 191–217 8 0.741 0.829 0.001aHQ713525
R: CACCCCACCTGTCTCAGTCT
Lc05G005D05 F: CGGTGCAGAGTGGATCAGTA (TG)19 56.0 137–181 19 0.767 0.918 ****aHQ713530
R: GGAAATGAACTGAGGGGTGA
Lc05G010E09 F: AAGCACAATCACGCACTCAC (TG)15 60 120–138 3 0.667 0.560 ****aHQ713513
R: TTATGGCAGCGTGTTAGTGC
Lc05G017H11 F: CCATCTGTGGGCCTGTTTAT (TG)11 60.0 200–246 16 0.800 0.916 ****aHQ713515
R: GTCCATTTTGCATTGTGTGC
Lc02G012G04 F: TCTTCCAAGCCTCTTCCAAA (CA)19 61.0 170–186 9 0.733 0.802 ****aHQ713516
R: GGGACTTTTGCTGCCTACTG
Lc02G015H11 F: ATACAGGGGGCGTAGAAGGT (CA)21 54.2 177–221 19 0.767 0.917 ****aHQ713531
R: TCGCATTCATGTGTCAGGAT
Lc02G016E12 F: CCGGGTAATTGTATCGGACA (CA)12 64.7 214–250 16 0.897 0.926 0.108 HQ713517
R: TGGGAAGAACAATGCTGACA
Lc02G018F03 F: ATTTCTGCCATGTTCGCTCT (AC)15 65.0 181–199 10 0.724 0.796 0.001aHQ713518
R: TCCCACTAAGGTGTGTGCAG
Journal of Genetics Vol. 91, Online Resources e83
Zulaiha Abdul Rahman et al.
Table 1 (contd)..(contd).
Locus Sequence Repeat motif Ta(◦C) Size range NAHoHEPvalue Accession
Lc02G019C11 F: ATTGGGCTGTGAGGTTTCAG (GT)2TT(GT)863.9 143–159 8 0.833 0.834 0.003 HQ713519
R: ACCGCTCTTCTTCCGTCTTC
Lc02G020F03 F: TACGTCCCAGGCTGATCTGA (GT)11 64.7 196–276 24 1.000 0.951 ****aHQ713520
R: GCATGAACACGTGCAACATA
Lc02G022C11 F: TGGGAGGCAGAGTCATTTCT (TG)11 56.4 153–209 22 0.833 0.944 ****aHQ713532
R: GCTTCCGACAAGTGTTCGAT
Lc02G029G12 F: GCAGAAAGACCCTGAGCTTG (TG)9-TA(TG)362.7 234–292 16 0.800 0.908 ****aHQ713521
R: CAGCCTATGGTAAGGGCTGA
HO, observed heterozygosity; HE, expected heterozygosity; NA, number of alleles; Pvalue were calculated for 30 L.calcarifer individuals; Ta, actual annealing temperature.
Accession is GenBank ID.
**** for Pvalue <0.0001.
aDeviation from HWE.
USA). Amplification was performed using thermal cycler
DNA Engine (PTC-200) (MJ Research, Massachusetts,
USA). The PCR profile was: initial denaturation at 94◦Cfor
2 min; followed by 34 cycles of 94◦C for 1 min, annealing
(see table 1) for 1 min, and 72◦C for 1 min and finally 1 cycle
of 72◦C for 5 min. Amplification products were resolved
on 6.0% nondenaturing polyacrylamide gel and detected by
ethidium-bromide staining. Standard samples were included
across all gels to aid in accuracy and consistent sizing. Gel
images were captured and scoring was carried out against
20-bp Extended Range DNA Ladder (Cambrex, New Jersey,
USA) using Kodak Digital Science ID software. The number
of alleles (NA), expected heterozygosity (HE)and observed
heterozygosity (HO)were calculated using POPGENE v1.31
(Francis and Rong-Cai 1999). Tests for deviation from
Hardy–Weinberg equilibrium (HWE) and linkage disequilib-
rium (LD) were performed using GENEPOP v4.0
(Rousset 2008). Micro-Checker v2.2.3 was used to deter-
mine the most probable cause of departure from HWE
(Van Oosterhout et al. 2004). LD was determined by using
Arlequin v3.11 software (Excoffier et al. 2005).
Result and discussion
Only 23 out of 206 loci showed polymorphism. The rest were
monomorphic, or had presence of stutter bands, while some
loci were not easily amplified using a standard protocol. This
may be because either the flanking regions were too short or
failed to meet minimum amplification criteria. Data obtained
are summarized in table 1. All 23 loci were novel microsatel-
lites. The number of alleles per locus ranged from 3 to 24
with an average of 12.30 alleles per locus and values of the
observed and expected heterozygosities ranged from 0.400 to
1.000 and from 0.560 to 0.951, respectively. Six loci, namely
Lc02G003F04(A),Lc02G003F04(B),Lc05G005B05,
Lc05G010F10,Lc02G016E12 and Lc02G019C11, con-
formed to HWE, while the remaining 17 loci showed
significant deviation from HWE after Benferroni correction
at 5% significance level (P>0.002). No significant LD
was detected in any loci. Micro-Checker analysis suggested
that there was no evidence for scoring error due to stuttering
and no evidence for large allele dropout. It also suggested
that loci Lc02G003F04(A),Lc02G044F11,Lc02G045G12,
Lc05G010F10,Lc05G005D05,Lc02G015H11 and
Lc02G022C11, showed signs of the presence of null alleles.
In addition to the presence of null allele, the other factor that
may contribute to deviation from HWE may be nonrandom
sampling. These loci are valuable as molecular markers as
they show high levels of polymorphism and heterozygosity.
Acknowledgements
This project was funded by the Malaysian Genome Institute
(MGI) under grant UKM-MGI-NBD0004-2007/(304/PBIOLOGY/
650389/M128). The authors would like to thank P. C. Boyce
Journal of Genetics Vol. 91, Online Resources e84
Isolation and characterization of microsatellite loci for Lates calcarifer
(PPSKH-USM) for constructive critical reading of this manuscript.
The fourth author is grateful to USM fellowship for providing
financial support.
References
Awang A. 1986 Status of sea bass (Lates calcarifer) culture in
Malaysia. Management of wild and cultured sea bass/Barramundi
(Lates calcarifer). In Proceeding of an International Workshop.
No. 20 (ed. J. W. Copland and D. L. Grey), pp. 165–167.
ACIAR, Darwin, NT, Australia.
Benson G. 1999 Tandem repeats finder: a program to analyze DNA
sequences. Nucleic Acids Res. 27, 573–580.
Chistiakov D. A., Hellemans B. and Volckaert F. A. M. 2006
Microsatellites and their genomic distribution, evolution, func-
tion and applications: a review with special reference to fish
genetics. Aquaculture 255, 1–29.
Excoffier L., Laval G. and Schneider S. 2005 Arlequin ver. 3.0:
An integrated software package for population genetics data
analysis. Evol. Bioinformatics Online 1, 47–50.
Francis C. Y. and Rong-Cai Y. 1999 PopGene v. 1.31, Microsoft
Window–based freeware for population genetic analysis.
Greenwood P. H. 1976 A review of the family Centropomidae
(Pices, Perciformes). Bull. Br. Mus. (Nat. Hist.) Zool. 29, 4–81.
Hayden M. J. and Sharp P. J. 2001 Targeted development of infor-
mative microsatellite (SSR) markers. Nucleic Acids Res. 29,8
e44.
Liu Z. J., Karsi A. and Dunham R. A. 1999 Development of poly-
morphic EST markers suitable for genetic linkage mapping of
catfish. Mar. Biotechnol. 1, 437–447.
McCouch S. R., Chen X., Panaud O., Temnykh S., Xu Y., Cho
Y. G. et al. 1997 Microsatellite marker development, mapping
and applications in rice genetics and breeding. Plant Mol. Biol.
35, 89–99.
Moore R. and Reynolds L. F. 1982 Migration pattern of barramundi,
Lates calcarifer (Bloch) in Papua New Guinea. Aust.J.Mar.
Freshwater Res. 33, 671–682.
O’Brien S. J. 1991 Molecular genome mapping lessons and
prospects. Curr. Opin. Genet. Dev. 1, 105–111.
Rousset F. 2008 Genepop’007: A complete reimplementation of the
Genepop software for Windows and Linux. Mol. Ecol. Res. 8,
103–106.
Sim M. P. and Othman A. S. 2005 Isolation and characterization of
microsatellite DNA loci in sea bass, Lates calcarifer Bloch. Mol.
Ecol. Notes 5, 873–875.
Steve R. and Helen J. S. 2000 Primer3 on the WWW for general
users and for biologist programmers. In Bioinformatics methods
and protocols: methods in molecular biology (S. Krawetz and
S. Misener), pp. 365–386. Humana Press, Totowa, USA.
Taggart J. B., Hynes R. A., Prodohl P. A. and Ferguson A. 1992 A
simplified protocol for routine total DNA isolation from salmonid
fishes. J. Fish Biol. 40, 963–965.
Van Oosterhout C., Hutchinson W. F., Wills D. P. M. and Shipleys
P. 2004 MICROCHECKER: software for identifying and correct-
ing genotyping errors in microsatellite data. Mol. Ecol. Notes 4,
535–538.
Yue G. H., Li Y., Chao T. M., Renee C. and Laszlo O. 2002 Novel
microsatellites from Asian sea bass (Lates calcarifer)andtheir
application to broodstock analysis. Mar. Biotechnol. 4, 503–511.
Zhu Z. Y., Lin G., Lo L. C., Xu Y. X., Feng F., Chou R. and Yue
G. H. 2006 Genetic analyses of Asian seabass stocks using novel
polymorphic microsatellites. Aquaculture 256, 167–173.
Received 24 August 2011, in revised form 2 January 2012; accepted 23 May 2012
Published on the Web: 8 August 2012
Journal of Genetics Vol. 91, Online Resources e85
