Single mutation to a sex pheromone receptor provides adaptive specificity between closely related moth species

Article · August 2012with96 Reads
DOI: 10.1073/pnas.1204661109 · Source: PubMed
Abstract
Sex pheromone communication, acting as a prezygotic barrier to mating, is believed to have contributed to the speciation of moths and butterflies in the order Lepidoptera. Five decades after the discovery of the first moth sex pheromone, little is known about the molecular mechanisms that underlie the evolution of pheromone communication between closely related species. Although Asian and European corn borers (ACB and ECB) can be interbred in the laboratory, they are behaviorally isolated from mating naturally by their responses to subtly different sex pheromone isomers, (E)-12- and (Z)-12-tetradecenyl acetate and (E)-11- and (Z)-11-tetradecenyl acetate (ACB: E12, Z12; ECB; E11, Z11). Male moth olfactory systems respond specifically to the pheromone blend produced by their conspecific females. In vitro, ECB(Z) odorant receptor 3 (OR3), a sex pheromone receptor expressed in male antennae, responds strongly to E11 but also generally to the Z11, E12, and Z12 pheromones. In contrast, we show that ACB OR3, a gene that has been subjected to positive selection (ω = 2.9), responds preferentially to the ACB E12 and Z12 pheromones. In Ostrinia species the amino acid residue corresponding to position 148 in transmembrane domain 3 of OR3 is alanine (A), except for ACB OR3 that has a threonine (T) in this position. Mutation of this residue from A to T alters the pheromone recognition pattern by selectively reducing the E11 response ∼14-fold. These results suggest that discrete mutations that narrow the specificity of more broadly responsive sex pheromone receptors may provide a mechanism that contributes to speciation.
Figures
Sex Pheromone Receptor Specificity in the European
Corn Borer Moth,
Ostrinia nubilalis
Kevin W. Wanner
1
*, Andrew S. Nichols
2
, Jean E. Allen
1
, Peggy L. Bunger
1
, Stephen F. Garczynski
3
,
Charles E. Linn, Jr.
4
, Hugh M. Robertson
5
, Charles W. Luetje
2
1Department of Plant Sciences and Plant Pathology, Montana State University, Bozeman, Montana, United States of America, 2Department of Molecular and Cellular
Pharmacology, Miller School of Medicine, University of Miami, Miami, Florida, United States of America, 3Yakima Agricultural Research Laboratory, Agricultural Research
Service, United States Department of Agriculture, Wapato, Washington, United States of America, 4Department of Entomology, Barton Laboratory, New York State
Agricultural Experiment Station, Cornell University, Geneva, New York, United States of America, 5Department of Entomology, University of Illinois at Urbana-Champaign,
Urbana, Illinois, United States of America
Abstract
Background:
The European corn borer (ECB), Ostrinia nubilalis (Hubner), exists as two separate sex pheromone races. ECB(Z)
females produce a 97:3 blend of Z11- and E11-tetradecenyl acetate whereas ECB(E) females produce an opposite 1:99 ratio
of the Z and E isomers. Males of each race respond specifically to their conspecific female’s blend. A closely related species,
the Asian corn borer (ACB), O. furnacalis, uses a 3:2 blend of Z12- and E12-tetradecenyl acetate, and is believed to have
evolved from an ECB-like ancestor. To further knowledge of the molecular mechanisms of pheromone detection and its
evolution among closely related species we identified and characterized sex pheromone receptors from ECB(Z).
Methodology:
Homology-dependent (degenerate PCR primers designed to conserved amino acid motifs) and homology-
independent (pyrophosphate sequencing of antennal cDNA) approaches were used to identify candidate sex pheromone
transcripts. Expression in male and female antennae was assayed by quantitative real-time PCR. Two-electrode voltage
clamp electrophysiology was used to functionally characterize candidate receptors expressed in Xenopus oocytes.
Conclusion:
We characterized five sex pheromone receptors, OnOrs1 and 3–6. Their transcripts were 14–100 times more
abundant in male compared to female antennae. OnOr6 was highly selective for Z11-tetradecenyl acetate
(EC
50
= 0.8660.27 mM) and was at least three orders of magnitude less responsive to E11-tetradecenyl acetate. Surprisingly,
OnOr1, 3 and 5 responded to all four pheromones tested (Z11- and E11-tetradecenyl acetate, and Z12- and E12-tetradecenyl
acetate) and to Z9-tetradecenyl acetate, a behavioral antagonist. OnOr1 was selective for E12-tetradecenyl acetate based on
an efficacy that was at least 5-fold greater compared to the other four components. This combination of specifically- and
broadly-responsive pheromone receptors corresponds to published results of sensory neuron activity in vivo. Receptors
broadly-responsive to a class of pheromone components may provide a mechanism for variation in the male moth response
that enables population level shifts in pheromone blend use.
Citation: Wanner KW, Nichols AS, Allen JE, Bunger PL, Garczynski SF, et al. (2010) Sex Pheromone Receptor Specificity in the European Corn Borer Moth, Ostrinia
nubilalis. PLoS ONE 5(1): e8685. doi:10.1371/journal.pone.0008685
Editor: Walter S. Leal, University of California Davis, United States of America
Received November 18, 2009; Accepted November 30, 2009; Published January 13, 2010
This is an open-access article distributed under the terms of the Creative Commons Public Domain declaration which stipulates that, once placed in the public
domain, this work may be freely reproduced, distributed, transmitted, modified, built upon, or otherwise used by anyone for any lawful purpose.
Funding: K.W.W. gratefully acknowledges the support of Montana State University. This work was funded in part by United States Department of Agriculture
(USDA) grants 2007-35604-17756 and 2008-35302-18815 to H.M.R. and National Institutes of Health (NIH) grant DC008119 to C.W.L. The funders had no role in
study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing Interests: The authors have declared that no competing interests exist.
* E-mail: kwanner@montana.edu
Introduction
Sex pheromone communication between male and female
moths is believed to have contributed to their extensive speciation
[1]. More than 98% of the 150,000 described extant species of
Lepidoptera belong to the Ditrysia, a monophyletic lineage that
evolved during the last 110 million years [2]. Female moths
produce and release a mixture of related fatty acid derivatives from
their pheromone gland to which males respond from long
distances. In many cases, subtle changes in carbon chain length,
double bond location and isomer blend differentiate the
pheromones of closely related species [3]. While a variety of
mating systems have evolved in the Lepidoptera, female release of
pheromone is a predominant ancestral trait [4]. One long standing
question has been the origin and mechanism of the variation in
detection that enables the evolution of new pheromone blends.
The European corn borer (ECB), Ostrinia nubilalis (Hubner), has
provided a model system to study the evolution of sex pheromones
among closely related races and species. Most of the 20 species in
the genus Ostrinia use varying ratios of Z11- and E11-tetradecenyl
acetate (Z11- and E11-14:OAc) as the two main components of
their pheromone blend [5–7]. An introduced pest from Europe,
the ECB was first detected in North America in 1917 and exists as
two different pheromone races [8]. Males of the Z-race are
attracted to a 97:3 blend of Z11- and E11–14:OAc whereas
ECB(E) males are attracted to a 1:99 blend of the Z and E isomers
[9–10]. The closely related Asian corn borer (ACB), O. furnacalis,is
unique in this genus, having evolved to use a pheromone blend
PLoS ONE | www.plosone.org 1 January 2010 | Volume 5 | Issue 1 | e8685
with a shift in the location of the double bond, Z12- and E12-
tetradecenyl acetate (Z12- and E12-14:OAc) [11]. Mating isolation
between the Z- and E-races of ECB is controlled by a few major
genetic loci, including pher and resp, controlling female blend
production and male response, respectively [12–15]. Desaturase
enzymes in the female moth pheromone gland introduce double
bonds at specific locations along the hydrocarbon chain. The
recruitment of a novel D14 desaturase into the pheromone
biosynthesis pathway of an ancestor of the ACB led to a novel
pheromone blend (Z12- and E12–14:OAc) contributing to the
divergence of this species from the ECB [16].
Male moths have evolved to detect female-produced sex
pheromones with great sensitivity and specificity over a wide
range of concentrations [17]. A majority of the olfactory neurons
on male antennae, housed within long trichoid sensilla, specifically
respond to components of the female sex pheromone. The sex
pheromones are detected by odorant receptors (Ors) expressed on
the dendrites of the olfactory neurons [18–19]. The trichoid
sensilla on male ECB and ACB antennae typically house three
different olfactory neurons that can be differentiated by the
amplitude of their electrophysiological response spikes. For
ECB(E) males, a large-spiking neuron responds to the main
pheromone component, a small-spiking neuron responds to the
minor component, and an intermediate-spiking neuron responds
to Z9-tetradecenyl acetate (Z9-14:OAc) [20–24]. The olfactory
pathway responding to Z9-14:OAc antagonizes responses to the
attractive pheromone pathway and prevents upwind flight to
similar sex pheromone blends that include Z9-14:OAc [6].
Insect Ors are a family of chemoreceptors (Cr) that function as
ligand-gated ion channels [25–27]. A highly conserved Or termed
83b in Drosophila melanogaster and its ortholog in other insect species
acts as a chaperone and dimerization partner for other Ors that
impart ligand specificity [28]. Together Or83b+Or
x
form a ligand-
gated ion channel. Approximately 10% of the expected 60–70 Or
genes encoded in moth genomes form a distinct phylogenetic
subfamily that appears to be dedicated to sex pheromone detection
[18–19]. Seven silkworm (Bombyx mori) and six tobacco budworm
(Heliothis virescens) Ors belong to this subfamily. All but two are
expressed at higher levels in male antennae [29–30] and four respond
to their respective sex pheromone components in vitro [18,31].
The behavioral response of male insects to sex pheromone can be
closely linked to the activity of the peripheral olfactory neurons.
Transgenic fruit flies expressing the silkworm pheromone receptor
BmOr1 [18] in place of their sex and aggregation pheromone
receptor DmOr67d [32] are attracted to the silkworm pheromone
bombykol rather than their own pheromone vaccenyl acetate [33].
Activation of the sex- and aggregation-specific olfactory pathway
results in behavioral attraction independent of the actual signal. The
neurological pathway of sex pheromone sensitive olfactory neurons
and their projection to the antennal lobe was recently compared
between ECB(Z) and ECB(E) males. In each case, the axons of the
large-spiking neurons that respond to the main pheromone
component, Z11-14:OAc for ECB(Z) and E11–14:OAc for ECB(E),
projected to the same macroglomerulus in the male antennal lobe
[34]. The authors concluded that the major genetic locus that controls
the altered olfactory response between the Z and E races did not result
in a rewiring of the olfactory neurons, rather, the mechanisms must be
located at the periphery. Ors belonging to the sex pheromone
receptor subfamily are excellent candidates because the activity of an
olfactory neuron often parallels theresponsespectrumoftheOrthat
it expresses [35]. Here we employed a functional genomics approach
to identify and characterize five sex pheromone receptors from
ECB(Z) moths to further explore peripheral mechanisms contributing
to the evolution of sex pheromone detection.
Results
Five Candidate Sex Pheromone Receptors Identified from
ECB(Z)
Two complementary approaches were used to identify the
greatest possible number of candidate sex pheromone receptors in
the absence of whole genome sequencing. First, degenerate PCR
primers were designed to match a conserved amino acid motif in
the carboxy(C)-terminus of known Lepidoptera sex pheromone
receptors, (I/L/V)PW(E/D)(Y/F/C/H/A)M(D/N)(T/V/K/I/N).
Using these degenerate primers, the C-terminus of five Or
transcripts with amino acid homology to the Lepidoptera sex
pheromone receptor subfamily were identified by 39Rapid
Amplification of cDNA Ends (RACE) reactions (GeneBank
accession numbers FJ385011 - FJ385015).
In a second approach, an EST library was created by high-
throughput pyrophosphate sequencing of antennal cDNA. Seven
partial cDNA sequences with amino acid homology to known
Lepidoptera sex pheromone receptors were identified by
tBLASTn searches of the assembled contigs (Text S1). The seven
contigs varied from 178 to 1124 nucleotides (nt) in length, and
were assembled from a minimum of 6 sequence reads to a
maximum of 198 reads (Table S1). OnOr2, the ortholog of
DmOr83b that acts as a chaperone and partner for most Ors, was
represented by two contigs (Table S1) of 1032 and 178 nt (62 and
6 reads, respectively). All cDNAs were partial sequences, 39and 59
RACE was required to clone and sequence the complete open
reading frames (ORFs).
As a result, the combined approaches yielded 5 unique cDNAs,
OnOr1 and 3–6 (GenBank Accession numbers GQ844876-
GQ844881) that were cloned using primers designed from the
RACE sequences. OnOr1 and OnOr 3–6 encode proteins ranging
from 421 to 425 amino acids in length including motifs
characteristic of the insect Or family (such as the conserved
C-terminal serine and tyrosine residues,36; Figure S1). All five Ors
have BLASTp similarity to lepidopteran sex pheromone receptors
that have been functionally characterized. OnOr 1 and 6 are 36%
and 41% identical to Plutella xylostella Or1 [37]; OnOr3 is 36%
identical to Diaphania indica Or1 [37]; and, OnOr 4 and 5 are 63%
and 99% identical to a sex pheromone receptor recently char-
acterized from O. nubilalis [7].
ESTs representing OnOr 4 and 5were identified by 39RACE
with degenerate primers but were not represented by pyrosequen-
cing contigs. Conversely, ESTs representing OnOr6 were abun-
dantly represented by pyrosequencing contigs but were not
amplified using degenerate primers. These results illustrate the
benefit of using two complementary approaches to identify
candidate pheromone receptors, one dependent on sequence
homology and the other independent of sequence homology, but
dependent on adequate expression levels.
It was uncertain whether the pyrosequencing approach would
provide sufficient sequence coverage of rare transcripts to assemble
contigs that could be detected by tBLASTn searches. The full
length nucleotide sequences of OnOrs 1–6 used as queries for
BLASTn searches yielded only three new contigs (Figure S2).
These contigs were not detected in our original tBLASTn searches
because they contained intron or 39UTR sequence and less than
120 nt of coding sequence.
OnOrs 1 and 3–6 Are Expressed at Higher Levels in Male
Antennae
Expression levels of OnOrs 1 and 3–6, averaged from four
biological replications, were determined by quantitative real-time
PCR (qPCR). The transcripts of all five candidate pheromone
Corn Borer Sex Pheromones
PLoS ONE | www.plosone.org 2 January 2010 | Volume 5 | Issue 1 | e8685
receptors were expressed at higher levels in male antennae,
ranging from 14 to 100 times higher compared to female antennae
(Figure 1). OnOr2 was highly expressed at levels comparable to the
reference gene ribosomal protein S3 (OnRPS3) and only 1.6 times
higher in the male antennae. OnOr 1 and 6transcripts were
detected at similarly high levels, whereas the transcripts of OnOrs3–
5were approximately an order of magnitude less abundant
(Figure 1). In general, OnOrs1-6 were not expressed at significant
levels in other tissues such as legs, abdomen and mouthparts
(Figure S2). OnOr1 expression in female but not male mouthparts,
and OnOr3 expression in male but not female abdomens, may be
two interesting exceptions (Figure S2). Low level signal, more than
two orders of magnitude below that of the reference gene OnRPS3,
can result from non-specific PCR amplification that is detected by
the SYBR green dye or by genomic DNA contaminating the RNA
template. In addition to removing DNA from the RNA template
by enzyme digestion, false expression signal from contaminating
DNA was assessed by including RNA that was not reverse
transcribed. These negative controls did not produce signals of
expression confirming the purity of the RNA template. In
addition, several primer sets spanned an intron, and the absence
of larger-sized amplicon that would result from genomic DNA
template was confirmed by gel electrophoresis of the PCR product
and by its melting point curve.
Specific and Broad Responses of Different ECB Sex
Pheromone Receptors
Each of the five candidate ECB(Z) receptors was co-expressed
in Xenopus oocytes with the obligatory functional partner OnOr2,
and screened for responsiveness to a panel of ECB and ACB
pheromone components (Z12–14:OAc, E12–14:OAc, Z11–
14:OAc, and E11–14:OAc), and the antagonist Z9–14:OAc, at a
10 mM concentration (Figure 2). OnOr4/2 failed to be activated
by any of the components tested, with the exception of a very slight
response to the antagonist Z9–14:OAc (Figure 2C). Increasing the
concentration of Z9–14:OAc to 300 mM did not increase the
Figure 1. Male-biased expression of five ECB(Z) sex pheromone
receptor genes. Ratios of male to female expression (M:F) are
presented below each bar. Gene expression, determined by real-time
quantitative PCR with SYBR green, is reported relative to the reference
gene OnRPS3 on a logarithmic scale. Expression values are presented as
averages (with standard error bars) of four biological replicates and
three nested technical replicates. Sex-biased expression is supported by
nested ANOVA analyses of the normalized CT values, P = 0.03, 0.04,
0.001, 0.06, 0.001 and 0.003, OnOrs1-6 respectively.
doi:10.1371/journal.pone.0008685.g001
Figure 2. Functional screen of candidate ECB(Z) pheromone
receptors. Oocytes expressing OnOr2 and either OnOr1 (A), OnOr3 (B),
OnOr4 (C), OnOr5, (D) or OnOr6 (E) were challenged with 20 sec
applications (arrowheads) of various ECB and ACB pheromones (at
10 mM): Z9–14:OAc (Z9), Z12–14:OAc (Z12), E12–14:OAc (E12), Z11–
14:OAc (Z11), and E11–14:OAc (E11). Each application was separated by
10 min washing in ND96 (4.6 ml/min). Pheromone-induced currents
were measure by two-electrode voltage clamp electrophysiology.
doi:10.1371/journal.pone.0008685.g002
Corn Borer Sex Pheromones
PLoS ONE | www.plosone.org 3 January 2010 | Volume 5 | Issue 1 | e8685
response amplitude (unpublished results), suggesting that OnOr4/
2 may not be robustly expressed in our assay system, or the
receptor responds to a ligand not tested here. OnOr6/2 was
specifically activated only by Z11–14:OAc (Figure 2E). Surpris-
ingly, OnOr1/2, OnOr3/2, and OnOr5/2 responded to all five
components (Figure 2A, B and D). OnOr3/2 and OnOr5/2
exhibited only slight isomer selectivity, both favoring the E isomers
over the Z isomers. OnOr1/2 did not share this trend; it was more
selective for E12–14:OAc over Z12–14:OAc, but surprisingly, was
selective for Z11–14:OAc over E11–14:OAc.
OnOr6 Is a Highly Specific Receptor Tuned to
Z11–14:OAc
We next investigated the specificity of OnOr6/2 through a
range of pheromone concentrations. Dose-response analysis
revealed OnOr6/2 to be a sensitive receptor for Z11–14:OAc,
with an apparent EC
50
of 0.8660.27 mM (mean 6SEM, n = 4)
(Figure 3). Although E11–14:OAc began to elicit a receptor
response at higher concentrations, approximately half of this
response can be attributed to the small amount of Z11–14:OAc
present in our sample of E11–14:OAc (0.1%, personal commu-
nication, Pherobank, Wageningen, The Netherlands). If the
remaining response is truly due to E11–14:OAc, then OnOr6/2
is approximately 1000-fold selective for Z11–14:OAc over E11–
14:OAc. These results demonstrate that OnOr6/2 is highly
specific for Z11–14:OAc, exhibiting a strong degree of isomer
selectivity.
Based on Relative Efficacy, OnOr1 Responds Best to
E12–14:OAc
Although OnOr1/2 responded to all five components, this
receptor exhibited unique preferences as compared to OnOr3/2
and OnOr5/2. Therefore, dose-response analysis was performed
for all five pheromones (Figure 4). While OnOr1/2 was broadly
activated by the various pheromones with similar potencies, we
observed a wide range of relative efficacies that may provide a
mechanism for OnOr1/2 to differentiate among pheromone
isomers (Table 1). Based on this analysis, we conclude that E12–
14:OAc is the strongest activator of OnOr1/2.
Phylogenetic Relationship of OnOrs1-6 within the
Pheromone Receptor Subfamily
The 28 published Or sequences from 8 different species that
belong to the lepidopteran pheromone receptor subfamily group
together generally at the superfamily level of taxonomy (Figure 5).
OnOrs1, 3 and 6 are most related to each other and group
together with two Ors from the diamondback moth, Plutella
xylostella. OnOrs 4 and 5 group together on a separate lineage
along with an Or from the light brown apple moth Epiphyas
postvittana and an Or from the cucumber moth Diaphania indica.
With the current representation of published sequences there is no
clear relationship between pheromone receptor phylogeny and
their ligand response. For example, HvCr14 and PxOr1 both
respond best to Z11-16:OAc and HvCr13 and MSepOr1 both
respond best to Z11-16:Al (Figure 5)[31,37]. The receptors do not
appear to be orthologous in either case.
Discussion
Chemical communication in mating behavior is a prominent
feature of moth biology that has contributed to their extensive
divergence. To understand better how the molecular mechanisms
of sex pheromone detection evolve we identified and characterized
five sex pheromone receptors from the ECB(Z), a model example
of an early stage of speciation [38]. OnOr6 was particularly
interesting as it responded with high specificity and isomer
selectivity to Z11–14:OAc, the main component of the ECB(Z)
pheromone blend. Based on EC
50
values, OnOr6 is at least 1000
times more responsive to Z11–14:OAc compared to E11–14:OAc
(Figure 3). Importantly, these in vitro results correspond to in vivo
electrophysiological recordings that found a large-spiking neuron
in ECB(Z) males, and a small-spiking neuron in ECB(E) males that
responded specifically to Z11–14:OAc [22–23]. Consequently,
OnOr6(Z) should be expressed in the large-spiking neurons of
ECB(Z). Its ortholog in ECB(E) males is likely expressed in the
Figure 3. Dose-response relationships for Z11-14:OAc and E11-
14:OAc activation of OnOr6/2. Pheromone-induced currents were
measure by two-electrode voltage clamp electrophysiology. Refer to
Table 1 for EC
50
, Hill slope, and relative efficacy values. Data is
presented as means 6SEM (Z11–14:OAc, n = 4; E11–14:OAc, n = 5).
doi:10.1371/journal.pone.0008685.g003
Figure 4. Dose-response relationships for E12–14:OAc, Z12–14:OAc, Z11–14:OAc, E11–14:OAc and Z9–14:OAc activation of
OnOr1/2. Left and right graphs have different y-axis scales of the same data points. Pheromone-induced currents were measure by two-electrode
voltage clamp electrophysiology. Refer to Table 1 for EC
50
, Hill slope, and relative efficacy values. Data is presented as means 6SEM (E12–14:OAc,
n = 5; Z12–14:OAc, n = 6; Z11–14:OAc, n = 7; E11–14:OAc, n = 5; and Z9–14:OAc, n = 5).
doi:10.1371/journal.pone.0008685.g004
Corn Borer Sex Pheromones
PLoS ONE | www.plosone.org 4 January 2010 | Volume 5 | Issue 1 | e8685
small-spiking neurons, but further research will be required to test
this hypothesis.
We did not find a similar receptor that responded specifically to
E11–14:OAc. An additional sex pheromone receptor that responds
specifically to E11–14:OAc that was not identified by our approach
might also exist. Traditionally it has been thought that male moth
antennae possess olfactory neurons specifically tuned to each of the
components of the female sex pheromone blend [39–41]. Rather,
we found that the remaining pheromone receptors responded
generally and more broadly to the five compounds tested. OnOr1
responded to all five compounds tested with EC50s ranging from
0.26 uM to 2.73 uM (Table 1). BmOr1 and 3, the silkworm
bombykol and bombykal receptors, responded with similar
sensitivities to their pheromone ligands when co-expressed with
BmOr2 in Xenopus oocytes (EC50s 0.26 and 1.5 uM, respective-
ly)[18]. These results are similar to recent electrophysiological data
finding that the large-spiking neurons of ECB(E) males actually
respond more broadly in vivo [22–23]. This neuron responded best
to E11–14:OAc but it also responded to the Z11-, E12- and Z12-
14:OAc components. However, co-expression of two or more
pheromone receptors in the same olfactory neuron could also
explain the more broad in vivo responses [23].
The existence of more broadly-responsive sex-pheromone
receptors in vitro, and pheromone-sensitive olfactory neurons in
vivo, suggests that not all components of a pheromone blend need
to be detected with high specificity. Male moths respond to the
ratios of the major and minor components in a pheromone blend
[22]. If behavioral attraction requires activity of both neuron types
at specific ratios, behavioral specificity can be retained with one
highly-specific neuron and one more generally-responding neuron.
A combination of specific- and generally-responsive pheromone
receptors may provide the genetic variability for males to detect
and track shifts in female pheromone blend production [42].
‘Rare’ ECB and ACB males, typically representing 3–5% of the
population, are less specific in their behavioral response to related
pheromone blends [6]. Changes in the periphery that alter the
strength or specificity of the olfactory neuron’s response to specific
pheromone components could account for the rare responses
[22–24]. For example, a decrease in responsiveness of the small-
spiking neuron of rare ECB(E) males to Z12–14:OAc may alter the
firing ratio relative to the large-spiking neuron in a way that allows
the ACB blend to mimic the ECB(E) blend [22]. The antagonism-
related olfactory neuron of normal ACB males responds to Z11–
14:OAc in addition to Z9–14:OAc, preventing flight of ACB males
to the ECB pheromone blend. However, this response to Z11–
14:OAc in the antagonism pathway is lacking in rare ACB males
that fly to the ECB pheromone [24]. Amino acid polymorphisms
between alleles of a more broadly tuned Or could account for subtle
changes in olfactory neuron response. Such variation could also
provide the genetic material for the evolution of altered detection
and response to new pheromone blends [22]. OnOr1 in this study
exhibited a more efficacious response to the E12–14:OAc ligand. Its
ortholog in the ACB might be a candidate receptor for one of its
main pheromone components, E12–14:OAc.
Alternatively, the broad in vitro responses measured in this study
may not completely reflect their in vivo specificity. While the Ors are
clearly one of the major determinants of olfactory neuron specificity,
complexes of interacting proteins are involved in the signal
transduction, including sensory neuron membrane protein 1
(SNMP1) and pheromone binding proteins (PBPs) [43]. For
example, PBPs can increase physiological sensitivity to pheromone
ligands. BmOr1 expressed in the empty neurons of Drosophila ab3
sensilla is activated by the silkworm sex pheromone bombykol.
However, when co-expressed with BmPBP1, much lower concen-
trations of bombykol activate the BmOr1-expressing neuron [44].
PBPs may also affect the specificity of the physiological response to
sex phoromone. A PBP added to an in vitro assay altered the
specificity of a moth pheromone receptor, making its response more
specific [31]. Similarly, the responses of OnOr1 and 3 characterized
in this study may be more specific in vivo in the presence of PBPs.
Also, the responses of OnOr1 and 3–6 to a larger panel of
pheromone and general odors should be tested in future work.
OnOr5 in this study corresponds to an ECB Or that was recently
reported to respond to E11-tetradecen-1-ol, a pheromone compo-
nent used by ancestral species in the genus Ostrinia [7].
The male moth olfactory system that responds to the female-
produced sex pheromone is believed to be subject to stabilizing
selection. Duplication of desaturase enzyme genes and their
differential activation in the pheromone glands of female ECB and
ACB moths provides a mechanism for sudden changes in the
pheromone blend [45–46]. The origins of variation in male
detection and response that enable the evolution of new sex
pheromone blends has been a long-standing question [16]. To
address this, the asymmetric tracking hypothesis proposed that
male responses were broad enough to track changes in female
production [42]. Physiological studies of the pheromone-sensitive
ORNs of rare ECB males that respond to ACB pheromone
provided support for this hypothesis [22]. The existence of both
specifically- and broadly-responsive sex pheromone receptors may
represent a molecular mechanism; however, further in vitro and in
vivo experiments will be required to test this hypothesis.
Ethics Statement
The care and use of X. laevis frogs in this study were approved by
the University of Miami Animal Research Committee and meet
the guidelines of the National Institutes of Health.
Table 1. Summary data of the activation of OnOr1/2 and OnOr6/2 by ECB and ACB pheromones and the antagonist Z9–14:OAc.
OnOr1/2 EC
50
(mM6SEM) Hill slope Relative Efficacy (% response to Z11–14:OAc)
Z9–14:OAc 1.5460.33 1.85 36.162.8
Z12–14:OAc 2.7360.24 1.68 87.462.3
E12–14:OAc 0.2660.05 1.30 515630.9
Z11–14:OAc 0.3460.05 1.10 100.763.9
E11–14:OAc 1.9260.20 1.31 55.062.0
OnOr6/2
Z11–14:OAc 0.8660.27 0.91 100
doi:10.1371/journal.pone.0008685.t001
Corn Borer Sex Pheromones
PLoS ONE | www.plosone.org 5 January 2010 | Volume 5 | Issue 1 | e8685
Materials and Methods
Insects and RNA Extraction
ECB(Z) pupae were purchased from Benzon Research (Carlisle,
Pennsylvania) and provided from a colony maintained at the New
York State Agricultural Experiment Station. Antennae were
dissected from male and female adults within 3 days of emergence.
Mouthparts, legs, and abdomens were dissected separately. All
tissues were stored at 280uC. For gene expression studies antennae
were collected from four batches each consisting of 35–50 male and
35–50 female moths. RNA was extracted from frozen tissue using a
Dounce homogenizer and an RNeasy Mini kit (Qiagen, Valencia,
CA). RNA was quantified and assayed for purity by absorbance at
260 nm, 280 nm, and 230 nm using a NanoDrop 1000 Spectro-
photometer (Thermo Scientific, Waltham, MA).
Pyrosequencing and Or EST Identification
cDNA was prepared by the University of Illinois Urbana-
Champaign W.M. Keck Center for Comparative and Functional
Figure 5. Phylogenetic relatedness of OnOrs1-6 to the Lepidoptera sex pheromone receptor subfamily, neighbor-joining (corrected
distance) tree. Bootstrap values are presented as a percentage of n =1000 replicates at significant branch points. The tree is rooted with lepidopteran
orthologs of DmOr83b. The responses of receptors that have been functionally characterized are indicated by numbers corresponding to the 15
pheromone compounds listed, bolded numbers indicate the strongest response. Bm, Bombyx mori; Di, Diaphania indica;Ep,Epiphyas postvittana; Hv;
Heliothis virescens; Msex, Manduca sexta; On, Ostrinia nubilalis;Px,Plutella xylostella; Msep, Mythimna separata. Superfamily taxonomies are delineated by
vertical bars. ECB receptors reported in this study are bolded; OnOr1* was reported in [7] and is identical to OnOr5 in this study. Pheromone ligands: 1)
E11–14:OH; E11-tetradecen-1-ol, 2) Z9–14:Al; Z9-tetradecenal, 3) Z9–14:OAc; Z9-tetradecenyl acetate, 4) Z11–14:OAc; Z11-tetradecenyl acetate, 5) E11–
14:OAc; E11-tetradecenyl acetate, 6) Z12–14:OAc; Z12-tetradecenyl acetate, 7) E12–14:OAc; E12-tetradecenyl acetate, 8) Z11–16:OH; Z11-hexadecen-1-ol,
9) Z9–16:Al; Z9-hexadecenal, 10) Z11–16:Al; Z11-hexadecenal,11) E11–16:Al; E11-hexadecenal, 12) Z11–16:OAc; Z11-hexadecenyl acetate, 13) E11
16:OAc; E11-hexadecenyl acetate, 14) E10, Z12–16:OH; E10,Z12-hexadecadien-1-ol, and 15) E10, Z12–16:Al; E10,Z12-hexadecadienal.
doi:10.1371/journal.pone.0008685.g005
Corn Borer Sex Pheromones
PLoS ONE | www.plosone.org 6 January 2010 | Volume 5 | Issue 1 | e8685
Genomics from 200 mg of pooled antennal total RNA (100 mg
from male and female antennae). The cDNA was pyrosequenced
using a Roche 454 GS-FLX system and the sequence reads
assembled into contigs. FASTA files of the non-redundant contigs
were formatted as BLAST databases and searched using a PC
version of standalone BLAST. Silkworm Or sequences were used
as queries in tBLASTn searches to identify EST contigs with
homology to known lepidopteran sex pheromone receptors.
Detailed methods and results of the EST library will be presented
elsewhere.
Or Cloning
39and 59RACE-ready cDNA was generated from male ECB
antennal total RNA using the SMART RACE cDNA Amplifica-
tion kit (Clontech, Mountain View, CA). Forward and reverse
gene-specific primers designed from ESTs with homology to
lepidopteran sex-pheromone receptors were combined with the
SMART RACE primers (Invitrogen, Carlsbad, CA) to amplify
PCR products. PCR reactions used the Advantage 2 Polymerase
Mix (Clontech) under the following conditions: 94uC for 3
minutes, 24 cycles of 94ufor 20 seconds, 68ufor 6 minutes,
followed by 1 cycle of 72ufor 5 minutes. In some cases a second
internal gene-specific reverse primer was used for nested 59RACE.
39and 59RACE products were gel purified (Qiagen MinElute Gel
Extraction Kit), cloned into the TOPO pCR2.1 vector (Invitrogen
TOPO TA cloning kit) and sequenced in both directions. The
resulting sequences were used to design forward and reverse
primers (with restriction enzyme sites for pGEMHE) to amplify the
complete ORFs of five unique Ors (OnOrs1 &3–6) and the
DmOr83b ortholog. Each TOPO clone was sequenced in both
directions and the inserts subcloned into the pGEMHE vector
which was subsequently sequenced in both directions. The
relationships of translated Or sequences were analyzed by
constructing a neighbor-joining phylogenetic tree using PAUP
software [47]. Corrected distances were used to construct the tree
and uncorrected distances to perform bootstrap analysis (n = 1000
replicates) as described in [48].
Gene Expression
Genomic DNA was digested from Total RNA used for gene-
expression with the TURBO DNA-free kit (Applied Biosystems,
Foster City, CA). cDNA was synthesized from 300–600 ng of Total
RNA using SuperScript III Reverse Transcriptase (Invitrogen) and
50 mM Oligo(dT)
12–18
primer and incubated at 52uC for one hour
followed by inactivation at 70uC for 15 minutes. qPCR primers
were designed using Primer3 software [49] with the following
criteria: primers 15–30 base pairs in length, annealing temperature
58–60uC and a 75–100 nt amplicon. OnRPS3-F, TGGTAGTGT-
CTGGCAAGCTC, OnRPS3-R, CGTAGTCATTGCATGGGT-
CT; OnOr1-F, CGGCGTCAGCACCATGA, OnOr1-R, TCTCC-
CATTGTTTGCAGAATG; OnOr2-F,GCTCTGAAGAAGCCA-
AGACC, OnOr2-R, CAAGTCCAGTGAAACCGTGA; OnOr3-F,
GGCGCACCGCTCATATC, OnOr3-R, CCCAACGCTTTGAT-
GGTGAT; OnOr4-F, CTGGTGACCCTGGAGATGAT, OnOr4-
R, CAAATGCCTCGGATGTTTTAG; OnOr5-F, TCACGG-
TCGGCGTCACTA, OnOr5-R, TTCGCAAGAACATGAAG-
TAAGAAAA, OnOr6-F, AGAGACGGAAAAGCTGAAGG, and
OnOr6-R, TATCCCCAACATGGTGTTCA. Each primer set was
validated by calculating standard curves with 106serial dilutions of
template (three replicated wells for each template dose). The
threshold cycle (CT) was plotted against the log of the template
dilution and primers with slopes ranging from 3.1 to 3.5 were used
(a slope of 3.3 represents 100% efficiency).
qPCR experiments were performed using 96 well plates (Bio-
Rad, Hercules, CA), the IQ5 Real Time PCR Detection System
(Bio-Rad) and IQ SYBR Green Supermix (Bio-Rad). Each 15 ml
reaction was replicated in triplicate. Cycling conditions were as
follows: 95uC for 1 minute, 40 cycles of 95uC for 10 seconds and
58uC for 1 minute, followed by melting temperature analysis:
95uC for 1 minute, 58Cufor 1 minute and 67 cycles of 55–88Cu
for 10 seconds. Baseline cycle and threshold values were calculated
automatically using default settings. No-template and no-reverse
transcriptase controls were included in each experiment. As a final
validation, qPCR products were cloned into TOPO pCR-4 and
sequenced to ensure that the expected product was amplified.
Expression levels of OnOrs 1–6 were calculated relative to the
control gene, OnRpS3, using the 2
2DCT
method [50].
Preparation of Oocytes
Xenopus laevis frogs were purchased from Nasco (Fort Atkinson,
WI). The care and use of X. laevis frogs in this study were approved
by the University of Miami Animal Research Committee and
meet the guidelines of the National Institutes of Health. Frogs were
anesthetized by submersion in 0.1% 3-aminobenzoic acid ethyl
ester, and oocytes were surgically removed. Oocytes were
separated from follicle cells by treatment with collagenase B
(Roche, Indianapolis, IN) for 2 h at room temperature.
cRNA Injections
Capped cRNA encoding each candidate pheromone receptor
was synthesized from linearized template DNA cloned in
pGEMHE using mMessage mMachine kits (Ambion, Austin,
TX). cRNAs were then injected into Stage V-VI Xenopus oocytes at
a concentration of 25 ng/cRNA species/oocyte. Oocytes were
incubated at 18uC in Barth’s saline (in mM: 88 NaCl, 1 KCl, 2.4
NaHCO
3
, 0.3 CaNO
3
, 0.41 CaCl
2
, 0.82 MgSO
4
, 15 HEPES,
pH 7.6, and 100 mg/ml amikacin) for 2–5 days prior to
electrophysiological recording.
Electrophysiology and Data Analysis
Pheromone-induced currents were measured under two-elec-
trode voltage clamp using an automated parallel electrophysiology
system (OpusExpress 6000A; Molecular Devices, Union City, CA).
Micropipettes were filled with 3 M KCl and had resistances of
0.2–2.0 MV. The holding potential was 270 mV. Pheromones
were perfused with ND96 (in mM: 96 NaCl, 2 KCl, 1 CaCl
2
,1
MgCl
2
, 5 HEPES, pH 7.5). Pheromone stock solutions (1 M) were
prepared in DMSO and stored at 220uC. On the day of each
experiment, fresh dilutions were prepared in ND96. Unless
otherwise noted, pheromones were diluted in ND96 and applied
for 20 sec at a flow rate of 1.65 ml/min with extensive washing in
ND96 (10 min at 4.6 ml/min) between applications. Pheromone
compounds typically greater than 99% purity were purchased
from Pherobank, Plant Research International B.V., Wageningen,
The Netherlands. Current responses, filtered (4-pole, Bessel, low
pass) at 20 Hz (23 db) and sampled at 100 Hz, were captured and
stored using OpusXpress 1.1 software (Molecular Devices). Initial
analysis was done using Clampfit 9.1 software (Molecular Devices).
Dose-response analysis was done using PRISM 4 software
(GraphPad, San Diego, CA). Dose-response curves were fit
according to the equation: I~Imax=1zEC50 =XðÞ
n
ðÞ, where I
represents the current response at a given pheromone concentra-
tion, X;I
max
is the maximal response; EC
50
is the concentration of
pheromone yielding a half-maximal response; and n is the
apparent Hill coefficient. Relative efficacies of pheromones were
normalized to the maximal response elicited by Z11–14:OAc.
Corn Borer Sex Pheromones
PLoS ONE | www.plosone.org 7 January 2010 | Volume 5 | Issue 1 | e8685
Supporting Information
Text S1 Pyrosequencing contigs, FASTA nucleotide file.
Found at: doi:10.1371/journal.pone.0008685.s001 (0.03 MB
DOC)
Figure S1 ClustalX alignment of OnOrs1 and 3–6.
Found at: doi:10.1371/journal.pone.0008685.s002 (7.01 MB TIF)
Figure S2 Expression of OnOrs 1–6 in three different tissues of
adult male and female moths: A) heads (with mouthparts); B) legs;
and, C) abdomens. Gene expression, determined by real-time
quantitative PCR with SYBR green, is reported relative to the
reference gene OnRPS3. Expression was not detected in legs, no
values are reported on the graph.
Found at: doi:10.1371/journal.pone.0008685.s003 (0.26 MB TIF)
Table S1 Pyrosequencing contigs with homology to lepidopter-
an pheromone receptors.
Found at: doi:10.1371/journal.pone.0008685.s004 (0.03 MB
DOC)
Acknowledgments
K.W.W. thanks the Tom Blake lab (University of Montana) for the use of
their qPCR instrument. All authors thank the anonymous reviewers for
thoughtful and constructive comments to improve the manuscript.
Author Contributions
Conceived and designed the experiments: KWW ASN JEA HMR CWL.
Performed the experiments: KWW ASN JEA PLB SFG. Analyzed the
data: KWW ASN JEA CWL. Contributed reagents/materials/analysis
tools: KWW SFG CELJ. Wrote the paper: KWW ASN JEA CELJ CWL.
References
1. Carde RT, Haynes KF (2004) Structure of the pheromone communication
channel in moths. In: Carde RT, Millar JG, eds. Advances in Insect Chemical
Ecology. Cambridge: Cambridge University Press. pp 383–332.
2. Grimaldi D, Engel MS (2005) Evolution of the insects. Cambridge: Cambridge
University Press. 755 p.
3. Ando T, Inomata S, Yamam oto M (2004) Lepidopteran sex pheromones. Topics
in Current Chemistry 239: 951–961.
4. Lo¨fstedt C (1993) Moth pheromone genetics and evolution. Phil Trans Roy Soc
Lond B 340: 167–177.
5. Ishikawa Y, Takanashi T, Kim C-G, Hoshizaki S, Tatsuki S, et al. (1999) Ostrinia
spp. in Japan: their host plants and sex pheromones. Entomol Exp Appl 91:
237–244.
6. Linn CE Jr, Domingue MJ, Musto CJ, Baker TC, Roelofs WL (2007) Support
for (Z)-11-hexadecanal as a pheromone antagonist in Ostrinia nubilalis: flight
tunnel and single sensillum studies with a New York population. J Chem Ecol
33: 909–921.
7. Miura N, Nakagawa T, Tatsuki S, Touhara K, Ishikawa Y (2009) A male-
specific odorant receptor conserved through the evolution of sex pheromones in
Ostrinia moth species. Int J Biol Sci 5: 319–330.
8. Brindley TA, Sparks AN, Showers WB, Guthrie WD (1975) Recent research
advances on the European corn borer in North America. Ann Rev Entomol 20:
221–239.
9. Carde´ RT, et al. (1978) European Corn Borer: Pheromone Polymorphism or
Sibling Species? Science 199: 555–556.
10. Roelofs WL, Du JW, Tang HX, Robbinson PS, Eckenrode CJ (1985) Three
European corn borer populations in New York based on sex pheromones and
voltinism. J Chem Ecol 11: 829–836.
11. Klun JA, Bierl-Leonhardt BA, Schwarz M, Litsinger JA, Barrion AT, et al.
(1980) Sex pheromone of the Asian corn borer moth. Life Sci 27: 1603–1606.
12. Lo¨ fstedt C, Hansson BS, Roelofs W, Bengtsson BO (1989) No linkage between
genes controlling female pheromone production and male pheromone response
in the European corn borer, Ostrinia nubilalis Hu¨ bner (Lepidoptera; Pyralidae).
Genetics 123: 553–556.
13. Roelofs W, Glover T, Tang XH, Sreng I, Robbins P, et al. (1987) Sex
pheromone production and perception in European corn borer moths is
determined by both autosomal and sex-linked genes. Proc Natl Acad Sci USA 84:
7585–7589.
14. Dopman EB, Bogdanowicz SM, Harrison RG (2004) Genetic mapping of sexual
isolation between E and Z pheromone strains of the European corn borer
(Ostrinia nubilalis). Genetics 167: 301–309.
15. Dopman EB, Pe´rez L, Bogdanowicz SM, Harrison RG (2005) Consequences of
reproductive barriers for genealogical discordance in the European corn borer.
Proc Natl Acad Sci USA 102: 14706–14711.
16. Roelofs WL, Rooney AP (2003) Molecular genetics and evolution of pheromone
biosynthesis in Lepidoptera. Proc Natl Acad Sci USA 100: 9179–9184.
17. Schneider D (1992) 100 years of pheromone research, an essay on Lepidoptera.
Naturwissenschaften 79: 241–250.
18. Nakagawa T, Sakurai T, Nishioka T, Touhara K (2005) Insect sex-pheromone
signals mediated by specific combinations of olfactory receptors. Science 307:
1638–1642.
19. Krieger J, Grosse-Wilde E, Gohl T, Breer H (2005) Candidate pheromone
receptors of the silkworm Bombyx mori. Eur J Neurosci 21: 2167–2176.
20. Hansson BS, Lo¨ fstedt C, Roelofs WL (1987) Inheritance of olfactory response to
sex pheromone components in Ost rinia nubilalis. Naturwissensch aften 74:
497–499.
21. Hansson BS, Hallberg E, Lo¨ fstedt C, Steinbrecht RA (1994) Correlation
between dendrite diameter and action potential amplitude in sex pheromone
specific receptor neurons in male Ostrinia nubilalis (Lepidoptera: Pyralidae).
Tissue Cell 26: 503–512.
22. Domingue MJ, Musto CJ, Linn CE Jr, Roelofs WL, Baker TC (2007) Altered
olfactory receptor neuron responsiveness in rare Ostrinia nubilalis males attracted
to the O. furnacalis pheromone blend. J Insect Physiol 53: 1063–1071.
23. Domingue MJ, Musto CJ, Linn CE Jr, Roelofs WL, Baker TC (2007) Evidence
of olfactory antagonistic imposition as a facilitator of evolutionary shifts in
pheromone blend usage in Ostrinia spp. (Lepidoptera: Crambidae). J Insect
Physiol 53: 488–496.
24. Domingue MJ, Musto CJ, Linn CE Jr, Roelofs WL, Baker TC (2008) Olfactory
neuron responsiveness and pheromone blend preference in hybrids between
Ostrinia furnacalis and O. nubilalis (Lepidoptera: Crambidae). J Insect Physiol 54:
1261–1270.
25. Sato K, Pellegrino M, Nakagawa T, Nakagawa T, Vosshall LB, Touhara K
(2008) Insect olfactory receptors are heteromeric ligand-gated ion channels.
Nature 452: 1002–1006.
26. Wicher D, et al. (2008) Drosophila odorant receptors are both ligand-gated and
cyclic-nucleotide-activated cation channels. Nature 452: 1007–1011.
27. Smart R, Kiely A, Beale M, Vargas E, Carraher C, et al. (2008) Drosophila
odorant receptors are novel seven transmembrane domain proteins that can
signal independently of heterotrimeric G proteins. Insect Biochem Mol Biol 38:
770–780.
28. Benton R, Sachse S, Michnick SW, Vosshall LB (2006) Atypical membrane
topology and heteromeric function of Drosophila odorant receptors in vivo. PLoS
Biol 4(2): e20. doi:10.1371/journal.pbio.0040020.
29. Krieger J, Grosse-Wilde E, Gohl T, Dewer YM, Raming K, et al. (2004) Genes
encoding candidate pheromone receptors in a moth (Heliothis virescens). Proc Natl
Acad Sci USA 101: 11845–11850.
30. Wanner KW, Anderson AR, Trowell SC, Theilmann DA, Robertson HM, et al.
(2007) Female-biased expression of odorant receptor genes in the adult antennae
of the silkworm, Bombyx mori. Insect Mol Biol 16: 107–119.
31. Grosse-Wilde E, Gohl T, Bouche´ E, Breer H, Krieger J (2007) Candidate
pheromone receptors provide the basis for the response of distinct antennal
neurons to pheromonal compounds. Eur J Neurosci 25: 2364–2373.
32. Ha TS, Smith DP (2006) A pheromone receptor mediates 11-cis-vaccenyl
acetate-induced responses in Drosophila. J Neurosci 26: 8727–8733.
33. Kurtovic A, Widmer A, Dickson BJ (2007) A single class of olfactory neurons
mediates behavioural responses to a Drosophila sex pheromone. Nature 446:
542–546.
34. Ka´rpa´ ti Z, Dekker T, Hansson BS (2008) Reversed functional topology in the
antennal lobe of the male European corn borer. J Exp Biol 211: 2841–2848.
35. Hallem EA, Ho MG, Carlson JR (2004) The molecular basis of odor coding in
the Drosophila antenna. Cell 117: 965–979.
36. Wanner KW, Robertson HM (2009) Lepidopteran Chemoreceptors. In:
Goldsmith MR, Marec F, eds. Molecular biology and genetics of Lepidoptera.
New York: CRC Press. pp 153–168.
37. Mitsuno H, Sakurai T, Murai M, Yasuda T, Kugimiya S, et al. (2008)
Identification of rece ptors of main sex-pheromon e components of three
Lepidopteran species. Eur J Neurosci 28: 893–902.
38. Pe´lozuelo L, Meusnier S, Audiot P, Bourguet D, Ponsard S (2007) Assortative
mating between European corn borer pheromone races: beyond assortative
meeting. PLoS ONE 2(6): e555. doi:10.1371/journal.pone.0000555.
39. Van der Pers JNC, Den Otter CJ (1978) Single cell responses from olfactory
receptors of small ermine moths to sex-attractants. J Insect Physiol 24: 337–343.
40. Hansson BS, Blackwell A, Hallberg E, Lofqvist J (1995) Physiological and
morphological characteristics of the sex pheromone detecting system in male
corn stemborers, Chilo partellus (Lepidoptera: Pyralidae). J Insect Physiol 41:
171–178.
41. Larsson MC, Hallberg E, Kozlov MV, Francke W, Hansson BS, et al. (2002)
Specialized olfactory receptor neurons media ting intra- and interspeci fic
chemical communication in leafminer moths Eriocrania spp. (Lepidoptera:
Eriocraniidae). J Exp Biol 205: 989–998.
Corn Borer Sex Pheromones
PLoS ONE | www.plosone.org 8 January 2010 | Volume 5 | Issue 1 | e8685
42. Phelan PL (1997) Genetics and phylogenetics in the evolution of sex
pheromones. In: Carde RT, Minks AK, eds. Insect Pheromone Research: New
Directions. New York: Chapman & Hall. pp 563–579.
43. Rutzler M, Zwiebel LJ (2005) Molecular biology of insect olfaction: recent
progress and conceptual models. J Comp Physiol A Neuroethol Sens Neural
Behav Physiol 191: 777–790.
44. Syed Z, Ishida Y, Taylor K, Kimbrell DA, Leal WS (2006) Pheromone reception
in fruit flies expressing a moth’s odorant receptor. Proc Natl Acad Sci U S A.
103: 16538–16543.
45. Roelofs WL, Liu W, Hao G, Jiao H, Rooney AP, et al. (2002) Evolution of moth
sex pheromones via ancestral genes. Proc Natl Acad Sci USA 99: 13621–1 3626.
46. Xue B, Rooney AP, Kajikawa M, Okada N, Roelofs WL (2007) Novel sex
pheromone desaturases in the genomes of corn borers generated through gene
duplication and retroposon fusion. Proc Natl Acad Sci USA 104: 4467–4472.
47. Swofford DL (2001) PAUP*. Phylogenetic Analysis Using Parsimony (*and
Other Methods). Version 4. Sinauer Associates, Sunderland, MA.
48. Wanner KW, Robertson HM (2008) The gustatory receptor family in the
silkworm moth Bombyx mori is characterized by a large expansion of a single
lineage of putative bitter receptors. Insect Mol Biol 17: 621–629.
49. Rozen S, Skaletsky HJ (2000) Primer3 on the WWW for general users and for
biologist programmers. In: Krawetz S, Misener S, eds (2000) Bioinformatics
Methods and Protocols: Methods in Molecular Biology. Totowa: Humana Press.
pp 365–386.
50. Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using
real-time quantitative PCR and the 2DDCt method. Methods 25: 402–408.
Corn Borer Sex Pheromones
PLoS ONE | www.plosone.org 9 January 2010 | Volume 5 | Issue 1 | e8685
    • Moreover, a remarkable peculiarity of the genetic structure of marine iguanas is found in the island of San Cristó bal, where two genetically distinct subspecies are in an ongoing speciation process within the same island (MacLeod et al., 2015;Miralles et al., 2017). One of the most important mechanisms driving speciation through chemical signals is a mutation in a receptor that switches the specificity for a given pheromone compound (Leary et al., 2012). This process promotes the development of divergent pheromones, thereby establishing pre-mating barriers and precluding gene flow between populations.
    [Show abstract] [Hide abstract] ABSTRACT: Background Chemical signals are widely used in the animal kingdom, enabling communication in various social contexts, including mate selection and the establishment of dominance. Femoral glands, which produce and release waxy secretions into the environment, are organs of central importance in lizard chemical communication. The Galápagos marine iguana (Amblyrhynchus cristatus) is a squamate reptile with a lek-mating system. Although the lekking behaviour of marine iguanas has been well-studied, their potential for sexual communication via chemical cues has not yet been investigated. Here we describe the diversity of the lipophilic fraction of males’ femoral gland secretions among 11 island populations of marine iguanas, and compare it with the composition of its sister species, the Galápagos land iguana (Conolophus subcristatus). We also conducted behavioural observations in marine iguana territorial males in order to explore the possible function of these substances in the context of male dominance in leks. Methods Femoral secretions were analysed by gas chromatography coupled to mass spectrometry (GC–MS), and chromatography with a flame ionisation detector (GC-FID) in order to characterise the lipophilic composition. To understand the potential role of femoral secretions in marine iguana intraspecific communication, territorial males were sampled for their femoral glands and monitored to record their head bob rate—a territorial display behaviour in males—as well as the number of females present in their leks. Results We found that the gland secretions were composed of ten saturated and unsaturated carboxylic acids ranging in chain length between C16 and C24, as well as three sterols. Cholesterol was the main compound found. Intriguingly, land iguanas have a higher diversity of lipophilic compounds, with structural group of lipids (i.e. aldehydes) entirely absent in marine iguanas; overall the chemical signals of both species were strongly differentiated. Lipid profiles also differed among populations of marine iguanas from different islands, with some islands demonstrating a high diversity of lipophilic compounds (i.e. full spectra of compounds), and others lacking one or more compounds. Among the compounds most frequently found missing were 11- and 13-eicosenoic acids. Gland secretions of males with a better body condition and with a higher dominance status (i.e. those accompanied by females and with higher head bob display) were proportionately richer in C20-unsaturated fatty acids (11-eicosenoic acid). Discussion Land and marine iguanas strongly diverged in their chemical composition of the femoral glands likely due to ecological differences between both species. Despite that marine iguana populations varied in their femoral gland composition that was not related to their genetic structure. Our results indicated that 11-eicosenoic acid may play an important role in intraspecific chemical communication in marine iguanas.
    Full-text · Article · Aug 2017
    Alejandro Ibáñez+1 more author...
    • Previous studies have highlighted the importance of divergence in orthologous chemosensory receptor genes in the divergence of insect species and/or populations (Leary et al. 2012;Smadja et al. 2012;Eyres et al. 2017). For example,Leary et al. (2012)showed that positive selection of specific amino acid substitutions in OR orthologs led to novel receptor functions through changes in ligand binding affinities in Ostrinia moths. Under this model, orthologous OR genes undergo functional divergence driven by positive selection in the absence of a duplication event.
    [Show abstract] [Hide abstract] ABSTRACT: Insects rely on chemical information to locate food, choose mates, and detect potential predators. It has been hypothesized that adaptive changes in the olfactory system facilitated the diversification of numerous insect lineages. For instance, evolutionary changes of Odorant Receptor (OR) genes often occur in parallel with modifications in life history strategies. Corbiculate bees display a diverse array of behaviors that are controlled through olfaction, including varying degrees of social organization, and manifold associations with floral resources. Here we investigated the molecular mechanisms driving the evolution of the OR gene family in corbiculate bees in comparison to other chemosensory gene families. Our results indicate that the genomic organization of the OR gene family has remained highly conserved for 80 Myr, despite exhibiting major changes in repertoire size among bee lineages. Moreover, the evolution of OR genes appears to be driven mostly by lineage-specific gene duplications in few genomic regions that harbor large numbers of OR genes. A selection analysis revealed that OR genes evolve under positive selection, with the strongest signals detected in recently duplicated copies. Our results indicate that chromosomal translocations had a minimal impact on OR evolution, and instead local molecular mechanisms appear to be main drivers of OR repertoire size. Our results provide empirical support to the longstanding hypothesis that positive selection shaped the diversification of the OR gene family. Together, our results shed new light on the molecular mechanisms underlying the evolution of olfaction in insects.
    Full-text · Article · Aug 2017
    • One hypothesis for the difference in olfactory responses between X. birchmanni and X. malinche females is that the odorant receptor proteins in the olfactory periphery are functionally divergent between species[58]. Using orthologous sequences from five Xiphophorus species, representing all three major clades[28], we found better support for the M8 model assuming some non-zero proportion of the sites with a dN/dS ratio. 1 (conserved þ neutral 0 , v1 1 b distributed, and faster-than-neutral: v2. 1) compared to the null model assuming only 0 , v1 1 (model M7) or the null model having v2 fixed at 1 (M8a) on four V2R receptors (electronic supplementary material, table S8; M8– M7 p , 0.05, M8–M8a p , 0.02, electronic supplementary material,figure S9), one OR receptor (M8–M7 p , 0.05, M8– M8a p , 0.02, electronic supplementary material,figure S10) and five TAAR receptors (M8–M7 p , 0.05, M8–M8a p , 0.02, electronic supplementary material,figure S11).
    [Show abstract] [Hide abstract] ABSTRACT: Mate choice can play a pivotal role in the nature and extent of reproductive isolation between species. Mating preferences are often dependent on an individual's social experience with adult phenotypes throughout development. We show that olfactory preference in a swordtail fish (Xiphophorus malinche) is affected by previous experience with adult olfactory signals. We compare transcriptome-wide gene expression levels of pooled sensory and brain tissues between three treatment groups that differ by social experience: females with no adult exposure, females exposed to conspecifics and females exposed to heterospecifics. We identify potential functionally relevant genes and biological pathways differentially expressed not only between control and exposure groups, but also between groups exposed to conspecifics and heterospecifics. Based on our results, we speculate that vomeronasal receptor type 2 paralogs may detect species-specific phero-mone components and thus play an important role in reproductive isolation between species.
    Full-text · Article · May 2017
    • Divergence in male flight response to female pheromone can limit 80% of gene flow between strains (Dopman et al. 2010). Male pheromone preference is due to one or more QTL on the Z chromosome, and sex-linked preference traits include differences in male flight response to female pheromone (Dopman et al. 2004; Koutroumpa et al. 2016 ), differences in male neuroanatomy and physiology (K arp ati et al. 2008, 2010) and differences in antennal expression of olfactory receptors (OR) genes showing ligand specificity to Z-11 (OR6) or the E-11 pheromone components (OR3) (Miura et al. 2010; Wanner et al. 2010; Yasukochi et al. 2011; Leary et al. 2012; Koutroumpa et al. 2014 ). Genes encoding OR3 and OR6 are physically linked <1 Mb apart (Yasukochi et al. 2011 ) and located within the ECB rearrangement in one pedigree mapping family (Lassance et al. 2011).
    [Show abstract] [Hide abstract] ABSTRACT: Chromosomal rearrangements between sympatric species often contain multiple loci contributing to assortative mating, local adaptation, and hybrid sterility. When and how these associations arise during the process of speciation remains a subject of debate. Here, we address the relative roles of local adaptation and assortative mating on the dynamics of rearrangement evolution by studying how a rearrangement co-varies with sexual and ecological trait divergence within a species. Previously, a chromosomal rearrangement that suppresses recombination on the Z (sex) chromosome was identified in European corn borer moths (Ostrinia nubilalis). We further characterize this recombination suppressor and explore its association with variation in sex pheromone communication and seasonal ecological adaptation in pairs of populations that are divergent in one or both of these characteristics. Direct estimates of recombination suppression in pedigree mapping families indicated that more than 39% of the Z chromosome (encompassing up to ~10 megabases and ~ 300 genes) resides within a non-recombining unit, including pheromone olfactory receptor (OR) genes and a major quantitative trait locus (QTL) that contributes to ecotype differences (Pdd). Combining direct and indirect estimates of recombination suppression, we found that the rearrangement was occasionally present between sexually isolated strains (E versus Z) and between divergent ecotypes (univoltine versus bivoltine). However, it was only consistently present when populations differed in both sexual and ecological traits. Our results suggest that independent of the forces that drove the initial establishment of the rearrangement, a combination of sexual and ecological divergence is required for rearrangement spread during speciation. This article is protected by copyright. All rights reserved.
    Article · Jan 2017
    • This pattern was particularly exciting because it suggests that these genes might play a key role in physiological or ecological functions in Pyrrhalta that might contribute to reproductive isolation. Myriad ecological factors may have promoted differentiation of chemosensory genes between sympatric sister species, including changes in mating ecology (Leary et al., 2012) and host shifts (Smadja et al., , 2012). For the sister beetle species studied here, previous studies have demonstrated that the difference in female cuticular hydrocarbons have caused divergence in male mate recognition (Zhang et al., 2014a), and that differences in leaf wax profiles of plants differing in age could also lead to divergent selection (Zhang et al., 2015).
    [Show abstract] [Hide abstract] ABSTRACT: Divergence in chemosensory traits has been posited as an important component of chemosensory speciation in insects. In particular, chemosensory genes expressed in the peripheral sensory neurons are likely to influence insect behaviors such as preference for food, oviposition sites, and mates. Despite their key role in insect behavior and potentially speciation, the underlying genetic basis for divergence in chemosensory traits remains largely unexplored. One way to ascertain the role of chemosensory genes in speciation is to make comparisons of these genes across closely related species to detect the genetic signatures of divergence. Here, we used high throughput transcriptome analysis to compare chemosensory genes of the sister leaf beetles species Pyrrhalta maculicollis and P. aenescens, whose sexual isolation and host plant preference are mediated by divergent chemical signals. Although there was low overall divergence between transcriptome profiles, there were a number of genes that were differentially expressed between the species. Furthermore, we also detected two chemosensory genes under positive selection, one of which that was also differentially expressed between the species, suggesting a possible role for these genes in chemical-based premating reproductive isolation and host use. Combined with the available chemical and ecological work in this system, further studies of the divergent chemosensory genes presented here will provide insight into the process of chemosensory speciation among Pyrrhalta beetles.
    Article · Nov 2016
    • To monitor the expression pattern of OR12 in adult H. armigera, RT-PCR was carried out using cDNA templates from different tissues. A house-keeping gene encoding ribosomal protein S3 (RPS3; GenBank accession number: KT962961) was used as a control [41]. All PCR products migrated with bands of the predicted sizes and their identity was confirmed by sequencing.
    [Show abstract] [Hide abstract] ABSTRACT: Odorant receptors (ORs) play an important role in insects to monitor and adapt to the external environment, such as host plant location, oviposition-site selection, mate recognition and natural enemy avoidance. In our study, we identified and characterized OR12 from three closely-related species, Helicoverpa armigera, Helicoverpa assulta, Heliothis virescens, sharing between 90 and 98% of their amino acids. The tissue expression pattern analysis in H. armigera showed that HarmOR12 was strongly expressed both in male and female antennae, but not in other tissues. Functional analysis performed in the heterologous Xenopus expression system showed that all three OR12 were tuned to six structurally related plant volatiles. Electroantennogram recordings from male and female antennae of H. armigera closely matched the data of in vitro functional studies. Our results revealed that OR12 has a conserved role in Heliothinae moths and might represent a suitable target for the control of these crop pests.
    Full-text · Article · May 2016
Show more

Supplementary resources

Article
August 2014 · Journal of Economic Entomology · Impact Factor: 1.51
    The success of mating disruption using synthetic sex pheromones depends not only on preventing mating, but also on delayed mating in the target insect. Using the rice leaffolder moth, Cnaphalocrocis medinalis (Guenée), we determined the effect of increased age at mating imposed on males only (male treatment), females only (female treatment), or on both sexes simultaneously (both sexes... [Show full abstract]
    Conference Paper
    December 2009
      The microlepidopteran family Choreutidae is distributed worldwide, with most of its species diversity found in the tropics. Through a massive campaign of rearing caterpillars in Papua New Guinea, a number of metalmark moth species were obtained. In this presentation, we will describe the diversity of this moth family in New Guinea and host specificity of the species found there.
      Discover more