Analysis of the epigenetic status of telomeres by using ChIP-seq data

Instituto de Bioquímica Vegetal y Fotosíntesis, CSIC-Universidad de Sevilla, IBVF (CSIC-USE), c/ Américo Vespucio n° 49, 41092 Seville, Spain and Department of Plant Biology and Pathology, Rutgers University, New Brunswick, NJ, USA.
Nucleic Acids Research (Impact Factor: 9.11). 08/2012; 40(21). DOI: 10.1093/nar/gks730
Source: PubMed
ABSTRACT
The chromatin structure of eukaryotic telomeres plays an essential role in telomere functions. However, their study might
be impaired by the presence of interstitial telomeric sequences (ITSs), which have a widespread distribution in different
model systems. We have developed a simple approach to study the chromatin structure of Arabidopsis telomeres independently
of ITSs by analyzing ChIP-seq data. This approach could be used to study the chromatin structure of telomeres in some other
eukaryotes. The analysis of ChIP-seq experiments revealed that Arabidopsis telomeres have higher density of histone H3 than
centromeres, which might reflects their short nucleosomal organization. These experiments also revealed that Arabidopsis telomeres
have lower levels of heterochromatic marks than centromeres (H3K9Me2 and H3K27Me), higher levels of some euchromatic marks (H3K4Me2 and H3K9Ac) and similar or lower levels of other euchromatic marks (H3K4Me3, H3K36Me2, H3K36Me3 and H3K18Ac). Interestingly, the ChIP-seq experiments also revealed that Arabidopsis telomeres exhibit high levels of H3K27Me3, a repressive mark that associates with many euchromatic genes. The epigenetic profile of Arabidopsis telomeres is closely
related to the previously defined chromatin state 2. This chromatin state is found in 23% of Arabidopsis genes, many of which
are repressed or lowly expressed. At least, in part, this scenario is similar in rice.

Full-text

Available from: Miguel A Vega-Palas, Feb 13, 2015
Analysis of the epigenetic status of telomeres
by using ChIP-seq data
Marı
´
a I. Vaquero-Sedas
1
, Chongyuan Luo
2
and Miguel A. Vega-Palas
1,
*
1
Instituto de Bioquı
´
mica Vegetal y Fotosı
´
ntesis, CSIC-Universidad de Sevilla, IBVF (CSIC-USE), c/ Ame
´
rico
Vespucio n
49, 41092 Seville, Spain and
2
Department of Plant Biology and Pathology, Rutgers University,
New Brunswick, NJ, USA
Received June 8, 2012; Accepted July 6, 2012
ABSTRACT
The chromatin structure of eukaryotic telomeres
plays an essential role in telomere functions.
However, their study might be impaired by the
presence of interstitial telomeric sequences (ITSs),
which have a widespread distribution in different
model systems. We have developed a simple
approach to study the chromatin structure of
Arabidopsis telomeres independently of ITSs by
analyzing ChIP-seq data. This approach could be
used to study the chromatin structure of telomeres
in some other eukaryotes. The analysis of ChIP-seq
experiments revealed that Arabidopsis telomeres
have higher density of histone H3 than centromeres,
which might reflects their short nucleosomal organ-
ization. These experiments also revealed that
Arabidopsis telomeres have lower levels of hetero-
chromatic marks than centromeres (H3K9
Me2
and
H3K27
Me
), higher levels of some euchromatic
marks (H3K4
Me2
and H3K9Ac) and similar or lower
levels of other euchromatic marks (H3K4
Me3
,
H3K36
Me2
, H3K36
Me3
and H3K18Ac). Interestingly,
the ChIP-seq experiments also revealed that
Arabidopsis telomeres exhibit high levels of
H3K27
Me3
, a repressive mark that associates with
many euchromatic genes. The epigenetic profile of
Arabidopsis telomeres is closely related to the pre-
viously defined chromatin state 2. This chromatin
state is found in 23% of Arabidopsis genes, many
of which are repressed or lowly expressed.
At least, in part, this scenario is similar in rice.
INTRODUCTION
Telomeres prevent chromosome fusions and degradation
by exonucleases and are implicated in DNA repair, hom-
ologous recombination, chromosome pairing and segrega-
tion. Telomeric DNA usually contains tandem repeats of a
short GC-rich motif, which can also be found at intersti-
tial chromosomal loci (1–5). These interstitial telomeric
sequences (ITSs) have a widespread distribution in differ-
ent model systems, including Arabidopsis, and have been
related to chromosomal aberrations, fragile sites,
hot spots for recombination and diseases caused by
genomic instability, although their functions remain
unknown (5–8).
Two major chromatin organizations can be found inside
the cell nucleus: heterochromatin and euchromatin.
Heterochromatic regions are highly condensed in inter-
phase nuclei giving rise to the so-called chromocenters
and usually associate with repetitive and silent DNA,
although certain level of transcription is required for
their establishment and maintenance. By contrast, euchro-
matic regions have an open conformation and are often
related to the capacity to be transcribed. Both kinds of
chromatin organizations exhibit defined epigenetic modi-
fications that influence their biochemical behavior. In
Arabidopsis, chromocenters contain pericentromeric het-
erochromatin, which associates with the 178-bp satellite
repeats (also known as 180-bp repeats) and with other
repetitive DNA sequences including mobile elements and
ITSs (9–15). Arabidopsis heterochromatin is characterized
by high levels of cytosine methylation, which can be
targeted at CpG, CpNpG or CpNpN residues (where N
is any nucleotide), and by H3K9
Me1,2
, H3K27
Me1,2
and
H4K20
Me1
. In turn, Arabidopsis euchromatin is
characterized by H3K4
Me1,2,3
, H3K36
Me1,2,3
, H4K20
Me2,3
and by histones acetylation (16). In addition, many genes
that localize in Arabidopsis euchromatin are labeled with
H3K27
Me3
, a repressive mark that is thought to regulate
tissue-specific gene expression (17–19).
The analysis of telomeric chromatin structure from
ChIP, ChIP-on-chip or ChIP-seq experiments might be
challenged by the presence of ITSs (20). This problem
might also be extensive to other repetitive sequences.
Here, we have developed an approach to study the epigen-
etic modifications of Arabidopsis telomeres independently
of ITSs by analyzing genome-wide ChIP-seq data. The
ChIP-seq experiments revealed that Arabidopsis telomeres
*To whom correspondence should be addressed. Tel: +34 954 489574; Fax: +34 954 460065; Email: vega-palas@ibvf.csic.es
Published online 1 August 2012 Nucleic Acids Research, 2012, Vol. 40, No. 21 e163
doi:10.1093/nar/gks730
ß The Author(s) 2012. Published by Oxford University Press.
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/
by-nc/3.0), which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Page 1
have higher density of histone H3 than centromeres. These
experiments also revealed that Arabidopsis telomeres have
lower levels of heterochromatic marks than centromeres
(H3K9
Me2
and H3K27
Me
), higher levels of some euchro-
matic marks (H3K4
Me2
and H3K9Ac) and similar or
lower levels of other euchromatic marks (H3K4
Me3
,
H3K36
Me2
, H3K36
Me3
and H3K18Ac). Interestingly, the
ChIP-seq data also revealed that Arabidopsis telomeres
exhibit higher levels of H3K27
Me3
than centromeres. At
least, in part, this scenario is similar in rice.
MATERIALS AND METHODS
Determination of the relative amounts of (CCCTAAA)
4
sequences at telomeres and ITSs
To analyze the chromatin structure of Arabidopsis telo-
meres using genome-wide ChIP-seq experiments, we had
to define a specific DNA sequence that revealed telomeres
but not ITSs. For that purpose, we estimated the number of
times that the sequence (CCCTAAA)
4
appears at internal
chromosomal loci and at telomeres in the Arabidopsis
thaliana (Col-0) genome. First, we performed Blast
analyses at the Map Viewer web site in National Center
for Biotechnology Information (NCBI) to determine the
number of times that the sequence (CCCTAAA)
4
appears
at internal chromosomal loci (http://www.ncbi.nlm.nih.
gov/mapview). In the case that a specific ITS contained
five perfect tandem telomeric repeats, the Blast analyses
revealed two overlapping (CCCTAAA)
4
sequences. If the
ITS contained six perfect tandem telomeric repeats, the
Blast analyses revealed three overlapping (CCCTAAA)
4
sequences and so on. We found 118 (CCCTAAA)
4
se-
quences at internal positions in the five chromosomes of
Arabidopsis, including subtelomeric regions.
To estimate the number of times that the sequence (CC
CTAAA)
4
is found at Arabidopsis telomeres, we assumed
that Arabidopsis thaliana (Col-0) telomeres are composed
of perfect telomeric repeats that spread about 3750 bp
(21,22). We estimated that the five Arabidopsis chromo-
somes should contain about 5350 overlapping (CCCTAA
A)
4
sequences at telomeres [(3750/7) 10]. Therefore,
when the frequency of reads containing the sequence (C
CCTAAA)
4
is determined in input samples of Arabidopsis
ChIP-seq experiments, only 2% of these reads should cor-
respond to ITSs [(118 100)/(118+5350)]. In conse-
quence, the frequency of the (CCCTAAA)
4
sequence
should essentially reveal telomeres in Arabidopsis
ChIP-seq experiments. In the case of rice (Oryza sativa
ssp. japonica cv. Nipponbare), the frequency of the (CC
CTAAA)
4
sequence should also reveal telomeres. The rice
genome contains a similar number of (CCCTAAA)
4
sequences at internal chromosomal loci than Arabidopsis
(127), has more chromosomes (twelve) and similar telo-
meric length (23).
Determination of enrichment values
We used the Sequence Read Archive database at NCBI
to study different epigenetic modifications in Arabidopsis
and in rice telomeres. In Arabidopsis, we analyzed all the
experiments from study SRP002100 (Gene Expression
Omnibus accession number GSE28398). This ChIP-seq
study was performed using aerial tissue (24).
We determined the number of reads containing the (CC
CTAAA)
4
sequence and the number of reads containing
the sequence TTGGCTTTGTATCTTCTAACAAG,
which is a conserved region of the 178-bp satellite
repeats present at centromeres. This sequence served as
heterochromatic reference (12,15). Although a fraction
of the 178-bp sequences associates with CENH3 chroma-
tin, surrounding 178-bp repeats associate with H3 chro-
matin. The conserved sequence that we have selected
spans from positions 56 to 79 of the repeats and do not
contain motifs specifically associated with CENH3 chro-
matin (15). Thus, this sequence is present at the centro-
meric 178-bp repeats that associate with CENH3
chromatin and also at the 178-bp repeats that associate
with H3 chromatin. It allowed us to analyze the chromatin
organization of Arabidopsis 178-bp satellite repeats as an
average, which is known to be heterochromatic
(9–11,15,25).
The study mentioned earlier in the text focused on nine
epigenetic modifications named H3K4
Me2
, H3K4
Me3
,
H3K9
Me2
, H3K27
Me
, H3K27
Me3
, H3K36
Me2
, H3K36
Me3
,
H3K9Ac and H3K18Ac. The number of telomeric and
centromeric reads corresponding to all these epigenetic
marks were determined (Supplementary Table S1) and
normalized against the input sample. Then, enrichment
values of telomeres versus centromeres were calculated
and normalized against histone H3 occupancy. The result-
ing values are represented in Figure 1. Similar results to
those shown in Figure 1 were obtained when a different
conserved sequence from the 178-bp satellite repeats was
used to estimate relative enrichment values (data not
shown). This sequence (CATATTTGACTCCAAAACA
CTAA) contains the dinucleotide TG at positions 160–
161 of the 178-bp repeats and is not frequent in CENH3
chromatin (15).
The enrichment values for H3K4
Me3
and H3K9Ac were
also calculated by analyzing experiments from a different
ChIP-seq study (SRP002650; GSE22276), which was per-
formed using Arabidopsis leaves (26). The enrichment
values obtained for these two epigenetic marks were very
similar to those shown in Figure 1: 0.7 for H3K4
Me3
and
3.3 for H3K9Ac.
For rice (O. sativa ssp. japonica cv. Nipponbare), en-
richment values were calculated by analyzing experiments
SRX016118, SRX016122, SRX016126 and SRX016130
from study SRP001788 (GSE19602). These experiments
were performed using four-leaf stage seedlings (27). The
number of reads containing the (CCCTAAA)
4
sequence
and the number of reads containing the sequence CGTTC
GTGGCAAAAACTCACTTCGT, which is part of the
CentO-1 centromeric satellite repeat (positions 1–25)
(28), were determined for four epigenetic modifications
(H3K4
Me3
, H3K9Ac, H3K27
Me3
and DNA methylation;
see Supplementary Table S2). The CentO repeats, which
are known to undergo DNA methylation similarly to the
178-bp repeats from Arabidopsis, served as heterochro-
matic reference (29–31). Since study SRP001788 did not
include input samples, relative enrichment values were
calculated. The number of reads corresponding to the
e163 Nucleic Acids Research, 2012, Vol. 40, No. 21 P
AGE 2 OF 6
Page 2
telomeric sequence was divided by the number of CentO-1
reads for every epigenetic modification. Then, relative en-
richment values were calculated by normalizing against
the resulting value for DNA methylation. To obtain a
graphic representation with similar values to those
shown in Figure 1, all the relative enrichment values
were divided by 10.
RESULTS
Epigenetic marks at Arabidopsis telomeres
To study the epigenetic modifications present at
Arabidopsis telomeres, we analyzed ChIP-seq data. We
determined the relative enrichment of telomeres versus
centromeres, which served as heterochromatic reference.
Previously, we had to find a specific sequence that repre-
sents telomeres but not ITSs in ChIP-seq analyses. Since
Arabidopsis ITSs are mostly composed of very short
stretches of perfect telomeric repeats interspersed with
degenerated repeats (7,8,32,33), a short stretch of perfect
telomeric repeats might essentially represent telomeres.
Blast analyses of the Arabidopsis genome revealed that
98% of the (CCCTAAA)
4
sequences are found at telo-
meres, whereas only 2% of these sequences localize at
ITSs (see ‘Materials and Methods’ section). Therefore,
the (CCCTAAA)
4
sequence is essentially found at
Arabidopsis telomeres. We chose this sequence to
analyze telomeres in ChIP-seq experiments. For centro-
meres, we selected a conserved sequence from the 178-bp
centromeric satellite repeats. It is well known that these
repeats are heterochromatic and localize to chromocenters
(9–13,15,25).
We analyzed ChIP-seq data from a study that focused
on different histone H3 modifications in Arabidopsis. The
epigenetic modifications analyzed in this study were two
characteristic heterochromatic marks (H3K9
Me2
and
H3K27
Me
) and six marks associated with euchromatin
(H3K4
Me2
, H3K4
Me3
, H3K36
Me2
, H3K36
Me3
, H3K9Ac
and H3K18Ac). In addition, this study also focused on
unlabeled histone H3 and on H3K27
Me3
, a repressive
mark found in many euchromatic genes (17–19). We
determined the enrichment of telomeres versus centro-
meres and found that the levels of unlabeled histone
H3 were 1.6 times higher at telomeres (Supplementary
Table S1). In all eukaryotic organisms analyzed, the nu-
cleosomal spacing of telomeres is 20 bp shorter than the
average bulk nucleosome organization (34). This import-
ant chromatin feature is probably related to the straight
nature of telomeric DNA and might condition the epigen-
etic behavior of telomeric nucleosomes (32,35–38). The
high density of histone H3 determined here at telomeres
might reflect the short spacing of telomeric nucleosomes,
which has been previously revealed by micrococcal
nuclease digestion experiments. Alternatively, we cannot
rule out other possibilities including a nucleosomal
spacing of the nucleosomes associated with the 178-bp
repeats longer than the average bulk nucleosome
organization.
We found that the levels of heterochromatic marks
analyzed (H3K9
Me2
and H3K27
Me
) were lower at telo-
meres than at centromeres. On the contrary, the levels of
some euchromatic marks were higher at telomeres
(H3K4
Me2
and H3K9Ac; Figure 1). These results
indicate that Arabidopsis telomeres exhibit euchromatic
features. However, not all the euchromatic marks
analyzed were enriched in telomeres versus centromeres.
That was the case for H3K4
Me3
, H3K36
Me2
, H3K36
Me3
and H3K18Ac. The levels of these marks were similar or
even lower at telomeres than at centromeres. Interestingly,
Arabidopsis telomeres were also enriched in H3K27
Me3
(Figure 1). Since we have previously found that telomeres
in Arabidopsis are marked with H4K16Ac (14), we
conclude that Arabidopsis telomeres are labeled with
H3K4
Me2
, H3K9Ac, H3K16Ac and H3K27
Me3
.
Epigenetic marks at rice telomeres
To study whether some of the epigenetic marks that char-
acterize Arabidopsis telomeres are present in other plant
species, we analyzed a genome-wide study performed
in rice where the levels of H3K4
Me2
, H3K9Ac,
H3K27
Me3
and DNA methylation were analyzed (27).
Since the (CCCTAAA)
4
sequences present at rice ITSs
represent 1% of the total, these sequences also reveal
telomeres in rice ChIP-seq experiments (see ‘Materials
and Methods’ section). As heterochromatic reference, we
analyzed a sequence from CenO, which is a satellite repeat
present in rice centromeres. We found that the relative
enrichment levels of telomeres versus centromeres were
more than one order of magnitude higher for H3K4
Me2
,
H3K9Ac and H3K27
Me3
than for DNA methylation
(Figure 2). These results strongly suggest that rice telo-
meres are also labeled with H3K4
Me2
, H3K9Ac and
H3K27
Me3
. However, these results are still compatible
with the existence of low levels of DNA methylation at
rice telomeres, which can also be present at Arabidopsis
telomeres (14).
ersus
4
nt of telomeres ve
res (fold)
2
3
Enrichmen
centrome
r
Me
e2
c
Me3
e
3
M
e2
Me3
Ac
e2
1
H3
H3K27
M
H3K4
Me
H3K9Ac
H3K27
M
H3K4
Me
H3K36
M
H3K36
M
H3K18A
H3K9
Me
Figure 1. Epigenetic features at Arabidopsis telomeres. Different
histone H3 epigenetic modifications were analyzed at telomeres and
at centromeres using study SRP002100 (Gene Expression Omnibus ac-
cession number GSE28398). Relative enrichment values of telomeres
versus centromeres were determined and represented as indicated in
the ‘Materials and Methods’ section.
PAGE 3 OF 6 Nucleic Acids Research, 2012, Vol. 40, No. 21 e163
Page 3
DISCUSSION
ChIP-seq data confirm that Arabidopsis telomeres exhibit
euchromatic features
We have previously analyzed the chromatin structures of
Arabidopsis telomeres and ITSs by ChIP, digestion with
the restriction endonuclease Tru9I, which digested ITSs,
and hybridization with a telomeric probe. These experi-
ments revealed that, although subtelomeric regions and
ITSs associate with heterochromatic marks, Arabidopsis
telomeres exhibit euchromatic features (14). More specif-
ically, we found that telomeres have lower levels of het-
erochromatic marks than ITSs (H3K9
Me2
, H3K27
Me
and
DNA methylation) and higher levels of euchromatic
marks (H3K4
Me2
, H3K9Ac and H4K16Ac). Here, we
have shown by analyzing ChIP-seq data that telomeres
have lower levels of heterochromatic marks than centro-
meres (H3K9
Me2
and H3K27
Me
) and higher levels of some
euchromatic marks (H3K4
Me2
and H3K9Ac). Thus, these
data confirm our previous results and validate the meth-
odological approach presented here.
The experimental approach that we have used here to
study the chromatin structure of Arabidopsis telomeres
independently of ITSs could be applied to other eukary-
otes. It will depend on how well genomes are assembled,
including subtelomeric regions, and also on the structure
of ITSs, including their length and number of perfect
tandem repeats.
Arabidopsis telomeres are labeled with H3K27
Me3
We have shown that Arabidopsis telomeres are labeled
with H3K27
3Me
, a repressive mark that usually do not
colocalize with DNA methylation. Recently, 4400
genes have been found to be labeled with this epigenetic
modification. These genes are often expressed in a tissue-
specific manner and many of them might be involved in
plant development. H3K27
Me3
is established by the
Polycomb Repressive Complex 2. This complex is
conserved along evolution and is present in Arabidopsis,
where its disruption causes serious developmental
problems (18,19,39–42). It will be interesting to ascertain
whether some of these problems are related to telomeres
biology.
The histone code hypothesis involves a complex inter-
play of writing, reading and erasing activities that regulate
the levels and the output of different epigenetic modifica-
tions (43). We have previously found that Arabidopsis
telomeres are labeled with H3K4
Me2
, H3K9Ac and
H4K16Ac. Here, we have confirmed these results and
have also shown that Arabidopsis telomeres are labeled
with H3K27
Me3
. The analysis of telomeres in mutants
affected in the establishment, recognition and/or erasing
of all these epigenetic marks open new avenues for future
telomeric studies.
The chromatin organization of Arabidopsis telomeres
shares similarities with the previously reported chromatin
state 2
Four main chromatin states (CS1–CS4) have been recently
defined in Arabidopsis based on the genome-wide distri-
bution of 12 epigenetic marks analyzed by ChIP-on-chip
(44–46). Since six of these marks were also analyzed here
(H3K4
Me2
, H3K4
Me3
, H3K9
Me2
, H3K27
Me
, H3K27
Me3
and H3K36
Me3
), we compared both studies and found
that the chromatin organization of Arabidopsis telomeres
is most similar to chromatin state 2 (CS2). This chromatin
state is associated with 23% of Arabidopsis genes, being
many of them repressed or lowly expressed. CS2 is
characterized by the presence of H3K4
Me2
, H3K27
Me2
and, above all, H3K27
Me3
. In addition, CS2 is also
characterized by the absence of H3K4
Me3
, H3K9
Me2
,
H3K9
Me3
, H3K27
Me
, H3K36
Me3
, H3K56Ac, H4K20
Me
,
H2Bub and
5Me
C (45).
ACCESSION NUMBERS
GSE28398, GSE22276 and GSE19602.
SUPPLEMENTARY DATA
Supplementary Data are available at NAR Online:
Supplementary Tables 1 and 2.
ACKNOWLEDGEMENTS
We want to thank the laboratories of Eric Lam, Jeffrey
Chen and Xing-Wang Deng for making available their
ChIP-seq data at the public databases. We are especially
4
(fold)
2
3
Relative enrihment of telomres versus
centromeres
1
5MeC
H3K4
Me3
Me2
H3K9Ac
H3K27
Figure 2. Epigenetic features at rice telomeres. Different histone epi-
genetic modifications were analyzed at telomeres and at centromeres
using study SRP001788 (GSE19602). Relative enrichment values of
telomeres versus centromeres were determined and represented as
indicated in the ‘Materials and Methods’ section.
e163 Nucleic Acids Research, 2012, Vol. 40, No. 21 PAGE 4 OF 6
Page 4
grateful to Eric Lam for allowing us to use their data prior
to publication. We also thank NCBI for providing the
tools that we have used to analyze the ChIP-seq data.
FUNDING
The Spanish Ministry of Education and Science [grant
BFU2008-02497/BMC] and by FEDER funds. Funding
for open access charge: Waived by Oxford University
Press.
Conflict of interest statement. None declared.
REFERENCES
1. Blackburn,E. (2005) Telomeres and telomerase: their mechanisms
of action and the effects of altering their functions. FEBS Lett.,
579, 859–862.
2. Cech,T. (2004) Beginning to understand the end of the
chromosome. Cell, 43, 405–413.
3. Greider,C. (2006) Telomerase RNA levels limit the telomere
length equilibrium. Cold Spring Harb. Symp. Quant. Biol., 71,
225–229.
4. Meyne,J., Baker,R., Hobart,H., Hsu,T., Ryder,O., Ward,O.,
Wiley,J., Wurster-Hill,D., Yates,T. and Moyzis,R. (1990)
Distribution of non-telomeric sites of the (TTAGGG)n telomeric
sequence in vertebrate chromosomes. Chromosoma, 99, 3–10.
5. Richards,E., Goodman,H. and Ausubel,F. (1991) The centromere
region of Arabidopsis thaliana chromosome 1 contains
telomere-similar sequences. Nucleic Acids Res., 19, 3351–3357.
6. Lin,K. and Yan,J. (2008) Endings in the middle: current
knowledge of interstitial telomeric sequences. Mutation Res., 658,
95–110.
7. Regad,F., Lebas,M. and Lescure,B. (1994) ITSs within the
Arabidopsis thaliana genome. J. Mol. Biol., 239, 163–169.
8. Uchida,W., Matsunaga,S., Sugiyama,R. and Kawano,S. (2002)
Interstitial telomere-like repeats in the Arabidopsis thaliana
genome. Genes Genet. Syst., 77, 63–67.
9. Johnson,L., Cao,X. and Jacobsen,S. (2002) Interplay between two
epigenetic marks: DNA methylation and histone H3 lysine 9
methylation. Curr. Biol., 12, 1360–1367.
10. Lindroth,A., Cao,X., Jackson,J., Zilberman,D., McCallum,C.,
Henikoff,S. and Jacobsen,S. (2001) Requirement of
CHROMOMETHYLASE3 for maintenance of CpXpG
methylation. Science, 292, 2077–2080.
11. Lindroth,A., Shultis,D., Jasencakova,Z., Fuchs,J., Johnson,L.,
Schubert,D., Patnaik,D., Pradhan,S., Goodrich,J., Schubert,I.
et al. (2004) Dual histone H3 methylation marks at lysines 9 and
27 required for interaction with CHROMOMETHYLASE3.
EMBO J., 23, 4286–4296.
12. Martı
´
nez-Zapater,J., Estelle,M. and Somerville,C. (1986) A high
repeated DNA sequence in Arabidopsis thaliana. Mol. Gen. Genet.,
204, 417–423.
13. Nagaki,K., Talbert,P., Zhong,C., Dawe,R., Henikoff,S. and
Jiang,J. (2003) Chromatin immunoprecipitation reveals that the
180-bp satelite repeat is the key functional element of Arabidopsis
thaliana centromeres. Genetics, 163, 1221–1225.
14. Vaquero-Sedas,M., Ga
´
mez-Arjona,F. and Vega-Palas,M. (2010)
Arabidopsis thaliana telomeres exhibit euchromatic features.
Nucleic Acids Res., 39, 2007–2017.
15. Zhang,W., Lee,H., Koo,D. and Jiang,J. (2008) Epigenetic
modification of centromeric chromatin: Hypomethylation of DNA
sequences in the CENH3-associated chromatin in Arabidopsis
thaliana and maize. Plant Cell, 20, 25–34.
16. Fuchs,J., Demidov,D., Houben,A. and Schubert,I. (2006)
Chromosomal histone modification patterns-from conservation to
diversity. Trends Plant Sci., 11, 199–208.
17. Fischer,A., Hofmann,I., Naumann,K. and Reuter,G. (2006)
Heterochromatin proteins and the control of heterochromatic
gene silencing in Arabidopsis. J. Plant Physiol., 163, 358–368.
18. Johnson,L., Mollah,S., Garcia,B., Muratore,T., Shabanowitz,J.,
Hunt,D. and Jacobsen,S. (2004) Mass spectrometry analysis of
Arabidopsis histone H3 reveals distinct combinations of
post-translational modifications. Nucleic Acids Res., 32,
6511–6518.
19. Zhang,X., Clarenz,O., Cokus,S., Bernatavichute,Y., Pellegrini,M.,
Goodrich,J. and Jacobsen,S. (2007) Whole-genome analysis of
histone H3 lysine 27 trimethylation in Arabidopsis. PLoS Biol., 5,
e129.
20. Vaquero-Sedas,M. and Vega-Palas,M. (2011) On the chromatin
structure of eukaryotic telomeres. Epigenetics, 6, 1055–1058.
21. Richards,E. and Ausubel,F. (1988) Isolation of a higher
eukaryotic telomere from Arabidopsis thaliana. Cell, 53, 127–136.
22. Shakirov,E. and Shippen,D. (2004) Length regulation and
dynamics of individual telomere tracts in wild-type Arabidopsis.
Plant Cell, 16, 1959–1967.
23. Ohmido,N., Kijima,K., Ashikawa,I., de Jong,J. and Fukui,K.
(2001) Visualization of the terminal structure of rice chromosomes
6 and 12 with multicolor FISH to chromosomes and extended
DNA fibers. Plant Mol. Biol., 47, 413–421.
24. Luo,C., Sidote,D., Zhang,Y., Kerstetter,R., Michael,T. and
Lam,E. (2012) Integrative analysis of chromatin states in
Arabidopsis identified potential regulatory mechanisms for
Natural Antisense Transcript production. (under review).
25. Fransz,P., Armstrong,S., Alonso-Blanco,C., Fischer,T., Torres-
Ruiz,R. and Jones,G. (1998) Cytogenetics for the model system
Arabidopsis thaliana. Plant J., 13, 867–876.
26. Ha,M., Ng,D., Li,W. and Chen,Z. (2011) Coordinated histone
modifications are associated with gene expression variation within
and between species. Genome Res., 21, 590–598.
27. He,G., Zhu,X., Elling,A., Chen,L., Wang,X., Guo,L., Liang,M.,
He,H., Zhang,H. and Chen,F. (2010) Global epigenetic and
transcriptional trends among two rice subspecies and their
reciprocal hybrids. Plant Cell, 22, 17–33.
28. Cheng,Z., Dong,F., Langdon,T., Ouyang,S., Buell,C., Gu,M.,
Blattner,F. and Jiang,J. (2002) Functional rice centromeres are
marked by a satellite repeat and a centromere-specific
retrotransposon. Plant Cell, 14, 1691–1704.
29. Lee,H., Neumann,P., Macas,J. and Jiang,J. (2006) Transcription
and evolutionary dynamics of the centromeric satellite repeat
CentO in rice. Mol. Biol. Evol., 23, 2505–2520.
30. Yan,H., Kikuchi,S., Neumann,P., Zhang,W., Wu,Y., Chen,F. and
Jiang,J. (2010) Genome-wide mapping of cytosine methylation
revealed dynamic DNA methylation patterns associated with
genes and centromeres in rice. Plant J., 63, 353–365.
31. Zhang,W., Yi,C., Bao,W., Liu,B., Cui,J., Yu,H., Cao,X., Gu,M.,
Liu,M. and Cheng,Z. (2005) The transcribed 165-bp CentO
satellite is the major functional centromeric element in the wild
rice species Oryza punctata. Plant Physiol., 139, 306–315.
32. Ga
´
mez-Arjona,F., Lo
´
pez-Lo
´
pez,C., Vaquero-Sedas,M. and Vega-
Palas,M. (2010) On the organization of the nucleosomes
associated with telomeric sequences. Biochim. Biophys. Acta, 1803,
1058–1061.
33. Vannier,J., Depeiges,A., White,C. and Gallego,M. (2009) ERCC1/
XPF protects short telomeres from homologous recombination in
Arabidopsis thaliana. PLoS Genet., 5, e1000380.
34. Pisano,S., Galati,A. and Cacchione,S. (2008) Telomeric
nucleosomes: Forgotten players at chromosome ends. Cell. Mol.
Life Sci., 65, 3553–3563.
35. Fajkus,J., KovariK,A., Kralovics,R. and Bezdek,M. (1995)
Organization of telomeric and subtelomeric chromatin in the
higher plant Nicotiana tabacum . Mol. Gen. Genet., 247, 633–638.
36. Mechelli,R., Anselmi,C., Cacchione,S., De Santis,P. and
Savino,M. (2004) Organization of telomeric nucleosomes: atomic
force microscopy imaging and theoretical modeling. FEBS Lett.,
566, 131–135.
37. Pisano,S., Pascucci,E., Cacchione,S., De Santis,P. and Savino,M.
(2006) AFM imaging and theoretical modeling studies of
sequence-dependent nucleosome positioning. Biophys. Chem., 124 ,
81–89.
38. Pisano,S., Marchioni,E., Galati,A., Mechelli,R., Savino,M. and
Cacchione,S. (2007) Telomeric nucleosomes are intrinsically
mobile. J. Mol. Biol., 369, 1153–1162.
PAGE 5 OF 6 Nucleic Acids Research, 2012, Vol. 40, No. 21 e163
Page 5
39. Feng,S. and Jacobsen,S. (2011) Epigenetic modifications in
plants: an evolutionary perspective. Curr. Opin. Plant Biol., 14,
179–186.
40. Hennig,L. and Derkacheva,M. (2009) Diversity of Polycomb
group complexes in plants: same rules, different players? Trends
Genet., 25, 414–423.
41. Pien,S. and Grossniklaus,U. (2007) Polycomb group and trithorax
group proteins in Arabidopsis. Biochim. Biophys. Acta, 1769,
375–382.
42. Zhang,K., Sridhar,V., Zhu,J., Kapoor,A. and Zhu,J. (2007)
Distinctive core histone post-translational modification patterns in
Arabidopsis thaliana. PLoS One, 2, e1210.
43. Gardner,K., Allis,C. and Strahl,B. (2011) Operating on
chromatin, a colorful language where context matters. J. Mol.
Biol., 409, 36–46.
44. Turck,F., Roudier,F., Farrona,S., Martin-Magniette,M.,
Guillaume,E., Buisine,N., Gagnot,S., Martienssen,R.,
Coupland,G. and Colot,V. (2007) Arabidopsis TFL2/LHP1
specifically associates with genes marked by trimethylation of
histone H3 lysine 27. PLoS Genet., 3, e86.
45. Roudier,F., Ahmed,I., Be
´
rard,C., Sarazin,A., Mary-Huard,T.,
Cortijo,S., Bouyer,D., Caillieux,E., Duvernois-Berthet,E., Al-
Shikhley,L. et al. (2011) Integrative epigenomic mapping defines
four main chromatin states in Arabidopsis. EMBO J., 30,
1928–1938.
46. Vaughn,M., Tanurdzic
´
,M., Lippman,Z., Jiang,H., Carrasquillo,R.,
Rabinowicz,P., Dedhia,N., McCombie,W., Agier,N. and Bulski,A.
(2007) Epigenetic natural variation in Arabidopsis thaliana. PLoS
Biol., 5, e174.
e163 Nucleic Acids Research, 2012, Vol. 40, No. 21 PAGE 6 OF 6
Page 6
  • Source
    • "Nevertheless, analysis of telomeres in Nicotiana tabacum (tobacco), a species with long telomeres and no detectable ITR fraction (Figure 1c) (Majerova et al., 2011b), demonstrated that telomeric histones were associated with both heterochromatin-and euchromatin-specific marks, with a clear prevalence of the heterochromatic H3K9me2 mark (Majerova et al., 2014). Interestingly, in accordance with a previous observation (Vaquero-Sedas et al., 2012), H3K27me3, a chromatin mark found on developmentally silenced genes, was present on telomeric histones (Figure 1a,c). The significance of this modification, and the general significance of all histone marks, with respect to the proper structure and function of plant telomeres remains to be determined. "
    [Show abstract] [Hide abstract] ABSTRACT: Telomeres and genes coding for 45S ribosomal RNA (rDNA) are frequent neighbours on eukaryotic chromosomes. Although their primary roles are different, they reveal an almost striking blend in their features and additional functions. Both genome domains show remarkable dynamics in their chromatin structures. They both are hypersensitive to dysfunctional histone chaperones, responding at the genomic and epigenomic levels. Both generate non-coding transcripts which, besides their epigenetic roles, may induce gross chromosomal rearrangements. Both can give rise to chromosomal fragile sites since their replication is intrinsically problematic. However, at the same time, both are essential for maintenance of genomic stability and integrity. Here we discuss data demonstrating structural and functional interconnectivity of telomeres and rDNA with a focus on recent results obtained in plants. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
    Full-text · Article · Mar 2015 · The Plant Journal
  • Source
    • "Therefore, these primer dimers are not expected to amplify themselves. Primers TelA and TelB were designed with more than 4 degenerated telomeric repeats because we have previously found that the sequence (CCCTAAA)4 is fundamentally present at Arabidopsis telomeres (in 98% of the cases), whereas it is very infrequent at ITSs (only in 2% of the cases)24. Therefore, primers TelA and TelB should amplify telomeres more efficiently than perfect ITSs. "
    [Show abstract] [Hide abstract] ABSTRACT: In humans, telomere length studies have acquired great relevance because the length of telomeres has been related to natural processes like disease, aging and cancer. However, very little is known about the influence of telomere length on the biology of wild type plants. The length of plant telomeres has been usually studied by Terminal Restriction Fragment (TRF) analyses. This technique requires high amounts of tissue, including multiple cell types, which might be the reason why very little is known about the influence of telomere length on plant natural processes. In contrast, many of the human telomere length studies have focused on homogenous cell populations. Most of these studies have been performed by PCR, using telomeric degenerated primers, which allow the determination of telomere length from small amounts of human cells. Here, we have adapted the human PCR procedure to analyze the length of Arabidopsis thaliana telomeres. This PCR approach will facilitate the analysis of telomere length from low amounts of tissue. We have used it to determine that CG and non CG DNA methylation positively regulates Arabidopsis telomere length.
    Full-text · Article · Jul 2014 · Scientific Reports
  • Source
    • "Although telomeres were originally thought to consist of heterochromatin, a recent molecular analysis of epigenetic marks in A. thaliana telomeres revealed that telomeric chromatin has some unexpected and unique features that are characteristic of intermediate heterochromatin [Vrbsky et al., 2010] or even euchromatin [Vaquero-Sedas and Vega-Palas, 2013]. Indeed, Arabidopsis telomeres are enriched in H3K9me2 and H3K27me1 heterochromatic marks but still retain the euchromatic H3K4me3 mark [Vrbsky et al., 2010; Vaquero-Sedas et al., 2012]. Furthermore, the A. thaliana telomeres are also relatively enriched in the H3.3 histone variant (which is usually associated with transcriptionally active regions) in comparison to centromeres that are enriched in H3.1 in comparison to telomeres [Vaquero-Sedas and Vega-Palas, 2013]. "
    [Show abstract] [Hide abstract] ABSTRACT: The interphase cell nucleus is extraordinarily complex, ordered, and dynamic. In the last decade, remarkable progress has been made in deciphering the functional organisation of the cell nucleus, and intricate relationships between genome functions (transcription, DNA repair, or replication) and various nuclear compartments have been revealed. In this review, we describe the architecture of the Arabidopsis thaliana interphase cell nucleus and discuss the dynamic nature of its organisation. We underline the need for further developments in quantitative and modelling approaches to nuclear organization. © 2014 S. Karger AG, Basel.
    Full-text · Article · Jun 2014 · Cytogenetic and Genome Research
Show more