ArticlePDF Available

Abstract

Proposed benefits of multiple paternity include increased reproductive output, elevated fitness of progeny, and maintenance of population genetic diversity. However, another consideration is whether multiple paternity is simply an unavoidable byproduct of sexual conflict, with males seeking to maximize mating encounters while females seek to minimize the stress of copulation. Here we examined the polyandrous mating system in sharks, with a focus on the reproductive genetics of the shortspine spurdog Squalus mitsukurii. Members of the genus Squalus are long-lived, slow-growing, and employ among the longest gestation periods of any vertebrate. To evaluate multiple paternity and genetic diversity in S. mitsukurii, we genotyped 27 litters plus 96 individuals with 8 microsatellite loci. Further, 670 bp of the mtDNA control region were sequenced in 112 individuals to examine population structure. S. mitsukurii in Hawaii showed low genetic diversity relative to other sharks (
MARINE ECOLOGY PROGRESS SERIES
Mar Ecol Prog Ser
Vol. 403: 255–267, 2010
doi: 10.3354/meps08417 Published March 22
INTRODUCTION
In sexually reproducing species, the existence of
conflicting fitness strategies between sexes can lead to
intense sexual selection and the establishment of sex-
ual conflict, where coercive traits that arise in one sex
are countered by the evolution of resistance traits in
the other (Zeh & Zeh 2003). In the majority of verte-
brate mating systems, females bear the energetic bur-
den of ova and parental care and are thus expected to
be the more ‘choosy’ sex in regards to mate selection.
Males, in contrast, are expected to be non-parental,
sexually competitive, and promiscuous (Smith 1984,
Birkhead 1998, Birkhead & Pizzari 2002). Contrary to
the historical assumption of monogamy in the choosy
sex, there is abundant evidence of multiple mating by
© Inter-Research 2010 · www.int-res.com*Email: tengel@email.arizona.edu
Is multiple mating beneficial or unavoidable?
Low multiple paternity and genetic diversity in
the shortspine spurdog Squalus mitsukurii
Toby S. Daly-Engel1, 5,*, R. Dean Grubbs2, Kevin A. Feldheim3, Brian W. Bowen4,
Robert J. Toonen4
1University of Hawaii at M
anoa, Department of Zoology, 2538 The Mall, Edmondson 152, Honolulu, Hawaii 96822, USA
2Florida State University Coastal and Marine Laboratory, 3618 Hwy 98, St. Teresa, Florida 32358, USA
3Field Museum, Pritzker Laboratory for Molecular Systematics and Evolution, 1400 S. Lake Shore Drive, Chicago,
Illinois 60605, USA
4Hawaii Institute of Marine Biology, PO Box 1356, Kaneohe, Hawaii 96744, USA
5Present address: University of Arizona, Forbes 410, 1140 E. South Campus Drive, Tucson, Arizona 85721, USA
ABSTRACT: Proposed benefits of multiple paternity include increased reproductive output, elevated
fitness of progeny, and maintenance of population genetic diversity. However, another consideration
is whether multiple paternity is simply an unavoidable byproduct of sexual conflict, with males seek-
ing to maximize mating encounters while females seek to minimize the stress of copulation. Here we
examined the polyandrous mating system in sharks, with a focus on the reproductive genetics of the
shortspine spurdog Squalus mitsukurii. Members of the genus Squalus are long-lived, slow-growing,
and employ among the longest gestation periods of any vertebrate. To evaluate multiple paternity
and genetic diversity in S. mitsukurii, we genotyped 27 litters plus 96 individuals with 8 microsatel-
lite loci. Further, 670 bp of the mtDNA control region were sequenced in 112 individuals to examine
population structure. S. mitsukurii in Hawaii showed low genetic diversity relative to other sharks
(π= 0.0010 ± 0.0008) and no significant population structure in the Hawaiian Archipelago. Direct
allele counts and Bayesian approximations returned concordant estimates of 11% multiple paternity,
the lowest observed in sharks to date. Considering the protracted reproductive interval of S. mitsu-
kurii, sexual conflict that results from differential male and female reproductive strategies may favor
the development of female mating avoidance behavior to minimize trauma. In S. mitsukurii this
behavior includes segregation of sexes and an asynchronous reproductive cycle.
KEY WORDS: Elasmobranch · Polyandry · Control region · Microsatellite DNA · Population structure ·
Sexual conflict · Sexual segregation · Reproductive strategy
Resale or republication not permitted without written consent of the publisher
Mar Ecol Prog Ser 403: 255–267, 2010
females with conventional sex roles (reviewed by Zeh
& Zeh 2003). Polyandry (females mating with more
than one male) and multiple paternity (a single brood
of offspring sired by multiple males) are now recog-
nized as common strategies in widely divergent taxa
including amphibians, mammals, reptiles, insects,
crustaceans, and fishes (Evans & Magurran 2000, Too-
nen 2004, Adams et al. 2005, Bretman & Tregenza
2005, Daly-Engel et al. 2006, Dean et al. 2006, Jensen
et al. 2006). It is still unclear, however, what roles sex-
ual conflict and intersexual selection might play in
polyandrous mating systems.
For males, the advantages to having multiple breed-
ing partners are clear: the more females a male insemi-
nates, the more offspring he fathers and the greater his
reproductive fitness. The benefits of polyandry to fe-
males are less obvious. Potential direct benefits to the
female include nuptial gifts or parental care on the part
of the male. No direct benefits have been shown in
shark mating systems, though there is potential for indi-
rect or genetic benefits through polyandrous mating. If
there is little or no opportunity to evaluate males prior
to copulation, a female may hedge her bets by mating
promiscuously and therefore increase her chances that
one of these matings may lead to higher survivorship
for offspring (genetic bet-hedging; Watson 1991, Mad-
sen et al. 2005). Alternatively, polyandry may result in
inbreeding avoidance or increase the likelihood that a
female’s offspring will be sired by a male whose genes
are compatible with hers (genetic compatibility hypo-
thesis; Zeh & Zeh 1997, 2001, Neff & Pitcher 2005).
However, multiple mating can also be disadvantageous
to females due to exposure to disease or risk of injury
during mating events; female sharks may sustain seri-
ous injury or even die as a result of harm incurred dur-
ing copulation (Pratt & Carrier 2001).
Apart from benefits to offspring, there is ongoing
debate over whether multiple paternity might confer
benefits to a population by maintaining genetic diver-
sity, depending on whether it increases or decreases
variance in reproductive success (Sugg & Chesser
1994, Zeh & Zeh 2003, Karl 2008). One school of
thought maintains that multiple paternity may buffer
against the loss of allelic diversity by increasing the
effective population size (Sugg & Chesser 1994, New-
comer et al. 1999, Martinez et al. 2000, Hoekert et al.
2002). This is countered by theoretical results indicat-
ing that by increasing the variance in male reproduc-
tive success (because each mating may result in fewer
offspring per male than with genetic monogamy), mul-
tiple paternity will reduce effective population size
and, consequently, limit population genetic diversity
(Nunney 1993, Ramakrishnan et al. 2004, Karl 2008).
Reproductive strategy can have considerable effect on
genetic diversity, which in turn affects the ability of
populations to respond to selection pressures like
changes in environmental conditions (Rowe & Hutch-
ings 2003, Frankham 2005). For this reason, loss of
genetic diversity has been associated with increased
vulnerability to population depletion and extinction
(Dulvy et al. 2003, Rowe & Hutchings 2003, Frankham
2005). Though a speciose group, sharks in particular
exhibit slower rates of genetic evolution than other
vertebrates (Martin et al. 1992), as well as lower rates
of growth and reproduction, which may limit their abil-
ity to recover from population depletion.
The frequency in a population with which a gravid
female carries a brood sired by more than one male
(multiple paternity) can be estimated by inferring the
minimum number of fathers per brood from genotypes
of mothers and their offspring. Previous work on multi-
ple paternity in elasmobranchs has shown a large
degree of inter- and intraspecific frequency variation
(Ohta et al. 2000, Saville et al. 2002, Chapman et al.
2004, Feldheim et al. 2004, Daly-Engel et al. 2007,
Lage et al. 2008). Given that Lage et al. (2008) found
low (30%) multiple paternity in the congener Squalus
acanthias, a low level of multiple paternity in S. mitsu-
kurii could indicate genus-level concordance in
squalid sharks. However, recent studies have further
shown that rates of multiple paternity can vary even
between populations of a single species (Daly-Engel et
al. 2007, Portnoy et al. 2007), indicating high levels of
behavioral trait plasticity. Though the number of stu-
dies on polyandrous mating in elasmobranchs contin-
ues to increase, multiple paternity has not yet been
shown to confer either direct or indirect benefits to
sharks (DiBattista et al. 2008a), leading some investi-
gators to hypothesize that multiple paternity in elas-
mobranchs may be influenced by sexual conflict (Daly-
Engel et al. 2007, Portnoy et al. 2007, DiBattista et al.
2008b).
We assessed the frequency of multiple paternity in
27 litters of the shortspine spurdog Squalus mitsukurii
from throughout Hawaii using a suite of 8 polymorphic
microsatellite DNA markers, including 6 novel species-
specific markers developed for the present study and
2 previously published loci developed for Squalus
acanthias (McCauley et al. 2004). In addition, we exa-
mined the link between genetic diversity and repro-
ductive strategy by estimating genetic diversity using
a 670 bp segment of the mitochondrial control region
for comparison to other studies. We also calculated
allelic richness for the microsatellite loci in all pub-
lished surveys of shark multiple paternity to determine
whether genetic diversity correlates with multiple
paternity in sharks. This is the first estimation of
genetic polyandry in S. mitsukurii coupled with one of
the few direct measures of genetic diversity (allelic
richness) in any squalid, a globally distributed family
256
Daly-Engel et al.: Multiple paternity in Squalus mitsukurii
of small sharks known collectively as dogfish. These
data, generated from an unfished population, will
serve as a foundation for future studies examining nat-
ural reproductive strategies and genetic diversity in
both exploited and unexploited populations of elasmo-
branch fishes.
MATERIALS AND METHODS
Study species. The shortspine spurdog Squalus mit-
sukurii aggregates on or near the bottom at a depth of
100 to 950 m in temperate, subtropical, and tropical
seas, particularly along coastlines, continental shelves,
and on seamounts (Wilson & Seki 1994, IUCN 2003).
The species is ovoviviparous with low fecundity.
Females give birth to an average of 6 pups ~25 cm in
length at birth every 2 to 3 yr (IUCN 2003, Compagno
et al. 2005). S. mitsukurii is widely distributed in the
Pacific Ocean (Last & Stevens 1994) and is likely a spe-
cies complex. Age at maturity is between 4 and 7 yr for
males and between 14 and 16 yr for females (Wilson &
Seki 1994, Taniuchi & Tachikawa 1999) and genera-
tion time is more than 25 yr (Compagno et al. 2005).
S. mitsukurii has no known quiescent period between
gestations, with ova maturing concurrently with
embryos, such that when pups are at term the new ova
are ready for fertilization (T. S. Daly-Engel & R. D.
Grubbs pers. obs.).
Squalus mitsukurii is currently listed as endangered
on the IUCN Red List (IUCN 2003), based primarily on
data taken from the Australian population. There,
S. mitsukurii populations declined as much as 97%
between 1976 and 1997 due to fishing mortality as
bycatch from commercial trawling (Graham et al. 2001,
IUCN 2003). The status of other populations of S. mit-
sukurii is unknown due to the high likelihood of mis-
identification and the lack of data from most of the
world. In Hawaii, S. mitsukurii is rare as bycatch in the
bottomfish fishery, and little is known about its range,
population structure, or stock status. A study of large
aggregations of S. mitsukurii from the Hancock sea-
mount in the Hawaiian– Emperor seamount chain is
the only published report of this species from the cen-
tral Pacific (Wilson & Seki 1994). Anecdotal data and
catch rates from the present study indicate a robust
Hawaiian stock which is largely unaffected by fishing
mortality, making Hawaii an ideal location to acquire a
baseline understanding of the genetic mating system
and allelic diversity of this species. A note on species
identification: though the species of dogfish most com-
mon in Hawaii is widely accepted to be S. mitsukurii,
recently published morphological keys (White et al.
2007) appear to exclude Hawaiian dogfish from S. mit-
sukurii (R. D. Grubbs unpubl. data). Until additional
studies are done, however, we will continue to use
accepted nomenclature.
Sampling. We collected sharks near Oahu and 5
other locations throughout the Hawaiian Archipelago
between August 2005 and November 2008 (Fig. 1). Of
the 27 litters collected, 4 were sampled from the newly
established Papah
anaumoku
akea Marine National
Monument in the Northwest Hawaiian Islands
(NWHI). The NWHI includes 10 small atolls, pinnacles,
257
Fig. 1. Hawaiian Archipelago. Stars indicate the 6 sampling sites. N: corresponding sample sizes were analyzed for mitochondrial
diversity. Base map reproduced from www.oar.noaa.gov/spotlite/archive/images/bottomfishing_NWHI.jpg
Mar Ecol Prog Ser 403: 255–267, 2010
and islands and encompasses 360 000 km2of ocean
water northwest of Kauai. The remote location of the
NWHI combined with high level of protection made it
difficult to acquire specimens, which were opportunis-
tic bycatch from bottom fishing vessels. The remaining
23 litters were obtained from the Main Hawaiian
Islands (MHI) off the islands of Oahu and Maui (Pen-
guin Banks, Table 1) using monofilament research
lines (shortened longlines, ~0.8 to 1.2 km) anchored at
each end and marked with buoys. Approximately 17%
of the sharks caught by longlining were pregnant
females. We used branch lines or gangions 4 m in
length composed of stainless steel tuna clips attached
to 2.5 m of 250 kg monofilament line. The line was
attached to 1.5 m of stainless steel aircraft cable with
8/0 stainless steel swivel and 11/0 circle hooks baited
with Japanese mackerel Scomber japonicus or squid
(Loligo spp.). Each line consisted of 50 to 80 gangions
spaced approximately 15 m apart. Sharks were mea-
sured and weighed, litter size was recorded, and small
samples of fin or muscle tissue were taken using scis-
sors from mothers and pups. Tissue was stored in 20%
dimethylsulfoxide (DMSO) saturated salt buffer
(Seutin et al. 1991) or >75% ethanol (EtOH). DNA was
extracted from tissue using a salting-out protocol
adapted from Sunnucks & Hales (1996). Samples
stored in EtOH were dried in a speed vacuum for
30 min at 55°C before extraction.
Microsatellite fragment analysis. We developed
microsatellite markers using an enrichment protocol
(Glenn & Schable 2005). This protocol, which employs
streptavidin-coated magnetic beads and biotin-labeled
repetitive probes here, (AGAT)8, (AAAG)8, and
(AAAC)6 was followed as described previously
(Feldheim et al. 2007). Six species-specific primers
were developed using the default settings in 0Primer3
(http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.
cgi). These 6 plus 2 primer pairs developed for Squalus
acanthias (T289 and U285; McCauley et al. 2004) were
found to be highly variable and therefore informative
for parentage analysis (Table 2). Following optimiza-
tion, unlabeled reverse primers were obtained from
Integrated DNA Technologies. Forward primers were
labeled with 6-FAM, VIC, NED, and PET proprietary
dyes (Applied Biosystems). PCR reac-
tions consisted of 0.1 U Biolase Taq
DNA polymerase (Bioline), 1×Taq
buffer, 0.25 to 0.0625 µm of each primer
(see Table 2), 200 µm each dNTP, and
2.0 mm MgCl2. PCR amplification on a
MyCycler (Bio-Rad) consisted of an ini-
tial denaturation at 95°C for 4 min fol-
lowed by 35 cycles of 1 min at 95°C,
30 s at optimal annealing temperature
(Ta) (Table 2), and 30 s at 72°C, fol-
lowed by a final extension at 72°C for
20 min. PCR products were resolved
with an ABI 3100 automated sequencer
and visualized using ABI PRISM Gen-
eMapper Software 3.0 (Applied Biosys-
tems). Negative and positive controls
consisted of extraction and amplifica-
tion of known samples and DNA
sequencing of randomly selected indi-
viduals.
We estimated heterozygosity and
tested for deviation from Hardy-Wein-
berg Equilibrium (HWE) in 96 unre-
lated individuals, including mothers
and all individuals from the NWHI,
using Genepop 3.4 (Raymond &
Rousset 1995), and tested for linkage
disequilibrium using Arlequin 3.11
(Excoffier et al. 2005). We used Micro-
Checker 1 (van Oosterhout et al. 2004)
to infer genotyping errors due to null
alleles, short PCR dominance (large
258
Table 1. Squalus mitsukurii. Date of capture and location is shown for each of
27 litters, as well as the size of the mother (TL: total length, cm), number of pups
per litter, average TL of pups, maximum number of paternal alleles detected
across 8 microsatellite loci, and minimum number of sires indicated by the pres-
ence of these alleles in each litter. PB: Penguin Banks; nd: not determined
Litter Capture Capture Maternal No. Mean Max. no. Min.
ID date location TL pups in TL of paternal no.
litter pups alleles sires
B Aug 2005 Oahu 60.0 6 21.5 2 1
C Aug 2005 Oahu 66.5 7 14.6 2 1
D Sep 2005 Oahu 68.5 5 23.6 2 1
E Feb 2006 Oahu 78.5 8 16.3 2 1
F Feb 2006 Oahu 78.0 5 12.7 2 1
G Feb 2006 Oahu 84.0 5 10.3 2 1
H Feb 2006 Oahu 74.0 5 24 2 1
I Feb 2006 Oahu 77.0 5 22.3 2 1
J May 2007 Oahu nd 3 7.9 2 1
K Feb 2008 Oahu 87.5 10 nd 2 1
L Mar 2008 PB 72.5 4 17.4 2 1
N Mar 2008 PB 79.0 7 3.5 2 1
O Mar 2008 PB 81.0 6 4.2 2 1
P Mar 2008 PB 70.0 5 2.3 2 1
Q Apr 2008 Oahu nd 7 nd 2 1
R Nov 2008 Oahu 88.0 9 12.8 2 1
S Nov 2008 Oahu 87.5 10 2.5 2 1
T Nov 2008 Oahu 84.5 10 9.3 2 1
U Nov 2008 Oahu 79.5 5 8.4 2 1
V Nov 2008 Oahu 88.0 9 14.7 4 2
W Nov 2008 Oahu 92.0 9 1.9 2 1
X Nov 2008 Oahu 86.0 10 18.4 2 1
Y Nov 2008 Oahu 83.0 6 4.2 2 1
NA Jun 2006 Lisianski 90.0 6 20.2 4 2
NB Jun 2006 Lisianski 101.0 7 10.9 2 1
NC Oct 2006 Gardner 84.5 5 7.6 2 1
ND Dec 2007 Nihoa 78.5 4 11.9 4 2
Daly-Engel et al.: Multiple paternity in Squalus mitsukurii
allele dropout), the scoring of stutter peaks, and typo-
graphic errors. We inferred the minimum number of
sires from the number of non-maternal alleles detected
among all pups following the methods of Neff et al.
(2002). For each litter, we removed the maternal alleles
and counted the number of unique non-maternal alle-
les (Toonen 2004). Since the genotypes of the sires are
unknown in these field-collected animals, we used the
conservative assumption that every female mated with
only heterozygous males. Given this assumption, the
minimum number of sires per litter is one-half the
number of non-maternal alleles. If an odd number of
non-maternal alleles were detected among the pups,
the minimum number of males was rounded up. For
example, if 3 non-maternal alleles were detected, the
minimum estimated number of sires was rounded up
from 1.5 to 2 males. Mendelian inheritance of maternal
alleles was tested in each litter using a chi-squared
goodness-of-fit test against an expected 1:1 inheri-
tance ratio.
We used the program PrDM 1 (Neff & Pitcher 2002)
to calculate the probability of detecting multiple mat-
ing (PrDM) in a sample of offspring based on (1) the
number of loci, (2) the number of alleles per locus, (3)
allele frequencies in the natural population (obtained
from the 96 unrelated individuals), (4) the conservative
estimate of number of sires contributing to each brood,
and (5) reproductive skew of each sire (Vieites et al.
2004). The model assumes single-sex multiple mating
(polygyny or polyandry), where all offspring in a brood
were either full-siblings or half-siblings. We used an
initial model of only 2 sires, each with the probability
of mating equal to 0.5, because this is the most conser-
vative estimate. Adding sires to the model would
increase the statistical power to detect multiple pater-
nity, but could lead to false overestimation of multiple
matings (Neff et al. 2002). We performed 8 replicates of
the analysis for the range observed in our samples (3 to
10 pups).
The Bayesian program FMM 1 (Neff et al. 2002) was
used to estimate expected frequency of multiple pater-
nity in this population. Because not all of the males in
the population are heterozygous for alleles other than
those carried by the mother, an estimate based solely
on the observed number of non-maternal alleles may
underestimate the true frequency of multiple paternity
(Neff et al. 2002, Toonen 2004). The Bayesian method
used in FMM takes the allele frequency distribution of
the population into consideration when calculating the
most likely frequency of multiple paternity, and
assigns a 95% confidence interval to that estimate.
Statistical correlations between the total length (TL) of
the mother, number of pups per litter, and number of
paternal alleles detected were tested with Minitab 14.
Genetic structure and diversity. Because we sampled
across a broad geographic range (2000 km), we needed
259
Table 2. Squalus mitsukurii. Details on microsatellite loci used in the present study. Locus name, primer sequence (F: forward; R:
reverse), repeat motif, and size (bp) of the allele from which primers were developed, plus annealing temperature (Ta, °C) and
primer concentration (µmol reaction–1). Also shown are allelic diversity (k), allelic richness (A), observed and expected heterozy-
gosities (Hobs and Hexp), probabilities (p-values) from Hardy-Weinberg Equilibrium tests for homozygote excess based on multi-
locus genotypes from 96 unrelated S. mitsukurii, and values of Jost’s estimated D(Dest). Dye labels were applied to forward primers
Locus Primer sequence Motif Size TaPrimer kAH
obs Hexp pDest
conc.
Smi033 F: GAAAGCAGAAATGCCCACAT (AC)22 223 62 0.5 13 11.20 0.311 0.352 0.229 0.003
R: GGGATATATGAACCCTTTTAAGTCA
Smi063 F: GGACAATTCAAACAATCTAAACAATG Imperfect 191 62 0.125 21 19.12 0.756 0.806 0.352 –0.034
R: AGTGCTGGACCATCATAGCC
Smi242 F: CATGTTTCAAGGAAGGATGG Imp. AAAG/ 286 62 0.25 2 1.93 0.607 0.514 0.000a 0.007
R: TAGTTGGGCACATGCAAGAA AAGG repeat
Smi292 F: TATATGGGGAATGASATTAAG Imperfect 249 56 0.15 8 8.00 0.385 0.373 0.097 0.005
R: AAAAGGAGATGGAATAACTATGGTG
Smi294 F: AACATAGCCACCCAATCACC Imperfect 158 62 0.15 2 2.00 0.674 0.502 0.000a–0.007
R: TTCAATGCACGTCAACAAGG
Smi327 F: CCGCTTCAGATCAGCTTTTT (TAGA)17 202 62 0.125 13 11.64 0.846 0.866 0.574 0.044
R: CCAAGGATTTGTACGGCATC
T289aF: GGGCGTCTGTGAACGCAGAC (TCC)7191 56 0.25 6 5.39 0.489 0.519 0.556 –0.011
R: ATAGTCCAGTAACATAACCTG
U285aF: CTGTCCATGGTCACTTTT (CT)11 240 56 0.125 8 7.56 0.551 0.602 0.138 – 0.016
R: GATACTTTTGTTCAGAGC
aMcCauley et al. (2004)
Mar Ecol Prog Ser 403: 255–267, 2010
to first confirm that we were assaying a single breeding
population. To this end, mitochondrial haplotype diver-
sity was calculated in all 112 unrelated individuals col-
lected across the sampling locations represented in the
present study (Fig. 1). A fragment of the control region
(670 bp) was amplified from each sample using the
ProL2 (5’-CTG CCC TTG GTC CCC AAA GC-3’) and
PheCaCaH2 (5’-CTT AGC ATC TTC AGT GCC AT-3’)
primers (Pardini et al. 2001). Target DNA was amplified
using the protocol outlined above, with a Taof 60°C.
PCR products were cycle sequenced using Big Dye
chemistry on an ABI 3100 automated sequencer (Ap-
plied Biosystems) at the Hawaii Institute of Marine Biol-
ogy EPSCoR Sequencing Facility, aligned by eye, and
edited using Sequencher 4.6 (Gene Codes Corpora-
tion). Arlequin was used to generate nucleotide and
haplotype diversities. PAUP* 4.0b10 (Swofford 2000)
was used to calculate genetic distance and Structure
2.2 (Pritchard et al. 2000) was used to calculate the
likely number of distinct populations (K) using mi-
crosatellite data. In Structure we used the admixture
model with a 10 000 burn-in length and 10 000 simula-
tions to test K= 1 – 5 with 10 repetitions each. The rela-
tionships between haplotypes are described with a par-
simony network based on TCS 1.21 (Clement et al.
2000) (see Fig. 2). We also used SMOGD 1.2.0 (Craw-
ford 2009) to calculate Jost’s Dfor unrelated individuals
at 8 microsatellite loci. Jost’s Dis a measure of genetic
differentiation that is independent of within-subpopu-
lation heterozygosity (Jost 2008).
For the analysis comparing allelism at microsatellite-
loci to frequency of multiple paternity, results from
7 studies were compared: Chapman et al. (2004),
Feldheim et al. (2004), Daly-Engel et al. (2007), Port-
noy et al. (2007), DiBattista et al. (2008b), Lage et al.
(2008), and the present study. Allelic richness was cal-
culated using FSTAT 2.9.3.2 (Goudet 1995). FSTAT
applies a rarefaction method to standardize alleles per
locus to a uniform sample size, in this case, 60 to
70 individuals. In studies where the number of unre-
lated individuals genotyped was already 60 to 70 indi-
viduals, rarefaction was not performed. Percent multi-
ple paternity was arcsine square root-transformed for
linearity, and Pearson correlation on these data was
done using Minitab 14.
RESULTS
Using the program Structure, we found no evidence
for more than one population within Hawaii (K= 1)
with estimates of posterior probability approaching 1,
which is consistent with a lack of genetic structure.
Similarly, within-population tests of genetic differenti-
ation showed little differentiation across loci (average
Dest = 0.016, Table 2). The TCS parsimony network of
haplotypes (Fig. 2) showed 11 variable sites and 6
haplotypes (GenBank accession no. GU192450–
GU192455). Two of these were exhibited among the
vast majority of individuals (107 out of 112), with the
other 4 haplotypes distributed among 5 remaining
individuals. No more than 2 mutational steps sepa-
rated any haplotype from another except for the diver-
gent type found in a single specimen from Gardner
Pinnacles, which was separated from the ancestral
type by 8 mutations (a genetic distance of d= 1.2%).
The parsimony network (Fig. 2) shows that the 2 most
common haplotypes were observed at every sampling
site where more than 1 sample was obtained, indicat-
ing high maternal gene flow throughout the sampling
range.
MicroChecker detected no microsatellite scoring
errors resulting from DNA degradation, low DNA con-
centrations, or primer-site mutations. There was evi-
dence of deviation from HWE at Smi242 and Smi294,
which showed significant heterozygote excess in the
sample of 96 unrelated individuals (Table 2). Maternal
260
Fig. 2. Squalus mitsukurii. Parsimony network of control re-
gion haplotypes from 112 unrelated individuals. Size of circles
or wedges represents the number of samples within each
haplotype, and uninterrupted branches represent single
mutational steps
Daly-Engel et al.: Multiple paternity in Squalus mitsukurii
alleles at these loci were inherited in expected 50:50
ratios in all offspring of the 27 litters, so heterozygote
excess at these loci did not affect our estimate of multi-
ple paternity. Smi033 was out of HWE due to heterozy-
gote deficiency until we excluded the specimens from
Lisianski and Raita Banks (the 2 atolls at the distal
northwest end of our sampling range), possibly indi-
cating a null allele at these locations. Though het-
erozygote deficiency may indicate a Wahlund effect,
we eliminated this possibility because the discrepancy
in HWE was limited to a single locus. Exclusion of the
5 individuals or this locus from any of our analyses did
not significantly change our results, so we retained
them in our analysis. HWE at Smi033 was based on 91
rather than 96 unrelated individuals. There was no evi-
dence of linkage disequilibrium among pairs of loci
after Bonferroni correction.
We found evidence of multiple paternity (3 or 4 pa-
ternal alleles at each of 2 to 3 loci) in 11% of the litters
sampled (3 of 27 litters; Table 1). Each of the 178 pups
had at least one maternal allele, and chi-squared tests
confirmed that inheritance of these alleles did not vary
from predicted 1:1 Mendelian inheritance ratios within
each litter (df = 1, p > 0.05). The program FMM esti-
mated the expected Bayesian frequency of multiple
mating to be 9% in this population (excluding Smi242
and 294; Neff et al. 2002), which closely approximated
our estimate of 11% based on direct count of non-
maternal alleles. The 95% confidence interval (CI) was
1 to 24% mixed paternity. When we removed Smi033
from this analysis, the results were essentially
unchanged (expected frequency of multiple mating =
12%, 95 % CI = 2 to 27 %).
Litters of Squalus mitsukurii ranged in size from 3 to
10 pups, and mean litter size was 6.6 (Table 2). The
program PrDM (Neff & Pitcher 2002) assigned a 90 %
probability of detecting multiple paternity in litters of
this size (Neff & Pitcher 2002), hence we had good
power to detect multiple paternity in S. mitsukurii. If
we adjusted our calculation of multiple paternity to
conservatively assume that it occurred in the 10 % of
cases where we lacked statistical power to detect it,
then the frequency of multiple paternity in this popula-
tion was approximately 12%, well within the 95% CI
calculated by FMM. Among these 27 litters we found a
significant correlation (Spearman’s test, df = 1, α=
0.05) between the TL of the mother and the number of
pups per litter (R2= 0.34, ρ= 0.59, p = 0.002). There was
no significant correlation between the TL of the mother
and the number of paternal alleles found among the
pups (R2= 0.06, ρ= 0.26, p = 0.216), or between litter
size and the number of paternal alleles detected (R2=
0.01, ρ= –0.06, p = 0.76).
Arlequin yielded a haplotype diversity value of h=
0.5412 ± 0.0221 and nucleotide diversity value of π=
0.0010 ± 0.0008. Table 3 shows the results of all known
studies documenting nucleotide and haplotype diver-
sities in the mitochondrial control region for elasmo-
branch species. Haplotype diversity in Squalus mit-
sukurii is the third lowest among sharks to date, and
nucleotide diversity was the second lowest measured
in an elasmobranch.
To examine the relationship between mating strategy
and genetic diversity we performed correlation analysis
on all 7 data points from shark paternity studies pub-
lished to date. Fig. 3A reports the results from the 5
studies that used only species-specific microsatellite
loci (Feldheim et al. 2004, Portnoy et al. 2007, DiBattista
et al. 2008b, Lage et al. 2008, present study), and Fig.
3B reflects the same analysis of these 5 studies plus 2
that did not use species-specific loci (Chapman et al.
2004, Daly-Engel et al. 2007). Microsatellite loci that
261
Table 3. Genetic diversity in the mitochondrial control region among 13 elasmobranch species. Nucleotide diversity (π), haplo-
type diversity (h), sequence length (bp), and sample sizes (N) are shown. nd: not determined. *Studies encompassing more than
one geographic region. SA: South Africa; WA: Western Australia
Species π±SD h± SE Sequence length N Source
Squalus mitsukurii 0.0010 ± 0.0008 0.541 ± 0.022 670 112 Present study
Galeorhinus galeus* 0.0025 0.805 ~990 116 Chabot & Allen (2009)
Negaprion brevirostris 0.0059 0.780 1090 80 Schultz et al. (2008)
Negaprion acutidens 0.0006 0.280 1090 58 Schultz et al. (2008)
Rhincodon typus 0.0110 ± 0.006 0.974 ± 0.008 1236 70 Castro et al. (2007)
Cetorhinus maximus* 0.0013 ± 0.0009 0.720 ± 0.028 1085 62 Hoelzel et al. (2006)
Carcharias taurus (SA) 0.0030 ± 0.0001 0.717 ± 0.010 700 26 Stow et al. (2006)
Carcharias taurus (WA) 0.0031 ± 0.0001 0.458 ± 0.024 700 16 Stow et al. (2006)
Sphyrna lewini* 0.0130 ± 0.0068 0.800 ± 0.020 548 271 Duncan et al. (2006)
Carcharhinus limbatus 0.0021 ± 0.0013 0.805 ± 0.018 1070 323 Keeney et al. (2005)
Raja clavata 0.0072 0.610 335 26 Valsecchi et al. (2005)
Raja miraletus 0.0031 0.170 330 12 Valsecchi et al. (2005)
Raja asterius 0.0092 0.290 329 18 Valsecchi et al. (2005)
Carcharadon carcharias 0.0203 nd nd 88 Pardini et al. (2001)
Mar Ecol Prog Ser 403: 255–267, 2010
are cross-amplified across species may be less polymor-
phic than they are in target species, though the number
of loci that successfully cross-amplify in sharks is often
higher than in other taxa, presumably due to their
slower rate of nucleotide mutation (Martin et al. 1992).
Although the removal of 2 studies leaves us with only 5
data points in Fig. 3A, we chose to present both sets of
data because we thought that the effect of this variable
cannot be sufficiently resolved within the scope of the
present study (though the present study used 2 loci de-
veloped for a congener, these loci were not considered
when calculating allelic richness). The correlation be-
tween multiple paternity and genetic diversity in the 5
species-specific studies returned an R2value of 0.40
(p = 0.184; Fig. 3A). When we included the 2 studies
that did not use species-specific markers (Chapman et
al. 2004, Daly-Engel et al. 2007), the R2dropped only
slightly, to 0.32 (p = 0.249; Fig. 3B). While preliminary
and not statistically significant, these data indicate that
a relationship may exist between allelic richness and
multiple paternity in sharks, though more data points
are needed to provide thorough analysis.
DISCUSSION
Population structure
We analyzed 670 bp of the mitochondrial control
region to characterize population structure and
nucleotide diversity in the shortspine spurdog Squalus
mitsukurii in Hawaii. Overall, our observation of sev-
eral common haplotypes distributed among nearly all
sampling sites indicates that S. mitsukurii throughout
the Hawaiian Archipelago is composed of a single
breeding population (K= 1). Given the low mtDNA
diversity and low sample sizes at most locations, how-
ever, the conclusion of no population structure in
S. mitsukurii from Hawaii must be regarded as provi-
sional. Although a robust test of this conclusion would
require larger sample sizes, the finding of no genetic
structure is consistent with reef fish studies that show
high connectivity across the Hawaiian Archipelago
(Craig et al. 2007, Eble et al. 2009). Interestingly, the
single specimen obtained from Gardner Pinnacles had
the most divergent haplotype, 1.2% from the nearest
related haplotype. This divergence is notable because
Gardner Pinnacles in the central Hawaiian Archipel-
ago is near Johnston Atoll, a suspected entry point for
colonization into Hawaii (Gosline 1955). These data
indicate that dispersal in S. mitsukurii is greater than
their known habitats would indicate (see Schultz et al.
2008), because maternal gene flow appears to occur
across depths greater than the maximum depth (954 m)
reported for this species (Compagno et al. 2005).
Multiple paternity in sharks
Our observation of 11% multiple paternity (3/27) in
Hawaiian Squalus mitsukurii is the lowest level esti-
mated in an elasmobranch species to date, with a max-
imum of 4 paternal alleles found at any single locus.
Number of paternal alleles detected per litter was not
correlated with TL of the mother or number of pups per
litter, though significant correlation was found be-
tween TL of the mother and number of offspring, a
finding consistent with other shark species (Cortes
2000). Estimates of the frequency of multiple paternity
in natural shark populations have included a predomi-
nance of genetic monogamy in the present study, as
well as in the bonnethead shark Sphyrna tiburo (18 %;
Chapman et al. 2004). Two studies have returned inter-
mediate values of multiple paternity, for the spiny dog-
fish shark Squalus acanthias (30%; Lage et al. 2008)
and the Hawaiian population of sandbar sharks Car-
charhinus plumbeus (40%; Daly-Engel et al. 2007).
Very high prevalence of multiple paternity was repor-
ted in lemon sharks Negaprion brevirostris from the
262
Fig. 3. Correlation of allelic richness with percent multiple
paternity (% MP; square root-arcsine transformed) in all elas-
mobranch multiple paternity studies to date for which allele
frequency data was available. (A) Includes data points from 5
studies with species-specific microsatellite markers (Feld-
heim et al. 2004, Portnoy et al. 2007, DiBattista et al. 2008b,
Lage et al. 2008, present study); (B) shows the same correla-
tion including 2 studies that used non-species-specific loci
(Chapman et al. 2004, Daly-Engel et al. 2007)
Daly-Engel et al.: Multiple paternity in Squalus mitsukurii
Bahamas (87%; Feldheim et al. 2004) and Florida
(85%; DiBattista et al. 2008a), and in the Northwest
Atlantic population of sandbar sharks C. plumbeus
(86%; Portnoy et al. 2007). No shark species examined
to date has shown a complete absence of multiple
paternity. The ubiquity of multiple paternity in sharks
indicates that this strategy is beneficial or unavoidable,
or possibly both.
Portnoy et al. (2007) proposed that females with
longer reproductive cycles may employ polyandrous
mating behavior, effectively increasing the cumulative
genetic variation in progeny. Lemon sharks and North-
west Atlantic sandbar sharks, which show a high rate
of multiple paternity, mate once every 2 yr, while the
predominantly monogamous bonnethead sharks have
an annual reproductive cycle (Chapman et al. 2004,
Compagno et al. 2005). Our current results and those
from a previous paper (Daly-Engel et al. 2007) do not
support the long reproductive cycle high multiple
paternity hypothesis, since sandbar sharks in Hawaii
have the same reproductive cycle as those in the
Atlantic, but a much lower rate of multiple paternity.
Encounter rate theory and sexual conflict
The simplest explanation for the multiple paternity
observed in natural populations is the encounter rate
theory (Lopez-Leon et al. 1993, Daly-Engel et al. 2007),
which holds that rate of multiple mating should
depend on the number of male conspecifics a female
encounters over the course of a breeding season. In
high density populations, therefore, a female should
have more opportunities to encounter males, and the
rate of multiple paternity should increase (Kokko &
Rankin 2006, Daly-Engel et al. 2007). For example, in
nesting populations of olive ridley sea turtles Lepi-
dochelys olivaceus, Jensen et al. (2006) found that the
frequency of multiple paternity was highly correlated
with the density of reproductive adults.
In sexually reproducing species, differing fitness
strategies can lead to conflict between males and
females. Though we did not directly measure sexual
conflict, the frequency of multiple paternity may be
determined not only by the ecological conditions that
affect encounter rate, but the sex ratios under which
those encounters occur. Among roving predators such
as sharks, the social interplay between the sexes can
strongly influence encounter rate. Though mating
behavior in sharks is difficult to observe, female sharks
do exert mate choice in the wild, largely through mat-
ing avoidance (Pratt & Carrier 2001, Whitney et al.
2004). In contrast, male sharks are expected to exhibit
a fitness strategy that favors promiscuity. Because
many sharks exhibit sexual segregation as well as sex-
ually differential migration, the conflict between the
sexes is played out largely during mating encounters.
Shark mating is usually characterized by the male bit-
ing the female, especially around the base of the fins
and flank, until he succeeds in grasping one of her pec-
toral fins, wrapping his body around her, and inserting
1 of 2 intromittent organs (claspers) into her cloaca for
insemination (Pratt & Carrier 2001, Hamlett 2005).
Though mortality is rare, it is common for females to
incur serious injury during mating (Carrier et al. 2004)
and to be more vulnerable to predation during and
immediately after mating attempts. In sharks, the
female is the larger of the 2 sexes, and could theoreti-
cally avoid mating with a conspecific male in a one-on-
one encounter. In encounters where males outnumber
females, which may occur within a mating aggrega-
tion, males can overcome the size disadvantage with
cooperative behavior (mobbing or herding) to induce
otherwise unwilling females to mate (Pratt & Carrier
2001, Whitney et al. 2004). In the case of coercive mat-
ing, a female may capitulate to avoid incurring more
harm, resulting in convenience polyandry (Thornhill &
Alcock 1983, Lee & Hayes 2004, DiBattista et al.
2008a). For example, populations of sandbar sharks
Carcharhinus plumbeus in the Northwest Atlantic are
sexually segregated throughout much of the year, but
aggregate in the warmer water of the Gulf of Mexico in
the winter (Musick 1999). These aggregations may
create opportunities for cooperative behavior on the
part of the males to induce mating. In the Hawaiian
sandbar shark population, males and females mix
throughout the year (Daly-Engel et al. 2006, 2007) and
no large aggregations for the purposes of mating have
been observed. The encounter rate theory predicts that
because sexual segregation is less stringent in Hawaii
than in the Atlantic, there should be a higher rate of
multiple paternity in Hawaii. Instead, the rate of multi-
ple paternity in Hawaii is about half that observed the
Northwest Atlantic (Daly-Engel et al. 2007, Portnoy et
al. 2007), indicating that aggregative behavior which
facilitates male coercion may have a disproportion-
ately large effect on rate of multiple paternity.
Genetic polyandry and mating avoidance
The discrepancy between predictions based on the
encounter rate theory and observations from Pacific
and Atlantic sandbar sharks indicates that the sex ratio
during mating encounters (male-biased aggregations
versus one-on-one encounters) may play a role in de-
termining the prevalence of multiple paternity. Even
when a population does not include mating aggrega-
tions, predictability in the mating behavior of one sex
(e.g. female dependence on coastal nursery grounds,
263
Mar Ecol Prog Ser 403: 255–267, 2010
or philopatry; Feldheim et al. 2004, Grubbs et al. 2007)
may create the opportunity for seasonally elevated
density. Such predictable behavior may account for the
high (81 to 87%) multiple paternity observed among
populations of philopatric lemon sharks Negaprion
brevirostris. Feldheim et al. (2004) and DiBattista et al.
(2008a) suggest that high multiple paternity in lemon
sharks is more likely a result of convenience polyandry
than of indirect genetic benefits such as inbreeding
avoidance.
Squalus mitsukurii in Hawaii have a number of
physiological and life history traits which, taken to-
gether, may reduce genetic polyandry. Compared with
oviparous sharks, the squalid oviducal gland (the
organ of elasmobranch sperm storage) is relatively
reduced (Hamlett 2005), suggesting that long-term
sperm storage may not play a large role in the squalid
mating system. Ecologically, S. mitsukurii inhabit a
slope habitat (100 to 950 m depth), aggregating around
pinnacles, canyons, and seamounts. Within these ag-
gregations, males segregate from females, and adults
from both subadults and juveniles (Wilson & Seki
1994). This sexual segregation is common to almost
every shark species examined to date, and is thought
to be a mechanism for both mating and cannibalism
avoidance (Cortes 2000). Mating aggregations which
facilitate convenience polyandry are unlikely in spe-
cies like S. mitsukurii, whose asynchronous, ovovi-
parous reproductive strategy makes it difficult for
males to predict when females might be receptive to
mating. Lack of opportunity for male coercion could
lead to potentially low rates of multiple paternity in
species that demonstrate asynchronous reproduction.
For example, Lage et al. (2008) recently estimated the
rate of multiple mating to be 30% in 10 litters of the
congener species S. acanthias, which has the same
asynchronous, ovoviviparous reproductive strategy as
S. mitsukurii.
The protracted reproductive cycle may provide fur-
ther incentive for female Squalus mitsukurii to avoid
incurring harm from multiple copulations (Siva-Jothy
2006). S. mitsukurii gestate their young for 24 mo
(Compagno et al. 2005) and give birth to average of
6 pups per litter (Table 1). Every mature female S. mit-
sukurii caught for the present study had either fertil-
ized ova or embryos; like the congener S. acanthias,
S. mitsukurii appears to have little or no quiescent
period between pregnancies (Fischer et al. 2006,
T. S. Daly-Engel & R. D. Grubbs unpubl. data), such
that successful copulation most likely occurs very soon
following parturition. In squalid sharks, all fertilized
ova in each uterus are encased in a single membranous
casing or ‘candle’ that fills the uterus. The distal ends
of this candle plug the oviduct cranially and the uterine
sphincter caudally, such that any copulation following
fertilization would be unsuccessful, likely causing a
rupture in the candle leading to the death of the exist-
ing embryos. This physiology likely results in decrea-
sed opportunity for multiple mating in squalid com-
pared to carcharhinid sharks, which can mate while
gravid over a period of several months without harm-
ing the embryos, and added incentive for male avoid-
ance in female S. mitsukurii.
Genetic diversity and multiple paternity
A frequently proposed benefit of multiple paternity
is its potential for increasing effective population size
by increasing the number of males that mate success-
fully, thereby maintaining population genetic diversity
(Nunney 1996, Ramakrishnan et al. 2004, Frankham
2005). Elasmobranchs have lower genetic diversity
than most other taxa (Hoelzel et al. 2006), perhaps
because of their slow rate of molecular evolution (Mar-
tin et al. 1992). Multiple paternity at some frequency
has been observed in every elasmobranch species
examined to date, indicating that multiple paternity
may serve as a stable evolutionary strategy to maintain
genetic diversity in elasmobranch populations. Meta-
bolism might also play a role in lowering genetic diver-
sity in Squalus mitsukurii, which inhabits deeper,
cooler waters than the other species examined, and
whose correspondingly slower metabolic rate may
confer a lower than normal rate of genetic evolution
(Brown et al. 1979).
Multiple paternity may result in increased genetic
diversity in a single litter, but at the population level,
this effect is likely to be mitigated by a corresponding
increased variance in male reproductive success (Karl
2008). Our comparison of published estimates of
multiple paternity in sharks (Fig. 3) yielded a non-
significant correlation of R2= 0.40 between genetic
diversity and multiple paternity. Though this test has
arguably low power because of the sample size of only
5 studies, as more of these studies are done, the rela-
tively high R2value indicates that there may well be a
relationship between these 2 variables and that further
investigation is warranted. It is possible that allelic
richness itself might account for some of this pattern,
since increased allelic diversity enhances the probabil-
ity of detecting multiple paternity across loci (Neff &
Pitcher 2002). However, the ability to detect multiple
paternity in most of these studies is quite good (> 90 %).
It is possible that even in studies reporting a high
PrDM, multiple paternity may be underestimated due
to lack of allelic diversity across loci or sampling sites,
but most studies incorporate an interpretation of
allelism and PrDM in their discussions when reporting
on rate of multiple paternity.
264
Daly-Engel et al.: Multiple paternity in Squalus mitsukurii
CONCLUSIONS
Here we report the lowest level of multiple paternity
(11%) observed to date in an elasmobranch, the short-
spine spurdog Squalus mitsukurii. This is the first sur-
vey of genetic polyandry in a deep-water vertebrate.
While frequency of genetic polyandry in shark popula-
tions is likely influenced by sexual conflict, the find-
ings for S. mitsukurii also indicate a potential role for
physiology and encounter rate in determining the fre-
quency of multiple paternity. Under this hypothesis,
the predominance of genetic monogamy in this species
results from life history characters such as asyn-
chronous reproduction, lack of mating aggregations,
and an ovoviviparous reproductive mode where all
embryos initially develop in a common casing. S. mit-
sukurii also exhibited low nucleotide and haplotype
diversity relative to other elasmobranchs (π=0.0010 ±
0.0008, h= 0.5412 ± 0.0221). Given that the S. mit-
sukurii in Hawaii represent a healthy, unfished popu-
lation yet show low levels of genetic diversity, it is pos-
sible that populations elsewhere may experience low
levels of diversity made even lower by exploitation.
Though the case for a causative relationship between
polyandry and genetic diversity has yet to be made, it
is known that both reproductive strategy and genetic
diversity can influence a species’ ability to rebound
from population depletion, and these factors should be
considered in efforts to conserve and manage these
taxa.
Acknowledgements. The authors extend special thanks to
K. Holland, whose support made this project possible. Thanks
to J. Musick, J. Romine, C. Cotton, Y. Papastamatiou, J. Dale,
D. Itano, B. Alexander, C. Kelley, S. Lee, K. Kawamoto,
L. Litherland, M. Gaither, T. Timoney, G. Dill, B. Kikkawa,
and L. Yamada for help with sample collection. C. Lage, J. Di-
Battista, and D. Chapman generously contributed data for the
diversity meta-analysis. Z. Szabo, C. Bird, S. Daley, M. Mi-
zobe, A. Eggers, T. Trejo, G. Concepcion, J. Puritz, J. Eble,
J. Franks, K. Andrews, and J. Coffey helped with genetic and
statistical analysis, and J. Eble gave valuable input that
greatly improved this manuscript. Thanks to all the members
of the Holland, Toonen, and Bowen Labs for their support.
Genetic analyses were made possible by the EPSCoR Evolu-
tionary Genetics Facility at the Hawaii Institute of Marine
Biology, and funding was provided by the Ecology, Evolution
and Conservation Biology (EECB) Program at the University
of Hawaii, the National Science Foundation (NSF Graduate
K-12 program grant to EECB No. 0232016, OCE-0453167 to
B.W.B., OCE-0623678 to R.J.T., and EPS-0554657 to Univer-
sity of Hawaii), the PADI Foundation, the American Associa-
tion of University Women, and Sigma Xi. Research in the
Northwest Hawaiian Islands is supported by NOAA National
Marine Sanctuaries Program MOA grant No. 2005-008/66882
(B.W.B. & R.J.T.). Microsatellite enrichment was partially
funded by the Grainger Foundation and was carried out in the
Pritzker Laboratory for Molecular Systematics and Evolution
operated with support from the Pritzker Foundation, and writ-
ing was supported by grant No. 2 K12 GM000708 to the PERT
Program at the University of Arizona from the National Insti-
tute of General Medical Sciences division of NIH. We also
thank reviewers and editor J. H. Choat for helpful comments
and improvements to the manuscript. This is contribution
No. 1357 from the Hawaii Institute of Marine Biology and con-
tribution No. 7786 from the School of Ocean and Earth Sci-
ence and Technology at the University of Hawaii.
LITERATURE CITED
Adams EM, Jones AG, Arnold SJ (2005) Multiple paternity in
a natural population of a salamander with long-term
sperm storage. Mol Ecol 14:1803–1810
Birkhead TR (1998) Cryptic female choice: criteria for estab-
lishing female sperm choice. Evolution 52:1212–1218
Birkhead TR, Pizzari T (2002) Postcopulatory sexual selection.
Nat Rev Genet 3:262– 273
Bretman A, Tregenza T (2005) Measuring polyandry in wild
populations: a case study using promiscuous crickets. Mol
Ecol 14:2169– 2179
Brown WM, George M Jr, Wilson AC (1979) Rapid evolution
of animal mitochondrial DNA. Proc Natl Acad Sci USA
76:1967–1971
Carrier JC, Pratt HL, Castro JI (2004) Reproductive biology of
elasmobranchs. In: Carrier JC, Musick JA, Heithaus MR
(eds) Biology of sharks and their relatives. CRC Press,
Boca Raton, FL, p 269– 286
Castro ALF, Stewart BS, Wilson SG, Hueter RE and others
(2007) Population genetic structure of Earth’s largest
fish, the whale shark (Rhincodon typus). Mol Ecol 16:
5183– 5192
Chabot CL, Allen LG (2009) Global population structure of
the tope (Galeorhinus galeus) inferred by mitochondrial
region sequence data. Mol Ecol 18:545–552
Chapman DD, Prodohl PA, Gelsleicher J, Manire CA, Mah-
mood SS (2004) Predominance of genetic monogamy by
females in a hammerhead shark, Sphyrna tiburo: implica-
tions for shark conservation. Mol Ecol 13:1965–1974
Clement M, Posada D, Crandall K (2000) TCS: a computer
program to estimate gene genealogies. Mol Ecol 9:
1657–1660
Compagno LJV, Dando M, Fowler SL (2005) Sharks of the
world. Princeton University Press, Princeton, NJ
Cortes E (2000) Life history patterns and correlations in
sharks. Rev Fish Sci 8:299– 344
Craig MT, Eble JA, Bowen BW, Robertson DR (2007) High
genetic connectivity across the Indian and Pacific Oceans
in the reef fish Myripristis berndti (Holocentridae). Mar
Ecol Prog Ser 334:245–254
Crawford NG (2009) SMOGD: software for the measurement
of genetic diversity. Molecular Ecology Resources, avail-
able at www.ngcrawford.com/django/jost/
Daly-Engel TS, Grubbs RD, Holland KN, Toonen RJ, Bowen
BW (2006) Assessment of multiple paternity in single lit-
ters from three species of carcharhinid sharks in Hawaii.
Environ Biol Fishes 76:419–424
Daly-Engel TS, Grubbs RD, Bowen BW, Toonen RJ (2007)
Frequency of multiple paternity in an unexploited tropical
population of sandbar sharks (Carcharhinus plumbeus).
Can J Fish Aquat Sci 64:198– 204
Dean MD, Ardlie KG, Nachman MW (2006) The frequency of
multiple paternity suggests that sperm competition is
common in house mice (Mus domesticus). Mol Ecol 15:
4141– 4151
DiBattista JD, Feldheim KA, Gruber SH, Hendry AP (2008a)
Are indirect genetic benefits associated with polyandry?
265
Mar Ecol Prog Ser 403: 255–267, 2010
Testing predictions in a natural population of lemon
sharks. Mol Ecol 17:783– 795
DiBattista JD, Feldheim KA, Thibert-Plainte X, Gruber SH,
Hendry AP (2008b) A genetic assessment of polyandry
and breeding-site fidelity in lemon sharks. Mol Ecol 17:
3337– 3351
Dulvy NK, Sadovy Y, Reynolds JD (2003) Extinction vulnera-
bility in marine populations. Fish Fish 4:25– 64
Duncan KM, Martin AP, Bowen BW, De Couet HG (2006)
Global phylogeography of the scalloped hammerhead
(Sphyrna lewini ). Mol Ecol 15:2239–2251
Eble JA, Toonen RJ, Bowen BW (2009) Endemism and disper-
sal: comparative phylogeography of three surgeonfish
species across the Hawaiian Archipelago. Mar Biol 156:
689– 698
Evans JP, Magurran AE (2000) Multiple benefits of multiple
matings in guppies. Proc Natl Acad Sci USA 97:
10074– 10076
Excoffier L, Laval LG, Schneider S (2005) Arlequin ver. 3.0: an
integrated software package for population genetics data
analysis. Evol Bioinform Online 1:47– 50
Feldheim KA, Gruber SH, Ashley MV (2004) Reconstruction
of parental microsatellite genotypes reveals female poly-
andry and philopatry in the lemon shark, Negaprion bre-
virostris. Evolution 58:2332–2342
Feldheim KA, Stow AJ, Ahonen H, Chapman DD, Shivji MS,
Peddemors V, Wintner S (2007) Polymorphic microsatellite
markers for studies of the conservation and reproductive
genetics of imperilled sand tiger sharks (Carcharias tau-
rus). Mol Ecol 7:1366–1368
Fischer AF, Veras DP, Hazin FHV, Broadhurst MK, Burgess
GH, Oliviera PGV (2006) Maturation of Squalus mitsukurii
and Cirrhigaleus asper (Squalidae, Squaliformes) in the
southwestern equatorial Atlantic Ocean. J Appl Ichthyol
22:495– 501
Frankham R (2005) Genetics and extinction. Biol Conserv 126:
131–140
Glenn TC, Schable NA (2005) Isolating microsatellite DNA
loci. Methods Enzymol 395:202– 222
Gosline WA (1955) The inshore fish fauna of Johnston Island,
a Central Pacific atoll. Pac Sci 9:442– 480
Goudet J (1995) FSTAT (version 1.2): a computer program to
calculate F-statistics. J Hered 86:485–486
Graham KJ, Andrew NL, Hodgson KE (2001) Changes in rel-
ative abundance of sharks and rays on Australian South
East Fishery trawl grounds after twenty years of fishing.
Mar Freshw Res 52:549–561
Grubbs RD, Musick JA, Conrath CL, Romine JG (2007) Long-
term migratory movements, migration, and temporal delin-
eation of summer nursery for juvenile sandbar sharks in
the Chesapeake Bay region. Am Fish Soc Symp 50:87– 107
Hamlett WC (ed) (2005) Reproductive biology and phylogeny
of Chondrichthyes: sharks, batoids and chimaeras, Vol 3.
Science Publishers, Enfield, NH
Hoekert WEJ, Neufeglise H, Schouten AD, Menken SBJ
(2002) Multiple paternity and female-biased mutation at a
microsatellite locus in the olive ridley sea turtle (Lepi-
dochelys olivacea). Heredity 89:107– 113
Hoelzel AR, Shivji MS, Magnussen J, Francis MP (2006) Low
worldwide genetic diversity in the basking shark (Ceto-
rhinus maximus). Biol Lett 2:639–642
IUCN (2003) IUCN Red List of threatened or endangered
species. Available at http://www.ucnredlist.org/search/
detailsphp/41877/all
Jensen MP, Abreu-Grobois FA, Frydenberg J, Loeschcke V
(2006) Microsatellites provide insight into contrasting mat-
ing patterns in arribada vs. non-arribada olive ridley sea
turtle rookeries. Mol Ecol 15:2567–2575
Jost L (2008) GST and its relatives do not measure differentia-
tion. Mol Ecol 17:4015– 4026
Karl SA (2008) The effect of multiple paternity on the geneti-
cally effective size of a population. Mol Ecol 17:3973–3977
Keeney DB, Heupel MR, Hueter RE, Heist EJ (2005) Micro-
satellite and mitochondrial DNA analyses of the genetic
structure of blacktip shark (Carcharhinus limbatus) nurs-
eries in the northwestern Atlantic, Gulf of Mexico, and
Caribbean Sea. Mol Ecol 14:1911–1923
Kokko H, Rankin DJ (2006) Lonely hearts or sex in the city:
density-dependent effects in mating systems. Philos Trans
R Soc B 361:319– 334
Lage CR, Petersen CW, Forest D, Barnes D, Kornfield I, Wray
C (2008) Evidence of multiple paternity in spiny dogfish
(Squalus acanthias) broods based on microsatellite analy-
sis. J Fish Biol 73:2068– 2074
Last P, Stevens JD (1994) Sharks and rays of Australia. CSIRO
Publishing, Collingwood, Victoria
Lee PLM, Hayes GC (2004) Polyandry in a marine turtle:
females make the best of a bad job. Proc Natl Acad Sci
USA 101:6530– 6535
Lopez-Leon MD, Cabrero J, Pardo MC, Viseras E, Camacho
JPM (1993) Paternity displacement in the grasshopper
Eyprepocnemis plorans. Heredity 71:539 545
Madsen T, Ujvari B, Olsson M, Shine R (2005) Paternal alleles
enhance female reproductive success in tropical pythons.
Mol Ecol 14:1783– 1787
Martin AP, Naylor GJP, Palumbi SR (1992) Rates of mitochon-
drial DNA evolution in sharks are slow compared with
mammals. Nature 357:153–155
Martinez JL, Moran P, Perez J, De Gaudemar B, Beall E, Gar-
cia-Vazquez E (2000) Multiple paternity increases effec-
tive size of southern Atlantic salmon populations. Mol Ecol
9:293– 298
McCauley L, Goecker C, Parker P, Rudolph T, Goetz F, Ger-
lach G (2004) Characterization and isolation of DNA
microsatellite primers in the spiny dogfish (Squalus acan-
thias). Mol Ecol Notes 4:494– 496
Musick JA (1999) Ecology and conservation of long-lived
marine animals. In: Musick JA (ed) Life in the slow lane:
ecology and conservation of long-lived marine animals.
Am Fish Soc Symp 23:1–10
Neff BD, Pitcher TE (2002) Assessing the statistical power of
genetic analyses to detect multiple mating in fish. J Fish
Biol 61:739– 750
Neff BD, Pitcher TE (2005) Genetic quality and sexual selec-
tion: an integrated framework for good genes and compat-
ible genes. Mol Ecol 14:19– 38
Neff BD, Pitcher TE, Repka J (2002) A Bayesian model for
assessing the frequency of multiple mating in nature.
J Hered 93:406–414
Newcomer SD, Zeh JA, Zeh DW (1999) Genetic benefits
enhance the reproductive success of polyandrous females.
Proc Natl Acad Sci USA 96:10236–10241
Nunney L (1993) The influence of mating system and overlap-
ping generations on effective population size. Evolution
47:1329– 1341
Nunney L (1996) The influence of variation in female fecundity
on effective population size. Biol J Linn Soc 59:411– 425
Ohta Y, Okamura K, McKinney EC, Bartl S, Hashimoto K,
Flajnik MF (2000) Primitive synteny of vertebrate major
histocompatability complex class I and class II genes. Proc
Natl Acad Sci USA 97:4712– 4717
Pardini AT, Jones CS, Noble LR, Kreiser B and others (2001)
Sex-biased dispersal of great white sharks. Nature 412:
139– 140
266
Daly-Engel et al.: Multiple paternity in Squalus mitsukurii
Portnoy DS, Piercy AN, Musick JA, Burgess GH, Graves JE
(2007) Genetic polyandry and sexual conflict in the sand-
bar shark, Carcharhinus plumbeus, in the western North
Atlantic and Gulf of Mexico. Mol Ecol 16:187–197
Pratt HL Jr, Carrier JC (2001) A review of elasmobranch
reproductive behavior with a case study on the nurse
shark, Ginglymostoma cirratum. Environ Biol Fishes 60:
157–188
Pritchard JK, Stephens M, Donnelly P (2000) Inference of
population structure using multilocus genotype data.
Genetics 155:945– 959
Pritchard JK, Stephens M, Donnelly P (2000a) Inference of
population structure using multilocus genotype data.
Genetics 155:945– 959
Ramakrishnan U, Storz JF, Taylor BL, Lande R (2004) Estima-
tion of genetically effective breeding numbers using a
rejection algorithm approach. Mol Ecol 13:3283 3292
Raymond M, Rousset F (1995) GENEPOP version 1.2. Popula-
tion genetics software for exact tests and ecumenicism.
J Hered 86:248–249
Rowe S, Hutchings JA (2003) Mating systems and the conser-
vation of commercially exploited marine fish. Trends Ecol
Evol 18:567– 572
Saville KJ, Lindley AM, Maries EG, Carrier JC, Pratt HLJ
(2002) Multiple paternity in the nurse shark, Ginglymos-
toma cirratum. Environ Biol Fishes 63:347–352
Schultz JK, Feldheim KA, Gruber SH, Ashley MV, McGovern
TM, Bowen BW (2008) Global phylogeography and sea-
scape genetics of the lemon sharks (genus Negaprion).
Mol Ecol 17:5336– 5348
Seutin G, White BN, Boag PT (1991) Preservation of avian
blood and tissue samples for DNA analyses. Can J Zool
69:82– 90
Siva-Jothy MT (2006) Trauma, disease, and collateral dam-
age: conflict in cimicids. Philos Trans R Soc B 361:269–275
Smith RL (1984) Sperm competition and the evolution of ani-
mal mating systems. Academic Press, San Diego, CA
Stow A, Zenger K, Briscoe D, Gillings M, Peddemors V,
Otway N, Harcourt R (2006) Isolation and genetic diversity
of endangered grey nurse shark (Carcharias taurus) popu-
lations. Biol Lett 2:308– 311
Sugg DW, Chesser RK (1994) Effective population sizes with
multiple paternity. Genetics 137:1147–1155
Sunnucks P, Hales DF (1996) Numerous transposed sequen-
ces of mitochondrial cytochrome oxidase I-II in aphids of
the genus Sitobion (Hemiptera: Aphididae). Mol Biol Evol
13:510– 524
Swofford DL (2000) PAUP*. Phylogeny analysis using parsi-
mony (*and other methods), version 4. Sinauer Associates,
Sunderland, MA
Taniuchi T, Tachikawa H (1999) Geographical variation in
age and growth of Squalus mitsukurii (Elasmobranchii:
Squalidae) in the North Pacific. Proc 5th Indo-Pacific Fish
Conf, 3– 8 Nov 1997, Nouméa. Societé Français d’Ichthy-
ologie, Paris, p 321– 328
Thornhill R, Alcock J (1983) The evolution of insect mating
systems. Harvard University Press, Cambridge, MA
Toonen RJ (2004) Genetic evidence of multiple paternity of
broods in the intertidal crab Petrolisthes cinctipes. Mar
Ecol Prog Ser 270:259–263
Valsecchi E, Vacchi M, Di Sciara DN (2005) Characterization
of a new molecular marker for investigating skate popu-
lation genetics: analysis of three Mediterranean skate
species (genus Raja) of commercial interest as a test case.
J Northwest Atl Fish Sci 35:225–231
van Oosterhout CV, Hutchinson W, Wills D, Shipley P (2004)
MICRO-CHECKER: software for identifying and correct-
ing genotype errors in microsatellite data. Mol Ecol Notes
4:535– 538
Vieites DR, Nieto-Roman S, Barluenga M, Palanca A, Vences
M, Meyer A (2004) Post-mating clutch piracy in an amphi-
bian. Nature 431:305–308
Watson PJ (1991) Multiple paternity as genetic bet hedging in
female sierra dome spiders, Linyphia litigiosa (Linyphi-
idae). Anim Behav 41:343– 360
White WT, Yearsley GK, Last PR (2007) Clarification of the
status of Squalus tasmaniensis and a diagnosis of Squalus
acanthias from Australia, including a key to the Indo-Aus-
tralasian species of Squalus. In: Last PR, White WT,
Pogonoski JJ (eds) Descriptions of new dogfishes of the
genus Squalus (Squaloidea: Squalidae). CSIRO Marine
and Atmospheric Research, Hobart, p 109 –115
Whitney NM, Pratt HL, Carrier JC (2004) Group courtship,
mating behaviour and siphon sac function in the whitetip
reef shark, Triaenodon obesus. Anim Behav 68:1435–1442
Wilson CD, Seki MP (1994) Biology and population character-
istics of Squalus mitsukurii from a seamount in the central
North Pacific Ocean. Fish Bull 92:851– 864
Zeh JA, Zeh DW (1997) The evolution of polyandry II: post-
copulatory defenses against genetic incompatibility. Proc
R Soc Lond B 264:69– 75
Zeh JA, Zeh DW (2001) Reproductive mode and the genetic
benefits of polyandry. Anim Behav 61:1051–1063
Zeh JA, Zeh DW (2003) Toward a new sexual selection para-
digm: polyandry, conflict, and incompatibility. Ethology
109:929– 950
267
Editorial responsibility: John Choat,
Townsville, Queensland, Australia
Submitted: August 18, 2009; Accepted: November 11, 2009
Proofs received from author(s): March 14, 2010
... El sistema de apareamiento de una especie se define como el modo en el que los individuos consiguen pareja (Klug 2011), la variación que pueda existir entre individuos de una población tendrá efectos en la aptitud de la especie. Entre los sistemas de apareamiento se encuentra la poliandria, común en varias especies de elasmobranquios (Chapman et al. 2004;Feldheim et al. 2004;Chevolot et al. 2007;Daly-Engel et al. 2007;Portnoy et al. 2007;DiBattista et al. 2008;Daly-Engel et al. 2010; Byrne y Avise 2012; Chabot y Haggin 2014), se caracteriza por la cópula de una hembra con varios machos en la misma temporada reproductiva. Este sistema puede llevar a una paternidad múltiple (PM), lo que puede culminar en la producción de una camada engendrada por múltiples machos (Karl 2008). ...
... Debido a lo anterior, diversos estudios se han enfocado en evaluar los procesos y características de las especies que promueven la PM en tiburones (Chapman et al. 2004;Feldheim et al. 2004;Chevolot et al. 2007;Daly-Engel et al. 2007;Portnoy et al. 2007;DiBattista et al. 2008;Daly-Engel et al. 2010; Byrne y Avise 2012; Chabot y Haggin 2014). Previamente se ha observado una correlación entre el tamaño de las hembras y el sistema de apareamiento que presentan algunas especies de tiburones (Chapman et al. 2004). ...
... Se discute que esta diferencia en el sistema de apareamiento quizá esté relacionada con la talla de las hembras, debido a que las de mayor tamaño tendieron a ser poliándricas (Chapman et al. 2004). De manera similar, se ha reportado ésta tendencia en la especie vivípara aplacentada Squalus mitsukurii en Hawái, en la que se registró solo el 11% de poliandria genética (Daly-Engel et al. 2010). La monogamia en tiburones se ha atribuido a caracteres fisiológicos como, una glándula oviductal reducida que no permite el almacenamiento de esperma (Hamlett 2005), una reproducción asincrónica que disminuye la frecuencia de cópulas coercitivas en la población, así como a las variaciones propias del hábitat (Daly-Engel et al. 2010). ...
Thesis
Los parámetros reproductivos de una población permiten evaluar su capacidad para sobreponerse ante la disminución de individuos, dichas evaluaciones han sido relevantes para la elaboración de planes de manejo en especies de importancia comercial. Aunado a esto, el sistema de apareamiento, juega un papel determinante en el éxito reproductivo de diversas especies. Actualmente los tiburones representan un grupo de importancia pesquera a nivel mundial, en la mayoría de las especies se ha reportado un apareamiento poliándrico, dando como resultado camadas fecundadas por múltiples machos (Paternidad Múltiple -PM-); sin embargo, una misma especie puede albergar individuos con apareamiento monógamo. Se desconoce cuáles son los factores que promueven una mayor o menor frecuencia de PM en especies que presentan ambos tipos de apareamiento. Estudios previos sugieren una relación entre el tamaño de las hembras y la PM, ya que las hembras grandes presentan camadas grandes. Esto lleva a hipotetizar que la PM está determinada por el tamaño de las hembras y sus camadas. Mustelus henlei es una especie que representa las principales capturas de elasmobranquios en la pesca artesanal del norte del Golfo de California, por lo que conocer los factores que determinan la PM resulta pertinente para la elaboración de planes de manejo que tomen en consideración dichas variables. El objetivo de este estudio fue evaluar la relación de la talla de las hembras y el tamaño de sus camadas con la PM en Mustelus henlei, mediante un análisis de paternidad con cuatro loci microsatelitales. Los resultados revelaron 56.52% de PM (n = 23 camadas), con un mínimo número de padres que osciló entre 1 y 4. En 10 de 13 camadas poliándricas se observó un sesgo en el éxito reproductivo de los machos, lo que sugiere la existencia de procesos post-copulatorios que determinan el porcentaje de paternidad individual. Un Modelo Linear Generalizado indicó que entre mayor es la talla de la hembra mayor es la probabilidad de ocurrencia de PM, lo que comprueba la hipótesis formulada en este estudio. Es probable que las hembras de menor tamaño tengan menos capacidades fisiológicas para mantener cópulas múltiples que las hembras grandes; este patrón, aunado a que las hembras no tienen periodos de descanso entre partos y suelen estar listas para ser fecundadas nuevamente, ha permitido que la especie mantenga altas tasas de crecimiento poblacional a lo largo de varias décadas y sus niveles de diversidad genética aún sean altos. Palabras clave: elasmobranquios, poliandria, paternidad múltiple, selección sexual.
... Estas características limitan a las especies en su capacidad de compensar pérdidas excesivas de organismos producto de la sobrepesca, por lo tanto coloca a las especies en un riesgo de ser extirpadas localmente (Cailliet et al. 2005;Musick et al. 2000;Smith et al. 1998;Stevens 2000). Por lo tanto, profundizar en los estudios de reproducción así como en los sistemas de apareamiento de los tiburones, nos permitirá entender mejor la dinámica de las poblaciones, lo que implica una aportación en la conservación y manejo de estos organismos (Chapman et al. 2004;Daly-Engel et al. 2010). ...
... La mayoría de las especies de tiburones presentan un comportamiento poliándrico (Daly-Engel et al. 2007;DiBattista et al. 2008;Feldheim et al. 2001;Portnoy et al. 2007;Rossouw et al. 2016), el cual se caracteriza por el acoplamiento sexual de una hembra con múltiples machos (Karl 2008). En contraste, algunos registros reportan la prevalencia de monogamia (Chapman et al. 2004;Daly-Engel et al. 2010;Holmes et al. 2018;Portnoy et al. 2007), que se caracteriza por ser una relación de apareamiento entre una hembra y un macho para toda la vida o en una temporada reproductiva (Karl 2008). En general, la poliandria como una estrategia reproductiva, puede ser benéfica para la población, debido a que, cuando resulta en múltiple paternidad (MP) puede aumentar la diversidad genética poblacional, y en consecuencia, la probabilidad de una mayor aptitud de la progenie ( Chapman et al. 2004;Daly-Engel et al. 2010). ...
... En contraste, algunos registros reportan la prevalencia de monogamia (Chapman et al. 2004;Daly-Engel et al. 2010;Holmes et al. 2018;Portnoy et al. 2007), que se caracteriza por ser una relación de apareamiento entre una hembra y un macho para toda la vida o en una temporada reproductiva (Karl 2008). En general, la poliandria como una estrategia reproductiva, puede ser benéfica para la población, debido a que, cuando resulta en múltiple paternidad (MP) puede aumentar la diversidad genética poblacional, y en consecuencia, la probabilidad de una mayor aptitud de la progenie ( Chapman et al. 2004;Daly-Engel et al. 2010). Por otro lado, se considera que la monogamia tiene la tendencia a reducir la diversidad genética y el tamaño poblacional efectivo (Ne), el cual está restringido por el número de hembras y machos que se puedan reproducir, por lo que en esta estrategia reproductiva se espera un menor número de parejas reproductivas, lo que a largo plazo puede llevar a un aislamiento reproductivo entre poblaciones, endogamia y por lo tanto una menor aptitud de la especie (Chapman et al. 2004;Chevolot et al. 2007). ...
... with more females would be desirable because it could increase its reproductive fitness (Daly-Engel et al., 2010). On other hand, mating with multiple males would be desirable for females because it could reduce genetic incompatibility and increase offspring fitness (Lyons et al., 2017). ...
... The evolutive drivers behind MP evolution in elasmobranchs are still being discussed. Convenience polyandry is when multiple mating occurs with females to avoid the physical costs of resisting copulation with different males and is widely used to explain MP in elasmobranchs (Daly-Engel et al., 2010). On the other hand, some evidence points to females having an active role in the reproductive system selection rather than being passive, due to potential benefits obtained from multiple mating (Lyons et al., 2021). ...
Article
Multiple paternity (MP) is a phenomenon observed for more than 30 elasmobranch species. The Batoidea is more specious than the Selachii, however, only three studies of multiple paternity have been conducted on batoids. The occurrence of MP in freshwater stingrays was tested using microsatellite markers, which were developed for Potamotrygon leopoldi. Six mothers and their litters were genotyped, providing the first evidence of multiple paternity for Potamotrygonidae, with a MP frequency of 33%. This article is protected by copyright. All rights reserved.
... Conversely, polyandrous mating behavior by female sharks may actually decrease their fitness as a result of wounds inflicted during copulation, when males are known to grasp the flanks and pectoral fins of the females with their teeth (Pratt & Carrier, 2001). As a result, the study of multiple mating in sharks has long focused on the role of females and female choice (Daly-Engel et al., 2010;Fitzpatrick et al., 2012). Multiple paternity may be favored to evolve in species in which the female has a lower risk of injury if she submits to copulation, a hypothesis known as convenience polyandry (DiBattista et al., 2008). ...
... Table 2). Despite high polyandry, we found no evidence for increased fitness as a result of multiple mating; also, as in previous studies on sharks (Boomer et al., 2013;Daly-Engel et al., 2010;Portnoy et al., 2007), litter size and rate of MP were not correlated. ...
Article
Full-text available
The mechanisms underlying polyandry and female mate choice in certain taxonomic groups remain widely debated. In elasmobranchs, several species have shown varying rates of polyandry based on genetic studies of multiple paternity (MP). We investigated MP in the finetooth shark, Carcharhinus isodon, in order to directly test the encounter rate hypothesis (ERH), which predicts that MP is a result of the frequency of encounters between mature conspecifics during the breeding season, and should therefore increase when more time is available for copulation and sperm storage. Female finetooth sharks in the northern Gulf of Mexico (GoM) have been found to reproduce with both annual periodicity and biennial periodicity, while finetooth sharks from the northwestern Atlantic Ocean have only been found to reproduce biennially, allowing us to compare mating opportunity to frequency of MP. Our results show high rates of MP with no significant difference in frequency between females in the GoM (83.0%) and Atlantic (88.2%, p = .8718) and varying but nonsignificant rates of MP between females in the GoM reproducing annually (93.0%) and biennially (76.6%, p = .2760). While the ERH is not supported by this study, it remains possible that reproductive periodicity and other physiological factors play a role in determining rates of MP in elasmobranchs, with potential benefits to individuals and populations. We investigated multiple paternity in the finetooth shark in order to directly test the encounter rate hypothesis, which predicts that multiple paternity is a result of the frequency of encounters between mature conspecifics during the breeding season. We found high rates of multiple paternity with no significant differences corresponding to reproductive periodicity or location.
... Sharks often have lower genetic diversity than mammals and bony fishes due to their relatively slow rate of change genomes. There are differences in the level of genetic diversity due to the different evolutionary history of the different aquatic organisms and the ecological geography environment [30][31][32]. Generally, species that are endemic or endangered tend to have lower genetic variation and lower genetic diversity [6,33]. ...
Article
Full-text available
Estimation of genetic diversity of threatened species constitutes a prerequisite for conservation. Inter-simple sequence repeat (ISSR) analysis was applied to investigate genetic diversity in three populations of Arabian carpet shark, Chiloscyllium arabicum from Saudi water in the Arabian Gulf. Overall, seventeen selected ISSR primers produced 154 bands, with 96 (62.34%) being polymorphic through 90 samples belonging to three populations that were amplified. 58.20%, 53.10 % and 50.32 % of these loci were polymorphic over all the genotype examined in Al-Jubail, Al-Qatif and Al-Odaid populations, respectively. The average number generated per primer for band and polymorphic band was 9.05 and 5.64, respectively. The measurement of genetic diversity between populations has been estimated by the overall genetic differentiation (Gst) 0.223, and the gene flow (Nm) 1.13. In addition, analysis of molecular variance (AMOVA) showed that genetic variation within population and among populations was 79% and 21 %, respectively. The dendrogram linked Al-Qatif and Al-Odaid populations separated from the Al-Jubail population. The finding of principal coordinate analysis (PCoA) showed that parallel to those given by the UPGMA cluster analysis. The results demonstrated that the usefulness of ISSR markers for estimating the genetic diversity within and among of Chiloscyllium arabicum populations and also, gain genetic information preliminary that can be effected for monitoring and management conservation of this species.
... Sharks often have lower genetic diversity than mammals and bony fishes due to their relatively slow rate of change genomes. There are differences in the level of genetic diversity due to the different evolutionary history of the different aquatic organisms and the ecological geography environment [30][31][32]. Generally, species that are endemic or endangered tend to have lower genetic variation and lower genetic diversity [6,33]. ...
Article
Full-text available
The population genetic structure and female philopatry to nursery grounds of the scalloped hammerhead shark (Sphyrna lewini) were studied in different mangrove estuaries along the Mexican Pacific coast containing putative nurseries. These nurseries were grouped into northern (Sinaloa-Nayarit), central (Jalisco), and southern (Oaxaca-Chiapas) regions. Neonates and young of the year were collected near estuaries or river inlets, and their genetic variation was compared based on mitochondrial DNA (mtDNA) genome sequences and 11 nuclear microsatellite loci. The mtDNA analysis showed significant differences between the abovementioned regions, accompanied by genetic homogeneity of microsatellites. Based on the genetic divergence of mtDNA and the lack of differences in nuclear markers, our results are congruent with female philopatry to nursery areas, as observed in other shark species. The parentage analysis applied to the microsatellite data showed moderate levels of relatedness among individuals within nurseries, suggesting philopatry as a cause of the observed results. The pattern of nursery grounds of the scalloped hammerhead shark in the Mexican Pacific seems to be regional, as no differences were observed between neighboring estuaries within each studied region. These findings are relevant for delineating conservation plans to preserve key populations and minimize the effects of commercial fisheries.
Article
Multiple paternity (MP) in the brown smooth‐hound shark (Mustelus henlei) was assessed in 15 litters (15 mothers and 97 embryos) collected in the northern Gulf of California of which 86.7% were sired by more than one male (i.e., from 2 to 4 sires). When taken together with results from previous studies, this record indicates that there is regional variation in MP in M. henlei in the northeastern Pacific. This pattern is associated with variations in the reproductive traits of each population (e.g., female size and litter size). In the Gulf of California, the results of a generalized linear model (GLZ) indicated that the litters of larger females had a higher probability of MP compared to those of smaller females.
Article
Full-text available
Understanding mating systems is a pillar of behavioral ecology, placing the complex interactions between females and males into a reproductive context. The field of multiple paternity, the phenomenon whereby many sires contribute to an individual litter, has traditionally viewed females as passive players in a male‐male competitive framework. With the emergence of feminist perspectives in ecological fields, novel alternative mechanisms and evolutionary theories across invertebrate and vertebrate taxa recognize females are active stakeholders in the reproductive process. Despite their evolutionary significance, ecological diversity, and myriad reproductive modes elasmobranch (sharks, skates and rays) research lags behind other fields regarding complex biological processes, such as multiple paternity which is often ascribed to convenience polyandry. Here, we layout hypotheses and re‐synthesize multiple paternity literature from a female and life history perspective to highlight how alternative mechanisms influence the predominance of multiple paternity across elasmobranchs. We draw upon parallels in other invertebrate and vertebrate taxa to demonstrate how female elasmobranchs can influence multiple paternity outcomes that benefit their reproductive success. Our article challenges dogma that has resulted from years of dismissing the female perspective as important and provides a framework for future advancement using more holistic approaches to studying mating systems.
Article
Full-text available
Skin mucus in fish is the first barrier between the organism and the environment but the role of skin mucus in protecting fish against pathogens is not well understood. During copulation in sharks, the male bites the female generating wounds, which are then highly likely to become infected by opportunistic bacteria from the water or from the male shark’s mouth. Describing the microbial component of epithelial mucus may allow future understanding of this first line of defense in sharks. In this study, we analyzed mucus and skin samples obtained from 19 individuals of two shark species and a stingray: the nurse shark ( Ginglymostoma cirratum ), the lemon shark ( Negaprion brevirostris ) and the southern stingray ( Hypanus americanus ). Total DNA was extracted from all samples, and the bacterial 16S rRNA gene (region V3-V4) was amplified and sequenced on the Ion Torrent Platform. Bacterial diversity (order) was higher in skin and mucus than in water. Order composition was more similar between the two shark species. Alpha-diversities (Shannon and Simpson) for OTUs (clusters of sequences defined by a 97% identity threshold for the16S rRNA gene) were high and there were non-significant differences between elasmobranch species or types of samples. We found orders of potentially pathogenic bacteria in water samples collected from the area where the animals were found, such as Pasteurellales (i.e., genus Pasteurella spp. and Haemophilus spp.) and Oceanospirillales (i.e., genus Halomonas spp.) but these were not found in the skin or mucus samples from any species. Some bacterial orders, such as Flavobacteriales, Vibrionales (i.e., genus Pseudoalteromonas ), Lactobacillales and Bacillales were found only in mucus and skin samples. However, in a co-occurrence analyses, no significant relationship was found among these orders (strength less than 0.6, p-value > 0.01) but significant relationships were found among the order Trembayales, Fusobacteriales, and some previously described marine environmental Bacteria and Archaea, including Elusimicrobiales, Thermoproteales, Deinococcales and Desulfarculales. This is the first study focusing on elasmobranch microbial communities. The functional role and the benefits of these bacteria still needs understanding as well as the potential changes to microbial communities as a result of changing environmental conditions.
Article
Full-text available
Arlequin ver 3.0 is a software package integrating several basic and advanced methods for population genetics data analysis, like the computation of standard genetic diversity indices, the estimation of allele and haplotype frequencies, tests of departure from linkage equilibrium, departure from selective neutrality and demographic equilibrium, estimation or parameters from past population expansions, and thorough analyses of population subdivision under the AMOVA framework. Arlequin 3 introduces a completely new graphical interface written in C++, a more robust semantic analysis of input files, and two new methods: a Bayesian estimation of gametic phase from multi-locus genotypes, and an estimation of the parameters of an instantaneous spatial expansion from DNA sequence polymorphism. Arlequin can handle several data types like DNA sequences, microsatellite data, or standard multilocus genotypes. A Windows version of the software is freely available on http://cmpg.unibe.ch/software/arlequin3.
Article
Full-text available
For over a decade, we have been studying the reproductive behavior of the nurse shark, Ginglymostoma cirratum, in the Dry Torugas off the Florida Keys, an important mating and nursery ground for this species. In the course of these studies, we have used a variety of tags and tagging protocols to monitor individual animals. Here we report the use of molecular methods for the genetic analysis of nurse sharks. Specifically we have analyzed genetic variation at the MHC II alpha locus using the polymerase chain reaction (PCR) followed by restriction fragment length polymorphism (RFLP) analysis of the amplified products. We found this technique to be a relatively rapid and reliable method for identifying genetic differences between individual sharks. Applying this method to a family of sharks consisting of a mother and 32 pups, we demonstrate that at least four fathers must have fathered this brood. Multiple paternity in the nurse shark suggests a mechanism by which populations of this species may maximize genetic variability. This seems especially valuable for philopatric species whose migratory movement, and thus potential for genetic diversity, is limited.
Article
Full-text available
Delineation of essential fish habitat for exploited populations is critical to proper management. Spatial delineation of summer nurseries for elasmobranchs has received increased attention in recent years; however, temporal patterns of nursery use and the delineation of wintering areas are as critical. The lower Chesapeake Bay is the largest summer nursery for sandbar sharks Carcharhinus plumbeus in the western Atlantic. The goals of this study were to delineate temporally the use of the nursery and the migratory movements of juvenile sandbar sharks in this estuary, to determine the location of wintering areas, and to determine if philopatry or homing to natal summer nurseries occurs in subsequent years. Longline sampling conducted between 1990 and 1999 indicated that immigration to the bay occurred from late May to early July and was highly correlated with increasing water temperature. Emigration from the estuary occurred in late September and early October and was highly correlated with decreasing day length. We hypothesize that photoperiod is the environmental trigger to begin fall and spring migrations, whereas temperature may elicit the response to move into the estuaries that serve as summer nurseries. Between 1995 and 2003, we tagged 2,288 juvenile sandbar sharks. Seventy-three sharks were recaptured following 4 to 3,124 d at liberty and the distance from tagging locations ranged from 0 to 2,800 km. Recapture data suggest that most sandbar sharks return to their natal estuaries during summer for at least the first 3 years and return to adjacent coastal waters for up to 9 years. These data also indicate that wintering areas are concentrated off the coast of North Carolina between 33°30’N and 34°30’N latitude, primarily in nearshore waters less than 20 m deep, though sharks older than 7 years were recaptured as far as 60 km from shore. Temporal use of this area by juvenile sandbar sharks occurs from late October until late May for at least the first 7 years and up to 10 years.
Article
Full-text available
Human impacts on the world's oceans have been substantial, leading to concerns about the extinction of marine taxa.We have compiled 133 local, regional and global extinc-tions of marine populations. There is typically a 53-year lag between the last sighting of an organism and the reported date of the extinction at whatever scale this has occurred. Most disappearances (80%) were detected using indirect historical compara-tive methods, which suggests that marine extinctions may have been underestimated because of low-detection power. Exploitation caused most marine losses at various scales (55%), followed closely by habitat loss (37%), while the remainder were linked to invasive species, climate change, pollution and disease. Several perceptions concerning the vulnerability of marine organisms appear to be too general and insu¤ciently con-servative. Marine species cannot be considered less vulnerable on the basis of biological attributes such as high fecundity or large-scale dispersal characteristics. For commer-cially exploited species, it is often argued that economic extinction of exploited popula-tions will occur before biological extinction, but this is not the case for non-target species caught in multispecies ¢sheries or species with high commercial value, espe-cially if this value increases as species become rare. The perceived high potential for recovery, high variability and low extinction vulnerability of ¢sh populations have been invoked to avoid listing commercial species of ¢shes under international threat criteria. However, we need to learn more about recovery, which may be hampered by negative population growth at small population sizes (Allee e¡ect or depensation) or ecosystem shifts, as well as about spatial dynamics and connectivity of subpopulations before we can truly understand the nature of responses to severe depletions. The evidence sug-gests that ¢sh populations do not £uctuate more than those of mammals, birds and but-ter£ies, and that ¢shes may exhibit vulnerability similar to mammals, birds and butter£ies. There is an urgent need for improved methods of detecting marine extinc-tions at various spatial scales, and for predicting the vulnerability of species.
Article
Because sharks possess an unusual suite of reproductive characteristics, including internal fertilization, sperm storage, relatively low fecundity, and reproductive modes that range front oviparity to viviparity, they can provide important insight into the evolution of mating systems and sexual selection. Yet, to date, few studies have characterized behavioral and genetic mating systems in natural populations of sharks or other elasmobranchs. In this study, highly polymorphic microsatellite loci were used to examine breeding biology of a large coastal shark, the lemon shark, Negaprion brevirostris, at a tropical lagoon nursery. Over six years, 910 lemon sharks were sampled and genotyped. Young were assigned into sibling groups that were then used to reconstruct genotypes of unsampled adults. We assigned 707 of 735 young sharks to one of 45 female genotypes (96.2%), and 485 (66.0%) were assigned to a male genotype. Adult female sharks consistently returned to Bimini on a biennial cycle to give birth. Over 86% of litters had multiple sires. Such high levels of polyandry raise the possibility that polyandry evolved in viviparous sharks to reduce genetic incompatibilities between mother and embryos. We did not find a relationship between relatedness of mates and the number of offspring produced, indicating that inbreeding avoidance was probably not driving pre- or postcopulatory male choice. Adult male sharks rarely sired more than one litter at Bimini and may mate over a broader geographic area.
Chapter
The elasmobranchs have had an incredibly long evolutionary history: more than 400 million years. During this extensive period elasmobranchs separately evolved many adaptations such as exquisite senses and complex reproductive modes that rival those of the most advanced tetrapods. In this chapter we review the reproductive adaptations of the elasmobranchs and show how these adaptations have contributed to their evolutionary success and genetic continuity. It is not intended here to produce a complete review of elasmobranch reproduction, as there are several excellent reviews already: Budker (1958), Wourms (1977), and Dodd (1983). Our goal is to produce a brief overview of elasmobranch reproduction that will lead the reader to the more specialized literature. We have used examples of anatomy and modes of reproduction for the few elasmobranchs that are well known. However, we must add the caveat that, although elasmobranch reproduction has proceeded along only a few paths, there is great diversity among congeners. This diversity is often expressed as different brood sizes, ovarian cycles, gestation periods, mating systems, use of different nurseries, etc. We must also state that the reproductive processes for most sharks remain unknown. Unraveling the many secrets of elasmobranch reproduction will remain a challenge for future researchers.
Article
Elasmobranch reproductive behavior has been inferred from freshly caught specimens, laboratory examinations of reproductive structures and function, or determined from direct observations of captive or free swimming wild animals. Several general behaviors have been described including seasonal sexual segregation, courtship and copulation. Courtship behavior was inferred for many species from the presence of scars and tooth cuts on the female's body, and noted in more detail from underwater observations. Copulation has been directly observed in captive settings for several species of elasmobranchs in large aquaria, and in the wild for three species of urolophids and for Triaenodon obesus and Ginglymostoma cirratum. A detailed ‘case history’ of nurse shark reproductive behavior is presented that may be used as a template for future work on shark reproductive behavior of other species. Our studies, using diver identifiable tags and in situ behavioral observations, provide unprecedented information on social structure and mating behavior in this species. Since 1993, 115 G. cirratum, 45 adults and 70 juveniles have been tagged in the Dry Tortugas, Florida. Observations show that adult males visit the study site every year with three males dominant. Individual adult females visit the study area to mate in alternate years. Polygyny and polyandry are common. Future research on reproductive behavior of elasmobranchs should address questions on male access to females, sexual selection and dominance hierarchies.
Article
Behavioural ecology is currently undergoing a paradigm shift, with the traditional concepts of the choosy, monogamous female and the coadapted gene complex increasingly giving way to the realization that sexual reproduction engenders conflicts, promotes polyandry, and thereby provides females with a cryptic arsenal of postcopulatory processes with which to safeguard their investment in large, costly eggs. As research focuses on reproduction from the female perspective, evidence is emerging that polyandry can provide genetic benefits that enhance female reproductive success. In this review, we propose that reproductive mode is a critically important factor influencing the type of genetic benefits that females gain by mating with more than one male. Among the hypotheses that propose genetic benefits to polyandry, there is a distinction between those that posit benefits from intrinsic (additive) effects of paternal genes in offspring, and those that propose a benefit resulting from defence against incompatibility. Polyandry to acquire superior paternal genes and polyandry as a defence against incompatibility are not mutually exclusive hypotheses. However, evidence from reproductive physiology, immunology and evolutionary conflict theory suggest that development of the embryo within the female makes polyandry for incompatibility avoidance far more important for viviparous females than for females that lay eggs.
Article
We analysed video records of three mating events involving nine free-living whitetip reef sharks in Cocos Islands, Costa Rica to examine reproductive behaviour in this species. We describe several behaviours never before documented in this species, and four behaviours never before documented in any elasmobranch. Here, we also present the first hypothesis for the function of the male's paired reproductive organs, the siphon sacs, to be based on observations of mating sharks. We introduce terminology for three separate siphon sac structural components that are externally visible during courtship and mating in this species. Based on our analyses, as well as evidence from past mating studies, the siphon sacs in whitetip reef sharks appear to be used to propel sperm into the female's reproductive tract, not for flushing the female's reproductive tract of sperm from previous males. We discuss the implications of 'group courtship', 'siphon isthmus constriction', 'reverse thrusting', 'postrelease gaping' and 'noncopulatory ejaculation'.