ArticlePDF Available

Abstract and Figures

Twenty-three populations belonging to 10 wild Primula L. (Primulaceae) taxa of Turkey, some of which are morphologically quite similar, were investigated based on nrDNA ITS regions. The plant materials were collected from different geographical areas of Anatolia in vegetation periods of 2005 and 2006. Total genomic DNAs were isolated from the healthy leaves of each population. The entire ITS regions of the populations were amplified by universal primers with the aid of a polymerase chain reaction (PCR), and then the PCR products were sequenced. Neighbour-Joining (NJ) and Maximum Parsimony (MP) trees were constructed in order to identify the relationships among Primula taxa. According to ITS data, 724 characters were determined among the aligned sequences of the populations and the divergence values were found to be between 0.0% and 20.9%. ITS sequences from 23 specimens provided a number of variable and sufficient characters to explore the relationships. As a result, it was determined that the dendrograms obtained by NJ and MP analysis are concordant with the traditional taxonomical order at subgeneric level.
Content may be subject to copyright.
Internal transcribed spacer (ITS) polymorphism in the wild
Primula (Primulaceae) taxa of Turkey
Mutlu GÜLTEPE1, Uğur UZUNER2, Kamil COŞKUNÇELEBİ1,
Ali Osman BELDÜZ1, Salih TERZİOĞLU3
1Karadeniz Technical University, Faculty of Arts & Sciences, Department of Biology, 61080 Trabzon - TURKEY
2Texas A&M University, Department of Plant Pathology & Microbiology, College Station, TX 77843 - USA.
3Karadeniz Technical University, Faculty of Forestry, Department of Forest Botany, 61080 Trabzon - TURKEY
Received: 27.05.2009
Accepted: 16.02.2010
Abstract: Twenty-three populations belonging to 10 wild Primula L. (Primulaceae) taxa of Turkey, some of which are
morphologically quite similar, were investigated based on nrDNA ITS regions. e plant materials were collected from
dierent geographical areas of Anatolia in vegetation periods of 2005 and 2006. Total genomic DNAs were isolated from
the healthy leaves of each population. e entire ITS regions of the populations were amplied by universal primers with
the aid of a polymerase chain reaction (PCR), and then the PCR products were sequenced. Neighbour-Joining (NJ) and
Maximum Parsimony (MP) trees were constructed in order to identify the relationships among Primula taxa. According
to ITS data, 724 characters were determined among the aligned sequences of the populations and the divergence values
were found to be between 0.0% and 20.9%. ITS sequences from 23 specimens provided a number of variable and sucient
characters to explore the relationships. As a result, it was determined that the dendrograms obtained by NJ and MP
analysis are concordant with the traditional taxonomical order at subgeneric level.
Key words: Turkey, ITS PCR, nrDNA, phylogeny, Primula
Türkiye’de doğal olarak yayılış gösteren Primula (Primulaceae)
taksonlarının ITS polimorzmi
Özet: Bu çalışmada, morfolojik olarak birbirine oldukça benzeyen 10 doğal Primula L. (Primulaceae) taksonuna ait 23
populasyon nrDNA ITS bölgeleri bakımından incelenmiştir. Bitki örnekleri 2005-2006 vejetasyon döneminde
Anadolu’nun farklı coğrak alanlarından toplanmıştır. Her populasyonun genomik DNAları sağlıklı yapraklardan elde
edilmiştir. ITS bölgeleri evrensel oligonükleotidler kullanılarak PCR yardımıyla elde edilmiş ve baz dizin analizleri
yapılmıştır. Primula taksonları arasındaki logenetik ilişkiyi belirlemek için Neighbour-Joining (NJ) ve Maksimum
Parsimoni (MP) ağaçları çizilmiştir. Populasyonlara ait baz dizin verilerinin hizalanmasıyla 724 karakterlik bir veri
matriksi elde edilmiş ve divergens değerlerinin de % 0,0-20,9 arasında değiştiği bulunmuştur. ITS baz dizinleri 23 örnekte
akrabalık ilişkilerini açıklamada yeterli veri sağlamaktadır. Sonuç olarak, NJ ve MP analizlerinden elde edilen
dendrogramların altcins seviyesinde geleneksel taksonomik verilerle uyumlu olduğu bulunmuştur.
Anahtar sözcükler: Türkiye, logeni, ITS PCR, nrDNA, Primula
147
Research Article
Turk J Bot
34 (2010) 147-157
© TÜBİTAK
doi:10.3906/bot-0905-23
* E-mail: mutlugultepe61@gmail.com
148
Internal transcribed spacer (ITS) polymorphism in the wild Primula (Primulaceae) taxa of Turkey
Introduction
The genus Primula L. (Primulaceae) includes
about 400 species belonging to 6 subgenera and 37
sections (Richards, 1993). It is widely distributed
outside of the Asian highlands and in the high
altitudes of North America, Europe, and the eastern
Sino-Himalayan region, considered the primary
centre of diversity for this genus (Hu & Kelso, 1996).
Many Primula species are also widely cultivated
throughout the world as ornamental plants (Mizuhiro
et al., 2001). Plant collectors have supplied enough
materials for horticultural and scientific purposes and
have played an important role in recognising the
genus (Hu & Kelso, 1996; Zhang & Kadereit, 2004)
and this genus has been recently studied by many
taxonomists, ecologists, geneticists, and gardeners
(Mast et al., 2001), but it is still not well known in the
wild. Heterostyly, recognised as a complex
reproductive syndrome with significant ecological
and evolutionary implications, is a well-known
process for the genus Primula (Barrett et al., 2000).
Heterostyly has played an important role in systematic
treatments of the genus Primula at the generic and
infrageneric levels (Richards, 1993). The suggested
base chromosome number is x = 11, but it varies from
x = 8 to x = 12 (Wendelbo, 1961; Mast et al., 2001;
Abou-el-Enain, 2005). Systematic investigations of
this genus have also shown that the chromosome
numbers are an important character in its
classification (Wendelbo, 1961; Richards, 1993).
A few characters used in the traditional systematic
studies for the genus Primula, besides heterostyly and
homostyly, are the chromosome base number, leaf
vernation, and pollen exine morphology (Mast et al.,
2001). Despite their putative importance in
elucidating relationships among Primula taxa, the
characters listed here do not align consistently with
one another (Mast et al., 2001), and therefore,
molecular sampling might provide an independent
systematic value (Conti et al., 2000). The internal
transcribed spacer (ITS) region and many other
molecular markers have been used in numerous plant
systematic studies at the family, generic, and specific
levels (Baldwin et al., 1995; Ogundipe & Chase, 2008).
This region is often used in closely related species for
phylogenetic analyses in several plant genera
(Anderberg & Stahl, 1995) and also in the genus
Primula (Conti et al., 2000; Kovtonyuk & Goncharov,
2009). Conti et al. (2000) used nuclear DNA
sequences to reconstruct the infrageneric phylogeny
of Primula, while Kovtonyuk and Goncharov (2009)
analysed the sequences of nuclear DNA and
confirmed Richards’ (2003) sectional rank proposal.
Mast et al. (2001) examined the specific chloroplast
DNA regions (the atpB, ndhF, and rblC genes) and
stressed that subg. Aleuritia needs a revision of its
delimitation. Analysis of the ITS sequences provided
new insights into the phylogeny of Primula (Conti et
al., 2000; Martins et al., 2003). According to Wendelbo
(1961) and Richards (1993), involute leaf vernation is
an ancestral trait, based on phenetic analysis, but
Conti et al. (2000) stress that the revolute traits are
ancestral, based on ITS data. Therefore, we thought
that performing molecular analyses based on nuclear
rDNA could provide additional useful information
about the Primula taxa of Turkey.
According to Lamond (1978), the genus Primula
is represented by only 8 species in Turkey. Of these, 2
members, P. d av i s ii W. W. S m . a n d P. l o ng i pe s Freyn &
Sint, are endemic to Turkey, and they are assessed as
vulnerable (VU) and endangered (EN), respectively
(Ekim et al., 2000). Turkish representatives of Primula
have been the subject of morphological, anatomical
(Beyazoğlu, 1989), cytotaxonomical (Hayırlıoğlu-
Ayaz & İnceer, 2003), and palynological (Pınar et al.,
2005) studies that have improved our understanding
of the systematics of the genus, but the Primula taxa of
Turkey have not been evaluated by analysis of ITS
region, except for P. davisii, which was used as an
outgroup to investigate the phylogeny and
biogeography of Dionysia Fenzl (Trift et al., 2004).
Thus, the main purpose of the current research was
to determine the ITS polymorphism among the taxa
of Primula distributed naturally in Turkey and to
elucidate their relationships.
Materials and methods
Plant Material
All plant materials used in this research were
collected from various regions of Anatolia during field
work in 2005 and 2006. For each population,
information related to the collection region and the
subgenera are shown in Table 1. The samples were
Table 1. Locality information.
Pop. Subg. Taxa Locality
no.
1P. vu lg ar is Huds. subsp. vulgaris A7 Trabzon: Beşikdüzü, Yeni Camii village, 01.v.2005, 970 m, Uzuner P11, KTUB
2P. vu lg ar is Huds. subsp. vulgaris A7 Trabzon: Beşikdüzü, Yeni Camii village, 01.v.2005, 970 m, Uzune r P12, KTUB
3P. vu lg ar is Huds. subsp. sibthor pii A7 Trabzon: Beşikdüzü, Yeni Camii village, 01.v.2005, 970 m, Uz uner P13, KTUB
(Hoffmanns.) W.W.Sm. & Forrest
4P. vu lg ar is Huds. subsp. vulgaris A4 Kastamonu: Bozkurt, 11.v.2005, 1200 m, Uz une r P15, KTUB
5P. vu lg ar is Huds. subsp. vulgaris A4 Kastamonu: Bozkurt, 11.v.2005, 1200 m, Uzuner P16, KTUB
6P. vu lg ar is Huds. subsp. sibthorpii A4 Kastamonu: Bozkurt, 11.v.2005, 1200 m, Uz une r P17, KTUB
(Hoffmanns.) W.W.Sm. & Forrest
7P. megaseifolia Boiss. & Bal. A7 Trabzon: Beşikdüzü, Şahmelik village, 10.iv.2005, 450 m, Uz uner P6, KTUB
8P. megaseifolia Boiss. & Bal. A8 Trabzon: Araklı, Sularbaşı village, 14.iv.2005, 1120 m, Uzune r P7, KTUB
9P. el at io r (L.) Hill subsp. meyerii (Rupr.) A8 Rize: İkizdere, Ovit Mountain, 24.vii.2005, 2850 m, Uzuner P26, KTUB
Valentine & Lamond
10 P. el at io r (L.) Hill subsp. meyerii (Rupr.) A7 Trabzon: Çaykara, Demirkapı village, 28.v.2005, 2920 m, Uzuner P29, KTUB
Valentine & Lamond
11 P. ve ri s L. subsp. columnae (Ten.) Lüdi A7 Trabzon: Çaykara, Ablaryas Plateau, 01.vi.2005, 2052 m, Uzuner P18, KTUB
12 P. ve ri s L. subsp. columnae (Ten.) Lüdi A7 Trabzon: Maçka Sümela Monastery, 24.v.2006, Coşkunçelebi 700, KTUB
13 P. v e r i s L. subsp. macrocalyx (Bunge) Lüdi A9 Artvin: Karagöl, 08.vi.2005, 1950 m, Uzuner P22, KTUB
14 P. lo ng ip e s Freyn & Sint. A8 Rize: İkizdere, Ovit Mountain, 24.vii.2005, 2850 m, Uzuner P25, KTUB
15 P. lo ng ip e s Freyn & Sint. A7 Trabzon: Çaykara, Demirkapı village, 28.v.2005, 3067 m, Uzuner P27, KTUB
16 P. auriculata Lam. A7 Gümüşhane: Kadırga village, 13.vi.2005, 2150 m, Uzuner P20, KTUB
17 P. auriculata Lam. A4 Kastamonu: Bozkurt, 1200 m 11.vi.2005, Coşkunçelebi 701, KTUB
18 P. auriculata Lam. A8 Erzurum: İspir, Moryayla, 21.x.2005, 2450 m, Uz une r P30, KTUB
19 P. auriculata Lam. A8 Kop Dağı, 2290 m, 18.v.2006, Coşkunçelebi 699, KTUB
20 P. algida Adams A9 Ardahan: Posof, Gönülaçan, 09.vi.2005, 2130 m, Uzuner P23, KTUB
21 P. algida Adams A8 Rize: İkizdere, Ovit Mountain, 24.vii.2005, 2850 m, Uzuner P24, KTUB
22 P. algida Adams A7 Trabzon: Çaykara, Demirkapı village, 28.v.2005, 2920 m, Uzuner P28, KTUB
23 P. davisii W.W.Sm C10 Hakkari: Çukurca, Stream path fork, 7.3 km, limy rock splits, 1200 m,
10.vi.2006, MF 10124, KTUB
Primula L.Aleuritia (Duby)
Wendelbo
Sphondylia
(Duby) Rupr.
149
M. GÜLTEPE, U. UZUNER, K. COŞKUNÇELEBİ, A. O. BELDÜZ, S. TERZİOĞLU
then identified according to traditional methods,
mainly by using Flora of Turkey (Lamond, 1978) and
Flora Europaea (Valentine & Kress, 1972), and stored
as herbarium specimens in the herbarium of the
Department of Biology, Faculty of Arts and Sciences,
Karadeniz Technical University.
DNA extraction
Total genomic DNAs were extracted from silica-
dried leaves or herbarium materials following the
modified CTAB extraction procedure of Doyle and
Doyle (1987). The gDNAs were resuspended in TE
(tris HCl-EDTA) and stored at +4 °C. The isolated
genomic DNAs were checked in a 1% agarose-TAE
(tris, acetate, and EDTA) gel containing 0.5 µg/L of
ethidium bromide and examined under UV light.
PCR amplification
The entire ITS regions (ITS1, 5.8S, and ITS2) were
amplified using a Biometra Personal Thermal Cycler.
The PCR reactions were performed using universal
ITS4 (5´- TCCTCCGCTTATTGATATGC- 3´) and
ITS5 (5´- GGAAGTAAAAGTCGTAACAAGG -3´)
primers, designed by White et al. (1990). The
amplification process was performed in 50 µL of PCR
reaction volume, containing 10 mM of Taq
polymerase reaction buffer, 2 mM of magnesium
chloride (MgCl2), 200 mM of dNTP, 1 M (ITS4 and
ITS5) each of the primer, 1-2 units of Taq DNA
polymerase, 2-6 ng (1 L of 2-6 ng/L) of total
template DNA, and 14 L of ddH2O. Reaction
mixtures were sealed with 1 or 2 drops of mineral oil
to prevent evaporation during thermal cycling.
Thermal cycling amplification was performed with an
initial denaturation step of 94 °C for 4 min, followed
by 35 cycles of strand denaturation at 94 °C for 1 min,
annealing at 50 °C for 45 s, and primer extension at
72 °C for 1 min, and a final elongation at 72 °C for 7
min.
Sequence analysis
PCR product purification and DNA sequence
analysis were performed by Macrogen Inc. (Seoul,
Korea). The sequencing process was conducted with
BigDyeTM terminator cycling protocols (Applied
Biosystems Inc., Foster City, CA, USA). PCR products
were purified using ethanol precipitation and run on
an Automatic Sequencer (ABI 3730x1) by a contract
laboratory. Sequencing of the 5’ end of the ITS region
was carried out using the primer ITS4. Sequences
with ambiguous sites were resequenced from the 3’
end with the primer ITS5. The sequence data were
submitted to GenBank under the accession number
of EU643642-EU643664 (Table 1).
Data analysis
The nucleotide sequences were automatically
aligned using BioEdit v.7.0 software (Hall, 1999).
Neighbour-Joining (NJ) and Maximum Parsimony
(MP) trees were built using the Molecular
Evolutionary Genetics Analysis (MEGA v.3.1)
program (Kumar et al., 2004). DNA sequences were
analysed based on Kimuras 2-parameter model
(K2P). All characters were unordered and equally
weighted, and gaps were treated as missing data. The
topology of the consensus tree was constructed and
evaluated with 1000 bootstrap replications
(Felsenstein, 1985) for both the MP and NJ (Saitou &
Nei, 1987) analysis. For the phylogenetic analyses of
the ITS regions, Lysimachia nemorum L. (GenBank:
AY855153) and Anagallis serpyllifolia Dumort.
(GenBank: AY855154) were selected as outgroups.
Results
The total lengths of the ITS (ITS1, 5.8S, and ITS2)
regions of the examined populations ranged from 695
to 714 bp. The shortest ITS length among the
examined taxa was identified in P. algida (Pop. No.
21), collected from A8 Rize, İkizdere, Ovit Mountain.
P. v er i s subsp. macrocalyx, collected from A9 Artvin,
was identified as the population with the longest ITS
length, at 714 bp (Table 1). Alignments of entire ITS
sequences resulted in 724 characters, except for the
outgroup. The entire ITS region contained 153
(21.1%) parsimony informative sites (Table 2), 252
(34.8%) variable sites, and 466 (64.3%) conserved
sites.
The NJ tree obtained from the analysis of the ITS
regions provided many useful data (Figure 1). All of
the investigated taxa settled explicitly into 3 clusters
corresponding to subgenera of Primula, namely subg.
Sphondylia (Clade-I), Aleuritia (Clade-II), and
Primula (Clade-III). Clade-I included only one taxon,
P. davisii, which is the single species of subg.
Sphondylia in Turkey. Clade-II, with a bootstrap value
of 63%, consisted of the populations of P. algida, P.
auriculata, and P. l o n g i p e s , which belong to subg.
Aleuritia. Among the representatives of subg.
Aleuritia, P. auriculata and P. algida were linked to
each other and formed a sister group with P. l on gi p es
(Figure 1). Clade-III contained the taxa P. v ul g ar is , P.
veris, P. megaseifolia, and P. e l a t i o r of subg. Primula,
with a bootstrap value of 98% (Figure 1), and this
clade also divided into 2 distinct subgroups. The first
subgroup was composed of P. veris and the second,
which was split again into 2 small clusters, was
composed of the rest of the members of subg.
Primula. While P. megaseifolia and P. el a t i o r were
linked to a low bootstrap value of 51%, the taxa of P.
vulgaris were linked to each other with bootstrap
values of 92% in the second subgroup.
Explanatory information related to the parsimony
informative sites inferred by MEGA software is given
in Table 2. The analysis of the entire ITS sequence of
P. ve ri s exhibited notable base alterations from the rest
Internal transcribed spacer (ITS) polymorphism in the wild Primula (Primulaceae) taxa of Turkey
150
M. GÜLTEPE, U. UZUNER, K. COŞKUNÇELEBİ, A. O. BELDÜZ, S. TERZİOĞLU
151
of the taxa of subg. Primula in the parsimonic
nucleotide sites at the positions of 143, 159, 300, 453,
567, 577, 620, 631, and 672. The examined subspecies
of P. v e r i s are distinguished from each other by
position 659 of their ITS sequences (see Table 2). In
addition, the 2 populations of P. megaseifolia included
different nucleotides at 91, 228, 456, 474, 512, 553,
and 600 when compared to the rest of the taxa of subg.
Primula, and they were also distinguished from each
other at the nucleotide positions of 60, 78, 94, and 108.
P. e l a t i o r , however, included fewer parsimony
informative sites and was separated from the rest of
the members of subg. Primula at the positions of 54,
457, 598, and 634. Furthermore, the distinct
population of P. e l a t i o r had only one different base
alteration, at the position of 624.
The members of subg. Aleuritia (Pop. No. 13-22)
displayed the highest parsimony informative sites
within all the taxa of the study. In this subgenus, the
population of P. au ri cu la t a displayed a number of base
alterations differing from the rest of the taxa of subg.
Aleuritia, at the positions of 54, 76, 82, 111, 230, 232,
304, 454, 456, 484, 497, 555, 567, 599, 601, 606, and
621 (see Table 2). The populations of P. a ur ic ul at a also
exhibited some differences at the positions of 259,
465, 478, 512, 552, 565, 572, 580, 600, 648, and 659.
The populations of P. algida demonstrated some
differences from other populations of subg. Aleuritia
at the positions of 82, 86, 94, 152, 190, 437, 454, 517,
540, 555, 563, 568, 575, 597, 620, 630, and 672. We
also observed some base variations at the positions of
37, 60, 61, 78, 102, 103, 105, 111, 219, 452, 475, and
563 among the populations of P. algida. P. l o n g i p e s ,
with the highest parsimony informative sites, differed
from the rest of the species of subg. Aleuritia at the
positions of 6, 61, 74, 75, 82, 89, 154, 166, 168, 184,
190, 217, 218, 219, 225, 231, 232, 234, 248, 259, 432,
442, 443, 445, 446, 447, 459, 481, 514, 537, 543, 556,
561, 562, 566, 567, 581, 583, 584, 603, 604, 618, 620,
624, 625, 630, 649, 650, 659, 674, 676, 677, 681, and
682. The 2 populations of P. l o n g i p e s also contained
Primula v ulg aris subsp. vulgaris (1)
Primula v ulg aris subsp. vulgaris (2)
Primula v ulg aris subsp. sibthorpii (3)
Primula v ulg aris subsp. v ulg ar is (5)
Primula vulgaris subsp. vulgaris (4)
Primula vulg aris subsp. sibthorpii (6)
Primu la meg aseifolia (7)
Primula megaseifolia (8)
Primula elatior subsp. mey erii (9)
Primula eletior subsp. mey e ri i (10)
Primula veris subsp. columnae (11)
Primula veris subsp. co lumnae (12)
Primu la veris subsp. macrocalyx (13)
CLA DE I II
Primula longipes (14)
Primu la lo ng ipe s (15)
Primula algida (21)
Primula algida (22)
Primula algida (20)
Primula auricu lata (19)
Primula auricu lata (17)
Primula auriculata (16)
Primula auriculata (18)
CLA DE II
CLAD E I
Primula davisii (23)
Lys ima ch ia n emo ru m
Anagallis serpyllifolia
OUTGROUP
99
99
91
99
72
67
99
59
63
86
99
96
89
98
51
62
70
79
92
0.1
Figure 1. The dendrogram showing the genetic relationships of the Turkish Primula. Primula species recovered from ITS sequences,
evaluated by the neighbour-joining method, with Lysimachia nemorum and Anagallis serpyllifolia as outgroups. Values above
the branch indicate bootstrap values supporting the respective cluster. Values higher than 50% are displayed.
Table 2. Parsimony informative sites’ aligned sequences of Primula taxa. For the pop. no. explanation, see Table 1.
1
TAAGCGCATGGACAACGACTGAAGATGGTAGGTCTGTTAAGAATGCCTATATTTAAGGCTCTTGTAACCTATGGCAG
2
.............................................................................
3
.............................................................................
4
...............................................................A.........A...
5
...............................................................A.........A...
6
...............................................................A.........A...
7
.....C....T.....A.T...T.C....................T.................T......G...A..
8
................A.......C....................T.................T......G...A..
9
....A...................C-.....................................T.......C.....
10
....A...................C-.....................................T.......C.....
11
..........................A...A..........................A.....T....G........
12
..........................A...A..........................A.....T....G........
13
..........................A...A..........................A.....T....G........
14
CG.A..ATA..TT.T..T.A.G..CG..CG.TATAAGATCA.GCA..ATGGG.ATG...A.CGCAC.....CT...A
15
CG.A..ATA..TT.T..T.A.G..CG..CG.TATAAGATCA.GCA..ATGGG.ATG...A.CGCAC.....CT...A
16
.G..A.T..A.TG.GG.T.A.GGACG...G....AA.A...G.C..A.G.GGG..GA.T-...T..G..AGCA....
17
.G..A.T..A.TG.GG.T.A.GGACG...G....AA.A...G.C..A.G.GGG..GA.T-...T..G..AGCA...A
18
.G..A.T..A.TG.GG.T.A.GGACG...G....AA.A...G.C..A.G.GGG.GGA.T-...T..G..AGCA....
19
.G..A.T..A.TG.GG.T.A.GGACG...G....AA.A...G.C..A.G.GGG..GA.T-...T..G..AGCAA...
20
.TCA.CG...TTATGG.TTGCCG.CG.A.G....AAC....G.CA.....GGG..GA..-T..T..G..G.CA.-..
21
.G.A..T....TATGG.TTC.GGTCG.A.G....AAC...TG.CA.....GGG..GA..-T..T..GG.G.CA.-C.
22
.G.A..T....TATGG.TTCAGG.CG.A.G....AAC...TG.CA.....GGG..GA..-T..T..GG-G.CA.-C.
23
.GC.TAT....TA.GG.T.CAGGACG...G....AA.A.....C....TCGGG..G...-.C.T..G....CA.-..
6
37
52
53
54
60
61
74
75
76
78
79
82
86
89
90
91
93
94
102
103
105
108
111
116
126
143
152
154
156
159
166
168
184
187
189
190
215
217
218
219
224
225
226
227
228
230
231
232
234
236
239
246
248
259
271
291
300
304
432
437
442
443
445
446
447
449
452
453
454
456
457
459
465
474
475
478
Pop. no.
Dashes (-) indicate alignment gaps within the sequence
152
Internal transcribed spacer (ITS) polymorphism in the wild Primula (Primulaceae) taxa of Turkey
different nucleotides at the positions of 623 and 631.
P. dav i si i , the single population of subg. Sphondylia in
Turkey, differed from subg. Primula and subg.
Aleuritia at the positions of 54, 60, 234, 566, 612, and
674.
The pair-wise distances obtained by Kimura’s 2-
parameter model for the examined populations varied
from 0.0% to 20.9% (see Table 3). The divergence
values within the subg. Primula based on ITS
sequence variations ranged from 0.0% to 5.4%; for
subg. Aleuritia, it was determined to range from 0.0%
to 19.7%. The pair-wise distance matrix of genetic
divergence values among all of the examined species
is given in Table 4 and includes various outputs
ranging from 0.0% to 18.9%. The base variations of
investigated species of subg. Primula ranged from
0.0% to 6.0% and varied from 0.0% to 16.1% for the
subg. Aleuritia. The values of the pair-wise distances
of subg. Sphondylia,represented byP. d av is ii , to subg.
Primula and subg. Aleuritia are 15.7% and 12.6%,
respectively.
Discussion
Internal transcribed spacer (ITS) sequences have
been widely used in plant molecular phylogenetics
and evolutionary studies (Zheng et al., 2008).
Alignment of the nrDNA ITS sequences for many
plant taxa has supplied useful data for solving
taxonomic problems, especially below the generic
levels (Baldwin et al., 1995; Gravendeel et al., 2001).
As an explicit result of the present study, all of the
examined taxa were found to be clustered within the
3 main clades of the phylogenetic tree obtained by NJ
analysis. The clades, which represent 3 different
subgenera, included the closely related taxa congruent
with the conventional taxonomic order of Turkey’s
Primula (Table 1). The present data confirmed the
tree topologies of Mast et al. (2001), in which subg.
Primula and subg. Aleuritia taxa are clustered in a
different clade. The molecular results of these 2
studies supported the view of Lamond (1978) at the
subgenera level.
1
CCAAGGGAGCTCCGATTAACCCCCCCGTGGAAGGACAACGCGAGATGAGAGCCAAGTGACGCATTCAGAAGGAATA
2
............................................................................
3
............................................................................
4
.....A......................................................................
5
...............................G............................................
6
.....A......................................................................
7
.....AA..........C........................G......................T...G......
8
.....AA..........C........................G................-.....T...G......
9
.....A..................................A.............C....T.....T...G......
10
.....A..................................A..................T.....T...G......
11
.....A...................T......A..................T......T......T...GA.....
12
.....A...................T......A..................T......T......T...GA.....
13
.....A...................T......A..................T......T......T.A.GA.....
14
ATGC...T.TC.TAGCA..ATG..TT--AAG.AATGCGT..A..GATCC.AG..GACCG.A-GAGG.A.G.TTGAG
15
ATGC...T.TC.TAGCA..ATG..TT--AAG.AATGCGT..A..GATCC.AG.GGACC..A-GAGG.A.G.TTGAG
16
.TTCT.A..TG...GCA.C..A.T.A-GAAG-A.CT.GT..T.A..ACCC..T...C...AAG..GGTTG......
17
.TTCT.A..TG...GCG.C..A.T.A-GAAG-A.CT.GT..T.A..ACCC..T...C...AAG..GGATG......
18
.TTCT.A..TG...GCA.C..A.T.A-GAAG-A.CT.GT..TGA..ACCC..T...C...AAG..GGTTG......
19
.TTCT....TG...GCA.C..A...A-GA.G-AACT.GT..T.A..ACCC..T...C...AAT..GGTTG......
20
.TGC....ATGTT..CG.T..AG...AGAAGGA.CT...A.A....TCCC.T.G..CA..AAG..GGTTGA.....
21
.TGC....ATGTT..CG.T..AG...AGAAGGA.CT...A.A....TCCC.T.G..CA..AAG..GGTTGA.....
22
.TGC....ATGTT..CG.T..AA...AGAAGGA.CT...A.A....TCCC.T.G..CA..AAG..GGTTGA.....
23
.T.CT....T..T.GCG.T..G..GAAGAAGGA.CT.G...-.....TCCA..G..C.....G..GGATGAC....
481
483
484
490
497
508
512
514
517
533
537
540
541
543
545
550
552
553
555
556
561
562
563
565
566
567
568
569
570
572
573
575
577
580
581
583
584
586
595
597
598
599
600
601
603
604
606
612
613
617
618
620
621
623
624
625
629
630
631
634
636
641
648
649
650
653
654
659
660
667
672
674
676
677
681
682
Pop. no.
Table 2. Continued.
Dashes (-) indicate alignment gaps within the sequence
153
M. GÜLTEPE, U. UZUNER, K. COŞKUNÇELEBİ, A. O. BELDÜZ, S. TERZİOĞLU
According to Lamond (1978), the species of P.
vulgaris, which does not have well- developed scape
structures, morphologically differs from P.
megaseifolia, P. e l at i o r ,and P. v e r i s . In the present
study, it was found that all examined populations of
P. v u l g a r i s formed a distinct cluster from the rest of
the taxa of subg. Primula, having well-developed
scape structures. As seen in Figures 1 and 2, the
examined populations of P. v u l g a r i s clustered into 2
lineages with high bootstrap values of 92% and 78%,
respectively. These genetic dissimilarities can also be
inferred from the pair-wise distance values given in
Table 3. The first 3 populations of P. v ul ga ri s (Pop. no.
1, 2, and 3), which have diverse corolla colours as the
single apparent morphological differentiation, were
collected from the same location (A7 Trabzon) and
clustered into one subgroup in relation to their
ecological closeness. The second 3 populations of
Primula (Pop. no. 4, 5, and 6; A4 Kastamonu) were
also accumulated together in the subgroup due to
similar conditions. Although both population
members of P. v ul g a ri s were collected from 2 distinct
regions, they exhibited high similarity (only 2 base
diversities; see Table 2) with respect to their ITS
sequence data. We also identified several parallel
alignments that demonstrate congruency with
geographical dispersion within the other examined
populations. Many studies have shown that there is a
clear affinity between populations and the
environments in which they exist (Aston & Bradshaw,
1966). The current and previously introduced data
showed that closer geographical distances yield more
homology in ITS genotypes (Wardill et al., 2005). On
the other hand, the genetic variations within the
subspecies could be affected by regional climates
(Noyes, 2006).
Both P. e l a t i o r and P. v e r i s have leaves that are
rugose, efarinose, and glabrous to densely villous
below, and so they carry relatively similar
morphological characteristics (Lamond, 1978). Yet, as
seen in Figure 1, P. e l a t i o r is closely linked to P.
Table 3. Pair-wise distance matrix of genetic divergence values of 23 populations, according to Kimura’s 2-parameter model. For the pop. no. explanation, see Table 1.
Pop. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23
no.
1 0.000
2 0.000
3 0.000 0.000
4 0.004 0.004 0.004
5 0.003 0.003 0.003 0.001
6 0.004 0.004 0.004 0.000 0.001
7 0.047 0.047 0.047 0.047 0.049 0.047
8 0.016 0.016 0.016 0.016 0.018 0.016 0.03
9 0.013 0.013 0.013 0.013 0.015 0.013 0.046 0.015
10 0.013 0.013 0.013 0.013 0.015 0.013 0.044 0.015 0.003
11 0.018 0.018 0.018 0.018 0.020 0.018 0.054 0.023 0.020 0.020
12 0.018 0.018 0.018 0.018 0.020 0.018 0.054 0.023 0.020 0.020 0.000
13 0.040 0.040 0.040 0.040 0.041 0.040 0.076 0.044 0.041 0.041 0.021 0.021
14 0.160 0.160 0.160 0.164 0.162 0.164 0.207 0.170 0.160 0.162 0.164 0.164 0.186
15 0.162 0.162 0.162 0.166 0.164 0.166 0.209 0.172 0.162 0.164 0.168 0.168 0.190 0.009
16 0.112 0.112 0.112 0.116 0.114 0.116 0.145 0.112 0.109 0.109 0.119 0.119 0.143 0.138 0.140
17 0.116 0.116 0.116 0.119 0.117 0.119 0.149 0.116 0.112 0.112 0.123 0.123 0.144 0.138 0.140 0.006
18 0.119 0.119 0.119 0.123 0.121 0.123 0.149 0.116 0.116 0.116 0.126 0.126 0.150 0.143 0.145 0.006 0.012
19 0.126 0.126 0.126 0.126 0.124 0.126 0.163 0.130 0.122 0.122 0.133 0.133 0.157 0.154 0.156 0.023 0.029 0.029
20 0.163 0.163 0.163 0.167 0.165 0.167 0.190 0.171 0.163 0.163 0.165 0.165 0.190 0.197 0.195 0.117 0.120 0.124 0.136
21 0.117 0.117 0.117 0.121 0.119 0.121 0.155 0.125 0.117 0.117 0.119 0.119 0.143 0.143 0.141 0.067 0.070 0.074 0.085 0.059
22 0.119 0.119 0.119 0.123 0.121 0.123 0.157 0.127 0.119 0.119 0.121 0.121 0.145 0.145 0.143 0.070 0.073 0.077 0.088 0.060 0.006
23 0.150 0.150 0.150 0.154 0.152 0.154 0.191 0.158 0.148 0.148 0.154 0.154 0.177 0.173 0.171 0.099 0.097 0.106 0.118 0.154 0.109 0.109 0.000
Internal transcribed spacer (ITS) polymorphism in the wild Primula (Primulaceae) taxa of Turkey
154
M. GÜLTEPE, U. UZUNER, K. COŞKUNÇELEBİ, A. O. BELDÜZ, S. TERZİOĞLU
155
magaseifolia rather than P. v e r i s , by virtue of sharing
the same character (C) at site 116 (Table 2). This
evidence indicates that molecular data may
sometimes present findings that are in contrast to
morphological data and could not always resolve the
relationships in Primula (Martins et al., 2003).
Although several hybrids naturally occur between
P. v u l ga ri s and P. v e r i s (Kalman et al., 2004), P. v e r i s is
a distinct species among the subg. Primula based on
the NJ analysis (Figure 1). In addition, P. v u l g a r i s
(Hayırlıoğlu-Ayaz & İnceer, 2003) and P. v er is (Abou-
El-Enain, 2005) have the same (2n = 22) chromosome
Table 4. Pair-wise distance matrix of genetic divergence values of 8 taxa, according to Kimura’s 2-parameter model.
Subg. Species P. vulgaris P. megaseifolia P. elatior P. veris P. longipes P. auriculata P. algida P. davisii
P. vulgaris
Primula P. megaseifolia 0.032
P. elatior 0.014 0.030
P. v er i s 0.040 0.060 0.041
P. l on gi pe s 0.162 0.189 0.162 0.188
Aleuritia P. auriculata 0.119 0.135 0.115 0.148 0.144
P. algida 0.135 0.154 0.133 0.159 0.161 0.092
Sphondylia P. davisii 0.152 0.174 0.148 0.177 0.172 0.105 0.124
Primula vulgaris s ubsp. vulgaris (1)
Primula vulgaris s ubsp. vulgaris (2)
Primula vulgaris s ubsp. sibthorpii (3)
Primula vulgaris s ubsp. vulgaris (5)
Primula vulgaris subsp. vulgaris (4)
Primula vulgaris subsp. sibthorpii (6)
Primula megaseifolia (7)
Primula megaseifolia (8)
Primula elatior subsp. mey e rii (9)
Primula eletior subsp. meye rii (10)
Primula veris subsp. columnae (12)
Primula veris subsp.columnae (11)
Primula veris subsp. macroc alyx (13)
Primula longipes (14)
Primula longipes (15)
Primula auriculata (19)
Primula auriculata (17)
Primula auriculata (16)
Primula auriculata (18)
Primula algida (20)
Primula algida (21)
Primula algida (22)
Primula davisii (23)
Lys ima ch ia n emo ru m
Anagallis serpyllifolia
97
100
60
100
100
99
92
63
53
56
78
100
100
100
50
Figure 2. One of 16 parsimony trees for the Primula nuclear ITS region. Bootstrap values were obtained by 1000 replicates; numbers
above the branches are bootstrap values > 50, tree length 669, consistency index = 0.8714, retention index = 0.9198, rescaled
consistency index = 0.8016.
number. This is probably due to the few base
variations that emerged as a result of geographical and
ecological effects.
P. e l a t i o r and P. megaseifolia are linked to each other
with a low bootstrap value (51%) (Figure 1) and they
revealed a few more base dissimilarities than the rest
of the subg. Primula taxa (Table 2). The different
corolla colours and chromosome numbers of these
species also support their differences. Furthermore, the
earlier recorded different chromosome numbers for P.
megaseifolia (2n = 18) and P. v u l g a r i s (2n = 22)
(Hayırlıoğlu-Ayaz & İnceer, 2003) can be presented as
additional evidence for genetic dissimilarity. Although
P. megaseifolia morphologically resembles P. v u l g a r i s
(Lamond, 1978), the results based on phylogenetic
analyses showed a distinctive relationship between P.
elatior and P. megaseifolia (Table 4 and Figure 1),
despite the differences in their chromosome numbers
(2n = 16 and 2n = 18, respectively) (Hayırlıoğlu-Ayaz
& İnceer, 2003). The current data also indicate that P.
veris and P. megaseifolia are the most distant species in
the subg. Primula because of the high base variation
(Table 2), which may be caused by ecological effects
(Scheiber et al., 2000).
The subg. Aleuritia is represented by 3 species in
the present study. Among these species, P. l o n g i p e s is
the most distinct, based on inflorescence shape and
length of scape (Lamond, 1978). The results of the
sequence analyses of the entire ITS region also
confirmed this taxonomical differentiation (Figure 1).
According to the genetic divergence values of the pair-
wise distance matrix (Table 4), P. a u r i c u l a t a and P.
algida are the most closely related species, while P.
algida and P. l on gi pe s are the most discrete taxa of the
subg. Aleuritia. P. l o ng i p e s was obviously separated
from the other taxa of subg. Aleuritia since it
contained many different base substitutions (Table 2)
compared to P. auriculata and P. algida, which are the
closer taxa in Clade-II (Figure 1). Several earlier
studies related to ITS regions have shown that this
region supplies sufficient genetic information to
explore the relationships at both specific and generic
levels (Bain & Jansen, 1995).
Leaf vernation is a useful taxonomic character for
Primulaceae (Wendelbo, 1961); however, both
revolute and involute leaf vernation can occur in the
genus Primula (Richards, 1993). According to
Wendelbo (1961), the involute vernation is a primitive
morphological trait which is one of the distinguishing
characters of the subg. Sphondylia. The current
findings based on the NJ tree and other related data
also support the positioning of P. d a v i s i i as a primitive
taxon consisting of traits that are present in the
common ancestor (Figure 1).
It is well known that molecular sampling might
provide an independent phylogenetic hypothesis
(Mast et al., 2001) for traditional taxonomic studies.
Thus, our current study can be illustrated as
preliminary molecular and phylogenetic research
carried out on the wild Primula taxa of Anatolia. All
the results showed that the ITS region supplies useful
molecular information for exploring the relationships
among the Turkish Primula taxa. However, to
reconstruct an accurate phylogenetic relationship, the
taxa should be examined with different molecular
markers and intensive sampling.
Acknowledgements
The authors would like to express their thanks to
Dr. Sabriye Dülger and Dr. Yusuf Bektaş for kindly
helping with the laboratory studies, Mehmet Fırat for
providing the sample of P. davisii, and TÜBİTAK
(TBAG-HD/356-107T918) and the Research
Foundation of Karadeniz Technical University (KTU-
BAP-2007.111.004.07) for the financial support.
Abou-El-Enain MM (2005). Chromosomal variability in the genus
Primula (Primulaceae). Bot J Linn Soc 150: 211–219.
Anderberg AA & Stahl B (1995). Phylogenetic interrelationships in
the Primulales, with special emphasis on the family
circumscriptions. Can J Botany 73: 1699–1730.
Aston DL & Bradshaw AD (1966). Evolution in closely adjacent
populations. Part II. Agrostis stolonifera in maritime habitats.
Heredity 37: 9–25.
Bain JF & Jansen RK (1995). A phylogenetic analysis of the aureoid
Senecio (Asteraceae) complex based on ITS sequence data. Plant
Syst Evol 195: 209–219.
References
156
Internal transcribed spacer (ITS) polymorphism in the wild Primula (Primulaceae) taxa of Turkey
M. GÜLTEPE, U. UZUNER, K. COŞKUNÇELEBİ, A. O. BELDÜZ, S. TERZİOĞLU
157
Baldwin BG, Sanderson MJ, Porter JM, Wojciechowski MF, Campbell
CS & Donoghue MJ (1995). The ITS region of nuclear
ribosomal DNA: a valuable source of evidence on angiosperm
phylogeny. Ann Mo Bot Gard 82: 247–277.
Barrett SCH, Jesson LK & Baker AM (2000). The evolution and
function of Stylar polymorphisms in flowering plants. Ann Bot-
London 85: 253–265.
Beyazoğlu O (1989). Kuzey Doğu Anadolu Bölgesi’nde yayılış
gösteren bazı Primulaceae taksonları üzerinde anatomik
çalışmalar. Turk J Bot 3: 3–16.
Conti E, Suring E, Boyd D, Jorgensen J, Grant J & Kelso S (2000).
Phylogenetic relationships and character evolution in Primula
L.: the usefulness of ITS data. Plant Biosyst 134: 385–392.
Doyle JJ & Dolye JL (1987). A rapid DNA isolation procedure for
small quantities of fresh leaf tissue. Phytochem Bull 19: 11–15.
Ekim T, Koyuncu M, Vural M, Duman H, Aytaç Z & Adıgüzel N
(2000). Red data book of Turkish plants. Ankara: Barışcan Ofset.
Felsenstein J (1985). Confidence limits on phylogenies: an approach
using the bootstrap. Evolution 39: 783–791.
Gravendeel B, Chase MW & de Vogel EF (2001). Molecular phylogeny
of Coelogyne (Epidendroideae; Orchidaceae) based on plastid
RFLPs, matK, and nuclear ribosomal ITS sequences: Evidence
for polyphyly. Am J Bot 88: 1915–1927.
Hall, TA (1999). BioEdit: a user-friendly biological sequence
alignment editor and analysis program for windows 95/98/NT.
Nucleic Acids Symp Ser 41: 95–98.
Hayırlıoğlu-Ayaz S & İnceer H (2003). Chromosome counts of some
Primula L. species (Primulaceae). Biol Brat 58: 45–48.
Hu CM & Kelso S (1996). Primulaceae. In: Wu CY & Raven PH (eds.)
Flora of China, Myrsinaceae Through Loganiaceae, 15, pp. 118–
119. Beijing: Science Press.
Kalman K, Medvegy A & Erzsebet M (2004). Pattern of the floral
variation in the hybrid zone of two Distylous Primula species.
Flora 199: 218–227.
Kovtonyuk NK & Goncharov AA (2009). Phylogenetic relationships
in the genus Primula L. (Primulaceae) inferred from the ITS
region sequences of nuclear rDNA. Russ J Genet 45: 663–670.
Kumar S, Tamura K & Nei M (2004). MEGA3: Integrated software
for molecular evolutionary genetics analysis and sequence
alignment. Brief Bioinform 5: 150–163.
Lamond J (1978). Primula L. (Primulaceae). In: Davis PH (ed.) Flora
of Turkey and the East Aegean Islands, Vol. 6, pp. 112–120.
Edinburgh: Edinburgh University Press.
Martins L, Oberprieler C & Hellwig FH (2003). A phylogenetic
analysis of Primulaceae s.l. based on internal transcribed spacer
(ITS) DNA sequence data. Plant Syst Evol 237: 75–85.
Mast AU, Kelso S, Richards AJ, Lang DJ, Feller DMS & Conti E (2001).
Phylogenetic relationships in Primula and related genera
(Primulaceae) based on noncoding chloroplast DNA. Int J Plant
Sci 162: 1381–1400.
Mizuhiro M, Ito K & Mii M (2001). Production and characterization
of interspesific somatic hybrids between Primula malacoides
and Primula obconica. Plant Sci 161: 489–496.
Noyes RD (2006). Intraspecific nuclear ribosomal DNA divergence
and reticulation in sexual diploid Erigeron strigosus
(Asteraceae). Am J Bot 93: 470–479.
Ogundipe OT, Chase M (2008). Phylogenetic analyses of
Amaranthaceae based on matK DNA sequence data with
emphasis on West African species. Turk J Bot 33: 153–161.
Pınar NM, Doğan D, Akgül G & Geven F (2005). The pollen
morphology of the wild Primula L. (Primulaceae) species in
Turkey. XVII International Botanical Congress Vienna, Austria,
327.
Richards J (1993). Primula L. First ed., Timber Press, Portland,
Oregon, USA.
Richards J (2003). Primula L. Second ed., Timber Press, Portland,
Oregon, USA.
Saitou N & Nei M (1987). The neighbor-joining method: a new
method for reconstructing phylogenetic trees. Mol Biol Evol 4:
406–425.
Scheiber SM, Jarret RL, Robacker CD & Newman M (2000). Genetic
relationships within Rhododendron L. section Pentanthera G.
Don based on sequences of the internal transcribed spacer (ITS)
region. Sci Hortic-Amsterdam 85: 123–135.
Trift I, Liden M & Anderberg AA (2004). Phylogeny and
biogeography of Dionysia (Primulaceae). Int J Plant Sci 165:
845–860.
Valentine DH & Kress A (1972). Primula L. (Primulaceae). In: Tutin
TG, Heywood VH, Burges NA, Moore DM, Valentine DH,
Walters SM & Webb DA (eds.) Flora Europaea, 3, pp. 15–20.
Cambridge: Cambridge University Press.
Wardill TJ, Graham GC, Zalucki M, Palmer WA, Playford J & Scott
KD (2005). The importance of species identity in the biocontrol
process: identifying the subspecies of Acacia nilotica
(Leguminosae: Mimosoidae) by genetic distance and the
implications for biological control. J Biogeogr 32: 2145–2159.
Wendelbo P (1961). Studies in the Primulceae II: An account of
Primula subg. Sphondylia (syn. Sect. Floribundae) with a review
of subdivisions of the genus. Arbok Universitet, Bergen.
Matematisk- Naturvitenskapelig 11: 1–46.
White TJ, Bruns T, Lee S & Taylor J (1990). Amplification and direct
sequencing of fungal ribosomal RNA genes for phylogenetics.
In: Innis M, Gelfand D, Sninsky J, White TJ (eds.) PCR
protocols: a guide to methods and application, pp. 315–322.
Academic Press, San Diego.
Zhang L & Kadereit JW (2004). Classification of Primula Sect.
Auricula (Primulaceae) based on two molecular data sets (ITS,
AFLPs), morphology and geographical distribution. Bot J Linn
Soc 146: 1–26.
Zheng X, Cai D, Yao L & Teng Y (2008). Non-concerted ITS evolution,
early origin and phylogenetic utility of ITS pseudogenes in
Pyrus. Mol Phylogenet Evol 48: 892–903.
... The Chinese Plant Barcode of Life group (2011) [15] considered ITS, which is a nuclear genome marker, as an additional marker for differentiation of closely related species. There are number of studies that showed high level of inter-and interspecific relationships using ITS region [16,17,18]. ...
Article
The Aconitum L. is a diverse genus consisting of more than 300 species all over the World, including 11 species grown in Kazakhstan. The phylogeny of the genus was mostly studied by using internal transcribed sequences (ITS) of the nuclear genome and maturase K (matK) of the chloroplast genome. Therefore, in this study it was decided to assess the phylogenetic position of three local species A. leucostomum, A. soongoricum and A. apetalum, by using ITS and matK. The application of Maximum-Likelihood (ML) method suggested that the A. soongoricum belong to subgenus Aconitum, and A. leucostomum and A. apetalum to the subgenus Lycoctonum, which was congruent to previous taxanomic studies for this genus. The Median-Joining network using ITS suggested that A. sachalinense belongs to the group of processors of the genus among species that were involved in the analysis. The study is the first attempt to understand phylogenetic relationship of three species of Aconitum grown in Kazakhstan.
... Primers internal transcribed spacer ITS4 and ITS5 (White et al., 1990) were used to amplify the nrDNA ITS region. The polymerase chain reaction (PCR) protocol for the amplification of the region followed that of Gültepe et al. (2010). The PCR products were sequenced by Macrogen Inc. (Seoul, Korea) using the ITS4 and ITS5 primers. ...
... Genomic DNAs were extracted from silica-dried leaves following the modified extraction procedure of Doyle and Doyle (1987). Amplification and sequence of nrDNA ITS regions were carried out according to Gültepe et al. (2010). Phylogenetic analyses were performed on the ITS data set consisting of 87 accessions (Table 1), of which 15 were newly generated sequences, 72 sequences were obtained from GenBank and 10 were used as an outgroup provided from Gültepe et al. (2016). ...
... Total genomic DNA was extracted from silica dried leaves following the modified CTAB extraction procedure of Doyle & Doyle (1987). The nrITS region and trnT-trnL spacer were amplified using the universal 'ITS4 and ITS5' primers (White et al. 1990) and the universal 'a and b' primers (Taberlet et al. 1991), respectively, according to the PCR conditions described by Gültepe et al. (2010). The PCR products were sequenced with the aid of Macrogen Inc. (Seoul, Korea) using the same primers. ...
Article
Full-text available
We report chromosome counts for ten taxa of Vincetoxicum sensu stricto (s. str.) (Apocynaceae) from Turkey (of which two are endemic), including the first chromosome counts for V. canescens subsp. pedunculata, V. funebre, V. fuscatum subsp. boissieri, V. parviflorum and V. tmoleum. Two taxa of V. fuscatum proved to be tetraploid (2n=44) and the remaining eight taxa diploid (2n=22). Molecular phylogenetic analyses based on nrDNA (ITS) and cpDNA (trnT-trnL) (including 31 newly generated sequences) confirm the position of the Turkish Vincetoxicum in the Vincetoxicum s. str. clade. Vincetoxicum fuscatum, V. parviflorum, V. speciosum, as well as the Turkish endemic V. fuscatum subsp. boissieri, were clearly resolved as species-level clades, whereas the delimitation of the rest of the Turkish taxa was less clear based on molecular data.
... DNA extraction, PCR amplification, sequencing, and phylogenetic analyses Total genomic DNA was extracted from herbarium material following the modified CTAB extraction procedure of Doyle & Doyle (1987). The nrITS region and trnL-F were amplified with universal ITSA/ITSB (Blattner 1999) and with the universal primers trnC/trnF (Taberlet et al. 1991), respectively, according to the PCR conditions of Gültepe et al. (2010). PCR products were sequenced with the aid of Macrogen Inc. (Seoul, Korea) by use of the same primers. ...
Article
Nonea (Boraginaceae) with nearly 35 species was divided into four sections based on the shape of mericarpids and the position of the anthers in the corolla tube. Although several comprehensive taxonomic studies have been performed on Turkish and European Nonea taxa, Caucasian ones have not been studied well. Therefore Caucasian Nonea need close attention with regard to molecular systematics. In this study, 15 Caucasian Nonea including N. cyanocalyx and N. bakuensis were evaluated with nrDNA ITS and cpDNA trnL-F sequence data using Maximum Parsimony and Bayesian Inference to reconstruct phylogeny. All examined members of Nonea were grouped at three main clades with weak to good support values based on nrITS and at two main clades with moderate to good support values based on trnL-F. Both trees did not coincide with the traditional sub-generic delimitation of Nonea, but nrITS tree supported monophyly of Nonea. On the other hand, Pulmonaria is deeply nested in Nonea in the trnL-F tree. Moreover, present findings support treating N. cyanocalyx and N. bakuensis as distinct species rather than subspecies and revealed a preliminary phylogenetic structure of little known Caucasian Nonea.
... ITS markers are based on internal transcribed spacer regions and part of the chromosomal regions that are located next to the regions of ribosomal genes, can be used as universal primers to evaluate the intra-and inter-species phylogenetic relationships. The ITS regions are among the regions conserved during evolution (Brasileiro et al. 2004;Gultepe et al. 2010). ITS regions are used to investigate new strains of pathogens, as well as kin relationships among organisms (Adams et al. 1998;Brasileiro et al. 2004;Joseph et al. 1999). ...
Article
Full-text available
Lilium is a perennial bulbous plant belonging to the liriotypes genus. Our aim was to study the phylogenetic relationships of the Lilium family. Two varieties of Lilium ledebourii, 44 varieties of the gene bank, and one variety from the Tulipa family served as the out group. In order to study the diversity between lilium masses, ITS regions were used to design the marker. The results showed that the guanine base is the most abundant nucleotide. Relatively high conservation was observed in the ITS regions of the populations (0.653). Phylogenetic analysis showed that sargentiae and hybrid varieties are older than other varieties of the Lilium family. Also, the location of L. ledebourii varieties (Damash and Namin) was identified in a phylogenetic tree by using the ITS marker. Overall, our research showed that ITS molecular markers are very suitable for phylogenetic studies in the Lilium family.
... ITS markers are based on internal transcribed spacer regions and part of the chromosomal regions that are located next to the regions of ribosomal genes, can be used as universal primers to evaluate the intra-and inter-species phylogenetic relationships. The ITS regions are among the regions conserved during evolution (Brasileiro et al. 2004;Gultepe et al. 2010). ITS regions are used to investigate new strains of pathogens, as well as kin relationships among organisms (Adams et al. 1998;Brasileiro et al. 2004;Joseph et al. 1999). ...
Article
Full-text available
Lilium is a perennial bulbous plant belonging to the liriotypes genus. Our aim was to study the phylogenetic relationships of the Lilium family. Two varieties of Lilium ledebourii, 44 varieties of the gene bank, and one variety from the Tulipa family served as the out group. In order to study the diversity between lilium masses, ITS regions were used to design the marker. The results showed that the guanine base is the most abundant nucleotide. Relatively high conservation was observed in the ITS regions of the populations (0.653). Phylogenetic analysis showed that sargentiae and hybrid varieties are older than other varieties of the Lilium family. Also, the location of L. ledebourii varieties (Damash and Namin) was identified in a phylogenetic tree by using the ITS marker. Overall, our research showed that ITS molecular markers are very suitable for phylogenetic studies in the Lilium family.
... The major focus of this study was the evaluation of morphological characters and assessment of taxonomic position of O. almaatensis based on the use of the nuclear ribosomal DNA internal transcribed spacer region (ITS) [23]. ITS is a highly polymorphic DNA marker and widely recognized as a valuable tool in plant evolutionary studies [24][25][26]. The research is part of the new nation-wide research project [27] that combine efforts of local botanists and geneticists from Biotechnology Research Organizations, Botanical Gardens, National Nature Parks and Reserves. ...
Article
Full-text available
Background Oxytropis almaatensis Bajt. is a rare, narrow endemic species of the Trans-Ili Alatau mountains in Kazakhstan. Up to now, no studies regarding the taxonomy and variation of key morphological traits of O. almaatensis were undertaken. The purpose of this analysis was to evaluate phenotypic variation of O. almaatensis and assess the position of the species within the genus based on nucleotide sequences of the nuclear ribosomal DNA internal transcribed spacer (ITS) region. Results Two populations of O. almaatensis were collected in neighboring gorges of the Trans-Ili Alatau Mountains. The ITS sequences from the samples of two populations of O. almaatensis were identical. The phylogenetic analysis indicated that O. almaatensis is within Oxytropis genetically close to O. glabra as these species formed a separate subclade. The phenotypic variation of populations was assessed using nine morphological traits and compared to descriptions of O. glabra. The range of variation for the traits between two populations was established. A clear morphological difference of O. almaatensis and O. glabra was found in peduncle length to leaf length ratio. This was in O. almaatensis 1.56, while in O. glabra, it was 1.0. Conclusions The study provides the first phenotypic description and phylogenetic placement of the rare endemic species O. almaatensis. The morphological traits in two O. almaatensis populations showed a high level of phenotypic variability. Although clearly different from O. glabra, the ITS phylogeny grouped these species in a subclade within the genus. Electronic supplementary material The online version of this article (10.1186/s12870-017-1128-x) contains supplementary material, which is available to authorized users.
... Total genomic DNAs were extracted from fresh healthy leaves or herbarium material according to Doyle & Doyle (1987). ITS (Internal transcribed Spacer) regions were amplified with universal ITS4 and ITS5 primers (White et al. 1990) according to Gültepe et al. (2010). Sequencing of the PCR products were carried out with the aid of Macrogen Inc. (Seoul, Korea) by using primers ITS4 and ITS5. ...
Article
Full-text available
On the basis of both morphological and molecular data, three new species belonging to the genus Paronychia were described from Turkey: P. aksoyii (from Tortum, Erzurum) which is related to P. saxatilis, P. kocii (from Kelkit, Erzincan) which is related to P. turcica, and P. davrazensis (from Isparta) which is related to P. pontica. Morpholgy, notes on ecology, conservation status and distribution maps are provided for each new species, as well as a morphological comparison with the related taxa is given.
Article
Full-text available
With its theoretical basis firmly established in molecular evolutionary and population genetics, the comparative DNA and protein sequence analysis plays a central role in reconstructing the evolutionary histories of species and multigene families, estimating rates of molecular evolution, and inferring the nature and extent of selective forces shaping the evolution of genes and genomes. The scope of these investigations has now expanded greatly owing to the development of high-throughput sequencing techniques and novel statistical and computational methods. These methods require easy-to-use computer programs. One such effort has been to produce Molecular Evolutionary Genetics Analysis (MEGA) software, with its focus on facilitating the exploration and analysis of the DNA and protein sequence variation from an evolutionary perspective. Currently in its third major release, MEGA3 contains facilities for automatic and manual sequence alignment, web-based mining of databases, inference of the phylogenetic trees, estimation of evolutionary distances and testing evolutionary hypotheses. This paper provides an overview of the statistical methods, computational tools, and visual exploration modules for data input and the results obtainable in MEGA.
Article
Full-text available
The internal transcribed spacer (ITS) region of 18S-26S nuclear ribosomal DNA (nrDNA) has proven to be a useful source of characters for phylogenetic studies in many angiosperm families. The two spacers of this region, ITS-1 and ITS-2 (each <300 bp), can be readily amplified by PCR and sequenced using universal primers, even from DNAs of herbarium specimens. Despite high copy numbers of both spacers, the near uniformity of ITS paralogues, attributed to rapid concerted evolution, allows direct sequencing of pooled PCR products in many species. Divergent paralogues, where detected, require cloning, but may offer a means of obtaining multiple estimates of organismal relationships and of determining placement of the root in a phylogeny independent of outgroup considerations. In reported studies, variation between ITS sequences is mostly attributable to point mutations. A relatively minor proportion of sites is affected by insertions or deletions (indels) among sequences that are similar enough to have retained sufficient signal for phylogenetic analysis. Within these limits, sequence alignment is generally unambiguous except in small regions of apparently lower structural constraint. Phylogenetic analyses of combined data sets from both spacers, where examined, yield trees with greater resolution and internal support than analyses based on either spacer alone. This beneficial effect of simultaneous analysis is not surprising based on the low number of useful characters in each spacer. This effect also suggests high complementarity of spacer data, in accord with similarity in size, sequence variability, and G + C content of ITS-1 and ITS-2 in most investigated groups of closely related angiosperms. Nonindependent evolution of ITS sites involved in intraspacer RNA base-pairing may occur, given possible functional constraints, but preliminary secondary structure analyses of ITS-2 in Calycadenia (Asteraceae) show no definite evidence of compensatory spacer mutations. As expected, levels of ITS sequence variation suitable for phylogenetic analysis are found at various taxonomic levels within families, depending on the lineage. The apparent rates of ITS molecular evolution are roughly correlated with plant life-form, as with chloroplast DNA (cpDNA) data, but reasons for this observation are unclear. ITS characters have improved our understanding of angiosperm phylogeny in several groups by (1) corroborating earlier unexpected findings, (2) resolving conflicts between other data sets, (3) improving resolution of species relationships, or (4) providing direct evidence of reticulate evolution. Hybridization or sorting of ancestral polymorphism in a lineage can complicate interpretation of trees based on any type of evolutionary evidence, including ITS or cpDNA sequences, particularly in the absence of at least one independent phylogenetic data set from the same organisms. The need for phylogenetic markers from the nuclear genome, to complement the rapidly growing body of cpDNA data, makes the ITS region a particularly valuable resource for plant systematists.
Article
Full-text available
The main goals of this research were to reconstruct the infrageneric phylogeny of the genus Primula based on both nuclear and chloroplast DNA sequences, and to use the resulting phylogenies to elucidate the evolution of breeding systems, morphological characters, chromosome number, and biogeographic distribution in the genus. In this paper, the results of a pilot study based on the nuclear ribosomal Internal Transcribed Spacer (ITS) region are described. ITS sequences from 21 taxa produced a number of variable characters sufficient to resolve relationships among sections. The resulting phylogeny confirmed the monophyly of sections Auricula and Aleuritia. Sections Armerina, Proliferae, Crystallophlomis, Parryi, and Auricula, with a base chromosome number of x = 11, and sect. Aleuritia, with a base chromosome number of x = 9, formed two well supported clades. The ITS topology also suggested that leaves with revolute vernation, previously believed to be a derived state, might represent the ancestral condition in Primula, with later reversals to the involute condition. Finally, this initial ITS tree provides preliminary support to the proposed role of the widespread, diploid and heterostylous P. mistassinica as having given origin to the polyploid, homostylous P. incana and P. laurentiana.
Article
The recently-developed statistical method known as the "bootstrap" can be used to place confidence intervals on phylogenies. It involves resampling points from one's own data, with replacement, to create a series of bootstrap samples of the same size as the original data. Each of these is analyzed, and the variation among the resulting estimates taken to indicate the size of the error involved in making estimates from the original data. In the case of phylogenies, it is argued that the proper method of resampling is to keep all of the original species while sampling characters with replacement, under the assumption that the characters have been independently drawn by the systematist and have evolved independently. Majority-rule consensus trees can be used to construct a phylogeny showing all of the inferred monophyletic groups that occurred in a majority of the bootstrap samples. If a group shows up 95% of the time or more, the evidence for it is taken to be statistically significant. Existing computer programs can be used to analyze different bootstrap samples by using weights on the characters, the weight of a character being how many times it was drawn in bootstrap sampling. When all characters are perfectly compatible, as envisioned by Hennig, bootstrap sampling becomes unnecessary; the bootstrap method would show significant evidence for a group if it is defined by three or more characters.
Article
The present paper deals with chromosome number of five Primula taxa. The studies were carried out plants from the northeast Anatolia (Turkey). The following chromosome numbers have been detected: Primula vulgaris HUDS. subsp. vulgaris 2n = 22, P. vulgaris subsp. sibthorpii (HOFFMANNS) W. W. SM. & FORREST 2n = 22, P. elatior subsp. meyeri (RUPR.) VALENTINE & LAMOND 2n = 16, P. megaseifolia BOISS 2n = 18 and P. longipes FREYN & SINT. 2n = 16. The chromosome numbers of four of these five taxa are presented for the first time. The present determination and previous reports of chromosome numbers of the genus exhibited great variation in the basic number.
Article
A new method called the neighbor-joining method is proposed for reconstructing phylogenetic trees from evolutionary distance data. The principle of this method is to find pairs of operational taxonomic units (OTUs [= neighbors]) that minimize the total branch length at each stage of clustering of OTUs starting with a starlike tree. The branch lengths as well as the topology of a parsimonious tree can quickly be obtained by using this method. Using computer simulation, we studied the efficiency of this method in obtaining the correct unrooted tree in comparison with that of five other tree-making methods: the unweighted pair group method of analysis, Farris's method, Sattath and Tversky's method, Li's method, and Tateno et al.'s modified Farris method. The new, neighbor-joining method and Sattath and Tversky's method are shown to be generally better than the other methods.
Article
Comparative sequencing of the chloroplast matK coding and non-coding regions was used to examine relationship among the species of Amaranthaceae with emphasis on the West African species and other closely related family such as Chenopodiaceae. Portulacaceae, and Caryophyllaceae. Phylogenetic analysis of the matK sequences alone and in combination using maximum parsimony methods produced monophyletic lineage of Amaranthaceae-Chenopodiaceae. Our results indicated that a polyphyletic Celosieae as sister to an Amaranthus-Chemissoa lineage. Subfamily Annaranthoideae is paraphyletic to the core Gomphrenoids. This study also shows that the polyphyly of Amarantheae is apparent and so is the polyphyly of Amaranthinae.
Article
Pattern of the floral variation was investigated in the hybrid zone of two distylous Primula species. The three taxa of the P. vulgaris × P. veris hybrid zone were identified on the basis of flower color and inflorescence structure. Hybrids were significantly different from the two parental species for all the floral characters examined: four out of the seven characters exhibited extreme values, and three characters were intermediate. The lack of great morphological variation and histograms of the characters exhibiting intermediate values in hybrids give the impression that there is no introgression in the studied hybrid zone. Stigma heights and, to a lesser degree, anther heights were in two discrete classes corresponding to short-styled and long-styled flowers in all the three taxa. Relative reciprocity ratios and examination of individual flowers revealed that there was strict reciprocity between anther and stigma heights in the two parental species, but reciprocity was strongly broken in the hybrids. Both stigma and anther heights showed considerable relationship with corolla tube length, and increasing corolla tube length resulted in deviation from the strict reciprocity in both floral morphs. Short-tubed long-styled and long-tubed short-styled flowers seem to be at a disadvantage in mating, and this might explain the extremely low variability of corolla tube length. Our results on the floral morphology indicate that there are no barriers against formation of the F1 hybrids in the adjacent populations of the two parental species. A possible explanation for the lack of introgression is also discussed.
Article
Cladistic parsimony analyses, based on morphological data, have been undertaken with the purpose of identifying major monophyletic groups and phylogenetic interrelationships within the Primulales. Actinidia (Actinidiaceae, Ericales) and three genera from two families of the Ebenales (Diospyros of the Ebenaceae and Manilkara and Monotheca of the Sapotaceae) were used as outgroups in the analyses. The results indicate that the Primulaceae, Theophrastaceae, and Myrsinaceae (excluding Maesa) represent three major monophyletic groups. The Myrsinaceae were found to be paraphyletic, with the majority of taxa forming a monophyletic group but with the genus Maesa constituting the sister group of the Primulaceae. It is proposed that Maesa should be raised to the rank of family to obtain strictly monophyletic groups in the Primulales. The genera Aegiceras and Coris, for which family affinities have been controversial, are well nested within the families Myrsinaceae and Primulaceae, respectively. Key words: Primulale...