Article

Marking and Quantifying IL-17A-Producing Cells In Vivo

Howard Hughes Medical Institute, University of California San Francisco, San Francisco, California, United States of America.
PLoS ONE (Impact Factor: 3.23). 06/2012; 7(6):e39750. DOI: 10.1371/journal.pone.0039750
Source: PubMed

ABSTRACT

Interleukin (IL)-17A plays an important role in host defense against a variety of pathogens and may also contribute to the pathogenesis of autoimmune diseases. However, precise identification and quantification of the cells that produce this cytokine in vivo have not been performed. We generated novel IL-17A reporter mice to investigate expression of IL-17A during Klebsiella pneumoniae infection and during experimental autoimmune encephalomyelitis, conditions previously demonstrated to potently induce IL-17A production. In both settings, the majority of IL-17A was produced by non-CD4(+) T cells, particularly γδ T cells, but also invariant NKT cells and other CD4(-)CD3ε(+) cells. As measured in dual-reporter mice, IFN-γ-producing Th1 cells greatly outnumbered IL-17A-producing Th17 cells throughout both challenges. Production of IL-17A by cells from unchallenged mice or by non-T cells under any condition was not evident. Administration of IL-1β and/or IL-23 elicited rapid production of IL-17A by γδ T cells, invariant NKT cells and other CD4(-)CD3ε(+) cells in vivo, demonstrating that these cells are poised for rapid cytokine production and likely comprise the major sources of this cytokine during acute immunologic challenges.

Full-text

Available from: Hong-Erh Liang, Jun 11, 2014
Marking and Quantifying IL-17A-Producing Cells
In Vivo
April E. Price
1,2
, R. Lee Reinhardt
1,2¤
, Hong-Erh Liang
1,2
, Richard M. Locksley
1,2,3
*
1 Howard Hughes Medical Institute, University of California San Francisco, San Francisco, California, United States of America, 2 Department of Medicine, University of
California San Francisco, San Francisco, California, United States of America, 3 Department of Microbiology and Immunology, University of California San Francisco, San
Francisco, California, United States of America
Abstract
Interleukin (IL)-17A plays an important role in host defense against a variety of pathogens and may also contribute to the
pathogenesis of autoimmune diseases. However, precise identification and quantification of the cells that produce this
cytokine in vivo have not been performed. We generated novel IL-17A reporter mice to investigate expression of IL-17A
during Klebsiella pneumoniae infection and during experimental autoimmune encephalomyelitis, conditions previously
demonstrated to potently induce IL-17A production. In both settings, the majority of IL-17A was produced by non-CD4
+
T
cells, particularly cd T cells, but also invariant NKT cells and other CD4
2
CD3e
+
cells. As measured in dual-reporter mice, IFN-
c-producing Th1 cells greatly outnumbered IL-17A-producing Th17 cells throughout both challenges. Production of IL-17A
by cells from unchallenged mice or by non-T cells under any condition was not evident. Administration of IL-1b and/or IL-23
elicited rapid production of IL-17A by cd T cells, invariant NKT cells and other CD4
2
CD3e
+
cells in vivo, demonstrating that
these cells are poised for rapid cytokine production and likely comprise the major sources of this cytokine during acute
immunologic challenges.
Citation: Price AE, Reinhardt RL, Liang H-E, Locksley RM (2012) Marking and Quantifying IL-17A-Producing Cells In Vivo. PLoS ONE 7(6): e39750. doi:10.1371/
journal.pone.0039750
Editor: Ciriaco A. Piccirillo, McGill University Health Center, Canada
Received January 26, 2012; Accepted May 29, 2012; Published June 29, 2012
Copyright: ß 2012 Price et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits
unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: This work was supported by AI30663 and AI078869 from the United States National Institutes of Health, the Howard Hughes Medical Institute, and the
Sandler Asthma Basic Research Center at University of California San Francisco. The funders had no role in study design, data collection and analysis, decision to
publish, or preparation of the manuscript.
Competing Interests: RML serves on the Scientific Review Board for Genentech/Roche and for the American Asthma Foundation. This does not alter the
author’s adherence to all the PLoS ONE policies on sharing data and materials.
* E-mail: locksley@medicine.ucsf.edu
¤ Current address: Department of Immunology, Duke University Medical Center, Durham, North Carolina, United States of America
Introduction
The cytokine interleukin (IL)-17A has a key role in immunity,
inducing the release of a variety of inflammatory cytokines as well
as chemokines that can mediate the rapid recruitment of
neutrophils. Studies with knockout mice and neutralizing anti-
bodies have revealed a role for IL-17A in immunity to various
bacterial and fungal infections and also in the induction and
propagation of several autoimmune diseases [1]. In humans,
genetic deficiencies in IL-17 receptor A or IL-17F are associated
with susceptibility to mucocutaneous infection with Candida albicans
and, to a lesser extent, Staphylococcus aureus [2]. Autoantibodies to
IL-17A and IL-17F are seen in patients with mutations in the
autoimmune regulator (AIRE) and may contribute to mucocuta-
neous candidiasis [3]. Patients with hyper-IgE syndrome associ-
ated with mutations in Stat3 have deficits in the induction of IL-
17-producing CD4
+
T (Th17) cells that correlate with recurrent
bacterial and fungal infections [4]. Polymorphisms in the gene
encoding the receptor to IL-23, a cytokine implicated in the
generation and maintenance of Th17 cells and in the promotion of
IL-17 secretion from innate cells [5,6,7,8], are associated with
protection against the development of inflammatory bowel disease
[9]. A more complete understanding of the biology of IL-17A,
including the temporal and cell-specific patterns of expression,
could aid in the generation of effective therapeutics targeted
towards these infectious and autoimmune conditions.
Although early work focused on IL-17A production by Th17
cells, more recent studies suggest important contributions by
innate-like lymphocytes, including cd T cells and NKT cells [10].
However, most reports use ex vivo restimulation to identify IL-17A-
producing cells, and thus potentially alter the pattern of cytokine
secretion that occurs in vivo. Several groups have generated IL-17F
reporter mice in order to bypass the need for restimulation, but
while IL-17A and IL-17F are often co-expressed, they are
differentially induced in certain models and can have distinct
functional roles [11,12,13]. More recently, IL-17A-cre reporter
mice were developed to permanently mark cells that have
activated the IL-17A locus, thus facilitating fate-tracking, and an
IL-17A-eGFP knockin mouse was used to track Th17 cells during
tolerance induced by a CD3-specific antibody and in mouse
models of sepsis [14,15]. Studies using IL-17F reporter mice and
IL-17A-cre mice, as well as studies using adoptive transfer [16,17],
have raised the possibility that Th17 cells have an unstable
phenotype, such that they lose the capacity to produce IL-17 and
begin to produce interferon (IFN)-c.
Here, we generated IL-17A reporter mice and used these mice
to examine the expression of IL-17A at rest, after bacterial
challenge, and during the development of autoimmune enceph-
alitis. To establish the relationships between IL-17A-producing
cells and IFN-c-producing cells, we additionally crossed these IL-
17A reporter mice to mice with an IFN-c reporter allele. Using
these dual-reporter mice, we quantified the numbers and types of
PLoS ONE | www.plosone.org 1 June 2012 | Volume 7 | Issue 6 | e39750
Page 1
cells that produce these cytokines in vivo without the need for ex vivo
restimulation.
Results
Generation and validation of Smart-17A reporter mice
To assess IL-17A expression in vitro and in vivo, we generated IL-
17A reporter mice, termed Smart (
Surface marker for transcrip-
tion)-17A mice (Figure 1A). In these mice, the 39 untranslated
region (UTR) of the il17a gene was modified to include an internal
ribosomal entry site (IRES) followed by a non-signaling form of the
human nerve growth factor (hNGFR) gene, resulting in IRES-
mediated translation of hNGFR when the IL-17A locus is
activated. We verified the efficacy of the Smart-17A allele by
demonstrating that hNGFR expression was specifically induced in
CD4
+
T cells in vitro only under Th17 polarizing conditions and
that intracellular IL-17A was found almost entirely within the
hNGFR
+
population (Figure 1B, Figure S1A). Thus, the hNGFR
reporter accurately marks 98% of Th17 cells identified using
standard methods of in vitro restimulation and intracellular
cytokine staining. Cells with the brightest staining for intracellular
IL-17A were also those with the highest mean fluorescence
intensity (MFI) for the hNGFR reporter. Approximately 30% of
cells were hNGFR
+
but negative for intracellular IL-17A
(Figure 1B). These cells tended to have the lowest MFI for
hNGFR, consistent with their identification as cells that had
previously secreted IL-17A and continued to be marked by the
surface reporter. The half-life of the reporter on the cell surface
was approximately 24–48 hours as assessed by decay under in vitro
conditions (Figure S1B). Taken together, these results demonstrate
that the Smart-17A reporter mouse sensitively and accurately
marks cells that are induced to express IL-17A.
IL-17A expression in naı
¨
ve mice
To characterize IL-17A expression in vivo, we crossed Smart-
17A mice to RORct-GFP reporter mice [18]. Expression of the
transcription factor RORct has been shown to accurately identify
both Th17 cells [19] and other lymphoid IL-17-producing cells
[10]. We anticipated that the inclusion of this second reporter
would enhance the detection of rare populations of IL-17A-
expressing cells by their concordant expression of RORct. We first
looked at CD3e
+
cell populations in multiple organs of naı
¨
ve mice
for evidence of RORct and IL-17A expression (Figure 2). CD3e
+
cells were gated as indicated in Figure S2. Invariant (i)NKT cells
were identified using a tetramer loaded with PBS-57 (an analogue
of a-galactosylceramide provided by the NIH tetramer facility),
and ‘‘other CD3e+ cells’’ were defined as cells that were CD3e+
but negative for CD4, CD8, the cd T cell receptor (TCR) and the
CD1d-tetramer.
As previously reported, we observed constitutive expression of
the RORct GFP reporter in CD4
+
T cells in the lamina propria of
the small intestine and colon [19]. We also identified populations
of GFP
+
cd T cells in the spleen, lung, skin and small intestine,
GFP
+
iNKT cells in the lung, and GFP
+
other CD3e
+
cells in the
lung and skin. Despite recovery of these RORct
+
cells, however,
we did not observe hNGFR
+
cells among the CD3e
+
cell
populations in any of the examined organs. In all populations,
the small percentage of cells within the hNGFR
+
gate was similar
to background levels present in naı
¨
ve wild-type mice (data not
shown). We also found no evidence of hNGFR expression by
dendritic cells, macrophages, neutrophils or a recently described,
lineage-negative, Thy1
+
population of innate lymphoid cells
(Figure S3) [20]. We repeated these analyses in Smart-17A mice
without the RORct-GFP allele and also in mice colonized by
segmented filamentous bacteria and obtained identical results
(data not shown). In all cases, none of the examined cell types,
including cells from intestinal tissues, constitutively expressed
hNGFR, suggesting that IL-17A is not expressed or is expressed at
levels too low to be detected using this reporter in resting mice.
IL-17A expression during Klebsiella pneumoniae infection
Klebsiella pneumoniae is a gram-negative extracellular bacterium
that is a cause of nosocomial and community-acquired pneumo-
nia. IL-17A is rapidly produced in the lungs of mice during K.
pneumoniae infection [21], and downstream signaling through the
IL-17 receptor (IL-17R) leads to the induction of a variety of
proinflammatory cytokines and chemokines that promote neutro-
phil accumulation [22]. Mice deficient in IL-17A, IL-17R or the
p19 subunit of IL-23 have increased bacterial dissemination and
increased mortality [22,23,24], supporting the use of this model to
investigate the cell types that produce IL-17A during acute
bacterial challenge.
We intranasally inoculated Smart-17A mice with a dose of K.
pneumoniae that led to mortality in a majority of infected mice by
day 5. During the first 3 days after infection, we noted a
substantial increase in the total number of CD3e
+
cells in the
lungs (Figure 3A). The vast majority of these cells were CD4
+
and
CD8
+
T cells, with much smaller numbers of cd T cells, iNKT
cells and other CD3e
+
cells. When assayed two days post-infection,
the highest percentages of hNGFR
+
cells were found amongcdT
cells, with lower percentages of hNGFR
+
iNKT cells and other
CD3e
+
cells (Figure 3B). A small but reproducible percentage of
CD4
+
T cells were also hNGFR
+
, whereas percentages of reporter-
positive CD8
+
T cells did not differ from background levels in
wild-type mice. We did not observe hNGFR expression by any
CD3e
-
cell populations (data not shown). Although innate-like T
cells comprised only a small portion of the total number of CD3e
+
cells in the infected lung, they represented a majority of the total
hNGFR
+
cells (Figure 3C). cd T cells themselves comprised over
half of the hNGFR
+
cells (54%), followed by CD4
+
T cells (31%),
other CD3e
+
cells (9%) and iNKT cells (5%). Thus, innate-like T
cells are major sources of IL-17A during K. pneumoniae infection.
Innate-like T cells are poised to produce IL-17A in
response to proinflammatory cytokines
The discovery that innate-like T cells expressed IL-17A during
acute K. pneumoniae infection led us to investigate the potential
signals that mediate the production of this cytokine. It has been
noted that IL-1b and IL-23 can induce TCR-independent IL-17A
production from cd T cells in vitro [7] and TCR/CD1d-dependent
IL-17A production from iNKT cells in vitro and ex vivo [8]. To
determine if these findings applied to innate-like T lymphocytes in
vivo, we administered IL-1b and IL-23 intranasally to Smart-17A
mice and examined reporter expression from cells in the lungs 8 hr
later (Figure 4A). The addition of either IL-1b or IL-23
individually elicited hNGFR expression in cd T cells, iNKT cells
and other CD3e
+
cells, and the combination of both cytokines
resulted in a synergistic increase in hNGFR levels to levels similar
to those seen after K. pneumoniae infection. In contrast, we did not
observe induction of IL-17A production as assessed by hNGFR
expression in CD4
+
T cells. The brief time between cytokine
administration and IL-17A expression suggests that tissue resident
innate-like T cells are poised to produce IL-17A rapidly after
receiving signals from these cytokines. IL-1b and IL-23 subunit
p19 mRNA were induced in the lung within 1 day after K.
pneumoniae infection (Figure 4B), providing further evidence that
these cytokines may play a role in inducing acute IL-17A
production from innate-like T lymphocytes.
IL-17A-Producing Cells In Vivo
PLoS ONE | www.plosone.org 2 June 2012 | Volume 7 | Issue 6 | e39750
Page 2
IL-17A expression during experimental autoimmune
encephalomyelitis
Experimental autoimmune encephalomyelitis (EAE) is a mouse
model of multiple sclerosis that is associated with the production of
IL-17A. IL-17A
2/2
mice have reduced incidence and severity of
disease [25]. IL-1R
2/2
mice and IL-23p19
2/2
mice are also less
susceptible to disease [7,26]. Although Th17 cells are thought to
be the main source of IL-17A during EAE, cd T cells can also
produce this cytokine and may act to amplify IL-17A production
from Th17 cells [7,14]. Most of these studies relied on ex vivo
restimulation to assay IL-17A production, however, and thus the
cells producing IL-17A directly in vivo during the development and
propagation of EAE are not fully characterized.
To track IL-17A expression during EAE, we immunized Smart-
17A mice with myelin oligodendrocyte glycoprotein peptide
(MOG) emulsified in complete Freund’s adjuvant (CFA) and
treated mice with pertussis toxin to induce disease. We then
examined CD3e
+
cell lineages in the draining lymph nodes (LN) at
day 6 and in the spinal cord and cerebellum (referred to as CNS)
at day 12 when mice displayed symptoms of paralysis. At both
sites, the vast majority of isolated T cells were CD4
+
or CD8
+
T
cells, with only small numbers of cd T cells, iNKT cells and other
CD3e
+
cells (Figure 5A). Small but reproducible percentages (1–
2%) of CD4
+
T cells expressed the hNGFR reporter in both the
LN and the CNS (Figure 5B). Among the remaining T cell
populations, we observed hNGFR-expressing cd T cells, iNKT
cells and other CD3e
+
cells (Figure 5B). The percentages of these
hNGFR
+
innate-like T cells were greater in the LN than the CNS.
Expression of hNGFR by CD8
+
T cells in both the LN and CNS
was negligible when compared to wild-type controls, and we did
not observe hNGFR expression by any CD3e
2
cells (data not
shown). Although the total numbers of cd T cells, iNKT cells and
other CD3e
+
cells were substantially lower than the total numbers
of CD4
+
cells, these innate-like T cells comprised the majority of
IL-17A-expressing hNGFR
+
cells in both the LN and CNS
(Figure 5C). In the LN, the greatest fraction of hNGFR
+
cells was
other CD3e
+
cells (36%), followed by cd T cells (29%), iNKT cells
(17%) and CD4
+
T cells (15%). In the CNS, the largest fractions of
hNGFR
+
cells were cd T cells and CD4
+
T cells (42% each), while
other CD3e
+
cells and iNKT cells together made up the remaining
16%. These data suggest that innate-like T cells are a significant
source of IL-17A during both the initiation and propagation
phases of EAE.
Figure 1. Generation of Smart-17A mice. (A) Targeting strategy for the il17a locus. For detailed description, see Materials and Methods. (B) CD4
+
T cells were isolated from wild-type or Smart-17A mice and polarized under Th17 conditions for 4 days. hNGFR was detected using a surface antibody
and IL-17A was assayed using intracellular cytokine staining after restimulation. A representative flow cytometry plot is shown from .5 comparable
experiments.
doi:10.1371/journal.pone.0039750.g001
IL-17A-Producing Cells In Vivo
PLoS ONE | www.plosone.org 3 June 2012 | Volume 7 | Issue 6 | e39750
Page 3
Since the percentages of IL-17A-expressing CD4
+
T cells
observed using the Smart-17A reporter were substantially lower
than what has been reported in the literature using ex vivo
restimulation, we verified that ex vivo restimulation of cells isolated
from the LN and CNS of Smart-17A mice led to an induction of
hNGFR expression that very closely mirrored the percentages of
IL-17A
+
cells found using standard intracellular cytokine staining
methods (Figure 5D). This confirms that cells from Smart-17A
mice accurately report IL-17A production, and further suggests
that ex vivo restimulation can induce IL-17A production from cells
that are not actively producing the cytokine in vivo.
Differential production of IL-17A and IFN-c at effector
sites during inflammation
IFN-c is a cytokine that is expressed by multiple cell types and is
generally associated with inflammatory immune responses. Mice
deficient in IFN-c or the IFN-c receptor (IFN-cR) are more
susceptible to a variety of bacterial infections including pulmonary
infection with K. pneumoniae [27]. IFN-c has also been implicated in
the pathogenesis of autoimmune diseases, including EAE,
although the precise role of this cytokine is controversial. Thus,
mice deficient in IFN-c, IL-12 p35 subunit and IFN-cR are more
susceptible to disease [28,29,30] whereas T-bet
2/2
mice are
protected from disease [31]. EAE can be induced in Rag
2/2
mice
by the transfer of CD4
+
T cells that have been polarized under
either Th1 or Th17 conditions [32]. Complicating matters further,
recent studies have suggested that Th17 cells may represent an
unstable population that can convert to an IFN-c producing
phenotype under specific inflammatory conditions [33].
To explore the relationship between IL-17A and IFN-c
production during K. pneumoniae infection and EAE, we crossed
Smart-17A mice to Great reporter mice, which mark IFN-c
production by the coordinate expression of YFP downstream of an
IRES introduced into the IFN-c locus [34]. The most striking
observation in these dual reporter mice was that at the effector
sites following both challenges, either in the lungs of mice infected
with K. pneumoniae or in the CNS of mice during EAE, the
percentages of YFP
+
cells were substantially greater than the
percentages of hNGFR
+
cells among CD4
+
T cells, iNKT cells
and other CD3e
+
cells (Figure 6A). In contrast, the populations of
cells that expressed YFP and hNGFR was much more comparable
among cd T cells. As noted previously, we saw no measurable
expression of hNGFR above background levels in CD8
+
T cells,
although we did note a substantial population of YFP
+
CD8
+
T
cells, especially in the CNS during EAE. We observed some co-
expression of YFP and hNGFR among CD4
+
T cells, especially in
Figure 2. IL-17A expression in resting mice. Cells were isolated from indicated organs of Smart-17A/RORct reporter mice and levels of hNGFR
were assayed. Populations were gated as described in Figure S2. All gates were set using a wild-type mouse as a negative control. * denotes cell
populations that were too few in number to reliably assess marker expression. Representative flow cytometry plots are shown from 1 of 3
comparable experiments, each including 2–3 mice.
doi:10.1371/journal.pone.0039750.g002
IL-17A-Producing Cells In Vivo
PLoS ONE | www.plosone.org 4 June 2012 | Volume 7 | Issue 6 | e39750
Page 4
the CNS of mice during EAE, where approximately half of the
hNGFR
+
cells also expressed YFP. However, among the innate-
like T cells, IFN-c-expressing and IL-17A-expressing cells
segregated into distinct populations. The same trends in cytokine
production were evident when we examined the total numbers of
YFP
+
and hNGFR
+
cells isolated from these effector sites
(Figure 6B). IFN-c-producing cells greatly outnumbered IL-17A-
producing cells during the first three days of K. pneumoniae infection
and during all stages of progressive EAE disease among all subsets
of CD3e
+
cells except for cd T cells.
Figure 3. IL-17A expression during infection with
Klebsiella pneumoniae.
Wild-type or Smart-17A mice were infected with 500–1000 K.
pneumoniae. (A) At the indicated time points, cells were harvested from lungs and numbers of cells were enumerated. (B) Cells were isolated from the
lungs of mice 2 days after infection and assayed for hNGFR expression. (C) The total number of hNGFR
+
and YFP
+
cells on day 2 post-infection were
calculated and the percentage attributable to each cell population is shown in a pie graph. The percentage of background staining seen in a wild-
type mouse under identical conditions was subtracted before performing all calculations to control for nonspecific staining. This experiment was
repeated 3 times with n .3 mice at each time point. For bar and pie graphs, data from independent experiments were compiled. For flow cytometry,
representative plots are shown.
doi:10.1371/journal.pone.0039750.g003
IL-17A-Producing Cells In Vivo
PLoS ONE | www.plosone.org 5 June 2012 | Volume 7 | Issue 6 | e39750
Page 5
Discussion
We used IL-17A reporter mice to assess IL-17A expression in
resting mice and during models of bacterial pneumonia and
autoimmune disease. We did not observe constitutive IL-17A
expression from cells in naı
¨
ve mice. However, in appropriate
infectious and autoimmune models, we observed IL-17A-express-
ing CD4
+
T cells and greater percentages of IL-17A-expressing cd
T cells, iNKT cells and other CD3e
+
cells. The other CD3e
+
cells
were defined by their expression of CD3e
+
and lack of expression
of CD4, CD8, cd TCR and the CD1d-tetramer. It is possible that
these cells are type II NKT cells that do not recognize a-
galactosylceramide, or T cells that have downregulated the
expression of CD4, CD8 or the cd TCR. In all of these studies,
Figure 4. Expression of IL-17A from innate-like T lymphocytes cells can be induced by IL-1b and/or IL-23. (A) Smart-17A mice were
inoculated intranasally with PBS or with 500 ng IL-1b, IL-23 or both cytokines. Lungs were harvested 8 hr later and cells were analyzed for hNGFR
expression. Gates were set using a wild-type control. The experiment was repeated 2 times and representative data are shown. (B) Wild-type mice
were infected with K. pneumoniae and levels of IL-1b and the IL-23 subunit p19 mRNA in whole lung homogenate were measured using quantitative
PCR. Expression of GAPDH was used as a reference to define relative expression. The experiment was done twice and a representative experiment is
shown, n = 3 for all groups.
doi:10.1371/journal.pone.0039750.g004
IL-17A-Producing Cells In Vivo
PLoS ONE | www.plosone.org 6 June 2012 | Volume 7 | Issue 6 | e39750
Page 6
IL-17A production as assessed by the reporter was limited to
CD3e
+
T cells and was not expressed by myeloid cell populations.
By using novel dual cytokine reporter mice, we demonstrated that
IFN-c-expressing lymphocytes greatly outnumbered IL-17A-
expressing lymphocytes in both the acute bacterial and in the
more subacute autoimmune challenges.
We were unable to detect expression of the hNGFR reporter in
any CD3e
+
or CD3e
2
cell type in naı
¨
ve mice, suggesting that IL-
Figure 5. IL-17A expression during experimental autoimmune encephalomyelitis. Wild-type or Smart-17A mice were immunized with
MOG-CFA to induce EAE. (A) At the indicated time point, cells were harvested from the draining axial, brachial and inguinal lymph nodes (LN) at day 6
or spinal cords and cerebellums (CNS) at day 12 and numbers of cells were enumerated. (B) Cells were assayed for hNGFR expression. (C) The total
numbers of hNGFR
+
cells were calculated and the percentage attributable to each cell population is shown in a pie graph. The percentage of
background staining seen in a wild-type mouse under identical conditions was subtracted before performing all calculations to control for
nonspecific staining. (D) Cells were isolated from the LN or CNS and immediately stained for surface markers or restimulated for 5 hr with PMA/
ionomycin and then stained for surface markers and/or intracellular expression of IL-17A. The experiments in A–C were repeated 3 times with n.2
mice at each time point. The experiment in D was repeated 2 times with n.5 mice at each time point. For bar and pie graphs, data from independent
experiments were compiled. For flow cytometry, representative plots are shown. For the CNS data, mice were excluded that did not display
symptoms of paralysis.
doi:10.1371/journal.pone.0039750.g005
IL-17A-Producing Cells In Vivo
PLoS ONE | www.plosone.org 7 June 2012 | Volume 7 | Issue 6 | e39750
Page 7
Figure 6. Differential production of IL-17A and IFN-c in effector sites during inflammation. (A) Expression of hNGFR and YFP was
assessed in the lungs of mice at day 2 after infection with K. pneumoniae or in the spinal cord and cerebellum (CNS) of mice at day 12 after induction
of EAE. (B) Numbers of hNGFR
+
and YFP
+
cells were enumerated during K. pneumoniae infection or EAE disease course. EAE disease scores were
determined as described in Materials and Methods. ND = not detected. These experiment was repeated 3 times with n.2 mice at each time point or
disease score. For flow cytometry, representative plots are shown. For bar graphs, data from individual experiments were compiled.
doi:10.1371/journal.pone.0039750.g006
IL-17A-Producing Cells In Vivo
PLoS ONE | www.plosone.org 8 June 2012 | Volume 7 | Issue 6 | e39750
Page 8
17A is not expressed in situ in resting mice. Segmented filamentous
bacteria (SFB), Candidatus arthromitis, have been shown to induce
IL-17A production by lamina propria T cells when introduced
into the mouse intestinal flora [35]. Cohousing Smart-17A mice
with mice obtained from Taconic Farms led to colonization by
SFB as determined by PCR, but did not induce hNGFR
expression on cells in the lamina propria of the small intestine
or colon (data not shown). Our inability to quantitate active IL-
17A production from cells in tissues of resting mice contrasts with
prior observations made with other strains of IL-17A reporter
mice. In the first report, Hirota et al. [14] crossed IL-17A-cre mice
to Rosa-flox-stop-YFP mice to generate an IL-17A fate-tracking
reporter and observed that 11% of lamina propria CD4
+
T cells
were constitutively YFP-positive in these mice. A study by
Esplugues et al. [15] using a second IL-17A reporter strain, which
utilized an IRES-eGFP knockin strategy more closely akin to the
construct used in the Smart-17A mice, reported that 2–4% of
lamina propria CD4
+
T cells constitutively expressed eGFP.
Whether the differences between our results and those using these
alternate reporter strains are technical (e.g. permissiveness of the
various IRES elements or detection limits of eGFP versus hNGFR)
is unclear, and will require direct comparisons of the strains in
question.
Here, we crossed our Smart-17A reporter mice to RORct-GFP
reporter mice to ensure our capacity to isolate potential IL-17A-
producing cells from the relevant tissues. Although we readily
identified populations of RORct
+
cells in multiple organs of naı
¨
ve
mice, these cells did not constitutively express the hNGFR
reporter. In line with a previous report [36], we noted substantial
populations of RORct
+
cd T cells in the skin and lungs of resting
mice. We also noted smaller percentages of RORct
+
iNKT cells in
the lung and other CD3e
+
cells in the lung and skin. Resident
dermal RORct
+
cd T cells have recently been shown to play a role
in cutaneous immunosurveillance and to contribute to skin
pathology during a mouse model of psoriasis [37,38,39]. The
localization of constitutive RORct
+
innate-like T lymphocytes to
the lung is intriguing as this mucosal tissue is relatively sterile and
devoid of large numbers of commensal bacteria, a feature that is
may contribute to the development of the RORct
+
populations in
the intestinal tract [35,40,41]. Although lung-resident innate-like
T cells did not constitutively express IL-17A as assessed by the
hNGFR reporter, cd T cells, iNKT cells and other CD3e
+
cells
expressed hNGFR within 24 hr after Klebsiella infection or 8 hr
after administration of IL-1b and/or IL-23. Taken together, these
data suggest that RORct
+
innate-like T cells accumulate at
multiple epithelial barriers, where they are poised to respond
rapidly to compromises in epithelial integrity with IL-17A
production and the subsequent recruitment of neutrophils to the
injured site.
Earlier reports used ex vivo restimulation to identify Th17 cells
induced during a variety of bacterial and fungal infections,
particularly those initiated by mucosal challenges
[42,43,44,45,46]. However, as we demonstrate here, ex vivo
restimulation has the potential to reveal IL-17A production by
cells that may not be actively producing this cytokine in vivo
(Figure 5D). Although our studies using K. pneumoniae in Smart-17A
mice revealed activation of reporter expression in both innate-like
T cells and CD4
+
Th17 cells, earlier studies demonstrated
increased mortality in mice lacking cd T cells but no difference
in mortality in mice lacking abT cells [22,46], suggesting that cd T
cells may be a more important source of IL-17A during this
infection. Similar observations were made in experimental
Mycobacterium tuberculosis infection [47] and in intraperitoneal
infection with Escherichia coli [48], suggesting a more generalized
role for IL-17A production by cd T cells in immunity to bacterial
infections. Our findings corroborate these interpretations.
Somewhat unexpected were the small percentages of IL-17A-
expressing CD4
+
T cells recovered from lymph nodes and spinal
cords and cerebellums during the peak of EAE disease, a canonical
experimental model for Th17 induction. Despite the relatively
small percentage of IL-17A reporter-positive CD4
+
T cells, the
large numbers of CD4
+
T cells in the inflammatory milieu was
such that CD4
+
T cells still comprised a sizeable portion of total
IL-17A-producing cells, making up 15% of the total in the LN and
42% in the CNS. The vast majority of effector CD4
+
T cells,
however, were Th1 cells as assessed by expression of the Great
IFN-c reporter allele and, based on our in vitro studies of the decay
of the reporter on Th17 cells, are unlikely to have secreted IL-17A
over the prior 1–2 days. Our findings seem to contrast with those
obtained using an IL-17A-cre/ ROSA-flox-stop-YFP fate-tracking
reporter mouse (14). In that study, the authors observed that over
half of the CD4
+
and cd T cells were YFP
+
in the spinal cords of
mice during the peak of EAE. However, cells positive for the IL-
17A-cre/Rosa-flox-stop-YFP reporter were those that expressed
the Cre recombinase from an activated IL-17A locus at any time
during their development, whereas the Smart-17A reporter
specifically marks cells that have recently expressed or are
currently expressing IL-17A. Thus, differences in construction of
these various reporter mice may account for the differences in the
experimental results.
Recent reports have raised the possibility that Th17 cells
represent an unstable transient phenotype rather than a fully
differentiated Th subset akin to that of Th1 and Th2 cells. During
the development of EAE, IL-17A
+
, IFN-c
+
and IL-17A/IFN-c
double-positive CD4
+
T cells have been observed in the lymph
nodes and spinal cords of immunized mice [19]. Adoptive transfer
of encephalitogenic Th17 cells purified from an IL-17F-cre BAC
transgenic mouse into RAG-2
2/2
or wild-type recipients revealed
that a portion of these cells began to secrete IFN-c during the
progression of EAE [49]. Similarly, studies using the IL-17A-cre/
Rosa-flox-stop-YFP mice revealed that only half of the reporter-
positive fate-marked CD4
+
T cells were positive for intracellular
IL-17A in the spinal cords during the peak of EAE [14], providing
further evidence for a switch from an IL-17A-producing to an
IFN-c-producing phenotype. However, all of these studies used ex
vivo restimulation to assess IL-17A and IFN-c production from
isolated spinal cord cells. Our study, which relied solely on direct
ex vivo detection of cytokine production using knockin reporter
mice, provides additional evidence for the marked predominance
of IFN-c production by CD4
+
T cells during each of the clinical
stages of EAE. We saw only low numbers of IL-17A
+
cells as
compared to IFN-c
+
cells, and approximately half of the Th17
cells concordantly expressed IFN-c. Taken together, these findings
suggest that activation of the IL-17A locus may be important in
the early differentiation of pathogenic CD4
+
T cells in EAE, but
that actual production of IL-17A might not be a major mechanism
driving the neurological manifestations of the disease. Indeed,
recent reports have demonstrated critical contributions by GM-
CSF rather than IL-17 in the pathogenesis of EAE [50,51].
A consistent observation was the pronounced segregation of IL-
17A-expressing and IFN-c-expressing cells within the innate-like T
cell populations. This segregation occurred in both the infectious
and autoimmune models, raising questions about the mechanisms
of regulation that account for this exclusionary pattern of cytokine
production. IFN-c and IL-17 have been shown to limit
differentiation of Th17 and Th1 cells, respectively, and this
mutual inhibition could be operating in these innate populations as
well [52,53,54]. It has also been suggested that antigen-naive cd T
IL-17A-Producing Cells In Vivo
PLoS ONE | www.plosone.org 9 June 2012 | Volume 7 | Issue 6 | e39750
Page 9
cells predominately produce IL-17A when activated, whereas
antigen-experienced cd T cells produce IFN-c [55], which could
potentially explain the differences in cytokine-secreting popula-
tions seen in our models. Further characterization of the cells
expressing these cytokines is needed to address this question more
fully.
Cytokine reporter mice allow for the functional marking of cells
during the course of an inflammatory challenge and have provided
essential insights into the coordination of the immune response in
vivo. The Smart-17A mice and Great mice used in this study
permitted the detection of IL-17A-producing and IFN-c-produc-
ing cells in situ without restimulation. Using these mice, we
demonstrated that innate-like T cells, particularly cd T cells,
comprised major cell populations poised for acute IL-17A
production. During both K. pneumoniae infection and EAE, models
previously demonstrated to induce potent IL-17 expression, we
show that the numbers of IL-17A-producing cells were far fewer
than the numbers of IFN-c-producing cells in the same tissues,
suggesting different levels of regulation of these two inflammatory
cytokines in vivo. Although IL-17A production has been elicited
from a number of different cell types using restimulation, our
reporter system suggests that cytokine production is limited to T
cells in the models we studied. These cytokine reporter mice will
be valuable tools for future studies investigating the full
contributions of IL-17A-expressing cells to vertebrate immunity.
Materials and Methods
Mice
C57BL/6 mice and RORct-GFP reporter mice [18] were
obtained from Jackson Laboratories. Great IFN-c reporter mice
have been described [34]. Smart-17A mice were generated by first
assembling a composite selection/reporter cassette using standard
cloning procedures in the following order: 1) a floxed-neomycin-
resistance gene (floxed Neo
r
); 2) encephalomyocarditis virus
(EMCV) internal ribosome entry site (IRES); 3) low-affinity
human nerve growth factor receptor (p75 LNGFR, also known
as CD271) cDNA (OriGene); 4) bovine growth hormone (bGH)
poly-adenylation signal (pA). This 3.1 kb selection/reporter
cassette was cloned into a basal targeting construct pKO915-DT
(Lexicon) containing diphtheria toxin (DT)a chain for negative
selection. Both 59 and 39 homologous arms used to flank the
cassette were obtained by high-fidelity PCR amplification of the
il17a locus from 129/SvJ genomic DNA. The 59 arm consists of a
1.6 kb fragment covering intron 2 and coding sequence of exon 3.
The 39 arm consists of a 2.2 kb fragment spanning the endogenous
39 UTR and downstream sequences. After sequence verification,
the NotI-linearized construct was electroporated into PrmCre ES
cells, which express Cre recombinase driven by the protamine
promoter [56]. G418-resistant ES clones were screened for
homologous recombination by Southern blot. Two independent
clones were injected into C57BL/6 blastocysts to generate
chimeras. The neomycin-resistance cassette was deleted in the
male germline by Cre-mediated recombination after breeding
male chimeras to C57BL/6 females. Mice carrying the Smart17A
allele were backcrossed 10 generations to the C57BL/6 back-
ground. In experiments utilizing Smart-17A/RORct-GFP mice,
the mice were homozygous for the Smart-17A allele and
heterozygous for RORct-GFP. Smart-17A/Great mice were
homozygous for both the IL-17A and IFN-c reporter alleles and
these dual reporter mice were used for all experiments described in
Figures 3, 4, 5, and 6.
Th17 polarization
CD4
+
T cells were isolated from the lymph nodes of Smart-17A
and wild-type C57BL/6 mice using MACS beads (Miltenyi
Biotech) and cultured with irradiated splenocytes from TCR-
Ca
2/2
mice. Cells were stimulated under the designated
conditions for 4 days: Th0 (50 U/ml IL-2), Th1 (50 U/ml IL-2,
5 ng/ml IL-12, 10
mg/ml anti-IL-4), Th2 (50 U/ml IL-2, 50 ng/
ml IL-4, 10
mg/ml anti-IFN-c), Th17 (3 ng/ml TGF-b, 20 ng/ml
IL-6, 10
mg/ml anti-IFN-c and anti-IL-4). Cytokines were
purchased from R&D Systems. For intracellular cytokine staining,
cells were restimulated with phorbol myristate acetate (50 ng/ml)
and ionomycin (750 ng/ml) for 5–6 hr, with monensin (3
mM)
added for the final 2 hr.
Klebsiella pneumoniae infection
K. pneumoniae (American Type Culture Collection #43816) were
cultured in Nutrient Broth (Difco) with shaking overnight at 37u C.
Cultures were diluted in Nutrient Broth and cultured for an
additional 2–3 hr until bacteria reached log phase. Bacteria were
pelleted by centrifugation, washed twice in PBS and diluted to a
final dose of 500–1,000 bacteria in 50
ml PBS. This inoculum was
administered intranasally after anaesthetizing mice with isofluor-
ane. Doses were confirmed by plating the inoculum on Nutrient
Broth agar plates and counting colonies the following day.
Induction of experimental autoimmune
encephalomyelitis
Mice were immunized with 200 mg of MOG35–55 emulsified in
CFA containing 4 mg/ml Mycobacterium tuberculosis (Difco) subcu-
taneously and given 200 ng of pertussis toxin (List Biological
Laboratories) intravenously on the day of and 2 days after
immunization. Animals were graded daily according to their
clinical severity as follows: grade 0, no abnormality; grade 1, limp
tail; grade 2, limp tail and hind limb weakness (waddling gait);
grade 3, partial hind limb paralysis; grade 4, complete hind limb
paralysis; grade 5, moribund.
Cell isolation and preparation
Mice were perfused with PBS and organs were removed.
Mechanical dissociation was used to prepare single-cell suspen-
sions from lymph nodes, spleens and Peyer’s patches. Lungs were
dissociated using a GentleMacs Dissociator (Miltenyi Biotech).
Small intestines and colons were cut into small pieces and
incubated in 5 mM EDTA in HBSS on stir plates 4 times for
15 min to remove the epithelial layer containing intraepithelial
lymphocytes. Intestinal pieces were incubated at 37uC in 200 U/
ml collagenase VIII (Sigma) in complete RPMI for a total of 4 30-
min incubations. Cells from all incubations were pooled and
lamina propria lymphocytes were purified over a 40%/100%
Percoll gradient. Central nervous system lymphocytes were
isolated as described (21) with modifications. Briefly, spinal cords
and cerebellums were cut into pieces and digested in 300 U/ml
Mandl units Collagenase D (Roche) and 50 U/ml DNase I
(Roche) at 37uC for 30 min. Lymphocytes were enriched by
separation on a 30%/70% Percoll gradient.
Flow cytometry
Single-cell suspensions were washed in FACS buffer (PBS, 3%
FCS, 1 mg/L NaN
3
), and the cell pellets were incubated for
10 min on ice with anti-CD16/CD32 monoclonal antibodies
(UCSF Antibody Core Facility). Cells were incubated for 30 min
on ice with antibodies to surface markers. As necessary, cells were
washed and stained with secondary antibodies for an additional
IL-17A-Producing Cells In Vivo
PLoS ONE | www.plosone.org 10 June 2012 | Volume 7 | Issue 6 | e39750
Page 10
20 min on ice. Live cells were gated using DAPI exclusion. For
intracellular cytokine staining, cells were stained for surface
markers, fixed in 2% formaldehyde in PBS for 20 min at room
temperature, washed and permeabilized in FACS buffer plus 0.5%
saponin. Cells were stained at room temperature for 30 min in
buffer containing 0.5% saponin buffer and 25% FCS. Dead cells
were excluded using a violet live/dead fixable stain (Invitrogen).
Antibodies were as designated and included: CD4 (BD,
eBioscience), CD8 (BD, Biolegend), cd (eBioscience), CD3e
(eBioscience), CD11b (BD, Biolegend), CD19 (Biolegend), Gr1
(BD), CD11c (BD), Thy1.2 (eBioscience), Sca-1 (BD), IL-17A (BD,
eBioscience), hNGFR (LabVision), Streptavidin-PE (Invitrogen),
Streptavidin-APC (Biolegend). PBS-157-loaded CD1d tetramer
was obtained from the NIH Tetramer Core Facility. Cell counts
were performed using Count-Bright absolute counting beads
(Invitrogen). Samples were acquired on a LSRII flow cytometer
(BD Biosciences) and analyzed using FlowJo software (Tree Star).
Quantitative PCR
Whole lungs were homogenized and RNA was isolated using
RNAzol (Molecular Research Center, Inc.). cDNA was prepared
using the SuperScript III First Strand Synthesis System (Invitro-
gen). Primer sequences (PrimerBank) where designated were as
follows: IL-1b: GAAATGCCACCTTTTGACAGTG,
CTGGATGCTCTCATCAGGACA; IL-23p19: CAG-
CAGCTCTCTCGGAATCTC, GCATGTGCGTTC-
CAGGCTA. Transcripts were quantified by incorporation of
SYBR Green (Invitrogen) on a StepOne Plus Real-Time PCR
System (Applied Biosystems) and quantified relative to the
expression of GAPDH (glyceraldehyde 3-phosphate dehydroge-
nase).
Supporting Information
Figure S1 Polarization of Smart-17A CD4 T cells in
vitro. (A) CD4
+
T cells were isolated from Smart-17A mice using
MACS beads and polarized under Th0, Th1, Th2 or Th17
conditions for 4 days, at which point surface hNGFR expression
was assayed by flow cytometry. This experiment was repeated 3
times and representative flow cytometry plots are shown. (B) CD4
+
T cells from wild-type or Smart-17A mice were polarized under
Th17 conditions for 4 days. Cells were restimulated with PMA and
ionomycin and then washed and re-plated in wells containing no
cytokines. The percentage of hNGFR
+
cells were measured at
indicated time points to determine the rate of decay of the hNGFR
reporter. A representative graph is shown from two comparable
experiments.
(TIF)
Figure S2 Gating of CD3e
+
cell populations. Flow
cytometry gating schemes for CD3e
+
cells used throughout this
study. (A) Gating scheme for CD4
+
T cells, cd T cells, iNKT cells
and other CD3e
+
cells. (B) Gating scheme for CD8
+
T cells. Plots
shown are from the mesenteric lymph node of a naı
¨
ve Smart-17A
mouse.
(TIF)
Figure S3 IL-17A expression in CD3e
2
cell populations.
Cells were isolated from the indicated organs of Smart-17A/
RORct dual reporter mice and assayed for GFP and surface
hNGFR expression. Dendritic cells were defined as CD11c
+
,
macrophages as CD11b
+
, neutrophils as CD11b
+
and Gr1
+
, and
innate lymphoid cells as lineage-negative (negative for CD3e,
CD8, CD19, CD11b, Gr1) and Thy1
+
. The gated innate
lymphoid cells included cells that were positive and negative for
both CD4 and Sca-1. hNGFR expression was not seen using any
gating scheme. All gates were drawn using a wild-type mouse as a
control. The experiment was repeated twice and representative
plots are shown.
(TIF)
Acknowledgments
We thank B. Fife and S. Bailey-Bucktrout for assistance with EAE
experiments, J. Bando for help with isolation of lamina propria cells, L.
Cheng for help with isolation of skin cells, and N. Flores-Wilson for support
of the mouse colony. We thank the NIH Tetramer Core Facility for
providing the CD1d tetramer reagent.
Author Contributions
Conceived and designed the experiments: AEP RLR RML. Performed the
experiments: AEP. Analyzed the data: AEP. Contributed reagents/
materials/analysis tools: RLR HEL. Wrote the paper: AEP RML.
References
1. Iwakura Y, Nakae S, Saijo S, Ishigame H (2008) The roles of IL-17A in
inflammatory immune responses and host defense against pathogens. Immunol
Rev 226: 57–79.
2. Puel A, Cypowyj S, Bustamante J, Wright JF, Liu L, et al. (2011) Chronic
mucocutaneous candidiasis in humans with inborn errors of interleukin-17
immunity. Science 332: 65–68.
3. Kisand K, Boe Wolff AS, Podkrajsek KT, Tserel L, Link M, et al. (2010)
Chronic mucocutaneous candidiasis in APECED or thymoma patients
correlates with autoimmunity to Th17-associated cytokines. J Exp Med 207:
299–308.
4. Milner JD, Brenchley JM, Laurence A, Freeman AF, Hill BJ, et al. (2008)
Impaired T(H)17 cell differentiation in subjects with autosomal dominant hyper-
IgE syndrome. Nature 452: 773–776.
5. Martin B, Hirota K, Cua DJ, Stockinger B, Veldhoen M (2009) Interleukin-17-
producing gammadelta T cells selectively expand in response to pathogen
products and environmental signals. Immunity 31: 321–330.
6. Ghoreschi K, Laurence A, Yang XP, Tato CM, McGeachy MJ, et al. (2010)
Generation of pathogenic T(H)17 cells in the absence of TGF-beta signalling.
Nature 467: 967–971.
7. Sutton CE, Lalor SJ, Sweeney CM, Brereton CF, Lavelle EC, et al. (2009)
Interleukin-1 and IL-23 induce innate IL-17 production from gammadelta T
cells, amplifying Th17 responses and autoimmunity. Immunity 31: 331–341.
8. Doisne JM, Soulard V, Becourt C, Amniai L, Henrot P, et al. (2011) Cutting
edge: crucial role of IL-1 and IL-23 in the innate IL-17 response of peripheral
lymph node NK1.1- invariant NKT cells to bacteria. J Immunol 186: 662–666.
9. Duerr RH, Taylor KD, Brant SR, Rioux JD, Silverberg MS, et al. (2006) A
genome-wide association study identifies IL23R as an inflammatory bowel
disease gene. Science 314: 1461–1463.
10. Cua DJ, Tato CM (2010) Innate IL-17-producing cells: the sentinels of the
immune system. Nat Rev Immunol 10: 479–489.
11. Lee YK, Turner H, Maynard CL, Oliver JR, Chen D, et al. (2009) Late
developmental plasticity in the T helper 17 lineage. Immunity 30: 92–107.
12. Croxford AL, Kurschus FC, Waisman A (2009) Cutting edge: an IL-17F-
CreEYFP reporter mouse allows fate mapping of Th17 cells. J Immunol 182:
1237–1241.
13. Chang SH, Dong C (2009) IL-17F: regulation, signaling and function in
inflammation. Cytokine 46: 7–11.
14. Hirota K, Duarte JH, Veldhoen M, Hornsby E, Li Y, et al. (2011) Fate mapping
of IL-17-producing T cells in inflammatory responses. Nat Immunol 12: 255–
263.
15. Esplugues E, Huber S, Gagliani N, Hauser AE, Town T, et al. (2011) Control of
TH17 cells occurs in the small intestine. Nature 475: 514–518.
16. Bending D, De la Pena H, Veldhoen M, Phillips JM, Uyttenhove C, et al. (2009)
Highly purified Th17 cells from BDC2.5NOD mice convert into Th1-like cells
in NOD/SCID recipient mice. J Clin Invest 119: 565–572.
17. Martin-Orozco N, Chung Y, Chang SH, Wang YH, Dong C (2009) Th17 cells
promote pancreatic inflammation but only induce diabetes efficiently in
lymphopenic hosts after conversion into Th1 cells. Eur J Immunol 39: 216–224.
18. Eberl G, Marmon S, Sunshine MJ, Rennert PD, Choi Y, et al. (2004) An
essential function for the nuclear receptor RORgamma(t) in the generation of
fetal lymphoid tissue inducer cells. Nat Immunol 5: 64–73.
IL-17A-Producing Cells In Vivo
PLoS ONE | www.plosone.org 11 June 2012 | Volume 7 | Issue 6 | e39750
Page 11
19. Ivanov Il, McKenzie BS, Zhou L, Tadokoro CE, Lepelley A, et al. (2006) The
orphan nuclear receptor RORgammat directs the differentiation program of
proinflammatory IL-17+ T helper cells. Cell 126: 1121–1133.
20. Buonocore S, Ahern PP, Uhlig HH, Ivanov Il, Littman DR, et al. (2010) Innate
lymphoid cells drive interleukin-23-dependent innate intestinal pathology.
Nature 464: 1371–1375.
21. Ye P, Garvey PB, Zhang P, Nelson S, Bagby G, et al. (2001) Interleukin-17 and
lung host defense against Klebsiella pneumoniae infection. Am J Respir Cell Mol
Biol 25: 335–340.
22. Ye P, Rodriguez FH, Kanaly S, Stocking KL, Schurr J, et al. (2001)
Requirement of interleukin 17 receptor signaling for lung CXC chemokine
and granulocyte colony-stimulating factor expression, neutrophil recruitment,
and host defense. J Exp Med 194: 519–527.
23. Happel KI, Dubin PJ, Zheng M, Ghilardi N, Lockhart C, et al. (2005) Divergent
roles of IL-23 and IL-12 in host defense against Klebsiella pneumoniae. J Exp
Med 202: 761–769.
24. Aujla SJ, Chan YR, Zheng M, Fei M, Askew DJ, et al. (2008) IL-22 mediates
mucosal host defense against Gram-negative bacterial pneumonia. Nat Med 14:
275–281.
25. Komiyama Y, Nakae S, Matsuki T, Nambu A, Ishigame H, et al. (2006) IL-17
plays an important role in the development of experimental autoimmune
encephalomyelitis. J Immunol 177: 566–573.
26. Cua DJ, Sherlock J, Chen Y, Murphy CA, Joyce B, et al. (2003) Interleukin-23
rather than interleukin-12 is the critical cytokine for autoimmune inflammation
of the brain. Nature 421: 744–748.
27. Moore TA, Perry ML, Getsoian AG, Newstead MW, Standiford TJ (2002)
Divergent role of gamma interferon in a murine model of pulmonary versus
systemic Klebsiella pneumoniae infection. Infect Immun 70: 6310–6318.
28. Ferber IA, Brocke S, Taylor-Edwards C, Ridgway W, Dinisco C, et al. (1996)
Mice with a disrupted IFN-gamma gene are susceptible to the induction of
experimental autoimmune encephalomyelitis (EAE). J Immunol 156: 5–7.
29. Becher B, Durell BG, Noelle RJ (2002) Experimental autoimmune encephalitis
and inflammation in the absence of interleukin-12. J Clin Invest 110: 493–497.
30. Willenborg DO, Fordham S, Bernard CC, Cowden WB, Ramshaw IA (1996)
IFN-gamma plays a critical down-regulatory role in the induction and effector
phase of myelin oligodendrocyte glycoprotein-induced autoimmune encephalo-
myelitis. J Immunol 157: 3223–3227.
31. Bettelli E, Sullivan B, Szabo SJ, Sobel RA, Glimcher LH, et al. (2004) Loss of T-
bet, but not STAT1, prevents the development of experimental autoimmune
encephalomyelitis. J Exp Med 200: 79–87.
32. Jager A, Dardalhon V, Sobel RA, Bettelli E, Kuchroo VK (2009) Th1, Th17,
and Th9 effector cells induce experimental autoimmune encephalomyelitis with
different pathological phenotypes. J Immunol 183: 7169–7177.
33. Zhou L, Chong MM, Littman DR (2009) Plasticity of CD4+ T cell lineage
differentiation. Immunity 30: 646–655.
34. Reinhardt RL, Liang HE, Locksley RM (2009) Cytokine-secreting follicular T
cells shape the antibody repertoire. Nat Immunol 10: 385–393.
35. Ivanov Il, Atarashi K, Manel N, Brodie EL, Shima T, et al. (2009) Induction of
intestinal Th17 cells by segmented filamentous bacteria. Cell 139: 485–498.
36. Lochner M, Peduto L, Cherrier M, Sawa S, Langa F, et al. (2008) In vivo
equilibrium of proinflammatory IL-17+ and regulatory IL-10+ Foxp3+
RORgamma t+ T cells. J Exp Med 205: 1381–1393.
37. Sumaria N, Roediger B, Ng LG, Qin J, Pinto R, et al. (2011) Cutaneous
immunosurveillance by self-renewing dermal gammadelta T cells. J Exp Med
208: 505–518.
38. Gray EE, Suzuki K, Cyster JG (2011) Cutting edge: Identification of a motile IL-
17-producing gammadelta T cell population in the dermis. J Immunol 186:
6091–6095.
39. Cai Y, Shen X, Ding C, Qi C, Li K, et al. (2011) Pivotal Role of Dermal IL-17-
Producing gammadelta T Cells in Skin Inflammation. Immunity 35: 596–610.
40. Sanos SL, Bui VL, Mortha A, Oberle K, Heners C, et al. (2009) RORgammat
and commensal microflora are required for the differentiation of mucosal
interleukin 22-producing NKp46+ cells. Nat Immunol 10: 83–91.
41. Satoh-Takayama N, Vosshenrich CA, Lesjean-Pottier S, Sawa S, Lochner M, et
al. (2008) Microbial flora drives interleukin 22 production in intestinal NKp46+
cells that provide innate mucosal immune defense. Immunity 29: 958–970.
42. Mangan PR, Harrington LE, O’Quinn DB, Helms WS, Bullard DC, et al.
(2006) Transforming growth factor-beta induces development of the T(H)17
lineage. Nature 441: 231–234.
43. Woolard MD, Hensley LL, Kawula TH, Frelinger JA (2008) Respiratory
Francisella tularensis live vaccine strain infection induces Th17 cells and
prostaglandin E2, which inhibits generation of gamma interferon-positive T
cells. Infect Immun 76: 2651–2659.
44. Zhang Z, Clarke TB, Weiser JN (2009) Cellular effectors mediating Th17-
dependent clearance of pneumococcal colonization in mice. J Clin Invest 119:
1899–1909.
45. LeibundGut-Landmann S, Gross O, Robinson MJ, Osorio F, Slack EC, et al.
(2007) Syk- and CARD9-dependent coupling of innate immunity to the
induction of T helper cells that produce interleukin 17. Nat Immunol 8: 630–
638.
46. Moore TA, Moore BB, Newstead MW, Standiford TJ (2000) Gamma delta-T
cells are critical for survival and early proinflammatory cytokine gene expression
during murine Klebsiella pneumonia. J Immunol 165: 2643–2650.
47. Lockhart E, Green AM, Flynn JL (2006) IL-17 production is dominated by
gammadelta T cells rather than CD4 T cells during Mycobacterium tuberculosis
infection. J Immunol 177: 4662–4669.
48. Shibata K, Yamada H, Hara H, Kishihara K, Yoshikai Y (2007) Resident
Vdelta1+ gammadelta T cells control early infiltration of neutrophils after
Escherichia coli infection via IL-17 production. J Immunol 178: 4466–4472.
49. Kurschus FC, Croxford AL, Heinen AP, Wortge S, Ielo D, et al. (2010) Genetic
proof for the transient nature of the Th17 phenotype. Eur J Immunol 40: 3336–
3346.
50. El-Behi M, Ciric B, Dai H, Yan Y, Cullimore M, et al. (2011) The
encephalitogenicity of T(H)17 cells is dependent on IL-1- and IL-23-induced
production of the cytokine GM-CSF. Nat Immunol 12: 568–575.
51. Codarri L, Gyulveszi G, Tosevski V, Hesske L, Fontana A, et al. (2011)
RORgammat drives production of the cytokine GM-CSF in helper T cells,
which is essential for the effector phase of autoimmune neuroinflammation. Nat
Immunol 12: 560–567.
52. Harrington LE, Hatton RD, Mangan PR, Turner H, Murphy TL, et al. (2005)
Interleukin 17-producing CD4+ effector T cells develop via a lineage distinct
from the T helper type 1 and 2 lineages. Nat Immunol 6: 1123–1132.
53. Park H, Li Z, Yang XO, Chang SH, Nurieva R, et al. (2005) A distinct lineage of
CD4 T cells regulates tissue inflammation by producing interleukin 17. Nat
Immunol 6: 1133–1141.
54. Toh ML, Kawashima M, Zrioual S, Hot A, Miossec P (2009) IL-17 inhibits
human Th1 differentiation through IL-12R beta 2 downregulation. Cytokine 48:
226–230.
55. Jensen KD, Su X, Shin S, Li L, Youssef S, et al. (2008) Thymic selection
determines gammadelta T cell effector fate: antigen-naive cells make interleukin-
17 and antigen-experienced cells make interferon gamma. Immunity 29: 90–
100.
56. O’Gorman S, Dagenais NA, Qian M, Marchuk Y (1997) Protamine-Cre
recombinase transgenes efficiently recombine target sequences in the male germ
line of mice, but not in embryonic stem cells. Proc Natl Acad Sci U S A 94:
14602–14607.
IL-17A-Producing Cells In Vivo
PLoS ONE | www.plosone.org 12 June 2012 | Volume 7 | Issue 6 | e39750
Page 12
  • Source
    • "The evidence that IL-17A-containing mast cells and neutrophils actively produce IL-17A is scarce [22] and in contradiction with murine data [37][38][39][40][41]. To address this discrepancy, we first investigated the capacity of primary human tissue mast cells to produce IL-17 family cytokines de novo. "
    [Show abstract] [Hide abstract] ABSTRACT: IL-17A, a major proinflammatory cytokine, can be produced by a variety of leukocytes, but its exact cellular source in human inflammatory diseases remains incompletely understood. IL-17A protein is abundantly found in mast cells in human tissues, such as inflamed synovium, but surprisingly, mechanistic murine studies failed to demonstrate IL-17A production by mast cells. Here, we demonstrate that primary human tissue mast cells do not produce IL-17A themselves but actively capture exogenous IL-17A through receptor-mediated endocytosis. The exogenous IL-17A is stored in intracellular granules and can subsequently be released in a bioactive form. This novel mechanism confers to mast cells the capacity to steer IL-17A-mediated tissue inflammation by the rapid release of preformed cytokine.
    Preview · Article · Mar 2016 · Journal of Leukocyte Biology
  • Source
    • "Early IL-17A production by these innate cells provides an initial response to pathogens to recruit neutrophils within 4–8 hours after infection. In the lung, γδT cells have been demonstrated to be the major source of early IL-17A production in response to some infections, such as K. pneumonia [178], M. tuberculosis [15, 179], and Mycobacterium bovis [180]. In the M. bovis-infected mouse model, the IL-17A secretion by γδT cells is essential for mature granuloma formation and resolution of infection [180]. "
    [Show abstract] [Hide abstract] ABSTRACT: The significance of Th17 cells and interleukin- (IL-)17A signaling in host defense and disease development has been demonstrated in various infection and autoimmune models. Numerous studies have indicated that Th17 cells and its signature cytokine IL-17A are critical to the airway's immune response against various bacteria and fungal infection. Cytokines such as IL-23, which are involved in Th17 differentiation, play a critical role in controlling Klebsiella pneumonia (K. pneumonia) infection. IL-17A acts on nonimmune cells in infected tissues to strengthen innate immunity by inducing the expression of antimicrobial proteins, cytokines, and chemokines. Mice deficient in IL-17 receptor (IL-17R) expression are susceptible to infection by various pathogens. In this review, we summarize the recent advances in unraveling the mechanism behind Th17 cell differentiation, IL-17A/IL-17R signaling, and also the importance of IL-17A in pulmonary infection.
    Full-text · Article · Jul 2013 · Clinical and Developmental Immunology
  • [Show abstract] [Hide abstract] ABSTRACT: γδ T cells are the major initial interleukin (IL)-17 producers in acute infections. Recent studies have indicated that some γδ T cells have IL-17-producing capabilities without explicit induction of an immune response. They are preferentially localized in barrier tissues and are likely to originate from fetal γδ thymocytes. In addition, γδ T cells present in the secondary lymphoid organs will mature and differentiate to produce IL-17 after antigen encounter in an immune response. Based on these studies, we propose that there are two different sets of IL-17-producing γδ T cells (Tγδ17) referred to as the 'natural' and the 'inducible' Tγδ17 cells. This review focuses on recent publications leading to the delineation of these two types of cells and their implied roles in host immune defense.
    No preview · Article · Dec 2012 · Trends in Immunology
Show more