Article
To read the full-text of this research, you can request a copy directly from the authors.

Abstract

In view of the amount of adaptive radiation among ovenbirds, Furnariinae, the traditional taxonomy needs scrutiny. We used nuclear DNA data to study relationships of the genus Upucerthia. Five species belong in the Furnariini, as traditionally assumed. The other species represent two independent cases of specialisation for terrestrial life, in response to formation of arid habitats in the southern Andes, within the paraphyletic assemblage of arboreal species referred to as Philydorini. © 2007 The Authors. Journal compilation

No full-text available

Request Full-text Paper PDF

To read the full-text of this research,
you can request a copy directly from the authors.

... As such, the ovenbird-woodcreeper assemblage shares adaptive features across the entire passerine radiation; 1) the ecomorphological variation in Furnariidae encompasses phenotypes that closely matches those of creepers, warblers, wheatears, thrashers, thrushes, bulbuls, dippers, jays, starlings, etc. [6,7], 2) members of Furnariidae have successfully colonized a wide variety of habitats, from the treeless grasslands in the Andes, through humid forests, savanna, and desert, to the coastal shoreline, 3) the variation in nest construction in the family approaches that found across the entire order of passerines [8,9]. Due to this great variation it is not surprising that recent molecular studies1011121314151617 have revealed several examples of convergent evolution and that the phylogenetic relationships among ovenbirds and woodcreepers are much more complex than suggested in traditional linear classifications. Among the examples of convergent evolution are the earthcreepers (Upucerthia sensu lato) that despite a similar external morphology represent several independent adaptations to terrestrial life in open country [14,17], and the parallel adaptation of Limnoctites, Spartonoica and Limnornis/Phleocryptes lineages to a marsh-dwelling life-style [15]. ...
... Due to this great variation it is not surprising that recent molecular studies1011121314151617 have revealed several examples of convergent evolution and that the phylogenetic relationships among ovenbirds and woodcreepers are much more complex than suggested in traditional linear classifications. Among the examples of convergent evolution are the earthcreepers (Upucerthia sensu lato) that despite a similar external morphology represent several independent adaptations to terrestrial life in open country [14,17], and the parallel adaptation of Limnoctites, Spartonoica and Limnornis/Phleocryptes lineages to a marsh-dwelling life-style [15]. It is apparent that members of the traditional three ovenbird subfamilies share a functional morphology rather than a close ancestry. ...
... The 105 ingroup species in this study represent more than one third of all species in Furnariidae recognized by Rem- sen [7]. The species selected cover all major radiations of ovenbirds and woodcreepers as suggested by recent molecular studies101112131416,17]. We have also included several taxa whose affinities have been difficult to establish by morphology and that had not been included in previous molecular studies, and we have sampled certain genera whose monophyly have been contested more densely [7]. ...
Article
Full-text available
The Neotropical ovenbird-woodcreeper family (Furnariidae) is an avian group characterized by exceptionally diverse ecomorphological adaptations. For instance, members of the family are known to construct nests of a remarkable variety. This offers a unique opportunity to examine whether changes in nest design, accompanied by expansions into new habitats, facilitates diversification. We present a multi-gene phylogeny and age estimates for the ovenbird-woodcreeper family and use these results to estimate the degree of convergent evolution in both phenotype and habitat utilisation. Furthermore, we discuss whether variation in species richness among ovenbird clades could be explained by differences in clade-specific diversification rates, and whether these rates differ among lineages with different nesting habits. In addition, the systematic positions of some enigmatic ovenbird taxa and the postulated monophyly of some species-rich genera are evaluated. The phylogenetic results reveal new examples of convergent evolution and show that ovenbirds have independently colonized open habitats at least six times. The calculated age estimates suggest that the ovenbird-woodcreeper family started to diverge at ca 33 Mya, and that the timing of habitat shifts into open environments may be correlated with the aridification of South America during the last 15 My. The results also show that observed large differences in species richness among clades can be explained by a substantial variation in net diversification rates. The synallaxines, which generally are adapted to dry habitats and build exposed vegetative nests, had the highest diversification rate of all major furnariid clades. Several key features may have played an important role for the radiation and evolution of convergent phenotypes in the ovenbird-woodcreeper family. Our results suggest that changes in nest building strategy and adaptation to novel habitats may have played an important role in a diversification that included multiple radiations into more open and bushy environments. The synallaxines were found to have had a particularly high diversification rate, which may be explained by their ability to build exposed vegetative nests and thus to expand into a variety of novel habitats that emerged during a period of cooling and aridification in South America.
... The avian genus Upucerthia was until recently considered to consist of nine species (Sibley and Monroe 1990, Dickinson 2003, Remsen 2003 of mainly terrestrial ovenbirds, commonly known as earthcreepers. Recent molecular studies of the genus , Fjeldså et al. 2007) indicated that Upucerthia, as traditionally constituted, was highly polyphyletic, its nine species apparently belonging to four distinct lineages. Four species of Upucerthiaalbigula, jelskii, validirostris, and the name-bearing species dumetaria -formed a well-supported clade sister to Cinclodes , Fjeldså et al. 2007. ...
... Recent molecular studies of the genus , Fjeldså et al. 2007) indicated that Upucerthia, as traditionally constituted, was highly polyphyletic, its nine species apparently belonging to four distinct lineages. Four species of Upucerthiaalbigula, jelskii, validirostris, and the name-bearing species dumetaria -formed a well-supported clade sister to Cinclodes , Fjeldså et al. 2007. Of the five other species of Upucerthia, U. andaecola and U. ruficaudus formed a clade with Eremobius phoenicurus and Chilia melanura, all of which were subsequently transferred to the genus Ochetorhynchus , Fjeldså et al. 2007. ...
... Four species of Upucerthiaalbigula, jelskii, validirostris, and the name-bearing species dumetaria -formed a well-supported clade sister to Cinclodes , Fjeldså et al. 2007. Of the five other species of Upucerthia, U. andaecola and U. ruficaudus formed a clade with Eremobius phoenicurus and Chilia melanura, all of which were subsequently transferred to the genus Ochetorhynchus , Fjeldså et al. 2007. Upucerthia harterti and U. certhioides formed a distinct clade and were placed in the newly erected genus Tarphonomus (Chesser and Brumfield 2007). ...
Article
Full-text available
Chesser, Terry, Claramunt, Santiago, Derryberry, Elizabeth, Brumfield, Robb T. (2009): Geocerthia, a new genus of terrestrial ovenbird (Aves: Passeriformes: Furnariidae). Zootaxa 2213: 64-68, DOI: 10.5281/zenodo.189906
... Recognition of non-monophyletic groups is an expected outcome of this approach. Not surprisingly, therefore, recent molecular phylogenetic analyses have revealed that several traditional genera of tracheophone suboscines are non-monophyletic assemblages of species (Aleixo, 2002;Irestedt et al., 2004Irestedt et al., , 2006Fjeldså et al., 2007;Brumfield and Edwards, 2007). Consequently, new generic names have been proposed or revalidated (e.g., Isler et al., 2006;Aleixo et al., 2007) and others need to be erected or recognized, especially to accomodate taxa in highly polyphyletic genera (see Irestedt et al., 2004;Fjeldså et al., 2007;. ...
... Not surprisingly, therefore, recent molecular phylogenetic analyses have revealed that several traditional genera of tracheophone suboscines are non-monophyletic assemblages of species (Aleixo, 2002;Irestedt et al., 2004Irestedt et al., , 2006Fjeldså et al., 2007;Brumfield and Edwards, 2007). Consequently, new generic names have been proposed or revalidated (e.g., Isler et al., 2006;Aleixo et al., 2007) and others need to be erected or recognized, especially to accomodate taxa in highly polyphyletic genera (see Irestedt et al., 2004;Fjeldså et al., 2007;. We think that this ''splitting" approach is preferable to the recognition of highly inclusive and confusingly heterogeneous genera in the sense that it more accurately reflects the complex evolutionary pathways of relatively old lineages of Neotropical birds. ...
... The superficial similarity between taxa that led former avian systematists to recognize polyphyletic genera within Furnarii may be explained by the convergence of some character suites (e.g., color patterns, size and general body proportions) resulting from adaptations to similar life styles (Fjeldså et al., 2007; see also . However, the close external similarity between Scytalopus (and also Myornis and Eugralla) and Eleoscytalopus may instead represent a case of evolutionary conservatism rather than convergent evolution of some general features (e.g., size and proportions) that characterize all taxa within these genera. ...
Article
Full-text available
The genus Scytalopus is a species-rich and taxonomically complicated component of the Neotropical avian family Rhinocryptidae. Probably because Scytalopus is a superficially uniform assemblage, its monophyly has not been seriously questioned. We investigated phylogenetic relationships of a representative set of species in the genus using nuclear and mitochondrial DNA sequences as well as anatomical data, and provided the first test of its presumed monophyly by including in the analyses its hypothesized closest relatives (the genera Myornis, Eugralla, and Merulaxis) as well as most rhinocryptid genera. We found strong support for the paraphyly of the genus Scytalopus, with the Scytalopus indigoticus species-group forming a clade with Merulaxis. A well-supported clade including the genera Eugralla, Myornis, and the remaining Scytalopus was also recovered. Because these results were recovered independently and with strong support using mitochondrial and nuclear data, and were entirely consistent with anatomical data, we erect a new genus for the S.indigoticus species-group. These findings illustrate the importance of formally testing hypotheses of monophyly even for well-accepted groups of Neotropical birds.
... The avian genus Upucerthia was until recently considered to consist of nine species (Sibley and Monroe 1990, Dickinson 2003, Remsen 2003 of mainly terrestrial ovenbirds, commonly known as earthcreepers. Recent molecular studies of the genus , Fjeldså et al. 2007) indicated that Upucerthia, as traditionally constituted, was highly polyphyletic, its nine species apparently belonging to four distinct lineages. Four species of Upucerthiaalbigula, jelskii, validirostris, and the name-bearing species dumetaria -formed a well-supported clade sister to Cinclodes , Fjeldså et al. 2007. ...
... Recent molecular studies of the genus , Fjeldså et al. 2007) indicated that Upucerthia, as traditionally constituted, was highly polyphyletic, its nine species apparently belonging to four distinct lineages. Four species of Upucerthiaalbigula, jelskii, validirostris, and the name-bearing species dumetaria -formed a well-supported clade sister to Cinclodes , Fjeldså et al. 2007. Of the five other species of Upucerthia, U. andaecola and U. ruficaudus formed a clade with Eremobius phoenicurus and Chilia melanura, all of which were subsequently transferred to the genus Ochetorhynchus , Fjeldså et al. 2007. ...
... Four species of Upucerthiaalbigula, jelskii, validirostris, and the name-bearing species dumetaria -formed a well-supported clade sister to Cinclodes , Fjeldså et al. 2007. Of the five other species of Upucerthia, U. andaecola and U. ruficaudus formed a clade with Eremobius phoenicurus and Chilia melanura, all of which were subsequently transferred to the genus Ochetorhynchus , Fjeldså et al. 2007. Upucerthia harterti and U. certhioides formed a distinct clade and were placed in the newly erected genus Tarphonomus (Chesser and Brumfield 2007). ...
Article
The avian genus Upucerthia was until recently considered to consist of nine species (Sibley and Monroe 1990, Dickinson 2003, Remsen 2003) of mainly terrestrial ovenbirds, commonly known as earthcreepers. Recent molecular studies of the genus (Chesser et al. 2007, Fjeldså et al. 2007) indicated that Upucerthia, as traditionally constituted, was highly polyphyletic, its nine species apparently belonging to four distinct lineages. Four species of Upucerthia – albigula, jelskii, validirostris, and the name-bearing species dumetaria – formed a well-supported clade sister to Cinclodes (Chesser et al. 2007, Fjeldså et al. 2007). Of the five other species of Upucerthia, U. andaecola and U. ruficaudus formed a clade with Eremobius phoenicurus and Chilia melanura, all of which were subsequently transferred to the genus Ochetorhynchus (Chesser et al. 2007, Fjeldså et al. 2007). Upucerthia harterti and U. certhioides formed a distinct clade and were placed in the newly erected genus Tarphonomus (Chesser and Brumfield 2007). The position of the final species, U. serrana, was not well resolved, although it appeared to form part of a clade including the genera Cinclodes and Upucerthia sensu stricto (Chesser et al. 2007, Fjeldså et al. 2007).
... These two species differ both in morphology and vocal behavior (Areta 2007), but the phylogenetic relationship of P. tatei to Roraimia has yet to be evaluated with molecular data. Given the increase of information showing that plumage pattern is not a reliable source of phylogenetic information in furnariids, a molecular study seems warranted (Irestedt et al. 2006, Fjeldså et al. 2007, Chesser et al. 2007, Moyle et al. 2009). Here, we use mitochondrial and nuclear DNA sequences to assess both the taxonomic status and phylogenetic relationships of P. tatei. ...
... Our study supports a sister relationship between Premnoplex and Margarornis. Such a relationship has been suggested by previous molecular studies, though the support varied with the gene region used (Irestedt et al. 2006, Fjeldså et al. 2007, Moyle et al. 2009). Our combined analysis of the nuclear and mitochondrial genes supports the relationship strongly, the nuclear data more so than the mitochondrial data (76 vs 64% bootstrap, 1.00 vs. 0.86 posterior probabilities). ...
Article
Full-text available
The White-throated Barbtail, Premnoplex tatei, is a poorly known furnariid endemic to the northeastern mountain ranges of Venezuela. Although currently considered a distinct species, it has often been treated as a subspecies of its widespread congener, the Spotted Barbtail, P. brunnescens. Here we use mitochondrial and nuclear DNA sequences to assess the taxonomic status of P. tatei and its phylogenetic relationships. We found P. tatei to be the sister species of P. brunnescens, but the genetic divergence between the two species is large in comparison to that within other genera of the Furnariidae. This result is consistent with the plumage, vocal, and ecological differences used to support the recognition of P. tatei as a distinct species. Our results also corroborate previous studies in finding Premnoplex and Margarornis as sister genera. A close relationship between P. tatei and Roraimia adusta, a scenario hypothesized from the systematic affinities of taxa distributed in the northeastern mountain region of Venezuela and the Pantepui region, was not supported by this study.
... The topology obtained in this study conforms to accepted knowledge about the infraorder Furnariides based on nuclear and mitochondrial DNA [13,[27][28][29]. Regarding Aphrastura, the phylogenetic position of the genus has adopted different phylogenetic positions within the Furnariidae depending on the marker and taxa analyzed. ...
... Based on a molecular clock for the myoblogin intron 2 in passerines [29], the genus Aphrastura probably diverged from other furnariids at the Lower Miocene [12]. In this study, Bayesian molecular clock analyses show also similar ages for the split between the Synallaxinae and Furnariinae (see Appendix 3). ...
Article
Full-text available
Masafuera Rayadito (Aphrastura masafuerae; Furnariidae) is a Critically Endangered species endemic to Alejandro Selkirk Island (Juan Fernandez Archipelago, Chile). Categorized as probably extinct in 1980, later estimates, ranging from 140 (in 2002) to 500 individuals (in 2006-2007), showed a fluctuating population size of the species. The grazing of goats and cattle has increased habitat loss for the species. Other threats are lack of nesting sites, introduced species such as feral cats and rats (Rattus rattus and R. norvegicus), and increased populations of natural predators like the Masafuera Hawk. In order to increase the availability of nesting sites, 81 nest boxes were installed in different habitats in 2006, with evidence of use during subsequent breeding seasons. Despite conservation concerns, however, no genetic studies are yet available for this furnariid. This study reports for the first time the levels of genetic divergence of the species, based on nucleotide sequences of the mitochondrial DNA (cytochrome oxidase subunit 1 gene; COI). Aphrastura masafuerae is closely related to a widespread species of furnariid distributed mainly in Chile on the mainland, the Thorn-tailed Rayadito (A. spinicauda). The Masafuera Rayadito diverged from its mainland sister species probably during the Pleistocene 0.57 +/- 0.19 Myr ago. Consistent with mitochondrial and nuclear molecular clocks, the estimated time of the split between A. masafuerae and A. spinicauda is in perfect agreement with the geological origin of the Juan Fernandez Archipelago, which is of volcanic origin. In order to assess genetic variability within the population of this fragile bird, further studies using a multi-locus genetic approach at the population level are necessary.
... Primer name Gene Sequence 5 0 ? 3 0 Reference Cytb-SynR1 cytb GTATTTCATGTCTCTTTGAATAGGTA This study Cytb-SynR1b cytb GTCTCTTTGAATAGGTAAGAGCC This study Cytb-SynF2 cytb ACATCGGACGAGGCTTCTACTA This study Cytb-SynR2 cytb TGTCAACTGAAAATCCTCCTCATG This study Cytb-SynF3 cytb CCTATATCGGACAAACACTCGT This study Cytb-SynR3 cytb GAATGTCTTTGGTTGAGAAGTAAG This study Cytb-SynF4 cytb TCTCATCAAACTGCGATAAAATCC This study Cytb-SynR4 cytb TTTATTTGGAATTGATCGTAGAATGG This study Cytb-SynF5 cytb CCTGAATGATACTTCCTATTTGCAT This study Cytb-SynR5 cytb TCTACTGGTTGGCTGCCTACT This study Cytb-SynF6 cytb ATATTCTGAATCCTAGTTACAAACCTT This study L14841 cytb CCATCCAACATCTCAGCATGATGAAA Lougheed et al. (2000) H16065 cytb GTCTTCAGTTTTTGGTTTACAAGAC Lougheed et al. (2000) ND2-synR1 ND2 TAGAAAGTATTTGGTTGTGGCTTCA This study ND2-synF2 ND2 ATCCTTCCCCTAATCTCAAAACC This study ND2-synR2 ND2 AATCAGAAGTGGAATGGGACTAG This study ND2-synF3 ND2 TAACAACAGCCATTTCAATCAAACT This study ND2-synR3 ND2 TTTTCGGATTTGGGTTTGGTTTAG This study ND2-synF4 ND2 CTGCCTTAGGAGGATGAATAGG This study ND2-synR4 ND2 TTAGTGAAGGGATTTTTGTTCATGC This study ND2-synF5 ND2 ACCAAAATTCTTAAACTATCCTCAATAA This study ND2-synR5 ND2 ATCGGAGGTAGAAGAAAAGTCCT This study ND2-synF6 ND2 CAACAATCATTGCCCTCCTCTC This study Lmet ND2 TATCGGGCCCATACCCCGAAAAT Hackett (1996) H6312 ND2 CTTATTTAAGGCTTTGAAGGCC Cicero and Johnson (2001) FIB5 FIB5 CGCCATACAGAGTATACTGTGACAT Marini and Hackett (2002) FIB6 FIB5 GCCATCCTGGCGATTCTGAA Marini and Hackett (2002) FIB-FurnL FIB5 AAGGAGAGCCTGGCTCATTCCTTA Fjeldså et al. (2007) ...
... FIB-FurnH FIB5 GAAGTTGAAGGAATGCCCTGGTCT T Fjeldså et al. (2007) Myo2 myo2 GCCACCAAGCACAAGATCCC Slade et al. (1993) Myo3F myo2 TTCAGCAAGGACCTTGATAATGACTT Heslewood et al. (1998) Myo309L myo2 CATAAGACCTGTCAGTGGCTGGA Irestedt et al. (2006) Myo345H myo2 TCCTCCAGGGTTTGCTCTAAAATTGT Fjeldså et al. (2007) G3PL890 G3PDH ACCTTTAATGCGGGTGCTGGCATTGC Friesen et al. (1997) G3PH950 G3PDH CATCAAGTCCACAACACGGTTGCTGTA Friesen et al. (1997) H. Batalha-Filho et al. / Molecular Phylogenetics and Evolution 67 (2013) 86–94 89 ...
Article
The Neotropical Synallaxis ruficapilla complex is endemic to the Atlantic Forest and is comprised of three species: S. ruficapilla, S. whitneyi, and S. infuscata. This group is closely related to the Synallaxis moesta complex that occurs in the Andes, Tepuis, and Guianan shield. Here we used mitochondrial and nuclear gene sequences to infer the phylogeny and the time of diversification of the S. ruficapilla and S. moesta complexes. We also included samples of an undescribed population of Synallaxis that resembles other populations of the S. ruficapilla complex. Our results showed that different geographical lineages within the S. ruficapilla complex are reciprocally monophyletic, but the northern form (S. infuscata) grouped with an Andean taxon. This suggests that at least two lineages of this group independently colonized the Atlantic Forest. Specimens of the undescribed population formed a monophyletic clade with deep divergence. Estimated diversification dates were within the late Pliocene to Pleistocene (2.75 - 0.16 million of years ago). This suggests that at this time there was a higher connectivity between habitats in the rugged landscapes of the circum-Amazonian bioregions. The observed Pleistocene diversification within the Atlantic Forest is congruent in space and time with studies of other co-distributed organisms, and may be associated with climate changes and tectonic activity during this period.
... Coprotretis jelskii Cabanis, 1874: 98. (Cabanis, 1874). See Cory & Hellmayr (1925: 46), and also Chesser et al. (2007) and Fjeldså et al. (2007). ...
Article
Jean Cabanis, curator of ornithology at the Museum für Naturkunde, Berlin, Germany, described, in 1873–1874, 34 new species of birds on the basis of specimens collected in Peru by Konstanty Jelski, a Polish naturalist. He borrowed or purchased these specimens from Władysław Taczanowski (1819–1890), curator of zoology at the Imperial Warszawa University in Warszawa, Poland. We located and identified their types in the museums of Berlin (ZMB) and Warszawa (MIZ). Types of 21 species (28 type specimens) were deposited in the ZMB, of which types of 18 species (22 specimens) survive. The MIZ originally housed types of 14 species (19 type specimens), of which the types of only four species (4 specimens) survive. Overall, all types were lost for 12 species of Peruvian birds described by Cabanis on the basis of Jelski’s collections.
... The inference is based on the accumulated number of substitutions along branches and it does not consider any specific model of evolution. It has been used, for example, to estimate divergence times within Neoaves, which includes almost 95% of all bird species (Ericson et al., 2006), within the group of ovenbirds, Furnariinae (Fjeldså et al., 2007), and within diatoms (Sorhannus, 2007). ...
Article
This PhD thesis consists of an introduction and five papers, dealing with statistical methods in phylogenetics.A phylogenetic tree describes the evolutionary relationships among species assuming that they share a common ancestor and that evolution takes place in a tree like manner. Our aim is to reconstruct the evolutionary relationships from aligned DNA sequences.In the first two papers we investigate two measures of confidence for likelihood based methods, bootstrap frequencies with Maximum Likelihood (ML) and Bayesian posterior probabilities. We show that an earlier claimed approximate equivalence between them holds under certain conditions, but not in the current implementations of the two methods.In the following two papers the divergence times of the internal nodes are considered. The ML estimate of the divergence time of the root is improved if longer sequences are analyzed or if more taxa are added. We show that the gain in precision is faster with longer sequences than with more taxa. We also show that the algorithm of the software package PATHd8 may give biased estimates if the global molecular clock is violated. A change of the algorithm to obtain unbiased estimates is therefore suggested.The last paper deals with non-informative priors when using the Bayesian approach in phylogenetics. The term is not uniquely defined in the literature. We adopt the idea of data translated likelihoods and derive the so called Jeffreys' prior for branch lengths using Jukes Cantor model of evolution.
... The taxonomy of Neotropical birds remains largely reliant on dated morphological studies [43], but molecular data promise to expedite a newly detailed understanding of this fauna [44]. Although levels of genetic differentiation do not dictate taxonomic status [45], barcode analysis illuminates those taxa and those segments of their ranges where further research is justified. ...
Article
Full-text available
The Neotropical avifauna is more diverse than that of any other biogeographic region, but our understanding of patterns of regional divergence is limited. Critical examination of this issue is currently constrained by the limited genetic information available. This study begins to address this gap by assembling a library of mitochondrial COI sequences, or DNA barcodes, for Argentinian birds and comparing their patterns of genetic diversity to those of North American birds. Five hundred Argentinian species were examined, making this the first major examination of DNA barcodes for South American birds. Our results indicate that most southern Neotropical bird species show deep sequence divergence from their nearest-neighbour, corroborating that the high diversity of this fauna is not based on an elevated incidence of young species radiations. Although species ages appear similar in temperate North and South American avifaunas, patterns of regional divergence are more complex in the Neotropics, suggesting that the high diversity of the Neotropical avifauna has been fueled by greater opportunities for regional divergence. Deep genetic splits were observed in at least 21 species, though distribution patterns of these lineages were variable. The lack of shared polymorphisms in species, even in species with less than 0.5M years of reproductive isolation, further suggests that selective sweeps could regularly excise ancestral mitochondrial polymorphisms. These findings confirm the efficacy of species delimitation in birds via DNA barcodes, even when tested on a global scale. Further, they demonstrate how large libraries of a standardized gene region provide insight into evolutionary processes.
... Indeed, three populations now considered to belong within U. validirostris have been given formal names (validirostris Burmeister, 1861, ruf escens Nores, 1986, and dabbenei Chapman, 1919, and a similar degree of variation resulted in recognition of three subspecies within U. jelskii ( jelskii Cabanis, 1874, pallida Taczanowski, 1883, and saturata Carriker, 1933. Despite recent phylogenetic and taxonomic work on the genus Upucerthia (Chesser et al. 2007, Fjeldså et al. 2007), the question lingers as to which treatment is best: are U. validirostris and U. jelskii two good species, or are they part of a cline in a single species? ...
Article
Full-text available
The Buff-breasted Earthcreeper (Upucerthia validirostris) is endemic to western Argentina, and the Plain-breasted Earthcreeper (U. jelskii, including subspecies saturata in the north and pallida in the south), ranges from northern Peru to northwestern Argentina. They have been considered subspecies, as constituents of a superspecies, and as different species. From north to south, a morphocline, involving an increase of rustiness of the plumage and of similar to 15% in bill length, 10% in wing length, and 20% in tail length, links jelskii to validirostris. The dine linking jelskii and pallida is gradual, over similar to 1800 km; that between pallida and validirostris is steep, over similar to 80 km. The northernmost record of validirostris is from the northern Calchaquies Valley, Salta, northwestern Argentina, a valley surrounded by mountains of up to similar to 6300 m above sea level through which the lowest pass is at over 4900 m, forming a barrier between validirostris and the southernmost record of pallida to the north. The song, continuous song, duet, and call of validirostris are structurally indistinguishable from those of jelskiilpallida and from the single available recorded song of saturata. In all playback experiments, validirostris answered by approaching and vocalizing to voices of validirostris and jelskiilpallida and vice versa. Treatment of validirostris as a single species is warranted, and three subspecies can be tentatively recognized: southern validirostris (large, rufescent birds with buff bellies restricted to Argentina), central and northern jelskii (small, pale birds ranging from northwestern Argentina to central Peru), and northern saturata (small, dark, and brownish birds in northern central Peru).
Article
The infraorder Furnariides is a diverse group of suboscine passerine birds comprising a substantial component of the Neotropical avifauna. The included species encompass a broad array of morphologies and behaviours, making them appealing for evolutionary studies, but the size of the group (ca. 600 species) has limited well-sampled higher-level phylogenetic studies. Using DNA sequence data from the nuclear RAG-1 and RAG-2 exons, we undertook a phylogenetic analysis of the Furnariides sampling 124 (more than 88%) of the genera. Basal relationships among family-level taxa differed depending on phylogenetic method, but all topologies had little nodal support, mirroring the results from earlier studies in which discerning relationships at the base of the radiation was also difficult. In contrast, branch support for family-rank taxa and for many relationships within those clades was generally high. Our results support the Melanopareidae and Grallariidae as distinct from the Rhinocryptidae and Formicariidae, respectively. Within the Furnariides our data contradict some recent phylogenetic hypotheses and suggest that further study is needed to resolve these discrepancies. Of the few genera represented by multiple species, several were not monophyletic, indicating that additional systematic work remains within furnariine families and must include dense taxon sampling. We use this study as a basis for proposing a new phylogenetic classification for the group and in the process erect new family-group names for clades having high branch support across methods.
Article
Full-text available
The tapaculos (Rhinocryptidae) are tracheophone, suboscine birds restricted to South and Central America. Most tapaculos share a number of internal and external characteristics that have been used to define the family taxonomically. The genera Melanopareia and Psiloramphus do not fully fit this pattern and have caused considerable dispute among taxonomists since they were first described. In this paper we delimit the systematic boundaries of the tapaculos and assess their generic relationships by analysis of molecular sequence data. The results show that whereas Psiloramphus is nested well within the Rhinocryptidae, Melanopareia falls far outside that clade. A new family is erected for Melanopareia. Keywords Melanopareia - Psiloramphus -Rhinocryptidae-Tapaculos-Molecular systematics-Taxonomy-South America
Article
Parallelisms and paraphyletic assemblages are common among ovenbirds. Molecular markers are therefore the best approach when studying the evolutionary relationships among the members of this unparalleled diversified family. We obtained nucleotide sequence data from mitochondrial (cytochrome b) and nuclear genes (myoglobin and glyceraldehyde-3-phosphodehydrogenase) and used these to deduce the phylogenetic position of a monotypic genus endemic to the austral temperate rainforests of southern South America, the Des Murs’ Wiretail (Sylviorthorhynchus desmursii Des Murs, 1847, Aves: Furnariidae). Phylogenetic analyses based on maximum parsimony, maximum likelihood and Bayesian inference all converged into a congruent topology, with a basal position of Des Murs’ Wiretail within Synallaxinae together with Tit–Spinetails (Leptasthenura). Our data reject the hypothesis of a phylogenetic relationship between Des Murs’ Wiretail and thistletails (Schizoeaca) which exhibit parallelisms in morphology, tail structure and nest architecture. Using a molecular clock based on the myoglobin intron 2 gene, we estimated a divergence time of Des Murs’ Wiretail from Tit-Spinetails of 14–15Myr, which is associated with the appearance of sclerophyllous forest elements in Chile at the Middle–Upper Miocene.
Article
Full-text available
By combining distributions and phylogenies for large groups of birds, it is now possible to disentangle the relative roles of contemporary ecology and history in explaining the distribution of biodiversity on earth. In South America, avian lineages, which represent radiations during the warm parts of the Tertiary, are best represented in the tropical lowlands and Andean forelands. During the upper Tertiary, diversification was most intense in the tropical Andes region, with recruitment back into the tropical lowlands and into South America's open biomes. Within the tropical Andes, endemism (mean inverse range size) and mean branch length (number of phylogenetic nodes on lineages) increase from the foothills up to the tree line and then decline again in the barren highlands, suggesting that the tree-line zone plays a special role in the diversification process. The resulting endemism is locally aggregated, often with marked peaks in areas immediately adjacent to ancient population centers. Thus, the process of evolution of new species is linked with local factors that, over a shorter time perspective, were also favorable for people. If we want to maintain the process of diversification, it becomes essential to supplement the traditional approach of preserving biodiversity in wilderness areas with few people with efforts to support sustainable development in populated areas.
Article
Full-text available
Upucerthia saturatior es un furnárido bien diferenciado que habita los bosques patagónicos del centro-oeste de Argentina y Chile, dentro del área de endemismo de Nothofagus. Inicialmente descripta como una especie distinta en 1900, U. saturatior fue rápidamente incluida dentro de U. dumetaria sin una explicación o estudio que lo avalaran; este tratamiento ha sido seguido por la mayoría de los autores posteriores. Basados en la variación geográfca aparentemente clinal de U. dumetaria y en un re-análisis de la morfología y plumaje de individuos que se suponía representaban gradación entre U. dumetaria y U. saturatior, concluimos que no hay evidencia de gradación entre estos taxones. Upucerthia saturatior difiere de U. dumetaria en canto (“p-p-tirik-tirik-tirik-tirik-tirik-tiruk” vs. “pli-pli-pli-pli-pli . . .”) y llamados (“pep” vs. “kiip”), morfología (más pequeña y oscura, con pico negro y corto vs. más grande y pálida, con pico largo y marrón) y patrón de la cola, hábitat reproductivo (bordes de bosque vs. estepa arbustiva y habitats abiertos de altura) y patrón migratorio (trans-andino vs. norte-sur). Estas diferencias son mayores a las que se encuentran entre U. jelskii y U. albigula, y son mucho mayores que las que encontramos entre U. jelskii y U. validirostris. Nuestros datos apoyan decididamente el estatus de especie plena para U. saturatior. La existencia de una Upucerthia debosque en parapatría con una especie de ambientes abiertos provee de una oportunidad para poner a prueba el papel de los cambios de hábitat entre ambientes áridos abiertos y ambientes boscosos durante la especiación.
Article
The insect fauna of the nests of Pseudoseisura lophotes (Reichenbach, 1853) (Aves: Furnariidae) from Argentina was investigated. A total of 110 species (68 identified to species, 22 identified to genus, 20 identified to family) in 40 families of 10 orders of insects was found in these nests. Triatoma platensis Neiva, 1913 (Hemiptera: Reduviidae) was found again in nests of P. lophotes, corroborating after 73 years the first observations made by Mazza in 1936. The occurrence of the insects in nests of P. lophotes is compared with the previously known insect fauna in nests of A. annumbi, Furnarius rufus (Furnariidae), and Myiopsitta monachus (Psittacidae). The insect fauna in additional nests of Anumbius annumbi from the same and/or different localities is given, and used in comparisons. The first occurrence of Cuterebridae (Diptera) in birds’ nests, their pupae as the overwintering stage, and the second simultaneous infestation by two species of Philornis (Diptera: Muscidae) on the same nestlings are presented. Other simultaneous infestations of different hematophagous arthropods (Hemiptera: Cimidae; Reduviidae: Triatominae, and Acari: Argasidae) are remarked and discussed.
Article
Full-text available
We review the main biogeographic and phylogenetic hypotheses about the origin and distribution of the endemic birds from Brazilian mountaintops, a heterogeneous group composed of hummingbirds and passerines living in high-altitude open habitats of campos rupestres, campos de altitude and campos sulinos from southern to north-eastern Brazilian mountaintops (Espinhaço Range, Serra do Mar, Serra da Mantiqueira and Serra Geral). Some authors consider that these birds are probably closely related to other species distributed in cooler areas of South America. We used ranges of these birds, spatial pattern and discontinuities in the distribution of phytophysiognomies to determine potential geographic barriers to dispersal and centres of origin and speciation. We reanalysed biogeographical hypotheses regarding the evolution of the endemic birds from Brazilian mountaintops and their habitats in the light of recent phylogenetic reconstructions that included some of these species. The evolutionary histories of the species Augastes scutatus, Augastes lumachella, Formicivora grantsaui, Polystictus superciliaris and Embernagra longicauda are difficult to assess due to lack of phylogenies that establish their systematic position. For Asthenes luizae, Asthenes moreirae, Cinclodes pabsti and C. espinhacensis, the phylogenies estimate also their lineage divergence times, which allows for inferences concerning connections between the biota of eastern Brazil, southern South America and the Andean mountains. We also identified 26 lowland regions between the mountains that were potentially barriers to dispersal. Phylogenetic relationships strongly highlight the importance of connecting paths and speciation through the south, especially in the cooler areas in South America. These patterns show that eastern Brazil, southern South America and the central and northern Andes are four important centres of origin and radiation for the endemic birds from the eastern Brazilian mountains.
Article
Full-text available
This report is the ninth one of a series and presents the results of a comprehensive literature screening in search for new bird taxa described in 2013, namely new genera, species and subspecies worldwide. We tracked names of ten genera, 25 species and three subspecies (one additional for 2010) new to science which, according to the International Code of Zoological Nomenclature were correctly described. On the basis of molecular genetic analyses new genera for species or species groups were proposed within Columbidae (2), Pipridae (1), and Thamnophilidae (7). Though various species concepts are concerned and "species" may have differing biological meanings, the number of 25 new bird species described in a single year is extraordinarily high. It is unsurpassed at least within the last hundred years. The new species refer to Hydrobatidae (1), Tytonidae (1), Strigidae (2), Bucconidae (1), Tyrannidae (1), Pipromorphidae (2), Thamnophilidae (5), Rhinocryptidae (1), Dendrocolaptidae (4), Furnariidae (1), Corvidae (1), Cisticolidae (1), Timaliidae (1), Polioptilidae (1), Passerellidae (1), and Thraupidae (1). Five of the new species described refer to Non-Passeriformes, the remainder 20 species to Passeriformes. In several cases the populations in question now considered to represent a new species were known since long. But only substantial studies of their songs, genetics and/or ecology led to description of new formerly unrecognized species. Most cases refer to the Neotropics.The distributional areas of the new species often are minute, restricted to remote and difficultly to access areas, often small islands and were hitherto overlooked due to their similarity to closely related species. Due to their limited ranges species new to science are often already endangered when detected. In a taxon sequence by genus/species/subspecies the newly described taxa have following origin: Neotropics (10/20/2), Palaearctic (-/1/2; one already in 2010) and Indo-Malaya (0/4/0). A number of splits, namely those of known species into allospecies as the geographic representatives of a superspecies are also addressed, but these are restricted to the Palaearctic and Indo-Malayan regions. Such splits markedly influenced species numbers especially in the Alcedinidae (kingfishers, Ceyx) and in the Pycnonotidae (bulbuls, Thapsinillas). We discuss possible flaws in new descriptions and certain splits, regardless of the species concept addressed. However, in general this report should be taken as a documentation of new taxa, not as a critical review of recent changes in bird taxonomy and bird descriptions.
Article
Jean Cabanis, curator of ornithology at the Museum für Naturkunde, Berlin, Germany, described, in 1873-1874, 34 new species of birds on the basis of specimens collected in Peru by Konstanty Jelski, a Polish naturalist. He borrowed or purchased these specimens from Wladyslaw Taczanowski (1819-1890), curator of zoology at the Imperial Warszawa University in Warszawa, Poland. We located and identified their types in the museums of Berlin (ZMB) and Warszawa (MIZ). Types of 21 species (28 type specimens) were deposited in the ZMB, of which types of 18 species (22 specimens) survive. The MIZ originally housed types of 14 species (19 type specimens), of which the types of only four species (4 specimens) survive. Overall, all types were lost for 12 species of Peruvian birds described by Cabanis on the basis of Jelski's collections.
Article
Full-text available
Biogeographic connections between Australia and other continents are still poorly understood although the plate tectonics of the Indo-Pacific region is now well described. Eupetes macrocerus is an enigmatic taxon distributed in a small area on the Malay Peninsula and on Sumatra and Borneo. It has generally been associated with Ptilorrhoa in New Guinea on the other side of Wallace's Line, but a relationship with the West African Picathartes has also been suggested. Using three nuclear markers, we demonstrate that Eupetes is the sister taxon of the South African genus Chaetops, and their sister taxon in turn being Picathartes, with a divergence in the Eocene. Thus, this clade is distributed in remote corners of Africa and Asia, which makes the biogeographic history of these birds very intriguing. The most parsimonious explanation would be that they represent a relictual basal group in the Passerida clade established after a long-distance dispersal from the Australo-Papuan region to Africa. Many earlier taxonomic arrangements may have been based on assumptions about relationships with similar-looking forms in the same, or adjacent, biogeographic regions, and revisions with molecular data may uncover such cases of neglect of ancient relictual patterns reflecting past connections between the continents.
Article
Full-text available
A recent study of New World orioles (Icterus spp.), which traced a large number of plumage characters onto a mitochondrial DNA phylogeny, reported high frequencies of evolutionary convergence and reversal of plumage characters (Omland and Lanyon 2000). Although those results are consistent with other smaller scale studies that have documented plumage homoplasy, the mitochondrial genome is inherited as a single linkage group, so mitochondrial data represent only one gene tree. The mitochondrial (mt) DNA tree may not reflect the true evolutionary history of a lineage; therefore, it remains possible that the plumage characters could reflect the true species phylogeny. Other rapidly evolving regions of DNA can provide independent phylogenetic hypotheses useful for evaluating mitochondrial gene trees. A novel phylogenetic marker, a region of the nuclear gene ornithine decarboxylase (ODC) spanning from exon 6 to exon 8, was sequenced in 10 oriole species. The resultant nuclear gene tree reconstructs the same three major oriole clades as the mtDNA tree (Omland et al. 1999), supporting the conclusion that plumage evolution in the New World orioles has been highly homoplastic. Although most phylogenetic studies that have employed introns report greatest resolution at the genus or family level, ODC appears to offer some degree of phylogenetic resolution for infrageneric analyses. However, that intron has clearly not sorted to monophyly within or between closely related species.
Book
Full-text available
This volume deals with the passerines (6063 spp. in pp. i-lii, 1-752. Joel Cracraft provided and explains the sequence of families. 15 expert colleagues assisted with this volume. The accompanying CD includes an editable spreadsheet version of the two-volume checklist as well as the volume reference list (over 3000 references) and appendices 5 to 9 (1 to 4 being in the book). Five new family-group names are introduced.
Article
Full-text available
We reviewed the tremendous architectural diversity of ovenbird (Furnariidae) nests based on literature, museum collections, and new field observations. With few exceptions, furnariids exhibited low intraspecific variation for the nest characters hypothesized, with the majority of variation being hierarchically distributed among taxa. We hypothesized nest homologies for 168 species in 41 genera (ca. 70% of all species and genera) and coded them as 24 derived characters. Forty-eight most-parsimonious trees (41 steps, CI = 0.98, RC = 0.97) resulted from a parsimony analysis of the equally weighted characters using PAUP, with the Dendrocolaptidae and Formicarioidea as successive outgroups. The strict-consensus topology based on these trees contained 15 clades representing both traditional taxa and novel phylogenetic groupings. Comparisons with the outgroups demonstrate that cavity nesting is plesiomorphic to the furnariids. In the two lineages where the primitive cavity nest has been lost, novel nest structures have evolved to enclose the nest contents: the clay oven of Furnarius and the domed vegetative nest of the synallaxine clade. Although our phylogenetic hypothesis should be considered as a heuristic prediction to be tested subsequently by additional character evidence, this first cladistic analysis of the furnariids demonstrates the general utility of nest characters in reconstruction of avian relationships, and it provides a test of monophyly for several furnariid taxa.
Article
Full-text available
The Curve-billed Reedhaunter (Limnornis curvirostris) and the Straight-billed Reedhaunter (Lim- noctites rectirostris) are marsh-dwelling ovenbirds that were first collected by Charles Darwin in Uruguay. Each has a limited distribution in southernmost Brazil, Uruguay, and northern Argentina, within which the birds occupy very distinct habitats. Originally described as congeners because of overall similarity of plum- age, the two species have been treated as close relatives through most of their history despite obvious structural differences. We analyzed DNA sequences from three different genes of these species, compar- ing them with a wide variety of other species of Furnariidae and several outgroup taxa. Limnoctites rectirostris belongs among the species traditionally placed in Cranioleuca, being most closely related to the marsh- dwelling Sulphur-throated Spinetail (C. sulphurifera) among the species we sampled. This is supported by vocalizations and nidification. Limnornis curvirostris forms a clade with the Wren-like Rushbird (Phleocryptes melanops), with the Sharp-tailed Streamcreeper (Lochmias nematura) as a rather distant sister-taxon. A close relationship between Limnornis and Phleocryptes is supported by the apparently unique nest architecture and blue-green egg color. Accepted 5 April 2005.
Article
Full-text available
Um novo híbrido intergenérico foi caracterizado utilizando caracteres morfológicos e seqüências de DNA nuclear e mitocondrial. Vários caracteres morfológicos sugerem que a ave é um intermediário entre Ilicura militaris e Chiroxiphia caudata. Seqüências do gene mitocondrial ND2 herdados via materna demonstram que a progenitora feminina foi uma Chiroxiphia caudata, e seqüências nucleares do intron 5 do beta-fibrinogênio não eliminaram Chiroxiphia e Ilicura como potenciais pais. Logo, os dados de seqüência de DNA levam à conclusão de que Ilicura é o progenitor masculino desta ave pouco comum. Este estudo é importante porque demonstra a significância de utilizar sistemas de múltiplos caracteres na diagnose de espécimes pouco comuns de aves.
Article
Full-text available
The Neotropical ovenbirds (Furnariidae) form an extraordinary morphologically and ecologically diverse passerine radiation, which includes many examples of species that are superficially similar to other passerine birds as a resulting from their adaptations to similar lifestyles. The ovenbirds further exhibits a truly remarkable variation in nest types, arguably approaching that found in the entire passerine clade. Herein we present a genus-level phylogeny of ovenbirds based on both mitochondrial and nuclear DNA including a more complete taxon sampling than in previous molecular studies of the group. The phylogenetic results are in good agreement with earlier molecular studies of ovenbirds, and supports the suggestion that Geositta and Sclerurus form the sister clade to both core-ovenbirds and woodcreepers. Within the core-ovenbirds several relationships that are incongruent with traditional classifications are suggested. Among other things, the philydorine ovenbirds are found to be non-monophyletic. The mapping of principal nesting strategies onto the molecular phylogeny suggests cavity nesting to be plesiomorphic within the ovenbird–woodcreeper radiation. It is also suggested that the shift from cavity nesting to building vegetative nests is likely to have happened at least three times during the evolution of the group. We suggest that the shifts in nest architecture within the furnariine and synallaxine ovenbirds have served as an ecological release that has facilitated diversification into new habitats and new morphological specializations.
Article
Full-text available
A robust phylogeny estimate for the family Furnariidae (sensu lato) was obtained using sequences of two nuclear introns and one mitochondrial gene (cyt b). Contrary to the widely accepted sister-group relationship of ovenbirds (Furnariinae) and woodcreepers (Dendrocolaptinae), a basal clade is suggested for Sclerurus and Geositta, while Xenops, hitherto considered an aberrant ovenbird, was found to occupy a basal position on the woodcreeper lineage. The morphological variation is re-interpreted in view of this revised phylogenetic hypothesis. Presumably, the remarkable adaptive radiation in this family started as primitive, Sclerurus-likes forms, which used the tail as a prop during terrestrial feeding, lured up to seek food on tree-trunks. The two basal woodcreeper genera, Xenops and then Glyphorynchus, show strong cranial specializations for hammering in wood, thus presenting a remarkable parallelism with the family Picidae, Xenops resembling a piculet, Glyphorynchus, a diminutive woodpecker. However, this specialization was lost in other woodcreepers, which show a more normal passerine skull, adapted for probing and prying in tree-trunk crevices and sallying for escaping insects. The ovenbirds developed a more flexible (rhynchokinetic) bill, well suited for probing and retrieving hidden prey in dead-leaf clusters and debris suspended in the vegetation, and in epiphyte masses. Adaptations to live in open terrain are secondary.
Article
Full-text available
The program MRBAYES performs Bayesian inference of phylogeny using a variant of Markov chain Monte Carlo. Availability: MRBAYES, including the source code, documentation, sample data files, and an executable, is available at http://brahms.biology.rochester.edu/software.html. Contact: johnh{at}brahms.biology.rochester.edu
Article
Full-text available
Zoogeographic, palaeontological and biochemical data support a Southern Hemisphere origin for passerine birds, while accumulating molecular data suggest that most extant avian orders originated in the mid-Late Cretaceous. We obtained DNA sequence data from the nuclear c-myc and RAG-1 genes of the major passerine groups and here we demonstrate that the endemic New Zealand wrens (Acanthisittidae) are the sister taxon to all other extant passerines, supporting a Gondwanan origin and early radiation of passerines. We propose that (i) the acanthisittids were isolated when New Zealand separated from Gondwana (ca. 82-85 Myr ago), (ii) suboscines, in turn, were derived from an ancestral lineage that inhabited western Gondwana, and (iii) the ancestors of the oscines (songbirds) were subsequently isolated by the separation of Australia from Antarctica. The later spread of passerines into the Northern Hemisphere reflects the northward migration of these former Gondwanan elements.
Article
Full-text available
The construction of evolutionary trees is now a standard part of exploratory sequence analysis. Bayesian methods for estimating trees have recently been proposed as a faster method of incorporating the power of complex statistical models into the process. Researchers who rely on comparative analyses need to understand the theoretical and practical motivations that underlie these new techniques, and how they differ from previous methods. The ability of the new approaches to address previously intractable questions is making phylogenetic analysis an essential tool in an increasing number of areas of genetic research.
Article
Full-text available
MrBayes 3 performs Bayesian phylogenetic analysis combining information from different data partitions or subsets evolving under different stochastic evolutionary models. This allows the user to analyze heterogeneous data sets consisting of different data types—e.g. morphological, nucleotide, and protein—and to explore a wide variety of structured models mixing partition-unique and shared parameters. The program employs MPI to parallelize Metropolis coupling on Macintosh or UNIX clusters. Availability: http://morphbank.ebc.uu.se/mrbayes Contact: fredrik.ronquist@ebc.uu.se * To whom correspondence should be addressed.
Article
Full-text available
Passerine birds are very plastic in their adaptations, which has made it difficult to define phylogenetic lineages and correctly allocate all species to these. Sapayoa aenigma, a member of the large group of New World flycatchers, has been difficult to place, and DNA-DNA hybridization experiments have indicated that it may have been misplaced. This is confirmed here, as base sequencing of two nuclear genes places it as a deep branch in the group of broadbills and pittas of the Old World tropics. The peculiar distribution of this lineage may be best explained in terms of a Gondwanic and Late Cretaceous origin of the passerine birds, as this particular lineage dispersed from the Antarctic landmass, reaching the Old World tropics via the drifting Indian plate, and South America via the West Antarctic Peninsula.
Article
Full-text available
Comparative genomic data among organisms allow the reconstruction of their phylogenies and evolutionary time scales. Molecular timings have been recently used to suggest that environmental global change have shaped the evolutionary history of diverse terrestrial organisms. Living xenarthrans (armadillos, anteaters and sloths) constitute an ideal model for studying the influence of past environmental changes on species diversification. Indeed, extant xenarthran species are relicts from an evolutionary radiation enhanced by their isolation in South America during the Tertiary era, a period for which major climate variations and tectonic events are relatively well documented. We applied a Bayesian approach to three nuclear genes in order to relax the molecular clock assumption while accounting for differences in evolutionary dynamics among genes and incorporating paleontological uncertainties. We obtained a molecular time scale for the evolution of extant xenarthrans and other placental mammals. Divergence time estimates provide substantial evidence for contemporaneous diversification events among independent xenarthran lineages. This correlated pattern of diversification might possibly relate to major environmental changes that occurred in South America during the Cenozoic. The observed synchronicity between planetary and biological events suggests that global change played a crucial role in shaping the evolutionary history of extant xenarthrans. Our findings open ways to test this hypothesis further in other South American mammalian endemics like hystricognath rodents, platyrrhine primates, and didelphid marsupials.
Article
Full-text available
The order Passeriformes ("perching birds") comprises extant species diversity comparable to that of living mammals. For over a decade, a single phylogenetic hypothesis based on DNA-DNA hybridization has provided the primary framework for numerous comparative analyses of passerine ecological and behavioral evolution and for tests of the causal factors accounting for rapid radiations within the group. We report here a strongly supported phylogenetic tree based on two single-copy nuclear gene sequences for the most complete sampling of passerine families to date. This tree is incongruent with that derived from DNA-DNA hybridization, with half of the nodes from the latter in conflict and over a third of the conflicts significant as assessed under maximum likelihood. Our historical framework suggests multiple waves of passerine dispersal from Australasia into Eurasia, Africa, and the New World, commencing as early as the Eocene, essentially reversing the classical scenario of oscine biogeography. The revised history implied by these data will require reassessment of comparative analyses of passerine diversification and adaptation.
Book
— We studied sequence variation in 16S rDNA in 204 individuals from 37 populations of the land snail Candidula unifasciata (Poiret 1801) across the core species range in France, Switzerland, and Germany. Phylogeographic, nested clade, and coalescence analyses were used to elucidate the species evolutionary history. The study revealed the presence of two major evolutionary lineages that evolved in separate refuges in southeast France as result of previous fragmentation during the Pleistocene. Applying a recent extension of the nested clade analysis (Templeton 2001), we inferred that range expansions along river valleys in independent corridors to the north led eventually to a secondary contact zone of the major clades around the Geneva Basin. There is evidence supporting the idea that the formation of the secondary contact zone and the colonization of Germany might be postglacial events. The phylogeographic history inferred for C. unifasciata differs from general biogeographic patterns of postglacial colonization previously identified for other taxa, and it might represent a common model for species with restricted dispersal.
Article
Phylogenetic relationships within the genus Cinclodes, a group of South American furnariids, were studied using complete sequences of the mitochondrial genes COII and ND3. The 13 species of Cinclodes formed a monophyletic group consisting of three major lineages: (1) the southeastern Brazilian isolate C. pabsti, which was sister to the rest of the genus; (2) a clade of five primarily Patagonian or central Argentine highlands species; and (3) a clade of seven primarily north-central Andean or Pacific species. Biogeographic structure in the Patagonian-Andean taxa was consistent with the deep Patagonian and north-central Andean division previously noted in the similarly distributed genus Muscisaxicola. Evolutionary relationships among Cinclodes species were partially consistent with expectations based on plumage, behavior, and ecology. The phenotypically distinctive C. antarcticus was found to be sister to the widespread C. fuscus in the primarily Patagonian-Argentine clade, and the distinctive C. palliatus to be sister to C. atacamensis in the high Andean-Pacific clade. The central Argentine isolates C. comechingonus and C. olrogi formed a clade with C. oustaleti (olrogi sister to oustaleti, and comechingonus sister to those two) within the Patagonian-Argentine clade. The Pacific marine specialists C. nigrofumosus and C. taczanowskii were sisters within the Andean-Pacific clade and were distantly related to the southern maritime species C. antarcticus. Thus, marine ecological specialization apparently evolved twice within Cinclodes; behavioral and ecological data also support the nonhomology of the two character states. The two exclusively Pacific species were positionally apomorphic within the Andean-Pacific clade; ancestral area analysis indicated that the high Andes were the most likely area of origin for this clade, and that the Pacific coast was occupied secondarily.
Conference Paper
In this paper it is shown that the classical maximum likelihood principle can be considered to be a method of asymptotic realization of an optimum estimate with respect to a very general information theoretic criterion. This observation shows an extension of the principle to provide answers to many practical problems of statistical model fitting.
Article
Un estudio reciente de Icterus, que analizó la evolución de un gran número de caracteres del plumaje sobre una filogenia basada en ADN mitocondrial, documentó una alta frecuencia de convergencias y reversiones evolutivas en caracteres del plumaje (Omland y Lanyon 2000). Aunque esos resultados son consistentes con otros estudios a menor escala que han reportado homoplasia en el plumaje, el genoma mitocondrial se hereda como un solo grupo de ligamiento, por lo que los datos mitocondriales representan sólo un árbol génico. Como el árbol de ADN mitocondrial podría no reflejar la verdadera historia evolutiva de un grupo, es aún posible que los caracteres de plumaje reflejen la filogenia real de las especies. Otras regiones de ADN que evolucionan rápidamente pueden proveer hipótesis filogenéticas independientes de utilidad para evaluar los árboles de genes mitocondriales. Un marcador filogenético nuevo, una región del gen nuclear ODC (“ornithine decarboxylase”) que va del exón 6 al exón 8, fue secuenciada para 10 especies de Icterus. El árbol resultante del gen nuclear reconstruye los mismos tres clados principales de Icterus que el árbol de ADNmt (Omland et al. 1999), apoyando la conclusión de que la evolución del plumaje en Icterus ha sido altamente homoplásica. Aunque la mayoría de los estudios que han empleado intrones documentan una resolución máxima al nivel de género o familia, ODC parece ofrecer algún grado de resolución filogenética para análisis infragenéricos. Sin embargo, este intrón claramente no se ha separado hasta la monofilia entre o dentro de especies estrechamente relacionadas.
Article
The woodcreepers is a highly specialized lineage within the New World suboscine radiation. Most systematic studies of higher level relationships of this group rely on morphological characters, and few studies utilizing molecular data exist. In this paper, we present a molecular phylogeny of the major lineages of woodcreepers (Aves: Dendrocolaptinae), based on nucleotide sequence data from a nuclear non-coding gene region (myoglobin intron II) and a protein-coding mitochondrial gene (cytochrome b). A good topological agreement between the individual gene trees suggests that the resulting phylogeny reflects the true evolutionary history of woodcreepers well. However, the DNA-based phylogeny conflicts with the results of a parsimony analysis of morphological characters. The topological differences mainly concern the basal branches of the trees. The morphological data places the genus Drymornis in a basal position (mainly supported by characters in the hindlimb), while our data suggests it to be derived among woodcreepers. Unlike most other woodcreepers, Drymornis is ground-adapted, as are the ovenbirds. The observed morphological similarities between Drymornis and the ovenbird outgroup may thus be explained with convergence or with reversal to an ancestral state. This observation raises the question of the use of characters associated with locomotion and feeding in phylogenetic reconstruction based on parsimony.
Article
Museum study skins represent an invaluable source of DNA for phylogenetics, phylogeography and population genetics. This becomes evident by comparing the number of study skins of birds housed in museums worldwide (c. 10 million) with the corresponding number of tissue samples (probably fewer than 500 000). While the laboratory techniques used hitherto have primarily allowed PCR-based studies of mitochondrial genes from museum skins, we present here the first avian phylogeny based on a large number of nuclear sequences. The targeted fragment sizes and the properties of the primers used are important contributory factors to obtain good amplification results. In this study we routinely amplified fragments of c. 350 bp nuclear DNA. This advance in methodology opens up a new avenue for the use of avian museum skins, as nuclear DNA is especially useful when studying ancient patterns of diversification. The phylogenetic hypothesis of the Old World suboscines (Eurylaimides) presented herein strongly supports a monophyletic origin of the pittas (Pittidae). The phylogeny further suggests that pittas could be divided into three major groups, in agreement with the external morphological variation found in this group. The broadbills (Eurylaimidae) as currently defined are, on the other hand, found to be a paraphyletic family, as both Sapayoa aenigma and the asities (Philepittidae) are nested among them. Based on the phylogenetic results we suggest a revised classification of the Old World suboscines (Eurylaimides).
Article
Phylogenetic relationships within the genus Muscisaxicola, a primarily Andean group of tyrant-flycatchers, were studied using complete sequences of the mitochondrial genes COII and ND3. Relationships among Muscisaxicola species were found to differ substantially from those of previous views, suggesting convergence in traditional avian taxonomic characters within the genus. The 11 species of large, gray, "typical" Muscisaxicola flycatchers (including M. grisea, newly restored to species status) formed a distinct clade, consisting of two major groups: a clade of 6 species breeding primarily in the central Andes and a clade of 5 species breeding primarily in the southern Andes. The other 2 species traditionally placed in this genus, M. fluviatilis, an Amazonian species, and M. maculirostris, were both rather divergent genetically from the typical species, although M. maculirostris may be the sister taxon to the typical clade. The patterns of sympatry exhibited by Muscisaxicola species in the high Andes appear to be the consequence of speciation and secondary contact within regions of the Andes, rather than a result of dispersal between regions. Diversification of the typical Muscisaxicola species appears to have occurred during the middle and late Pleistocene, suggesting generally that taxa of the high Andes and Patagonia may have been greatly influenced by mid-to-late Pleistocene events. There were likely several independent developments of migration within this genus, but migration is probably ancestral in the southern clade, with subsequent loss of migration in two taxa.
Article
Based on their highly specialized "tracheophone" syrinx, the avian families Furnariidae (ovenbirds), Dendrocolaptidae (woodcreepers), Formicariidae (ground antbirds), Thamnophilidae (typical antbirds), Rhinocryptidae (tapaculos), and Conopophagidae (gnateaters) have long been recognized to constitute a monophyletic group of suboscine passerines. However, the monophyly of these families have been contested and their interrelationships are poorly understood, and this constrains the possibilities for interpreting adaptive tendencies in this very diverse group. In this study we present a higher-level phylogeny and classification for the tracheophone birds based on phylogenetic analyses of sequence data obtained from 32 ingroup taxa. Both mitochondrial (cytochrome b) and nuclear genes (c-myc, RAG-1, and myoglobin) have been sequenced, and more than 3000 bp were subjected to parsimony and maximum-likelihood analyses. The phylogenetic signals in the mitochondrial and nuclear genes were compared and found to be very similar. The results from the analysis of the combined dataset (all genes, but with transitions at third codon positions in the cytochrome b excluded) partly corroborate previous phylogenetic hypotheses, but several novel arrangements were also suggested. Especially interesting is the result that the genus Melanopareia represents a basal branch within the tracheophone group, positioned in the phylogenetic tree well away from the typical tapaculos with which it has been supposed to group. Other novel results include the observation that the ground antbirds are paraphyletic and that Sclerurus is the sister taxon to an ovenbird-woodcreeper clade. Patterns of generic richness within each clade suggest that the early differentiation of feeble-winged forest groups took place south of the Amazon Basin, while the more recent diversification was near the equator and (in tapaculos and ovenbirds) in the south of the continent.
Article
Phylogenetic relationships among New World suboscine birds were studied using nuclear and mitochondrial DNA sequences. New World suboscines were shown to constitute two distinct lineages, one apparently consisting of the single species Sapayoa aenigma, the other made up of the remaining 1000+ species of New World suboscines. With the exception of Sapayoa, monophyly of New World suboscines was strongly corroborated, and monophyly within New World suboscines of a tyrannoid clade and a furnarioid clade was likewise strongly supported. Relationships among families and subfamilies within these clades, however, differed in several respects from current classifications of suboscines. Noteworthy results included: (1) monophyly of the tyrant-flycatchers (traditional family Tyrannidae), but only if the tityrines (see below) are excluded; (2) monophyly of the pipromorphine flycatchers (Pipromorphinae of ) as one of two primary divisions of a monophyletic restricted Tyrannidae; (3) monophyly of the tityrines, consisting of the genus Tityra plus all sampled species of the Schiffornis group (), as sister group to the manakins (traditional family Pipridae); (4) paraphyly of the ovenbirds (traditional family Furnariidae), if woodcreepers (traditional family Dendrocolaptidae) are excluded; and (5) polyphyly of the antbirds (traditional family Formicariidae) and paraphyly of the ground antbirds (Formicariidae sensu stricto). Genus Melanopareia (the crescent-chests), although clearly furnarioid, was found to be distant from other furnarioids and of uncertain affinities within the Furnarii. Likewise, the species Oxyruncus cristatus (the Sharpbill), although clearly tyrannoid, was distantly related to other tyrannoids and of uncertain affinities within the Tyranni. Results of this study provide support for some of the more novel features of the suboscine phylogeny of, but also reveal key differences, especially regarding relationships among suboscine families and subfamilies. The results of this study have potentially important implications for the reconstruction of character evolution in the suboscines, especially because the behavioral evolution of many suboscine groups (e.g., Furnariidae) is of great interest.
Article
Despite increased understanding of higher-level relationships in passerine birds in the last 15 years, the taxonomic boundaries and phylogenetic interrelationships of the major groups of the Tyrannida (including the cotingas, manakins, tityrines, and tyrant flycatchers) remain unclear. Here, we present an analysis of DNA sequence data obtained from two nuclear exons, three introns, and one mitochondrial gene for 26 genera of Tyrannida and 6 tracheophone outgroups. The analysis resulted in well-supported hypotheses about the earliest evolution within Tyrannida. The Cotingidae, Pipridae, Tityrinae (sensu) [Prum, R.O., Rice, N.H., Mobley, J.A., Dimmick, W.W., 2000. A preliminary phylogenetic hypothesis for the cotingas (Cotingidae) based on mitochondrial DNA. Auk 117, 236-241], Tyrannidae, and the tyrannid subfamiles Tyranninae and Pipromorphinae (sensu) [Sibley, C.G., Monroe, B. L. Jr., 1990. Distribution and Taxonomy of Birds of the World. Yale University Press, New Haven, CT] were all found to be reciprocally monophyletic (given the present taxon sampling). The Cotingidae and Pipridae form a clade that is the sister group to a well-supported clade including Oxyruncus, the Tityrinae, Piprites, and the Tyrannidae. Oxyruncus is the sister group to the Tityrinae, and Piprites is placed as the sister group to the Tyrannidae. The tyrannid subfamilies Tyranninae and Pipromorphinae are monophyletic sister taxa, but the relationships of Platyrinchus mystaceus to these two clades remains ambiguous. The presence of medial (=internal) cartilages in the syrinx is a synapomorphy for the Oxyruncus-Tityrinae-Piprites-Tyrannidae clade. Although morphological synapomorphies currently support the monophyly of both the Pipridae and the Cotingidae, convergences and/or reversals in morphological character states are common in Tyrannida. The relationship between Oxyruncus and the Tityrinae is congruent with additional syringeal synapomorphies and allozyme distance data. Accordingly, we propose the recognition the family Tityridae within the Tyrannida to include the genera Schiffornis, Laniisoma, Laniocera, Iodopleura, Xenopsaris, Pachyramphus, Tityra, and Oxyruncus.
Catalogue of the Birds in the British Museum
  • P L Sclater
Sclater, P. L. (1890). Catalogue of the Birds in the British Museum, Vol.
Birds of the High Andes
  • J Fjeldså
  • N Krabbe
Fjeldså, J. & Krabbe, N. (1990). Birds of the High Andes. Copenhagen: Apollo Books and Zoological Museum.
Remarks on the genus Ochetorhynchus Meyen
  • A Wetmore
  • J L Peters
Wetmore, A. & Peters, J. L. (1949). Remarks on the genus Ochetorhynchus Meyen. Proceedings of the Biological Society of Washington, 62, 97 –100.
Phylogeny estimation: Tradi-tional and Bayesian approaches
  • M Holder
  • P O Lewis
Holder, M. & Lewis, P. O. (2003). Phylogeny estimation: Tradi-tional and Bayesian approaches. Nature Genetics, 4, 275 – 284.
@BULLET Phylogeny of Upucerthia © 2007 The Authors. Journal compilation © 2007 The Norwegian Academy of Science and Letters @BULLET Zoologica Scripta
  • J Fjeldså
J. Fjeldså et al. @BULLET Phylogeny of Upucerthia © 2007 The Authors. Journal compilation © 2007 The Norwegian Academy of Science and Letters @BULLET Zoologica Scripta, 36, 2, March 2007, pp133–141 141
PATHd8 — a new method for estimating divergence times in large phylogenetic trees without a molecular clock Available at www.math Evolution in the high Andes: the phylogenetics of Muscisaxicola ground-tyrants
  • T Britton
  • C L Anderson
  • D Jaquet
  • S Lundquist
  • K Bremer
Britton, T., Anderson, C. L., Jaquet, D., Lundquist, S. & Bremer, K. (2006). PATHd8 — a new method for estimating divergence times in large phylogenetic trees without a molecular clock. Available at www.math.su.se/PATHd8 Chesser, R. T. (2000). Evolution in the high Andes: the phylogenetics of Muscisaxicola ground-tyrants. Molecular Phyogenetics and Evolution, 15, 369 – 380.
Ökomorphologische Aspekte von Speziation und adaptiver Radiation bei Vögeln
  • B Leisler
Leisler, B. (1977). Ökomorphologische Aspekte von Speziation und adaptiver Radiation bei Vögeln. Vogelwarte, 29, 136 –153.
PATHd8 - a new method for estimating divergence times in large phylogenetic trees without a molecular clock
  • T Britton
  • C L Anderson
  • D Jaquet
  • S Lundquist
  • K Bremer
Britton, T., Anderson, C. L., Jaquet, D., Lundquist, S. & Bremer, K. (2006). PATHd8 — a new method for estimating divergence times in large phylogenetic trees without a molecular clock. Available at www.math.su.se/PATHd8