Article

Plant Viruses Transmitted by Whiteflies

Authors:
To read the full-text of this research, you can request a copy directly from the author.

Abstract

One-hundred and fourteen virus species are transmitted by whiteflies (family Aleyrodidae). Bemisia tabaci transmits 111 of these species while Trialeurodes vaporariorum and T. abutilonia transmit three species each. B. tabaci and T. vaporariorum are present in the European–Mediterranean region, though the former is restricted in its distribution. Of the whitefly-transmitted virus species, 90% belong to the Begomovirus genus, 6% to the Crinivirus genus and the remaining 4% are in the Closterovirus, Ipomovirus or Carlavirus genera. Other named, whitefly-transmitted viruses that have not yet been ranked as species are also documented. The names, abbreviations and synonyms of the whitefly-transmitted viruses are presented in tabulated form together with details of their whitefly vectors, natural hosts and distribution. Entries are also annotated with references. Whitefly-transmitted viruses affecting plants in the European–Mediterranean region have been highlighted in the text.

No full-text available

Request Full-text Paper PDF

To read the full-text of this research,
you can request a copy directly from the author.

... Las lesiones se producen a través de la alimentación directa por la succión de la savia, pero principalmente de forma indirecta por la transmisión de virus, trastornos fisiológicos de las plantas, la contaminación con ligamaza y el crecimiento de hongos asociados. La transmisión de enfermedades es la forma más importante de daño, más de 100 virus diferentes son transmitidos por B. tabaci, la mayoría de los cuales pertenecen al género Begomovirus (Jones, 2003). La mosquita blanca se combate casi exclusivamente mediante el uso de insecticidas químicos, pero esta estrategia es limitada debido a la ubicación de adultos y ninfas en la superficie abaxial de la hoja. ...
... Las lesiones se producen a través de la alimentación directa por la succión de la savia, pero principalmente de forma indirecta por la transmisión de virus, trastornos fisiológicos de las plantas, la contaminación con ligamaza y el crecimiento de hongos asociados. La transmisión de enfermedades es la forma más importante de daño, más de 100 virus diferentes son transmitidos por B. tabaci, la mayoría de los cuales pertenecen al género Begomovirus (Jones, 2003). ...
... Una de las limitantes en la producción de tomate es la incidencia de la mosquita blanca Bemisia tabaci Genn. (Hemiptera: Aleyrodidae), que no sólo se alimenta de la savia de las plantas, sino que transmite de manera eficiente más de 100 virus del grupo begomovirus (Jones, 2003; Abd-Rabou y Simmons, 2010). Esta plaga se distribuye a nivel mundial y se distingue típicamente por su amplio rango de hospederos, alta fecundidad, amplia dispersión, y alta capacidad de transmisión de virus Stansly y Naranjo, 2010). ...
Thesis
Full-text available
Se han realizado varios estudios para evaluar el efecto de las plantas aromáticas como plagas repelentes de insectos. Sin embargo, no existe una revisión sistemática sobre la efectividad de esta técnica para el control de plagas, por lo que el objetivo de este estudio fue analizar el efecto de las plantas aromáticas para repeler a los insectos plaga. Para ello, se realizó una búsqueda exhaustiva, recuperando los artículos relevantes de las plataformas: Google Scholar, Only Library, Science Direct, Springer Journal, Taylor & Francis y Wiley Online Library. Examinamos 42 artículos, de los cuales solo 14 cumplieron con los criterios de inclusión en el meta-análisis. De estos artículos, 407 estudios fueron seleccionados para ser evaluados. Posteriormente se evaluó el efecto repelente de 18 plantas aromáticas en individuos adultos de B. tabaci en laboratorio por medio de un olfatómetro y en campo con un cultivo intercalado con tomate. El meta-análisis arrojó que al menos una parte de las plantas aromáticas evaluadas, son efectivas para modificar el comportamiento de la comunidad de insectos, los fitófagos respondieron negativamente y los enemigos naturales de manera positiva. De las especies aromáticas evaluadas para repelencia fitófaga y atracción de enemigos naturales, las más efectivas pertenecen a las familias Asteraceae y Lamiaceae. En los experimentos, de las 18 especies evaluadas en laboratorio, sobresalieron como repelentes a adultos de mosquita blanca, lavanda, paiché, perejil y tomillo que posteriormente se evaluaron en campo, donde los efectos repelentes de las plantas aromáticas fueron notorios en la alteración de la oviposición y posterior crecimiento de ninfas de la mosquita blanca.
... The silverleaf whitefly, Bemisia tabaci Gennadius (Homoptera: Aleyrodidae), is a major pest of economic importance worldwide. It feeds on over 700 plant species [1][2][3] and damages crop plants by sucking phloem sap and transmitting plant viruses 4,5 . ...
Article
Insecticide resistance has developed in several populations of the whitefly Bemisia tabaci worldwide and threatens to compromise the efficacy of chemical control. The molecular mechanisms underpinning resistance have been characterised and markers associated with the trait have been identified, allowing the development of diagnostics for individual insects. TaqMan and Droplet Digital PCR (ddPCR) assays were developed and validated, in individual and pooled whitefly samples, respectively, for the following target‐site mutations: the acetylcholinesterase (ace1) F331W mutation conferring organophosphate‐, the voltage‐gated sodium channel (vgsc) mutations L925I and T929V conferring pyrethroid‐ and the acetyl‐CoA carboxylase (acc) A2083V mutation conferring ketoenol‐ resistance. The ddPCR's Limit of Detection (LoD) was <0.2% (i.e., detection of 1 heterozygote whitefly in a pool of 249 wild type individuals). The assays were applied in 11 of B. tabaci field populations from four locations in Crete, Greece. The F331W mutation was detected to be fixed or close to fixation in 8/11 B. tabaci populations, and at lower frequency in the remaining ones. The pyrethroid resistance mutations were detected in very high frequencies. The A2083V spiromesifen resistance mutation was detected in 8/11 populations (frequencies=6.16%‐89.56%). Spiromesifen phenotypic resistance monitoring showed that the populations tested had variable levels of resistance, ranging from full susceptibility to high resistance. A strong spiromesifen resistance phenotype‐genotype (A2083V) correlation (rs = ‐0.839, p = 0.002) was observed confirming the ddPCR diagnostic value. The ddPCR diagnostics developed in this study are a valuable tool to support evidence based rational use of insecticides and resistance management strategies. This article is protected by copyright. All rights reserved.
... In particular, Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae), commonly known as the sweetpotato whitefly, has been responsible for causing serious economic losses in cotton production in Turkey since the major outbreak in 1974 (Özgür and Şekeroğlu 1986;Şengonca 1975;Satar et al. 2018). The whitefly damages crops directly by feeding on plant phloem, and indirectly through the transmission of plant viruses and secretion of honeydew, which also affects cotton lint quality (Henneberry et al. 1996;Jones 2003;Stansly and Naranjo 2010). ...
Article
Full-text available
Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae) is an economically important pest of agricultural crops. It is described as a species complex, among which MEAM1 (Middle East–Asia Minor 1) and MED (Mediterranean) are two of the most damaging and invasive species in the world. This study was conducted to determine the seasonal population variations of MEAM1 and MED species of B. tabaci from 2015 to 2018 in cotton fields of the Çukurova plain, Turkey. Whiteflies were sampled during the early season and late season from cotton fields located in six districts. A diagnostic microsatellite locus and PCR-RFLP methods were used to determine MED and MEAM1 species. Results showed that although its rate decreased over the years, MED was predominant over MEAM1 in cotton fields, with 60.9% of the total B. tabaci specimens determined as MED while 39.1% were MEAM1. The proportion of each species varied according to districts with the highest value of MED (100%) observed in inland districts. The species composition changed according to the season, and MEAM1 was found to be statistically higher in the late than the early season in the districts close to the Mediterranean Sea. The data showed that despite the closeness of the sampling areas, there was a habitat partitioning between MED and MEAM1 in the Çukurova plain. The crop pattern, migration, and climate were found to be important factors in the habitat partition. The results obtained in this study will help in the development of sustainable management strategies for these invasive species.
... The ideal soil temperature for the full development of the tomato plant is 27 °C (Jones, 2003), while for Ilić et al. (2015), evaluating the stress of tomato plants at high temperatures, found that the ideal temperature is 23 °C, where these temperatures are close to those observed in this study. The ideal soil temperature depends on the light intensity and the growth and development phase, with a temperature between 13 and 25 °C being ideal (Shamshiri et al., 2018). ...
Article
Full-text available
The aim was to evaluate the influence of soil covers on the dynamics of soil temperature and moisture, canopy air temperature, and yield of creeping fresh market tomatoes. The experiment was carried out in randomized blocks design, using the tomato cultivar Thaise, with 5 treatments, 4 replications, with different soil covers: a) Uncovered soil (conventional planting); b) Mulching (double-sided plastic film - black and white); c) Sorghum; d) Sudan grass and e) Pearl millet), cultivated in Tangará da Serra, Mato Grosso, Brazil. Soil temperature was monitored at depths of 5, 10, 20, and 30 cm and in the crop canopy, using thermocouple sensors of the type "K". Soil moisture was monitored in the 0 to 30 cm layer, using of time-domain reflectometry (TDR) probes. Soil temperature and moisture were evaluated throughout the cycle and, in the end, the total and commercial yield of tomato crop. Soil covers have a positive influence on soil temperature and moisture in the cultivation of creeping fresh market tomatoes so that soil cover with mulching provides the highest soil temperature in the early stages of development and covers with mulching and pearl millet provide the highest values of soil moisture. The highest total and commercial yield of tomato were in the soil cover with mulching, with 110.71 and 75.93 t ha-1, respectively, presenting ideal ranges of temperature and soil moisture, so that the other treatments do not differ from each other, with the average total yield of 91.45 t ha-1.
... In the past two decades, B. tabaci (Gennadius, 1889) has become a significant pest under field and polyhouse conditions and feeds over 900 host plants around the globe [8]. It alone acts as a vector for more than 300 plant viruses [9]. Plant viruses such as Begomovirus, Carlavirus, Crinivirus, Ipomovirus and Torradovirus are predominantly transmitted genera [10], thus leading to yield losses of around 20-100% and have exhibited resistance to more than 60 active ingredients [11]. ...
... The whitefly, Bemisia tabaci, an economically important agricultural pest that causes huge damage to crops worldwide both directly and as a vector of nearly 120 geminivirus, which includes Begomovirus, Crinivirus, Closterovirus etc. [1]. B.tabaci is listed among the top 100 dreadful alien invasive species [2]. ...
Article
Full-text available
The whitefly, B . tabaci is a major pest of agricultural crops which transmits begomovirus in a species-specific manner. Yellow vein mosaic disease (YVMD) and okra leaf curl disease (OLCD) caused by distinct begomovirus are a major limitation to production of okra in India. In this framework the present investigation reports, for the first time, comparative study of begomovirus species viz. yellow vein mosaic virus (YVMV) and okra enation leaf curl virus (OELCuV) ingested and egested by two cryptic species (Asia I and Asia II 5) of B . tabaci at different time interval using detached leaf assay. A gradual increase of both virus copies were observed with increased feeding exposure in Asia I and Asia II 5. Both the genetic groups of whitefly could acquire the viruses within just 5 minutes of active feeding however, a significant amount of variation was noted in virus uptake by the both. At 24 hours of active feeding Asia II 5 acquired more of YVMV whereas, Asia I ingested more OELCuV. Similarly, the genetic group acquiring higher titre of virus egested higher amount during inoculation period. On the whole, it can be presumed that Asia I is a more effective transmitter of OELCuV whereas, Asia II 5 of YVMV further suggesting increased risk of virus pandemics (both YVMV and OELCuV) in regions where Asia I and Asia II 5 is dominant.
... Whiteflies are also important plant virus vectors, transmitting many plant viruses of economic importance. They are usually present in regions with warm climate and in greenhouses [83]. Only a few of the 1500 species are capable in transmitting viruses, though, the two most prominent being the tobacco whitefly, Bemisia tabaci (Gennadius) complex, and the greenhouse whitefly Trialeurodes vaporariorum (Westwood). ...
Article
Full-text available
The estimated global production of raspberry from year 2016 to 2020 averaged 846,515 tons. The most common cultivated Rubus spp. is European red raspberry (Rubus idaeus L. subsp. idaeus). Often cultivated for its high nutritional value, the red raspberry (Rubus idaeus) is susceptible to multiple viruses that lead to yield loss. These viruses are transmitted through different mechanisms, of which one is invertebrate vectors. Aphids and nematodes are known to be vectors of specific raspberry viruses. However, there are still other potential raspberry virus vectors that are not wellstudied. This review aimed to provide an overview of studies related to this topic. All the known invertebrates feeding on raspberry were summarized. Eight species of aphids and seven species of plant-parasitic nematodes were the only proven raspberry virus vectors. In addition, the eriophyid mite, Phyllocoptes gracilis, has been suggested as the natural vector of raspberry leaf blotch virus based on the current available evidence. Interactions between vector and non-vector herbivore may promote the spread of raspberry viruses. As a conclusion, there are still multiple aspects of this topic that require further studies to get a better understanding of the interactions among the viral pathogens, invertebrate vectors, and non-vectors in the raspberry agroecosystem. Eventually, this will assist in development of better pest management strategies.
... Seeds being healthy, this infection would be due to the transmission of viruses from one plant to another by insect vectors, especially adults of Bemisia. tabaci which snuck into the experimental plots and are able to transmit more than a hundred viruses (111 viruses), including Begomoviruses (90%), Criniviruses (6%), Ipomoviruses, Closteroviruses and Carlaviruses (Jones D, 2003;Fiallo-Olivié E, 2019). ...
Article
Full-text available
Faced with the problem of providing a balanced mineral nutrition to tomato plants in order to strengthen them to better resist viruses, this work proposed to study the effectiveness of fertilizers in the sustainable management of these in South Togo. Five fertilizers were tested on five tomato cultivars namely Caraïbo, Mongal F1, Petomech, Tropimech and Adakamenou during two great rainy seasons (GRS) of 2019 and 2020 following the split-plot design with fertilizers in main plots and cultivars in secondary plots. Weekly observation of virus incidence and severity according to a rating scale (1-5) indicated a very highly significant effect (P < 0.001) under the cultivars for both experiments. Caraïbo, Mongal F1 and Adakamenou were the least susceptible cultivars to virus diseases. Fertilizers only significantly impacted cultivar susceptibility to virus diseases in GRS 2019 where virus disease incidence was low and statistically identical (22.80%; 22.67%) under organic T2 manure (10 t ha-1 of manure) and low dose organo-mineral T3 manure (38 kg N, 15 kg P2O5, 15 kg K2O ha-1 and 5 t ha-1 of manure). The effect of fertilizer-cultivar interactions on virus severity was significant (P < 0.05) in 2020 and very highly significant (P < 0.001) in 2019. The organomineral manure used at a low dose seems to be the best strategy for reinforcing the obtaining of satisfactory fruit yields.
... It sucks phloem sap, leaving the affected plants extremely weak, and secretes a honeydew onto the surface of the leaves that promotes the growth of sooty mold fungus [7]. Besides direct damage caused by feeding, B. tabaci transmits more than a hundred begomoviruses, carlaviruses, criniviruses, cytorhabdoviruses, ipomoviruses, poleroviruses, and torradoviruses ( [8][9][10][11][12][13][14][15][16]. Among them, begomoviruses represent 90% of the viruses transmitted by B. tabaci. ...
Article
Full-text available
Chilli leaf curl virus (ChiLCV; genus: Begomovirus), transmitted by Bemisia tabaci Gennadius 8 (Hemiptera: Aleyrodidae) in a persistent-circulative manner, is a major constraint in chilli produc-9 tion. The present study demonstrates for the first time that topical spray of naked double-stranded 10 RNA (dsRNA) on chilli plants induces mortality and inability to acquire and transmit ChiLCV in B. 11 tabaci. dsRNA targeting heat shock protein 70 (hsp70) and fasciclin 2 (fas2) of B. tabaci was first assessed 12 under controlled conditions through oral delivery. Hsp70 and fas2 dsRNA resulted in up to 82.22 13 and 72% mortality of B. tabaci and around 12.4 and 8.5-fold decrease in mRNA levels, respectively 14 24 hrs post ingestion. ChiLCV copies in hsp70 dsRNA-fed B. tabaci steadily decreased with an in-15 crease in dsRNA concentration and were undetectable at a higher concentration of dsRNA. How-16 ever, ChiLCV copies significantly increased in fas2 dsRNA-fed B. tabaci. Transmission of ChiLCV by 17 B. tabaci was completely inhibited post 24 hrs feeding on hsp70 dsRNA at 3 µg/mL. Naked hsp70 18 dsRNA was topically sprayed on ChiLCV-infected chilli plants like an insecticide and 67.77 % mor-19 tality of B. tabaci, 4.6-fold downregulation of hsp70 mRNA, and 1.34E+15-fold decreased ChiLCV 20 copies in B. tabaci were recorded when adults were exposed to the dsRNA-treated plants under 21 semi-field conditions. Foliar application of naked dsRNA reduced the ChiLCV transmission by 75% 22 without any visible symptoms in the inoculated plants. Two consecutive sprays of dsRNA provided 23 significant protection to B. tabaci for up to 20 days under semi-field conditions. 24
... Moreover, the significant effect of cyantraniliprole on feeding behavior was analyzed using electrical penetration graphing (EPG) and was observed in several insects, including Myzus persicae (Sulzer), Bactericera cockerelli (Sulc), Frankliniella fusca (Hinds), and F. occidentalis [38][39][40]. Piercing and sucking insect pests not only cause direct damage to plants by stylet probing but also indirectly by transmitting plant viruses between plants during feeding [41]. Cyantraniliprole has excellent cross-spectrum activity against a wide range of pests, including lepidoptera, dipteran leafminers, fruit flies, beetles, whiteflies, thrips, aphids, leafhoppers, psyllids, and weevils [42]. ...
Article
Full-text available
While existing insecticides are becoming obsolete, the need for research and application of alternative substances is growing. Cyantraniliprole is a second-generation ryanodine receptor with the ability to bind and activate the ryanodine receptors in insect striated muscle cells, causing continuous muscular contraction, paralysis, and death. Many studies indicate its effectiveness on a variety of insects, but its action on storage pests has not yet been reported. We successfully conducted experiments for the first time on adult Tenebrio molitor, Tribolium confusum, Alphitobius diaperinus, Rhyzopertha dominica, and Trogoderma granarium with application of cyantraniliprole, causing dose-dependent mortality. Bioassays were carried out in the laboratory, where experimental adults were sprayed with six concentrations of cyantraniliprole. Mortality was recorded at 7, 14, 21, and 28 days after exposure. Mean mortality, survival concentration, and survival time were estimated for each species. The concentrations with both the highest mortality and the lowest survival rate were 2500 and 3000 ppm. Our results indicate that the tested insecticide was effective against T. confusum adults and is a promising pesticide for use in storage facilities.
... The whitefly Bemisia tabaci (Hemiptera: Aleyrodidae) is a serious global pest of vegetable and ornamental crops [1,2]. It feeds on over 1000 ornamental and vegetable plant species from 74 different families including the Asteraceae (sunflower, aster flowers), Fabaceae (acacia., lotus), and Solanaceae (pepper, tomato) that are among the most infested plants [3]. ...
Article
Full-text available
Transposable elements (TEs) are genetically mobile units that move from one site to another within a genome. These units can mediate regulatory changes that can result in massive changes in genes expression. In fact, a precise identification of TEs can allow the detection of the mechanisms involving these elements in gene regulation and genome evolution. In the present study, a genome-wide analysis of the Hemipteran pest Bemisia tabaci was conducted using bioinformatics tools to identify, annotate and estimate the age of TEs, in addition to their insertion sites, within or near of the defensome genes involved in insecticide resistance. Overall, 1,292,393 TE copies were identified in the B. tabaci genome grouped into 4872 lineages. A total of 699 lineages were found to belong to Class I of TEs, 1348 belong to Class II, and 2825 were uncategorized and form the largest part of TEs (28.81%). The TE age estimation revealed that the oldest TEs invasion happened 14 million years ago (MYA) and the most recent occurred 0.2 MYA with the insertion of Class II TE elements. The analysis of TE insertion sites in defensome genes revealed 94 insertions. Six of these TE insertions were found within or near previously identified differentially expressed insecticide resistance genes. These insertions may have a potential role in the observed insecticide resistance in these pests.
... Trialeurodes vaporariorum is a sucking pest native to Central and South America (Mound & Halsey 1978). As one of the most important crop pests and virus vectors (Jones 2003), it also causes substantial tomato crop loss in Kenya (Gamarra et al. 2016;Kimathi et al. 2020). Whiteflies are small-sized insects and are suspected to be able to pass through most nets, and T. absoluta females can oviposit on nets and subsequently the hatched larvae can produce a silk thread (Desneux et al. 2010) that they use to drop onto the tomato plants (AC personal observation). ...
Article
The abandonment of insecticide treatments to achieve sustainable crop production calls for a combination of methods to obtain satisfactory pest control. To this end, net houses and biological control are two promising methods, though we suspected that most natural enemies are blocked outside the net houses. In Kenya, tomato crops are particularly threatened by Trialeurodes vaporariorum (Westwood 1856) and Tuta absoluta (Meyrick, 1917) that are targets of most insecticide treatments in this country. We investigated in an on-farm experiment (i) the abundances of T. vaporariorum and T. absoluta in open fields and in net houses, (ii) the diversity of arthropod natural enemies of these pests, and (iii) the effect of net houses on the natural regulation. To complete, in the laboratory, we checked the capacity of natural enemies to pass through different net types. We identified several natural enemies, mainly the mirid bug Nesidiocoris tenuis (Reuter 1895) that was the most abundant predator for both pests. One parasitoid species was also identified for each pest, i.e. Encarsia formosa Gahan (1924) and Copidosoma sp. for T. vaporariorum and T. absoluta respectively. Net houses reduced drastically the pest populations. Predators were less abundant under net houses, while parasitoids did not seem to be affected by the nets. Encarsia formosa was shown to be able to pass through the different net types, while N. tenuis adults were not. These results raise the potential for augmentative biological control under net houses. Using kairomones to attract natural enemies, or introducing natural enemies under the net houses through inoculative releases, are two approaches to increase the abundance of natural enemies under net houses.
... Tipe tanggap fungsional predator ditentukan berdasarkan nilai R 2 dari analisis regresi antara jumlah mangsa yang dikonsumsi (Ne) terhadap jumlah mangsa yang dipaparkan (No). Nilai R 2 tertinggi yang mendekati 1 ditetapkan sebagai tipe tanggap fungsional yang dimaksud, hal ini mengacu pada Jones (2003 Hubungan kemampuan pemangsaan predator terhadap kerapatan mangsa ini juga dijelaskan dalam tanggap fungsional. Sebagai komponen yang esensial dalam dinamika interaksi antara predator dan mangsanya, tanggap fungsional dinilai Imago M. persicae 0,038 ± 0,004 b 0,026 ± 0,001 abcd 0,045* Huruf yang sama dalam satu kolom menunjukkan tidak terdapat perbedaan yang signifikan berdasarkan uji Tukey pada taraf nyata 5%. ...
Article
Full-text available
The whitefly, Bemisia tabaci (Gennadius) and the aphid, Myzus persicae (Sulzer) are important pests in tomato and chilli pepper. These pests directly attack and as a viral vector can decrease the production of tomato and chili pepper. Menochilus sexmaculatus (Fabricius) and Micraspis lineata (Thunberg) are predator beetles of B. tabaci and M. persicae. This study aimed to know the potential predation of M. sexmaculatus and M. lineata as a predator of B. tabaci and M. persicae. Completely randomized factorial design using 2 factors consist of type and density of prey with 3 replicates used in this study. The potency of predatory coccinellidae as predator of B. tabaci and M. persicae was evaluated in 2 observations, i.e. predation and functional response assay. Based on logistic regression analysis, both of M. sexmaculatus and M. lineata showed characteristic of type I functional, this means that the higher density of prey, the ability and predation rate of M. sexmaculatus and M. lineata were also increased. The predator M. sexmaculatus and M. lineata were more effective to control M. persicae than B. tabaci. M. sexmaculatus was the effective predator to control adult of M. persicae.
... Differential roles of AC2 and AC4 of CMD viruses in the suppression of cassava mechanism of defence were largely described by Vanitharani etal. (2004).Such viruses are transmitted by whiteflies (Bemisiatabaci Gennadius -Hemiptera, Aleyrodidae) in a circulative manner (Njoroge et al. 2017;Maruthi et al. 2017Maruthi et al. , 2005Legg etal., 2006;Jones, 2003, Deng etal., 1994. ...
... Watermelon belongs to the family cucurbitaceae and is widely cultivated in different regions of the world. (Jones, 2003). Impact of invasive vertebrates, including a variety of avian pests viz. ...
Article
Full-text available
Present paper provides information on reducing the watermelon damage by using the distress sound player. As it is ranked as an important nutritional fruit crop of Pakistan, it is subjected to an intensive depredation by common myna (Acridotheres tristris), house crow (Corvus splendens) and house sparrow (Passer domesticus) in the unprotected conditions, causing not only severe damage but resultant economic losses. At the unguarded seedling stage, the damage was 1.192±0.023, and in protected with sound player it remained 0.200±0.014, while protected at foliage, flowering and mature stages, it remained as low as 0.130±0.007, 0.155±0.010, and 0.138±0.020, showing its effectiveness. It, therefore, suggests that use of this repellent can avert the damage not only on watermelon, but for other fruit crops, and by and large incorporation of mechanical and that the use of similar mechanical repellents, would be useful to inhibit the damage and restrain serious and economically important bird depredations on the sustainable horticultural and agricultural crops in Pakistan.
... The proliferation of greenhouses in Kenya has provided optimum climatic conditions for the high reproduction rates and proliferation of T. vaporariorum (Jones, 2003;Wainaina et al., 2018). From the greenhouses, the pest subsequently escapes into open fields, hence, its presence in both open and protected agricultural systems (Lapidot et al., 2014;Perring et al., 2018). ...
Article
Full-text available
In the scope of mitigating the negative impacts of pesticide use and managing greenhouse whiteflies, Trialeurodes vaporariorum sustainably, 16 endophytic fungal isolates from five different genera ( Beauveria , Trichoderma , Hypocrea , Bionectria , and Fusarium ) were screened for their ability to colonise two preferred host plant species, namely, tomato ( Solanum lycopersicum L.) and French bean ( Phaseolus vulgaris L.), through seed inoculation. Seven and nine isolates were endophytic to P. vulgaris and S. lycopersicum , respectively, where significant differences in the endophytic colonisation rates were observed among the fungal isolates in P. vulgaris and its plant parts, with a significant interaction between the isolates and plant parts in S. lycopersicum . Hypocrea lixii F3ST1, Trichoderma asperellum M2RT4, Trichoderma atroviride F5S21, and T. harzianum KF2R41 successfully colonised all the plant parts of both hosts and therefore were selected and further evaluated for their endophytic persistence, effect on plant growth, and pathogenicity to T . vaporariorum adults and F1 progeny. The four endophytes remained in both host plants for the 5-week assessment with varied colonisation rates related to the strong interaction with the time, isolates, and plant parts in both hosts. The effect of the same endophytes on the different host growth parameters varied in P. vulgaris and S. lycopersicum , with T. asperellum M2RT4 not boosting the growth in both host plants while T . atroviride F5S21 resulted in enhanced shoot biomass in S. lycopersicum . T. atroviride F5S21 and T . harzianum KF2R41 inoculated S. lycopersicum plants and H. lixii F3ST1, T. asperellum M2RT4, and T . harzianum KF2R41 inoculated P. vulgaris plants had significantly lower oviposition, while nymph development in both hosts was significantly prolonged in all the endophytically–colonised plants. The endophytes H. lixii F3ST1 and T. asperellum M2RT4 significantly reduced the longevity/survival of the exposed T. vaporariorum adults and the progeny in both S. lycopersicum and P. vulgaris . The findings demonstrate the attributes of the various endophytes in host plant growth promotion as well as their effects on the life-history parameters of T. vaporariorum and could consequently be developed as potential endophytic fungal-based biopesticides for the sustainable management of the pest in S. lycopersicum and P. vulgaris cropping systems.
... Serangga dewasa diketahui dapat membawa lebih dari 100 jenis virus tanaman diantaranya kelompok Begomovirus, Crinicirus, Ipomovirus, Torradovirus, dan Carlavirus(Jones, 2003; Navas-Castilo et al., 2011). Pada beberapa galur kedelai, identifikasi ketahanan galur terhadap serangan hama ini telah dilakukan.Inayati & Marwoto, (2012) melaporkan bahwa budidaya dengan varietas tahan dapat menekan kehilangan hasil hingga 80 %. ...
Conference Paper
Full-text available
Kacang nasi (Rice bean, Vigna umbellata) merupakan salah satu kacang potensial baik sebagai bahan pangan maupun pakan ternak. Kacang nasi diketahui memiliki kandungan protein yang tinggi. Budidaya tanaman ini tidak terlepas dari serangan hama, salah satunya kutu kebul (Bemisia tabaci). Penelitian ini bertujuan melihat keberadaan kutu kebul pada 30 aksesi kacang nasi. Penelitian dilaksanakan di rumah kaca dengan menggunakan rancangan acak kelompok, 3 ulangan, dan perlakuan terdiri dari 30 aksesi kacang nasi dengan infestasi hama secara alami. Hasil penelitian menunjukkan bahwa setiap aksesi kacang nasi memiliki respon gejala yang berbeda terhadap serangan kutu kebul diantaranya Bintik kuning (Bk); Bintik kuning disertai klorosis (BkKl); mosaik dan daun menyempit (MzDs); daun menguning dan tanaman menua dini (DkMd); tanaman menua dini dan tertutup embun jelaga (Md, Ej); daun coklat dan intensitas daun gugur tinggi (Dc,Gr). Beberapa aksesi diketahui memiliki intensitas serangan sedang hingga tinggi terhadap kutu kebul, sedangkan dua aksesi (11A dan 3A) diketahui memiliki intensitas serangan rendah pada pengamatan minggu pertama dan kedua. Aksesi dengan gejala serangan klorosis dan embun jelaga diketahui mengalami peningkatan serangan pada minggu kedua pengamatan. Kerapatan trikoma daun diketahui tidak berpengaruh dominan terhadap populasi kutu kebul. Kata Kunci: Bemisia tabaci, kacang nasi, serangan
... Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae) is one of the most threatening pests in many crops worldwide (De ). This species directly or indirectly affects more than 600 plant species by feeding on phloem, excreting honeydew, and transmitting plant viruses, resulting in significant agricultural losses (Simmons et al. 2008;Jones 2003;Navas-Castillo et al. 2011;Oliveira et al. 2001). Recent genomic studies have shown that B. tabaci is a unique species complex composed of more than 42 morphologically indistinguishable cryptic species (Kanakala and Ghanim 2019;De Barro et al. 2011). ...
Article
Full-text available
Bemisia tabaci is an important pest affecting agricultural and horticultural crops worldwide and comprises a complex of cryptic species. In China, the introduction of the two invasive cryptic species, Middle East-Asia Minor 1 (MEAM1) and Mediterranean (MED), has considerably affected the ecological niche of the native cryptic species. Based on occurrence records obtained through field surveys and high-resolution environmental data, using maximum entropy modelling, we established ecological niche models to predict the distribution of invasive and native cryptic species of B. tabaci in China and identified the differences in ecological niches. The results showed that the distribution range and niche breadth of the invasive cryptic species exceed that of the native cryptic species in the order of MED > MEAM1 > China1 > Asia1. There are different degrees of niche overlap and range overlap between cryptic species. Moreover, the important environmental variables affecting their distribution were different, as well as their response and adaptation to most environmental variables. Our results suggest that the B. tabaci species complex occupies a complex ecological niche in China. The findings improve our understanding of the ecological characteristics of B. tabaci species complex, which will be useful in the development of prevention and control strategies for this pest in China.
... Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae) is one of the most important agricultural pests and the most efficient vectors for the transmission of plant viruses in the world (De Barro et al. 2011). Previous studies have reported that more than 500 species of plant viruses from 5 families and 5 genera are transmitted by B. tabaci (Jones 2003, Bragard et al. 2013, Polston et al. 2014, He et al. 2021, and some of these viruses have caused serious damage and economic losses to agricultural production. ...
Article
Full-text available
Plant viruses can change the phenotypes and defense pathways of the host plants and the performance of their vectors to facilitate their transmission. Cucurbit chlorotic yellows virus (CCYV) (Crinivirus), a newly reported virus occurring on cucurbit plants and many other plant species, is transmitted specifically by Bemisia tabaci MEAM1 (B biotype) and MED (Q biotype) cryptic species in a semipersistent manner. This study evaluated the impacts of CCYV on B. tabaci to better understand the plant-virus-vector interactions. By using CCYV-B. tabaci MED-cucumber as the model, we investigated whether or how a semipersistent plant virus impacts the biology of its whitefly vector. CCYV mRNAs were detectable in nymphs from first to fourth instars and adults of B. tabaci with different titers. Nymph instar durations and adult longevity of female whiteflies greatly extended on CCYV-infected plants, but nymph instar durations and adult longevity of male whiteflies were not significantly influenced. In addition, the body length and oviposition increased in adults feeding on CCYV-infected plants, but the hatching rates of eggs and survival rates of different stages were not affected. Most interestingly, the sex ratio (male:female) significantly reduced to 0.5:1 in whitefly populations on CCYV-infected plants, while the ratio remained about 1:1 on healthy plants. These results indicated that CCYV can significantly impact the biological characteristics of its vector B. tabaci. It is speculated that CCYV and B. tabaci have established a typical mutualist relationship mediated by host plants.
... Silverleaf whitefly, Bemisia tabaci Gennadius (Hemiptera: Aleyrodidae) is an invasive insect pest and vector of several plant viruses (Legarrea et al., 2015). Transmission of several begomoviruses, carlaviruses, criniviruses, cytorhabdoviruses, ipomoviruses, poleroviruses, and torradoviruses by B. tabaci causes economic losses exceeding billions of US$ and threatens food security (Dasgupta et al., 2003;Jones, 2003;Navas-Castillo et al., 2011;Brown et al., 2015;Orfanidou et al., 2016;Saeed and Samad, 2017;Zanardo and Carvalho, 2017;Ghosh et al., 2019;Costa et al., 2020;Pinheiro-Lima et al., 2020;Cornejo-Franco et al., 2022). ...
Article
Full-text available
Bemisia tabaci (Hemiptera: Aleyrodidae) is a highly efficient vector in the spread of chilli leaf curl virus (ChiLCV, Begomovirus) which is a major constraint in the production of chilli in South Asia. Transcriptome analysis of B. tabaci post-6 h acquisition of ChiLCV showed differential expression of 80 (29 upregulated and 51 downregulated) genes. The maximum number of DEGs are categorized under the biological processes category followed by cellular components and molecular functions. KEGG analysis of DEGs showed that the genes are involved in the functions like metabolism, signaling pathways, cellular processes, and organismal systems. The expression of highly expressed 20 genes post-ChiLCV acquisition was validated in RT-qPCR. DEGs such as cytosolic carboxypeptidase 3, dual-specificity protein phosphatase 10, 15, dynein axonemal heavy chain 17, fasciclin 2, inhibin beta chain, replication factor A protein 1, and Tob1 were found enriched and favored the virus infection and circulation in B. tabaci. The present study provides an improved understanding of the networks of molecular interactions between ChiLCV and B. tabaci. The candidate genes involved in ChiLCV transmission would be novel targets for the management of the B. tabaci-begomovirus complex.
... 6,7 B. tabaci is also an effective vector for plant viruses. 8 For example, B. tabaci transmits the Cotton leaf curl virus, determine the species composition and resistance gene frequencies to pyrethroids and OPs in B. tabaci field samples from New South Wales (NSW) and Qld between 2013 and 2021. Furthermore, we used pyrethroid bioassay data from the same period to test for a correlation between the frequency of the resistance allele for pyrethroid resistance and survival at the discriminating dose. ...
Article
Background: Species within the Bemisia tabaci cryptic species complex can cause significant crop damage. We used high-throughput amplicon sequencing to identify the species composition and resistance allele genotypes in field populations from cotton fields in Australia. For selected populations, the resistance phenotype was determined in bioassays and compared to sequencing data. Results: A metabarcoding approach was used to analyse the species composition in 144 field populations collected between 2013-2021. Two mixed AUS I and MEAM1 populations were detected while the remaining 142 populations consisted of MEAM1 only. High-throughput sequencing of organophosphate and pyrethroid resistance gene amplicons showed that the organophosphate resistance allele F331W was fixed (>99%) in all MEAM1 populations, while the pyrethroid resistance allele L925I in the voltage-gated sodium channel gene was detected at varying frequencies [1.0-7.0% (43 populations); 27.7% and 42.1% (2 populations); 95-97.5% (3 populations)]. Neither organophosphate nor pyrethroid resistance alleles were detected in the AUS I populations. Pyrethroid bioassays of 85 MEAM1 field-derived populations detected no resistance in 51 populations, while 32 populations showed low frequency resistance, and 2 populations were highly resistant. Conclusions: We demonstrate that high-throughput sequencing and bioassays are complementary approaches. The detection of target site mutations and the phenotypic provides a comprehensive analysis of the low-level resistance to pyrethroids that is present in Australian cotton farms. In contrast, a limited survey of whitefly populations from horticulture found evidence of high-level resistance against pyrethroids. Furthermore, we found that the F331W allele (linked to organophosphate resistance) is ubiquitous in Australian MEAM1. This article is protected by copyright. All rights reserved.
... Silverleaf whitefly, Bemisia tabaci Gennadius (Hemiptera: Aleyrodidae) is an invasive insect pest and vector of several plant viruses (Legarrea et al., 2015). Transmission of several begomoviruses, carlaviruses, criniviruses, cytorhabdoviruses, ipomoviruses, poleroviruses, and torradoviruses by B. tabaci causes economic losses exceeding billions of US$ and threatens food security (Dasgupta et al., 2003;Jones, 2003;Navas-Castillo et al., 2011;Brown et al., 2015;Orfanidou et al., 2016;Saeed and Samad, 2017;Zanardo and Carvalho, 2017;Ghosh et al., 2019;Costa et al., 2020;Pinheiro-Lima et al., 2020;Cornejo-Franco et al., 2022). ...
Thesis
Chilli leaf curl disease caused by chilli leaf curl virus (ChiLCV, Begomovirus) is the major constrain in chilli production globally. ChiLCV is transmitted by Silverleaf whitefly (Bemisia tabaci, Hemiptera: Aleyrodidae) in a persistent circulative manner. The use of insecticides to control the vector population is commonly practiced to manage the disease. Understanding the molecular interactions between ChiLCV and B. tabaci and interrupting the interrelationship is a promising approach alternative to hazardous pesticides. Transcriptome analysis of B. tabaci at an early stage of ChiLCV infection showed differential expression of 80 (29 upregulated and 51 downregulated) genes. The highest numbers of differentially expressed genes are categorized under molecular functions, followed by cellular components and biological processes. KEGG pathway analysis of differentially expressed genes showed that the genes are involved in the functions like metabolism, signaling pathways, cellular processes, and organismal systems. Regulation of key DEGs such as carboxypeptidases, dual specificity protein phosphate, dynein, fasciclin 2, inhibin beta chain, replication factor, and Tob1 protein involved in receptor binding, viral accumulation, apoptosis, intracellular trafficking, cellular signaling, and endocytosis might favour the virus infection and circulation in B. tabaci. The present study helps in understanding the networks of molecular interactions between ChiLCV and B. tabaci. The candidate genes involved in the key physiological process and ChiLCV transmission by B. tabaci would be novel targets for sustainable management of the B. tabaci-begomovirus complex.
... Furthermore, the development of nymphs is commonly linked to the formation of sooty molds, which limit photosynthesis and cause defoliation and stunting [4]. Virus transmission can potentially cause significant damage as B. tabaci is a vector for over 100 plant viruses [5][6][7]. Tomato yellow leaf curl virus (TYLCV) and cucumber vein yellowing virus (CVYV) are two examples. These viruses are a severe problem for tomato and cucumber plants, causing yield loss of 50 to 100 percent [8,9]. ...
Article
Full-text available
Pests represent a huge problem in crop production causing significant losses. Currently, biocontrol is utilized as an eco-friendly approach for controlling pests and reducing the shortage in crop production. In the current study, the production of a biocontrol agent, which was identified based on sequencing of the 16S rRNA gene as Bacillusvelezensis strain GB1 with GenBank accession No. OM836750, was carried out in the stirred tank bioreactor using a batch fermentation process. For the first time, B. velezensis strain GB1 was tested as a biocontrol agent with soil drench application (109 cfu mL−1) for management of Bemisia tabaci and induction of squash plant systemic resistance under greenhouse conditions. β-1,3-glucanase, chitinase, polyphenol oxidase, and peroxidase activity were measured in squash leaves at 24, 48, 72, 96, and 120 h. The influence of B. velezensis strain GB1 on population density, fertility, and hatchability of B. tabaci on squash plants was studied. The batch fermentation process of B. velezensis strain GB1 maximized the production of secondary metabolites and culture biomass, which reached a maximum value of 3.8 g L−1 at 10.5 h with a yield coefficient of 0.65 g cells/g glucose. Treatment with B. velezensis strain GB1 induced squash plants to boost their levels of β-1,3-glucanase, chitinase, polyphenol oxidase, and peroxidase enzymes. On the other hand, B. velezensis strain GB1 could significantly reduce the mean number of the attracted B. tabaci on squash plants. Additionally, whiteflies laid a lower mean number of 2.28 eggs/female/day on squash plants inoculated with B. velezensis strain GB1 compared to control. The percentage of B. tabaci egg hatchability declined by 5.7% in the B. velezensis-inoculated squash plants.
... Furthermore, the development of nymphs is commonly linked to the formation of sooty molds, which limit photosynthesis and cause defoliation and stunting [4]. Virus transmission can potentially cause significant damage as B. tabaci is a vector for over 100 plant viruses [5][6][7]. Tomato yellow leaf curl virus (TYLCV) and cucumber vein yellowing virus (CVYV) are two examples. These viruses are a severe problem for tomato and cucumber plants, causing yield loss of 50 to 100 percent [8,9]. ...
... Therefore, its control is particularly challenging in many agroecosystems. Whiteflies in the B. tabaci complex are known to feed on over 1,000 species of plants (Simmons et al., 2008;Abd-Rabou and Simmons, 2010), transmit over 100 plant viruses (Jones, 2003), and are spread across every continent, except Antarctica (De Barro et al., 2000a;De Barro et al., 2000b). In addition to crop plants, other primary plant species that serve as hosts for whiteflies include weeds and other plants in the agroecosystem that have no or reduced economic value. ...
Article
Full-text available
Climate change is expected to have an impact on pest management in different agroecosystems. Pest management strategies in these agroecosystems may need to be adjusted in responses to long term changes in pest populations. The whitefly Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae) is an important pest on a global scale because of its voracious feeding and its role in transmission of numerous plant viruses in many agroecosystems. A field study was conducted to help elucidate the impact of climate change on populations of whiteflies in vegetable agroecosystems in Egypt. Mild winter temperatures allow whiteflies to live year-round in these agroecosystems. Predictions of populations of B. tabaci were done for agroecosystems in three Egyptian governorates (Dakahlia, Damietta, and Sohag). The Sohag site was in the Nile Valley (about 520 km south of Cairo). The other two sites (Dakahlia and Damietta) were in the Nile River Delta (about 110 km and 155 km north of Cairo, respectively). Historical seasonal patterns as well as long-term values (for the years 2041 and 2070) of populations of whiteflies were estimated. The results based on our analysis of the temperature and whitefly population patterns spanning an excess of three decades (from 1980 to 2013) support that the temperature continued to rise, and the whitefly population continued to increase among years in each agroecosystem. Results from this research will help agricultural stakeholders in understanding the impact of changing environments on populations of whiteflies.
... Cotton whitefly damages the plant by sucking cell sap resulting in 50% reduction in boll production [7] and act as a vector of leaf curl virus disease (CLCV) [8], which is threatening our cotton-based economy. It acts as a sole vector of more than 100 plant viruses, which cause diseases to many commercial crops in different parts of the world [9]. Heavy infestation may reduce plant vigor and growth, cause chlorosis and uneven ripening of bolls. ...
Article
Full-text available
Studies were carried out to investigate the population dynamics and the effect of abiotic factors on population dynamics of sucking insect pests of BT cotton whitefly (Bemisia tabaci) and jassid (Amrasca biguttula), under unprotected condition. The results of the field study revealed that the sucking pest (whiteflies and jassids) population was maximum at the highest temperature. (11.68) of whiteflies per leaf was recorded at highest temperature (45 oC) and lowest humidity (30%). Similarly, the maximum population (3.53) of jassids per leaf was recorded at maximum temperature (45 oC) and lowest humidity (30%) on July 10th, 2017. The rainfall had a slight impact on the population of whiteflies and Jassids. Simple correlation analysis revealed that maximum temperature showed a significant positive effect and the minimum temperature showed a negative effect on these pests. The relative humidity was non-significant effect, whereas precipitation was a negative effect on all the sucking pests
... Furthermore, the development of nymphs is commonly linked to the formation of sooty molds, which limit photosynthesis and cause defoliation and stunting [4]. Virus transmission can potentially cause significant damage as B. tabaci is a vector for over 100 plant viruses [5][6][7]. Tomato yellow leaf curl virus (TYLCV) and cucumber vein yellowing virus (CVYV) are two examples. These viruses are a severe problem for tomato and cucumber plants, causing yield loss of 50 to 100 percent [8,9]. ...
... The whitefly, Bemisia tabaci, is an economically important agricultural pest causing huge damage to crops worldwide. They inflict damage to plants directly and as a vector of several hundred viruses, with a majority (>320 species) of them belonging to the genus Begomovirus and other economically important viruses belonging to the genera Ipomovirus, Carlavirus, Crinivirus, Torradovirus, and Polerovirus (Jones, 2003;Mugerwa et al., 2021). Whitefly is composed of a complex group of genetically distinct species and/or biotypes that differ substantively by host plant preference, virus transmitting ability, and insecticide resistance (De Barro et al., 2011;Barman et al., 2022). ...
Article
Full-text available
Bemisia tabaci (whitefly) is one of the most detrimental agricultural insect pests and vectors of many plant viruses distributed worldwide. Knowledge of the distribution patterns and insecticide resistance of this cryptic species is crucial for its management. In this study, genetic variation of mitochondrial cytochrome oxidase subunit 1 (MtCoI) gene of B. tabaci was analyzed followed by a study of the infection profile of various endosymbionts in 26 whitefly populations collected from West Bengal, India. Phylogenetic analysis revealed Asia I as the major cryptic species (65.38%), followed by Asia II 5, China 3, and Asia II 7, which were diversified into 20 different haplotypes. In addition to the primary endosymbiont (C. poriera), each of the four whitefly species showed a variable population of three secondary endosymbionts, majorly Arsenophonus with the highest infection rate (73.07%), followed by Wolbachia and Rickettsia. Further phylogenetic analyses revealed the presence of two subgroups of Arsenophonus, viz., A1 and A2, and one each in Wolbachia (W1) and Rickettsia (R3). Resistance to thiamethoxam, imidacloprid, and acetamiprid insecticides was analyzed for a clear picture of pesticide resistance status. The highest susceptibility was noted toward thiamethoxam (LC 50 = 5.36 mg/L), followed by imidacloprid and acetamiprid. The whitefly population from Purulia and Hooghly districts bearing Asia II 7 and Asia II 5 cryptic species, respectively, shows maximum resistance. The differences in mean relative titer of four symbiotic bacteria among field populations varied considerably; however, a significant positive linear correlation was observed between the resistance level and relative titer of Arsenophonus and Wolbachia in the case of imidacloprid and thiamethoxam, while only Wolbachia was found in case of acetamiprid. Expression analysis demonstrated differential upregulation of insecticide resistance genes with Purulia and Hooghly populations showing maximally upregulated P450 genes. Moreover, thiamethoxam and imidacloprid resistance ratio (RR) showed a significant correlation with CYP6CM1, CYP6DZ7, and CYP4C64 genes, while acetamiprid RR correlated with Barman et al. Neonicotinoid Resistance in Whitefly Species CYP6CX1, CYP6DW2, CYP6DZ7, and CYP4C64 genes. Taken together, these findings suggested that P450 mono-oxygenase and symbiotic bacteria together affected whitefly resistance to neonicotinoids. Hence, a symbiont-oriented management programme could be a better alternative to control or delay resistance development in whitefly and can be used for pesticide clean-up in an agricultural field.
... T. perseae is not known to vector any plant viruses (Jones, 2003). ...
Article
Full-text available
Abstract The EFSA Panel on Plant Health performed a pest categorisation of Tetraleurodes perseae (Hemiptera: Aleyrodidae), the red‐banded whitefly, for the territory of the EU. T. perseae is a tropical and subtropical species that originated in the Neotropical region and has now spread and established in the USA (California and Florida), Israel and Lebanon. T. perseae is not listed in Commission Implementing Regulation (EU) 2019/2072. It is oligophagous on Lauraceae and most frequently reported on avocado (Persea americana), on which it is considered a minor or secondary pest. No evidence was found indicating damage to other plants. T. perseae larvae develop on the foliage and don’t attack the fruit. The number of generations per year varies between one and ten. High populations may promote the growth of black sooty moulds on the foliage and fruit, and adults feeding on the buds can lead to deformed immature leaves and premature leaf drop. However, T. perseae populations are usually effectively controlled by hymenopteran parasitoids, at least one of which (Cales noacki) is widespread in the EU. The producers of organic avocados in the EU could encourage the use of C. noacki, although occasional outbreaks of T. perseae could temporarily impact the fruit quality. Adults disperse naturally by flying and all stages can be moved over long distances by the trade of infested plant material. Plants for planting provide potential pathways for entry and spread in the EU. Climatic conditions and availability of host plants in southern EU countries are conducive for establishment. Phytosanitary measures are available to reduce the risk. T. perseae satisfies all of the criteria that are within the remit of EFSA to assess for it to be regarded as a potential Union quarantine pest. However, this conclusion has a high uncertainty regarding magnitude of potential impact as the insect is a minor and sporadic pest in its current area of distribution.
... It poses a threat to crop production through direct feeding and honeydew secretion [1][2][3][4]. B. tabaci can also transmit more than 300 plant viruses and lead to virus outbreaks [5][6][7]. Tomato chlorosis virus (ToCV) (Closteroviridae: Crinivirus) has spread from north central Florida (USA) into many countries, including China, accompanied by the outbreak of B. tabaci [8][9][10]. ToCV can infect numerous plants, and the spread of this virus depends on B. tabaci in many places [11][12][13][14]. ...
Article
Full-text available
Tomato chlorosis virus (ToCV) has seriously impacted tomato production around the world. ToCV is semi-persistently transmitted by the whitefly, Bemisia tabaci, which is a serious agricultural pest in the world. However, the interaction mechanism between ToCV and its whitefly vector is still poorly understood. Our previous transcriptome analysis demonstrated that the expression level of an immune-related gene, prophenoloxidase (PPO), in B. tabaci increased after ToCV acquisition, which indicates that the PPO may be involved in the interaction mechanism between the ToCV and its vector. To determine the role of the PPO in the acquisition and retention of ToCV by B. tabaci, we cloned the complete Open Reading Frames (ORF) of the BtPPOs (BtPPO1 and BtPPO2), and then structure and phylogenetic analyses were performed. BtPPOs were closely related to the PPO genes of Hemiptera insects. Spatial-temporal expression detection was qualified by using reverse transcription quantitative PCR (RT-qPCR), and this revealed that BtPPOs were expressed in all tissues and developmental stages. We found that only BtPPO1 was significantly upregulated after B. tabaci acquired ToCV for 12 and 24 h. According to the paraffin-fluorescence probe-fluorescence in situ hybridization (FISH) experiment, we verified that ToCV and BtPPO1 were co-located in the thorax of B. tabaci, which further revealed the location of their interaction. Finally, the effects of the BtPPOs on ToCV acquisition and retention by B. tabaci were determined using RNA interference (RNAi). The results showed that the RNAi of the responsive gene (BtPPO1) significantly increased the titer of ToCV in B. tabaci. These results demonstrate that BtPPO1 participates in ToCV acquisition and retention by B. tabaci.
... In particular, whiteflies were observed by the authors on several species of the Brassicaceae family, including M. livida, in arid sites. The whitefly damages host plants by secreting toxic saliva, removing phloem sap, and transmitting viruses (Jones, 2003). A laboratory-grown population was used (provided by Prof. Shai Morin, The Hebrew University of Jerusalem, Israel). ...
Article
Full-text available
Floral volatiles are among the well‐known cues that mediate plant‐pollinator interactions. Understanding plant‐pollinator interactions is especially important in arid regions, where the low abundance of pollinators limits their visiting frequency and, thus, constraints the reproductive success of many plant species. Moreover, plants in such arid habitats are exposed to abiotic stress, particularly to water shortage. Plants in arid habitats are also prone to suffer from multiple stress factors, such as the addition of pathogen and herbivore attacks. All these stress factors induce disruptions in the plant metabolism and increase physiological costs that may lead to changes in floral volatiles, thus affecting the communication between the plant and its pollinators, consequently intensifying the constraints on the plants’ reproductive success. To explore this general hypothesis, we used as a model Matthiola livida (Delile) DC. (Brassicaceae), a common native plant species in arid regions of the Middle East. We first tested whether water shortage and insect herbivory, inflicted by whiteflies, Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae), caused stress in M. livida, based on the change in carbohydrates and starch content, and examined whether the plants produced distinct volatile composition in response to these stressors. Then, we tested whether bumblebees, Bombus terrestris (L.) (Hymenoptera: Apidae), common pollinators of M. livida, were able to differentiate between plants suffering from water shortage and insect herbivory based only on volatile emission. We found that both water shortage and insect herbivory caused stress in the plants. We also found that the plants produced a distinct volatile composition in relation to the specific stress they were exposed to. Specifically, in comparison to control plants, insect herbivory increased the amounts of volatile alkanes, aldehydes, and alcohols, and reduced the amounts of esters, benzenoids, and phenylpropanoids. Water shortage reduced the amount of aldehyde volatiles and increased the amount of alcohol volatiles. Moreover, using choice experiments, we found that bumblebees differentiated between stressed and non‐stressed plants based on their volatile compositions, and preferred less stressed ones. Our study indicated that pollinators may use floral volatiles in their foraging decisions and are highly sensitive to variation in the plant conditions. This suggests that volatile cues may create a constraint on the ability of the plants to secure their reproductive success in arid habitats, that are added to the direct stress created by the arid conditions themselves.
... This is an economically important invasive species that causes considerable damage to agricultural crops. In addition to directly feeding on plants, some whitefly species can also transmit plant viruses, with one study suggesting that 114 virus species are transmitted by whiteflies [20]. ...
Article
Full-text available
Background: In this study, the entire mitochondrial genome (mitogenome) of Aleuroclava psidii (Singh, 1931) (Hemiptera: Aleyrodidae) was sequenced. The species A. psidii is currently classified in the subfamily Aleyrodinae. This mitogenome is the first representative from the genus Aleuroclava. Methods: Next-generation sequencing was used to obtain the molecular data. We conducted phylogenetic analyses with 18 existing mitogenomes of whiteflies and three outgroups of psyllids, under the Maximum likelihood and Bayesian inference criteria. Results: The arrangement of genes differed between the mitogenome of A. psidii and the putative ancestral insect mitogenome, and also differed from the mitogenomes of other whiteflies. Mitochondrial gene rearrangements involved the transpositions of trnQ, trnY, and the protein-coding gene nad1. Most hemipteran mitogenomes have the same mitochondrial gene order as that inferred to be ancestral for insects. However, there are an increased number of gene rearrangements in the mitogenomes of whiteflies. Phylogenetic reconstructions supported Aleurodicinae and Aleyrodinae as being monophyletic. Conclusions: Comparison of the gene order of mitogenomes revealed a clade-specific evolutionary trend in whiteflies. This study demonstrates the potential of using structural rearrangements to resolve major phylogenetic relationships within Aleyrodidae.
Article
Full-text available
South Georgia represents an area of intensive agricultural production where cultivated crops serve as hosts of the sweetpotato whitefly, Bemisia tabaci Gennadius (Hemiptera: Aleyrodidae), throughout the year. In addition to cultivated hosts, there are numerous weed species present in the agricultural landscape that are undoubtedly responsible for supporting B. tabaci population development. This study provided information on the most abundant weed hosts of B. tabaci from this region. We evaluated 31 different weed species, of which 16 weed species are reproductive hosts with varying degrees of preference. Suitable weed hosts included cypressvine morningglory (Ipomoea quamoclit L.), nodding spurge (Euphorbia nutans Lag.), prickly sida (Sida spinosa L.), sharppod morningglory (Ipomoea cordatotriloba Dennst.), smallflower morningglory (Jacquemontia tamnifolia L.), tall vervain (Verbena bonariensis L.), and wild poinsettia (Euphorbia heterophylla L.). These species are highly abundant and therefore likely influence B. tabaci populations in the landscape. Other species including bristly starbur (Acanthospermum hispidum DC) and redweed (Melochia corchorifolia L.) were highly preferred by B. tabaci but not nearly as abundant in the landscape. Furthermore, we identified 10 very common weed species that were poor reproductive hosts including wild radish (Raphanus raphanistrum L.), Palmer amaranth (Amaranthus palmeri S. Watson), common ragweed (Ambrosia artemisiifolia L.), Florida pusley (Richardia scabra L.), and henbit (Lamium amplexicaule L.).
Article
Full-text available
Current approaches to controlling plant viral diseases mainly focus on plant resistance, whereas suppression of viruses in vector species could provide an important alternative approach. Here we identified the therapeutic compound, gossypol, as capable of clearing Tomato yellow leaf curl virus (TYLCV) from its vector Bemisia tabaci (whitefly). Our initial field surveys showed that no whiteflies identified from cotton carried TYLCV, in contrast to a high incidence of this virus in whiteflies from other crops including tomato, cucumber and sweet potato. We found that when whiteflies were transferred from tomato or cucumber to cotton, there was a sharp reduction in the number of viruliferous whiteflies. When the whiteflies fed on cotton or ingested the metabolite, gossypol, derived from cotton, there was a sharp decrease in the incidence and abundance of TYLCV carried by the whiteflies. Gossypol degraded the coat protein and viral genome of TYLCV both in vitro and in vivo. Laboratory and field trials all showed that gossypol decreased TYLCV disease severity and had therapeutic efficacy on the disease. Our findings point to the possibility of identifying virus-therapeutic compounds by initially screening viruses in vectors derived from different crop plants.
Article
Full-text available
Middle East-Asia Minor 1 (MEAM1) and Mediterranean (MED) are two of the most invasive members of the sweetpotato whitefly, Bemisia tabaci, cryptic species complexes and are efficient vectors of begomoviruses. Bemisia tabaci MEAM1 is the predominant vector of begomoviruses in open-field vegetable crops in the southeastern United States. However, recently B. tabaci MED also has been detected in the landscape outside of greenhouses in Florida and Georgia. This study compared the transmission efficiency of one Old-World (OW) and two New-World (NW) begomoviruses prevalent in the southeastern United States, viz.., tomato yellow leaf curl virus (TYLCV), cucurbit leaf crumple virus (CuLCrV), and sida golden mosaic virus (SiGMV) between B. tabaci MEAM1 and B. tabaci MED. Bemisia tabaci MEAM1 efficiently transmitted TYLCV, CuLCrV, or SiGMV, whereas B. tabaci MED only transmitted TYLCV. Percent acquisition and retention of OW TYLCV following a 72 h acquisition access period was significantly higher for B. tabaci MED than B. tabaci MEAM1. In contrast, B. tabaci MEAM1 acquired and retained significantly more NW bipartite begomoviruses, CuLCrV or SiGMV, than B. tabaci MED. Quantitative analysis (qPCR) of virus DNA in whitefly internal tissues revealed reduced accumulation of CuLCrV or SiGMV in B. tabaci MED than in B. tabaci MEAM1. Fluorescent in situ hybridization (FISH) showed localization of CuLCrV or SiGMV in the midgut of B. tabaci MED and B. tabaci MEAM1. However, localization of CuLCrV or SiGMV was only observed in the primary salivary glands of B. tabaci MEAM1 and not B. tabaci MED. TYLCV localization was observed in all internal tissues of B. tabaci MEAM1 and B. tabaci MED. Overall, results demonstrate that both B. tabaci MEAM1 and B. tabaci MED are efficient vectors of OW TYLCV. However, for the NW begomoviruses, CuLCrV and SiGMV, B. tabaci MEAM1 seems to a better vector.
Article
Full-text available
To date, there are no reliable means for controlling the cotton whitefly Bemisia tabaci, since it has a high ability to develop resistance for all classes of insecticides. In order to avoid further environmental hazards resulting from the extensive use of chemical pesticides, alternative strategies through suitable successful integrated pest management (IPM) programs should be evaluated. During the present study, earth's geomagnetic field, color-tropism and host-plant traps had been evaluated separately or in combination as components of an IPM program for B. tabaci under greenhouse conditions. The most attractive cardinal direction to B. tabaci was the east (attracted 39.4% of whiteflies) followed by south, north then west (9.1%). The four halfway directions were more effective on the horizontal flight behavior of B. tabaci than the cardinal directions. About 53.1% of B. tabaci adults were significantly attracted to the southeast direction, followed by northeast , southwest then northwest (7.2%). When color-tropism was investigated, yellow sticky sheets significantly attracted about 44.16% of B. tabaci adults followed by bright green (18.36%) then orange (14.48%). The combined effect of the geomagnetic field and color-tropism showed that the combination of yellow traps at a wavelength of 590 nm in the southeast direction attracted about 17.75% of B. tabaci adults followed by bright green (530 nm) in southeast (10.98%). When host-plant preference was investigated, no significant differences were recorded among the attraction of tomato, cucumber or squash to B. tabaci. Sow thistle (Sonchus oleraceus L.), as a wild plant, was the most favorite plant with the cotton whitefly as it significantly attracted about 29.24% of B. tabaci adults. The most attractive combined effect of the geomagnetic field and host-plants was S. oleraceus in the southeast direction (attracted 14.18% of B. tabaci) followed by tomato in southeast (9.25%) then cucumber in southeast (8.36 %). The combined effect of color-tropism, plant traps and geomagnetic field on the population of B. tabaci under greenhouse conditions was studied. When yellow sticky sheets and S. oleraceus as a plant trap, were directed towards the southeast , the numbers of B. tabaci infested tomato plants were dramatically reduced from 8.1±0.13 to 0.57±0.05 adults/cm 2 within a week.
Article
The Bemisia tabaci (Gennadius) whitefly is a major economically damaging pest of many crops such as tomato (Solanum lycopersicum L.). Pesticides are widely used to control B. tabaci while the use of aromatic plants is an alternative control method. The aim of this study was to assess the B.tabaci repellent effect of wild oregano, Plectranthus amboinicus (Lour.) Spreng, a widespread aromatic plant in the West Indies. We tested three origins of wild oregano, including northern, central, and southern Martinique (French West Indies). Our results showed that all essential oils of wild oregano had either masking properties or were true repellents—the mean percentage of whiteflies present in the upper part of the still-air olfactometer was 1.3- to 1.9-fold lower than in the controls. The ethanolic solution of volatile organic compounds of wild oregano from southern Martinique also had a true repellent effect—the mean percentage of whiteflies present in the upper part of the still-air olfactometer was 1.3-fold lower than in the controls. Moreover, in a greenhouse insect-proof cage, there were 1.5 fewer adult whiteflies on tomato intercropped with wild oregano from southern Martinique than on tomato alone after 96 h exposure. Our study generated further insight into the potential of P. amboinicus for B. tabaci biocontrol on tomato crops. Wild oregano extracts were repellent to B. tabaci and could be used as a companion plant to prevent whitefly infestations on tomato crops. However, the B. tabaci behavior depends on the plant origin.
Article
Full-text available
Begomoviruses are transmitted by several cryptic species of the sweetpotato whitefly, Bemisia tabaci (Gennadius), in a persistent and circulative manner. Upon virus acquisition and circulative translocation within the whitefly, a multitude of molecular interactions occur. This study investigated the differentially expressed transcript profiles associated with the acquisition of the Old World monopartite begomovirus, tomato yellow leaf curl virus (TYLCV), and two New World bipartite begomoviruses, sida golden mosaic virus (SiGMV) and cucurbit leaf crumple virus (CuLCrV), in two invasive B. tabaci cryptic species, Middle East-Asia Minor 1 (MEAM1) and Mediterranean (MED). A total of 881 and 559 genes were differentially expressed in viruliferous MEAM1 and MED whiteflies, respectively, compared with their non-viruliferous counterparts, of which 146 genes were common between the two cryptic species. For both cryptic species, the number of differentially expressed genes (DEGs) associated with TYLCV and SiGMV acquisition were higher compared with DEGs associated with CuLCrV acquisition. Pathway analysis indicated that the acquisition of begomoviruses induced differential changes in pathways associated with metabolism and organismal systems. Contrasting expression patterns of major genes associated with virus infection and immune systems were observed. These genes were generally overexpressed and underexpressed in B. tabaci MEAM1 and MED adults, respectively. Further, no specific expression pattern was observed among genes associated with fitness (egg production, spermatogenesis, and aging) in viruliferous whiteflies. The weighted gene correlation network analysis of viruliferous B. tabaci MEAM1 and MED adults identified different hub genes potentially implicated in the vector competence and circulative tropism of viruses. Taken together, the results indicate that both vector cryptic species and the acquired virus species could differentially affect gene expression.
Book
Full-text available
Todo o conteúdo deste livro está licenciado sob uma Licença de Atribuição Creative Commons. Atribuição-Não-Comercial-NãoDerivativos 4.0 Internacional (CC BY-NC-ND 4.0). O conteúdo dos artigos e seus dados em sua forma, correção e confiabilidade são de responsabilidade exclusiva dos autores, inclusive não representam necessariamente a posição oficial da Atena Editora. Permitido o download da obra e o compartilhamento desde que sejam atribuídos créditos aos autores, mas sem a possibilidade de alterá-la de nenhuma forma ou utilizá-la para fins comerciais. Todos os manuscritos foram previamente submetidos à avaliação cega pelos pares, membros do Conselho Editorial desta Editora, tendo sido aprovados para a publicação com base em critérios de neutralidade e imparcialidade acadêmica. A Atena Editora é comprometida em garantir a integridade editorial em todas as etapas do processo de publicação, evitando plágio, dados ou resultados fraudulentos e impedindo que interesses financeiros comprometam os padrões éticos da publicação. Situações suspeitas de má conduta científica serão investigadas sob o mais alto padrão de rigor acadêmico e ético.
Article
The tobacco whitefly, Bemisia tabaci (Hemiptera: Aleyrodidae), is a serious pest that transmits tomato yellow leaf curl virus (TYLCV) in tomato. The tobacco whitefly exhibits morphological similarity with the greenhouse whitefly, Trialeurodes vaporariorum (Hemiptera: Aleyrodidae) which also damages various plants in the greenhouse. Therefore, it is very important to quickly and accurately diagnose whiteflies for applying pest management strategies. In this study, we used a loop-mediated isothermal amplification (LAMP) assay to quickly and effectively detect B. tabaci. Primer sets were investigated for the specificity of B. tabaci by visible detection of the target DNA fragment. Two primer sets for pheromone biosynthesis activating neuropeptide (PBAN) gene were obtained from transcriptomic analysis of B. tabaci biotype Q. The PBAN-based LAMP primer set showed specific amplification of the target region. The optimal conditions for B. tabaci detection were 60°C for 60 min with four LAMP primers of PBAN. The minimum amount of genomic DNA required for visible detection was 100 ng. These results suggest that the PBAN-based LAMP assay can be applicable for field monitoring of B. tabaci.
Chapter
Geminiviruses form the second largest family of plant viruses, the Geminiviridae, represented by four genera: Mastrevirus, Curtovirus, Topocuvirus, and Begomovirus. The majority of diseases caused by geminiviruses are whitefly-transmitted and placed in the genus Begomovirus. During the last two decades these viruses have emerged as devastating pathogens, particularly in the tropics and subtropics, causing massive economic losses and threatening production and food security. Epidemics caused by reemerging and newly emerging geminiviruses are becoming frequent even in regions that were earlier free from these viruses. This chapter outlines the various genera of geminiviruses, their host range, which varies from field crop plants to weed species, and the damage caused. Their morphological, genetic, and chemical composition are discussed in addition to their epidemiological dynamics. Information on their mode of transmission including vectors are captured in this review. Finally, the economic importance through their direct feeding and management of geminiviruses through crop breeding using biotechnological and integrated management approaches are also elucidated.
Article
Management of Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae) populations is a key strategy to reduce the transmission of viruses to crops. Yellow sticky traps are widely used tools to monitor and/or reduce B. tabaci populations. Nevertheless, these traps also allow the collection of debris and nontarget organisms including B. tabaci natural enemies. Covering the surface of the traps with a mesh is an alternative to mitigate those unwanted effects. Two field experiments were carried out to determine the color and size effect of the mesh on the capture of B. tabaci and nontarget organisms. The color experiment showed that among the 13 colors evaluated, only the yellow mesh did not reduce statically the number of B. tabaci captured compared with the uncovered traps. On the size experiment, among the three sizes evaluated, no statistical effect on the number of B. tabaci captured was exhibited. For the capture of nontarget organisms, the significative lowest values were showed in the small diamond and hexagon grooves. Those mesh traits were validated with two additional field experiments. The results of this study indicate that yellow sticky traps covered with a yellow mesh reduce the collection of nontarget organisms without affecting the capture of B. tabaci.
Article
Full-text available
The superfamily cytochrome P450s is involved in the evolution of insecticide resistance. However, whether CYP4G68, a differentially expressed gene identified from our transcriptomics analysis, confers resistance to the world’s heavily used insecticide class neonicotinoids is unknown. Hence, we explored the role of CYP4G68 in conferring imidacloprid and thiamethoxam resistance in Bemisia tabaci. The species B. tabaci MED developed low-to-high resistance to imidacloprid and thiamethoxam. Exposure to imidacloprid and thiamethoxam significantly increased the expression of CYP4G68. Moreover, quantitative real-time PCR analysis demonstrated that CYP4G68 was remarkably overexpressed in imidacloprid-resistant and thiamethoxam-resistant strains compared to susceptible strains. Further correlation analysis showed that CYP4G68 expression was significantly positively correlated with the associated resistance level in various strains of B. tabaci. These results suggest that the enhanced expression of CYP4G68 appears to mediate imidacloprid and thiamethoxam resistance in B. tabaci. Additionally, silencing CYP4G68 via RNA interference strongly increased the susceptibility of B. tabaci MED to imidacloprid and thiamethoxam. Collectively, this work revealed that CYP4G68 plays a vital role in imidacloprid and thiamethoxam resistance in B. tabaci MED. These findings will not only advance our understanding of the role of P450s in insecticide resistance but also provide a great potential target for the sustainable control of destructive insect pests such as whiteflies.
Chapter
The whitefly, Bemisia tabaci (Gennadius) is a polyphagous pest causing considerable yield loss to many crops around the globe. It is a phloem feeder and transmits several viral diseases as well. It has great genetic diversity and is considered a complex of biotypes. Despite the adoption of several available control strategies, management by chemical pesticides has still been the first choice for the farmers to protect their crops. However, prolonged use of chemical pesticides has ultimately accelerated the development of multifold resistance against various groups of insecticides in different parts of the world. The status of development of insecticide resistance against different groups of insecticides by this pest, mechanisms of resistance, cross-resistance, role of detoxifying enzymes, and management issues have been discussed in this chapter.
Article
Rapid density estimation of Bemisia tabaci (Grannadius) on sticky traps was implemented using the presence–absence model (PAM) for two commercial paprika greenhouses. The one-sided yellow sticky trap was divided into a 6 × 8 grid with 48 identical square cells (each cell being 2.5 cm × 2.5 cm). Morisita’s index was applied to analyze the distribution of caught B. tabaci within each trap. The PAM described well the relationship between whiteflies (independent variables) caught in cells and those on the trap with a natural logarithmic scale (dependent variables). Estimated caught whiteflies on the traps were well fitted within 95 % confidence limits using PAM. The within-trap distribution of whiteflies was confirmed to be mostly non-random (95.7 % of total traps) by Morisita’s index; however, the between-trap distribution of whiteflies was random by PAM. PAM method showed better efficiency by comparing the time cost of the whole trap, and the occupied cell count of traps that have the same whitefly densities. The PAM method was successfully applied and implemented to estimate the mean density of the B. tabaci on traps in greenhouse paprika system.
Archives of PhytopaA dose-response relationship was documented throughout two-year greenhouse trial on chili in 2019 and 2020 wherein varying acquisition and inoculation times affected Chili leaf curl virus (ChLCV) transmission significantly. Transmissions of ChLCV to the highest levels were statistically equal between 42 and 48 hours acquisition and inoculation. ChLCV transmission by female whiteflies is far superior to that by males. Acquisition and inoculation lasting more than 12 hours inflicted only 50% ChLCV transmission. In ChLCV transmission, a short acquisition with extended inoculation outperformed a long acquisition with short inoculation, emphasizing inoculation over acquisition. Infectivity of ChLCV in B. tabaci peaked at 2–3 days and got nil at 11 days. Studied B. tabacci was identified as Asian I Silverleaf whitefly by bioinformatics (100% identity on cytochrome oxidase I). Overall, the study will help chili growers learn more about the biology of Asian I Silverleaf whiteflies, and how to better manage them.
Thesis
Full-text available
Since some adult insects respond to particular wavelengths, this selective behaviour has been considered to develop strategies for pest control. The objective of this research was to determine the direct effect of yellow chromotropic roller traps on whiteflies population Trialeurodes vaporariorum West. (Hemiptera: Aleyrodidae) in greenhouse crops and their indirect effect on parasitism caused by the parasitoid species Encarsia formosa and Encarsia pergandiella (Hymenoptera: Aphelinidae). This study has taken place in a greenhouse tomato crop produced by a grower located in Chajarí (Province of Entre Ríos, Argentina). Plots with yellow roller traps (Treated Plots) and without yellow roller traps (Control Treatment) were arranged in commercial greenhouse with ecological production. The Treated Plots were monitored every 15 days to register the capture of adult whitefly and adult parasitoid. In such time periods, subsamples that involve yellow chromotropic sticky cards (monitoring cards) were removed from the roller traps and further analyzed in laboratory. However, in the case of Control Treatment, such cards - made of the same material as the roller traps - were placed according to a specific design. Pest monitoring was also accomplished by a direct crop inspection and tomato leaflets infested with whitefly pupae were collected to assess the parasitism rate. The results confirmed the hypothesis that Treated Plots significantly decreased the number of adult whitefly and pupae compared to Control Treatment. Nevertheless, no significant differences were observed in relation to the number of whitefly pupae parasitized by both parasitoids. Therefore, the use of these roller traps is effective without relevant negative consequences for parasitism resulting in an alternative for whiteflies pest management, which would reduce the application of insecticides required in tomato crops.
Article
Full-text available
Production of tomato (Lycopersicon esculentum) in Bangladesh, Malaysia, Myanmar, Vietnam, and Laos has been severely affected by yellow leaf curl disease. Tomato leaf samples were collected from symptomatic tomato plants from farmers' fields in the five countries from 1997 to 1999. DNA was extracted from all samples, four from Vietnam, two each from Malaysia, Laos, and Myanmar, and seven from Bangladesh. Virus DNA was amplified by polymerase chain reaction (PCR) using the begomovirus-specific degenerate primer pair PAL1v 1978/PAR1c 715(1), which amplifies the top part of DNA A. All samples gave the expected 1.4-kb PCR product. The PCR product of one sample per country was cloned and sequenced. Based on the sequences of the 1.4-kb DNA products amplified by the first primer pair, specific primers were designed to complete each of the DNA A sequences. Computer-assisted sequence comparisons were performed with begomovirus sequences available in the laboratory at the Asian Vegetable Research and Development Ce...
Article
Full-text available
The molecular characterization of bipartite geminiviruses infecting the common leguminous weed Macroptilium lathyroides was accomplished using polymerase chain reaction (PCR), deoxyribonucleic acid (DNA) hybridization, and nucleotide sequence analysis. The predicted PCR-amplified fragments for DNA-A and DNA-B showed that M. lathyroides was infected with bipartite geminiviruses with a genome organization similar to other Western Hemisphere geminiviruses. Nucleotide sequence analysis showed that M. lathyroides from Jamaica was infected with two different viruses. Phylogenetic analysis of these macroptilium viruses from Jamaica and Western Hemisphere viruses, including three viruses from Jamaica indicated that macroptilium golden mosaic virus Jamaica strain 1 (MacGMV-JM1) was phylogenetically related to PYMV and SiGMV-JM, while the other virus, macroptilium golden mosaic virus Jamaica strain 2 (MacGMV-JM2) was closely related to two Jamaican viruses, TDLCV and WGMV. The results suggest that crop and weed geminiviruses from Jamaica are related but distinct, and that M. lathyroides is not host to previously described crop-infecting geminiviruses from Jamaica.
Article
Full-text available
During winter 2000-2001, an unusual disease of tomato was observed in some greenhouses in Sardinia, Sicily, and Apulia, in southern Italy. Plants were chlorotic and reduced in size, expanded leaves showed interveinal yellowing, and older leaves developed interveinal reddish-bronze necrosis and downward rolling. The symptoms resembled those recently reported from Portugal (1) as induced by Tomato chlorosis virus (ToCV) (family Closteroviridae, genus Crinivirus), a whitefly-transmitted virus new to Europe. Symptomatic leaf tissues were extracted and analyzed by reverse transcription-polymerase chain reaction as described by Louro et al.(1). The 439-bp ToCV-specific DNA fragment was amplified in samples collected from 6 of 14 greenhouses in Sardinia, 2 of 5 greenhouses in Sicily, and 1 of 1 greenhouse in Apulia. The sequence of the fragment obtained from a Sicilian isolate (GenBank Accession No. AY048854) showed more than 99% identity to ToCV isolates (Accession Nos. AF024630 and AF234029) from the United States and Portugal, respectively. Infestations of Trialeurodes vaporariorum and Bemisia tabaci have been reported in autumn. To our knowledge, this is the first report of ToCV in Italy. Although we found the virus in three regions of the country, its distribution is likely to be wider, since the symptoms can be mistaken for those of a physiological disorder or of Tomato infectious chlorosis virus, another crinivirus infecting tomato. Reference: (1) Louro et al. Eur. J. Plant Pathol. 106:589, 2000.
Article
Full-text available
A newly discovered geminivirus [Family Geminiviridae, Genus "Subgroup III geminivirus"] which infects hollyhock (Althaea rosea) plants is reported in this study for the first time in Egypt. The name hollyhock leaf crumple virus (HLCrV) was given to this virus due to crumpling of the leaf blades of infected A. rosea. Additional symptoms included small vein thickening (SVT), epinasty, and cupping of leaves. HLCrV was transmitted by the silverleaf whitefly Bemisia argentifolii after acquisition and inoculation access periods of 30 and 15 min., respectively. Only one viruliferous whitefly insect could elicit disease syndrome. Host-range studies of HLCrV were restricted in the Malvaceae, viz. cheeseweed, cotton, and okra. HLCrV migrated in sucrose density gradients forming two peaks with A max and A min of 259, 240 nm (peak 1) and 258, 240 nm (peak 2), respectively. Purified H LCrV coat protein was separated in SDS-polyacrylamide gel electrophoresis into two components (25 kDa and 27 kDa). Gamma-globulin fraction of HLCrV-induced antiserum was prepared and used through direct ELISA to detect the virus in infected tissues. HLCrV-induced antiserum had a titer of 1/4000 when measured with indirect ELISA. Indirect ELISA failed to measure any serologic relatedness between HLCrV and the following geminiviruses: African cassava mosaic virus (ACMV), beet curly top virus (BCTV), cotton leaf curl virus (CLCuV), maize streak virus (MSV), squash leaf curl virus (SLCV), and tomato yellow leaf curl virus (TYLCV). On the otherhand, dot blot immunobinding assay (DBIA) detected positive relatedness between HLCrV, ACMV, and CLCuV; but not with BCTV, MSV, and SLCV. Ultrathin sections of infected A. rosea leaves indicated the restriction of HLCrV into the phloem tissues. Geminivirus-like particles in paracrystalline arrays were observed in the nucleus and the cytoplasm of parenchyma cells of the phloem.
Article
Full-text available
Macroptilium lathyroides (L) is a weed that is widely distributed in Cuba. Frequently, leaves show bright yellow mosaic symptoms, which suggest the incidence of a viral disease. Since begomovirus occurrence in Macroptilium lathyroides has been previously reported in other islands of the Caribbean (1,3), symptomatic plants from three distant places in Cuba (Havana, Villa Clara, and Camaguey), were collected and tested for the presence of begomoviruses. Plant DNA extracts were analyzed by Southern blot hybridization and polymerase chain reaction with two sets of degenerate primers (2). The presence of a bipartite begomovirus was evident through strong hybridization signals obtained with the DNA-A and DNA-B of Taino tomato mottle virus as probes at low stringency. Furthermore, 1.4-kb and 1.2-kb PCR amplified fragments were obtained with DNA-A degenerate primers, PAL1v1978-PAR1c715 and PAL1c1960-PAR1v722, respectively. Both PCR fragments from the samples from the three locations were cloned, and restriction f...
Article
Full-text available
Bitter melon, Momordica charantia (Cucurbitaceae), is a vegetable of nutritive and medicinal value that is cultivated throughout India and other tropical countries. In September 2001, a severe disease of bitter melon with virus-like symptoms was observed at Lucknow, India. Symptoms consisted of upward curling, shortening, and distortion of leaves. Diseased melon fruits were stunted and deformed. Disease incidence was as high as 100%. Whitefly (Bemicia tabaci) can transmit the associated virus from diseased bitter melon to Nicotiana tabacum cv. White burley. The development of leaf curl symptoms in N. tabacum indicated the pathogen could be a begomovirus. Total nucleic acids were extracted from diseased bitter melon leaves, and polymerase chain reaction (PCR) tests were performed. Three pairs of primers, AV494 and AC1048 (1), CL-CR/F2 and CL-CR/R2, CL/11F and CL10/R (2), specific to DNA-A of begomoviruses were used in PCR. Virus-specific DNA-A fragments of expected sizes were identified (≈0.5, 0.7 and 1.2 kb, respectively). The presence of a begomovirus in all PCR-amplified DNA fragments was confirmed by Southern hybridization. Cloned DNA-A fragments of Tomato leaf curl virus and Cotton leaf curl virus (both begomoviruses) cross-hybridized with the PCR products gave strong signals under high stringency conditions. These data suggest that a begomovirus is associated with this bitter melon disease. Watermelon mosaic 1 virus is the only virus previously reported to naturally infect bitter melon; however, this virus has not been identified in India. Bitter melon is also an experimental host of Ribgrass mosaic virus (genus Tobamovirus) and Trichosanthes mottle virus (genus Potyvirus). To our knowledge, this is the first report of the occurrence of begomovirus infecting bitter melon. References: (1) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288, 1996. (2). X. Zhou et al. J. Gen. Virol. 79:915, 1998.
Article
Full-text available
Tomato yellow leaf curl virus (TYLCV) is a major constraint to tomato production in Spain. This virus was observed for the first time in several tomato fields in Murcia (Spain) in the autumn of 1992 and Canary Islands in 1999. Currently the virus is prevalent along the Mediterranean coast of Spain (provinces of Malaga, Granada, Almeria, Murcia, Alicante, Valencia, and Barcelona) and in the Canary Islands. Two viral species have been identified in Spain, TYLCV-Sar in 1992 and TYLCV-Is in 1997. TYLCV-Is is more severe than TYLCV-Sar and produces the greatest economic losses. Curling of leaflets, yellowing, and growth reduction are more pronounced in plants infected with TYLCV-Is than in those infected with TYLCV-Sar. In order to study the presence and behavior of both viral species in the affected area, over 1,320 tomato plants were sampled. DNA was extracted from the samples and analyzed by polymerase chain reaction (PCR) amplification. The degenerate primer pair for Begomovirus detection (AV494/AC1048) (2...
Article
Full-text available
Bean golden yellow mosaic virus (BGYMV, GenBank Accession No. M91604) is reported to be the main bean-infecting (Phaseolus vulgaris) begomovirus in Central America (1,2). Another begomovirus, Bean calico mosaic virus (BCaMV, GenBank Accession No. AF110189), is known to infect P. vulgaris in central Mexico. Bean samples with the viral symptom of foliar chlorosis were collected in different regions of Costa Rica from 1994 to 2001. Total nucleic acids were extracted and tested using polymerase chain reaction (PCR) with degenerate primer pair PBL1v2039/PCRc2 for DNA-B, which can give a different fragment size for some begomoviruses (4). PCR fragments were obtained from 119 bean samples. Fifty samples from the central valley produced 600-bp PCR fragments, which is typical for BGYMV (4), and one sample produced two fragments (500 and 600 bp). One sample from western Costa Rica had a 550-bp fragment, and 69 samples from the western and northern regions produced 500-bp fragments. One of the latter samples (No. 01...
Article
Cabbage and collard greens were inflicted with a previously undescribed virus-like disease during the fall 2000. Symptoms on leaves were yellow spots, vein clearing, mosaic, curling, and puckering. Symptomatic plants were widespread in Brooks, Colquitt, Grady, and Pierce counties in Georgia. Disease incidence ranged from 10 to 20% in the majority of the fields surveyed but some fields had 100% incidence. Fields were heavily infested by Bemisia argentifolii and the symptoms were suggestive of a whitefly-transmitted geminivirus infection. A polymerase chain reaction (PCR)-based diagnostic test for geminivirus was conducted. Total DNA was extracted from symptomatic cabbage and collard green plants collected from commercial fields. The two primers, 5'-GCCCACATYGTCTTYCCNGT-3' and 5'- GGCTTYCTRTACATRGG-3' (2,3), are “universal” for genus Begomovirus of family Geminiviridae. The primer pair could amplify a part of the replicase-associated protein and coat protein and the complete common region of DNA-A. The PCR gave a DNA band of expected size (1.1 kb) from both symptomatic cabbage and collard green samples, whereas no such product was obtained from healthy samples, suggesting that the causal agent could be a geminivirus. To establish the identity of the virus, the 1.1 kb PCR product was cloned into pGEM-T Easy (Promega) and sequenced. GenBank search showed that the geminivirus isolated in Georgia was most closely related (98% sequence identity) to Cabbage leaf curl virus (accession number U65529) reported from Florida (1). The virus was mechanically transmitted to healthy cabbage and collard green plants under experimental conditions. To our knowledge, this is the first report of Cabbage leaf curl virus from Georgia. References: (1) A. M. Abouzid et al. Phytopathology 82:1070, 1992. (2) S. S. Pappu et al. Plant Dis. 84:370, 2000. (3) M. R. Rojas et al. Plant Dis. 77:340–347, 1993.
Article
Acalypha indica, Croton sparsiflorus and Vernonia cinerea, that grow around Vigna radiata and Vigna mungo fields and exhibit viral symptoms, were tested whether they serve as the reservoirs of Vigna yellow mosaic virus (YMV), a geminivirus. DNA A of Indian cassava mosaic virus (ICMV) was used as a general probe and DNA B of ICMV and YMV were used as specific probe. ICMV DNA A hybridized intensely to DNA from infected V. radiata, V. mungo, A. indica, C. sparsiflorus and V. cinerea, indicating that all these plants harboured whitefly-transmitted geminiviruses. The presence of single-stranded virion DNA and double-stranded replicative form in these plants was characterized by non-denaturing Southern analysis and by nuclease-sensitivity analyses. DNA B of ICMV, a specific probe, hybridized only to DNA from infected cassava and Acalypha suggesting that the geminiviruses that infected cassava and Acalypha are related. DNA B of YMV hybridized only to the DNA from infected V. mungo and V. radiata but not to the DNA of any of the weeds. Our results show that geminiviruses that infect the weeds A. indica, C. sparsiflorus and V. cinerea are not related to Vigna YMV and do not serve as reservoirs of V. mungo YMV.
Article
A previously undescribed disease of the yellowing type was found to occur on cucumber and muskmelon in commercial greenhouses in Kanto area. Long, flexuous, rod-shaped virus particles, 12×1, 000nm approximately, were detected in dip preparations from diseased plants of cucumber and muskmelon. The detection was not easy, because the particles were small in number and labile in nature. The particles were also observed in thin sections prepared from both naturally and artificially infected plants of cucumber and muskmelon. Their presence was always restricted to phloem cells, but sometimes they were found in xylem parenchyma cells of vascular bundles. Virus-infected cells were also characterized by the development of amorphous granular structures and small vesicles containing fibrous materials in the cytoplasm. Both of them seemed to be closely related to virus multiplicaiton, and was considered to be viroplasms. Phloem necrosis was usually observed in diseased plants. It caused a remarkable accumulation of starch grains in chloroplasts in mesophyll cells. The virus was transmitted to healthy seedlings of cucumber and muskmelon by viruliferous greenhouse whiteflies, but not by inoculation of sap. From these results, the yellowing disease of cucumber and muskmelon was concluded to be caused by the long, flexuous, rod-shaped virus, which was named cucumber yellows virus.
Article
Whitefly-transmitted disease agents cause significant losses throughout the world. Although not considered as important as aphids on a worldwide basis, they are responsible for the natural spread of a large number of economically important diseases in the tropical and subtropical areas. Recent years have shown an increase in losses in wide areas north and south of the tropics, approaching areas of intensive agricultural production such as the southern United States, Jordan, and Israel (26, 28, 32, 43). These areas are in the apparently increasing range of Bemisia tabaci (Gennadius), the most intensively studied whitefly vector. Recent years have shown, if not an absolute increase, at least an increase in the awareness of disease losses caused by two other whitefly species, Trialeurodes vaporarium (Westwood) and T. abutilonea (Hald.), in temperate areas of the United States, Europe, Australasia, and Asia (41, 42, 58, 60, 86, 102).
Article
Symptoms of interveinal chlorosis (yellowing) are commonly observed in melon or cucumber plants grown in greenhouses in the southeastern coast of Spain. The agent of the disease was determined to be cucurbit yellow stunting disorder virus (CYSDV). CYSDV was shown to be transmitted specifically by the tobacco whitefly (Bemisia tabaci), was retained by the vector for at least 7 days, and had an experimental host range restricted to members of the family Cucurbitaceae. Filamentous, flexuous virus particles typical of the closteroviruses were observed in infected plants. The length distribution of the virus particles showed two peaks at 825 to 850 nm and 875 to 900 nm. Analysis of double-stranded (ds) RNA extracts revealed two major dsRNA species of approximately 8 and 9 kbp. Random cDNA cloning of viral dsRNA was performed, and a virus-specific cDNA clone (p410) of 557 nucleotides that hybridized with the smaller of the two vital dsRNA species was identified. Computer-assisted analysis showed that the deduced amino acid sequence of p410 was significantly similar to the HSP70 homologs of the closteroviruses and showed greater similarity to the HSP70 homolog of the B. tabaci- transmitted lettuce infectious yellows closterovirus (LIYV) than to the HSP70 homologs of the aphid transmitted closteroviruses. The data suggest that CYSDV is a member of a newly recognized subgroup of closteroviruses with bipartite genomes exemplified by LIYV.
Chapter
Whiteflies, as vectors of disease agents, although not considered as important as aphids on a worldwide basis, caused significant losses throughout the world. There has been an increasing awareness of the losses caused by whitefly-transmitted viruses in the temperate areas. The number of articles dealing with whiteflies and viruses almost doubled in the last 10 years, whereas the number of articles on aphids and viruses remained almost constant. About one-tenth of the papers on whitefly-borne viruses discuss problems within Europe. The increasing menace of whitefly-borne viruses caused the European Union (EU) to set up the “European network on European whiteflies, their associated plant pathogens and disorders,” or more briefly, the European Whitefly Studies Network (EWSN), in 1999. Geographical Europe includes many more countries than those in the EU, and whitefly-borne viruses and their vectors tend to ignore borders, being more affected by geographical than political barriers. Therefore, this chapter includes the continental Europe countries extending over the Caucasus mountains (traditionally, one of the geographical limits of Europe) and Turkey, which is geographically mostly in Asia.
Article
Okra leaf curl disease (OLCD), characterized by either upward or downward leaf curl and stunted plant growth, is one of the major diseases of okra (Hibiscus esculentis L.) in Pakistan. OLCD is transmitted by the whitefly Bemisia tabaci and is suspected of being associated with a whitefly-transmitted geminivirus (Genus Begomovirus). Total DNAs isolated from both symptomatic and healthy okra plants collected from several locations in Pakistan were resolved on agarose gels and blotted to nylon membranes. A full-length DNA A clone of Cotton leaf curl virus (CLCuV) from Pakistan (2) was labeled with 32PdCTP and used as a probe at medium stringency. The probe detected the presence of characteristic geminivirus DNA forms in infected plants, while no hybridization was observed to healthy plant extracts, confirming the association of a begomovirus with OLCD. Degenerate oligonucleotide primers based on conserved sequences of DNA B components of begomoviruses were used in PCR for the detection of a potential DNA B (...
Article
In 1992 viruslike symptoms appeared on lisianthus plants grown at different locations in Israel. The symptoms included distortion of the growing tips, cup-shaped leaves, and swelling of veins on the lower surface of the leaves. Plants infected at an early stage did not yeld flowers, but late infections did not impair flowering. The viral causal agent of the disease was purified from infected plants and identified with a molecular probe prepared from cloned tomato yellow leaf curl virus (TULCV) DNA and a specific antiserum against the virus. Purified preparations were infectious to healthy lisianthus in transmission experiments with Bemisia tabaci. These data confirmed that lisanthus leaf curl is caused by TYLCV. This devastating disease has become a limiting factor in the expansion of lisianthus cultivation in Israel.
Article
An epidemic of bean golden mosaic virus (BGMV-H) was observed in the winter of 1993 in South Florida. The disease was found in common bean, Phaseolus vulgaris, and lima beans, P. lunatus, in southwest Dade County and southeast Palm Beach County. In a survey of 125 fields in Dade County, there was an average disease incidence of 26%, with higher disease incidences in fields of cranberry beans and pole beans than in snap beans. Approximately 30% of the estimated 11,000 ha planted to snap beans in South Florida was affected. In snap bean fields where BGMV-H was most severe, growers reported yields of 26-87 hL/ha compared to expected yields of 175 hL/ha. In some cases, fields were completely abandoned or destroyed. The disease was not detected in the other winter bean production areas in South Florida. An isolate of the virus from Homestead (BGMV-H) was mechanically transmissible to P. vulgaris cv. Topcrop, and the whitefly Bemisia labaci (also known as Bemisia argentifolii) was an efficient vector of the virus in transmission tests. Plants with bright golden mosaic symptoms tested positive for geminivirus infection when extracts were probed (dot blots) with A component DNA from a geminivirus infecting the weed Macroptilium lathyroides or from the recently identified tomato mottle geminivirus, both from Florida. The bean samples did not react with probes prepared to the B components for either of these viruses. Hybridization probes prepared to A and B components of BGMV-H gave strong reactions with extracts from beans infected with BGMV isolates from Guatemala and from the Dominican Republic. This is the first report of an epidemic of BGMV occurring in the continental United States.
Article
Symptoms of interveinal chlorosis, necrotic flecking, thickening, and rolling of leaves were observed on leaves of field-grown tomato (Lycopersicon esculentum) plants in Jauna Diaz, Puerto Rico. These symptoms are indicative of those produced by the whitefly-transmitted criniviruses, Tomato infectious chlorosis virus (TICV) and Tomato chlorosis virus (ToCV) (1). Samples collected from two symptomatic plants were examined by leaf dip and were found to contain long flexuous rods approximately 800 nm in length, characteristic of criniviruses. Symptomatic leaves were used for extraction of total nucleic acid and for whitefly transmission studies. The greenhouse whitefly, Trialeurodes vaporariorum (Westwood), is a highly efficient vector of TICV, but an inefficient vector of ToCV, whereas the banded wing whitefly, T. abutilonea (Haldeman), is an efficient vector of ToCV but does not transmit TICV (2). Whiteflies of both species were allowed to feed separately on symptomatic tomato leaves for 24 h and then tran...
Article
Whitefly-mediated transmission of circulative plant viruses involves highly specific, coevolved intramolecular interactions between the viral-encoded determinants and the receptor-like molecules of insect origin that interact to confer virus–vector specificity. This chapter describes the current physical, behavioral, cellular, and molecular aspects of whitefly-mediated transmission for the four plant virus genera known to be transmitted by one or more whitefly vector species: Begomoviruses, Carlaviruses, Criniviruses and Potyviruses. However, as very little is known about the cellular or molecular mechanisms of transmission of noncirculative whitefly-transmitted viruses, much of the review in the chapter concerns results of recent studies for begomoviruses and their whitefly vector, B. tabaci, and analogies that may be drawn from knowledge of other wellstudied circulative plant virus groups and their vector relations. Understanding the basis for the behavioural, cellular, and molecular phenomena that underlie whitefly-mediated transmission of plant viruses should provide great opportunities for directing the disruption of specific targets to interfere with the transmission process at critical and vulnerable points in the pathway.
Article
During the summer and autumn of 2001, symptoms of interveinal yellowing, bronzing, brittleness, and rolling of lower leaves were observed in greenhouse- and field-grown tomato (Lycopersicon esculentum) plants in Castellon Province in eastern Spain. Symptoms resembled those caused by the whitefly-transmitted criniviruses (1,2). Total RNA was extracted from 28 samples of symptomatic leaves collected in three greenhouses and one field and analyzed by reverse transcription-polymerase chain reaction using primers specific for Tomato chlorosis virus (ToCV) (1) and Tomato infectious chlorosis virus (TICV) (2). The 501-bp TICV-specific DNA fragment was amplified in four samples collected during the summer in three greenhouses and one field, and the 439-bp ToCV-specific DNA fragment was amplified in 15 samples collected during the autumn in the same three greenhouses; no mixed infections were found. The DNA fragments amplified from TICV were sequenced and showed 99 to 100% identity with the TICV isolates (GenBank Accession Nos. U67449 and AY048855) from the United States and Italy, respectively, confirming the diagnosis. One sequence was deposited as GenBank Accession No. AF479662. To our knowledge, this is the first report of TICV in Spain and the second in Europe. References: (1) D. Louro et al. Eur. J. Plant Pathol. 106:539, 2000. (2) A. M. Vaira et al. Phytoparasitica. In Press.
Article
Tomato yellow leaf curl virus (TYLCV, formerly TYLCV-Is) and Tomato yellow leaf curl Sardinia virus (TYLCSV, formerly TYLCV-Sar) are geminivirus species of the genus Begomovirus that cause the disease known as tomato yellow leaf curl. In Spain, TYLCV and TYLCSV have coexisted in field and greenhouse tomato (Lycopersicon esculentum) crops since 1996 (2). TYLCV is also the causal agent of the leaf crumple disease of common bean (Phaseolus vulgaris) (1), a species that TYLCSV is unable to infect (2). Analysis of field samples from common bean plants affected by leaf crumple disease collected in Almeria (southeastern Spain) during 1999 showed that, unexpectedly, several samples hybridized with TYLCV- and TYLCSV-specific probes prepared to the intergenic region (IR) as previously described (1). Polymerase chain reactions (PCR) performed with total nucleic acids extracted from one of these samples (ES421/99) using primer pairs specific to the IR of TYLCV (MA-30/MA-31) or TYLCSV (MA-14/MA-15) (1) gave no amplifi...
Article
The begomovirus Tomato yellow leaf curl virus (TYLCV) is one of the major threats to tomato production in tropical and subtropical regions worldwide. TYLCV was found in Cuba in 1994 and later became the most serious constraint to tomato production (2). During a field survey in 2001, pepper plants (Capsicum annuum) were observed in a greenhouse in Camagüey Province, showing mild interveinal yellowing and curling of leaves. Total nucleic acids were extracted from these plants and from pepper samples collected in previous years that showed similar symptoms. Polymerase chain reaction (PCR) was performed on extracts using a primer pair (TY-1/TY-2) (1) specific for the capsid protein (CP) gene of begomoviruses and a second primer pair (IR2353+: CTGAATGTTTGGATGGAAATGTGC; IR255-:GCTCGTAAGTTTCCT CAACGGAC) designed to amplify the part of the genome encompassing the intergenic region (IR) of the Cuban isolate of TYLCV-IS (2). With these primer pairs, amplicons of the expected size were obtained from five samples (one collected in 1995 in Havana Province, two in 1999 in Sancti Spiritus, and two in 2001 in Camagüey.) The CP fragment was digested with RsaI, while the IR amplicon was digested with AvaII and EcoRI. In all cases the patterns obtained corresponded to digestion patterns for identical PCR fragments obtained from TYLCV-infected tomatoes. The IR amplicon sequence from one sample showed ≈99% identity with the corresponding region of the TYLCV-IS isolated from tomato in Cuba. To our knowledge, this is the first report of TYLCV-IS infection in peppers in Cuba. References: (1) G. P. Accotto et al. Eur. J. Plant. Pathol. 106:179, 2000. (2) Y. Martínez et al. J. Phytopathol.144:277, 1996.
Article
Field tomato plants exhibiting upward curling of leaflets, chlorosis, and stunting symptoms described for tomato leaf curl disease in Sudan (2) were collected in 1996 from Gezira (GZ) and Shambat (SH), Sudan. Disease symptoms were reproduced following experimental transmission of the causal agent(s) by the whitefly Bemisia tabaci from field tomato to virus-free tomato seedlings in a glasshouse at Gezira Research Station, Wad Medani, Sudan. Total nucleic acids were extracted from symptomatic tomato test plants. An ≈1.3-kbp fragment, diagnostic for begomovirus, was obtained from extracts by polymerase chain reaction using degenerate primers that amplify the coat protein gene (CP) and the respective flanking sequences for most begomoviuses (1). A second pair of degenerate primers was used to amplify a 2.3-kbp begomoviral fragment that overlaps both ends of the (CP) amplicon by >200 nt (1). At least 10 amplicons for each were cloned, and their sequences were determined, revealing three unique, tomato-infectin...
Article
Thirty-five-day-old tomato plants (cultivar Florasette) exhibited yellow leaf curling, stunting, and extremely reduced fruit set in spring 2001, in Guanica, Puerto Rico (PR). Twenty percent disease incidence was observed in this field and, 8 weeks later, 75% of the plants showed symptoms. These symptoms were distinct from those caused by other tomato-infecting begomoviruses reported previously from PR, namely Merremia mosaic virus, Tomato mottle virus (ToMoV), and Potato yellow mosaic virus (1). A colony of the B biotype of Bemisia tabaci (Genn.) was used to transmit the suspect virus from symptomatic plants collected in the field and established in the greenhouse in Rio Piedras, PR. The suspect virus was transmitted readily to tomato cultivar Roma (10 of 10 plants), and symptoms were like those observed in the field. Symptoms also were reminiscent of those described for several Old World begomoviruses, referred to as Tomato yellow leaf curl virus (TYLCV). Total nucleic acids were isolated from three symp...