No full-text available
To read the full-text of this research,
you can request a copy directly from the author.
Plant Viruses Transmitted by Whiteflies
Abstract
One-hundred and fourteen virus species are transmitted by whiteflies (family Aleyrodidae). Bemisia tabaci transmits 111 of these species while Trialeurodes vaporariorum and T. abutilonia transmit three species each. B. tabaci and T. vaporariorum are present in the European–Mediterranean region, though the former is restricted in its distribution. Of the whitefly-transmitted virus species, 90% belong to the Begomovirus genus, 6% to the Crinivirus genus and the remaining 4% are in the Closterovirus, Ipomovirus or Carlavirus genera. Other named, whitefly-transmitted viruses that have not yet been ranked as species are also documented. The names, abbreviations and synonyms of the whitefly-transmitted viruses are presented in tabulated form together with details of their whitefly vectors, natural hosts and distribution. Entries are also annotated with references. Whitefly-transmitted viruses affecting plants in the European–Mediterranean region have been highlighted in the text.
... The winged, mobile adult females lay their eggs on the undersides of plant leaves. Under favorable conditions, the entire whitefly life cycle takes about three weeks, allowing populations to increase rapidly [18,19]. Due to the millimeter-scale size of larvae, detection methods are generally visual. ...
... nana shrub, maintained year-round in a greenhouse-like environment at the physics department of IASBS. The whiteflies studied are the Greenhouse Whitefly (Trialeurodes vaporariorum) [18]. Notably, there are about 1300 species of whiteflies worldwide, with the Greenhouse Whitefly being one of the most common [18]. ...
... The whiteflies studied are the Greenhouse Whitefly (Trialeurodes vaporariorum) [18]. Notably, there are about 1300 species of whiteflies worldwide, with the Greenhouse Whitefly being one of the most common [18]. It is worth noting that both transmission [14][15][16][17]20] and reflection [15] configurations were used for the leaf samples investigation. ...
This study explores the use of Mueller matrix imaging polarimetry (MMIP) to analyze whitefly larvae on a pomegranate leaf. Utilizing a dual-rotating retarder setup, we captured detailed Mueller matrix images of the infested leaf with whitefly larvae and after removing them. Through polar decomposition, we quantified depolarization, diattenuation, and retardance properties, providing insights into the structural and optical characteristics of the sample. The results indicate that the presence of larvae significantly alters the depolarization and retardance parameters, demonstrating the efficacy of MMIP in discerning fine structural and compositional changes in plant tissues.
... Whitefly has become a serious pest of potato crops all over the world due to its polyphagous nature, high fecundity, environmental adaptability, and diverse methods of crop destruction [3]. It extracts enormous amounts of plant sap from the phloem, resulting in decreased vigour and growth of plant, as well as uneven fruit ripening [4,5]. The pest releases sticky honeydew on the leaves, which allows the buildup of sooty mould, reduces the ability of plants to photosynthesize, and causes stunted growth. ...
... The pest releases sticky honeydew on the leaves, which allows the buildup of sooty mould, reduces the ability of plants to photosynthesize, and causes stunted growth. [5]. It also serves as a vector for more than 300 virus species, including the Potato Apical Leaf Curl Virus (PALCV) (Family-Geminiviridae; Genus-Begomovirus), which is a globally important virus for the potato crop [5] and was reported for the first time during the year 2000 from Hisar, India [6]. ...
... [5]. It also serves as a vector for more than 300 virus species, including the Potato Apical Leaf Curl Virus (PALCV) (Family-Geminiviridae; Genus-Begomovirus), which is a globally important virus for the potato crop [5] and was reported for the first time during the year 2000 from Hisar, India [6]. Potato Apical Leaf Curl Virus (PALCV) can inflict 40-75 per cent damage to potatoes in India, depending on the cultivar [7]. ...
... In watermelon, whiteflies cause direct feeding damage, leading to chlorosis and reduced fruit quality. The viruses transmitted by Bemisia tabaci can further exacerbate crop losses, making this pest one of the most challenging to manage in watermelon cultivation (Jones, 2003) [6] .Melon thrips (Thrips palmi) are another frequent and destructive pest in watermelon cultivation. These tiny insects cause direct damage by feeding on plant tissues and indirectly by acting as vectors for plant viruses such as the watermelon silvery mottle virus and groundnut bud necrosis. ...
... In watermelon, whiteflies cause direct feeding damage, leading to chlorosis and reduced fruit quality. The viruses transmitted by Bemisia tabaci can further exacerbate crop losses, making this pest one of the most challenging to manage in watermelon cultivation (Jones, 2003) [6] .Melon thrips (Thrips palmi) are another frequent and destructive pest in watermelon cultivation. These tiny insects cause direct damage by feeding on plant tissues and indirectly by acting as vectors for plant viruses such as the watermelon silvery mottle virus and groundnut bud necrosis. ...
This study evaluated the efficacy of various insecticides against key watermelon pests, including Thrips palmi, Liriomyza trifolii, and Bemisia tabaci, in Kandavara village, Karnataka, from January to April 2021. Employing a randomized complete block design, the research applied insecticides at economic threshold levels using a knapsack sprayer. Pre-and post-treatment pest populations were recorded to assess effectiveness. For Liriomyza trifolii, Cyantraniliprole 10.26 OD exhibited the highest efficacy, achieving a 70.48% reduction in leaf mines, followed by Fipronil 5 SC. Against Bemisia tabaci, Thiomethoxam 25 WG was the most effective, reducing populations by 82.90%, with Diafenthiuron 50 WP and Fipronil 5 SC also showing strong results. In managing Thrips palmi, Fipronil 5 SC proved most effective with a 64.89% reduction, supported by Thiomethoxam 25 WG and Diafenthiuron 50 WP. The results highlight Cyantraniliprole 10.26 OD, Thiomethoxam 25 WG, and Fipronil 5 SC as potent options for integrated pest management (IPM) in watermelon cultivation, emphasizing their role in enhancing crop health and productivity while suggesting the need for strategic rotation and combination to prevent resistance.
... The efficacy of the developed insecticidal compositions was supposed to be tested on the greenhouse whitefly Trialeurodes vaporariorum Westwood, which damages cultivated plants (tomatoes, cucumbers, peppers, eggplants), as well as certain ornamental flowering plants grown in enclosed environments, such as greenhouses, polytunnels, and indoors. [27][28][29] The main harm caused by the whitefly takes place during its larval stage. Upon hatching, it attaches to the underside of the leaves and begins to feed, sucking the juice from it and significantly weakening the plant's immunity. ...
... The greenhouse whitefly is also a malicious carrier of several pathogens, including viruses such as leaf rugose virus, infectious chlorosis, and torradoviruses. 29,30 As a result of the destructive activity of the whitefly, plants start to become diseased, lag in growth, leading to uneven ripening of fruits and a decrease in their marketable quality. This study involves various lines of scientific research including synthesis of new surfactants, investigation of their aggregation behavior in aqueous solutions, testing the impact of the developed insecticidal compositions on insect pests, and establishing the relationship between the properties of surfactants and their effectiveness as adjuvants. ...
BACKGROUND
Surfactants, particularly non‐ionic ones, are widely used as adjuvants in pesticide formulations due to their ability to maintain pesticide effectiveness without changing solution properties, such as pH. While non‐ionic surfactants are generally low‐toxic, stable, and excellent dispersants with high solubilization capabilities, they may be less effective than cationic surfactants, which offer superior surface activity, transport properties, and antimicrobial action. This study investigates the efficacy of new piperidinium surfactants with carbamate fragments as adjuvants in insecticide formulations containing imidacloprid. The efficacy of these formulations is being assessed against greenhouse whitefly, a pest known to harm cultivated and ornamental flowering plants.
RESULTS
The aggregation behavior of piperidinium surfactants containing carbamate fragments was investigated, and their wetting effect was evaluated. Synthesized surfactants have lower CMC values compared to their methylpiperidinium analogue. The effect of piperidinium surfactants on the insecticide concentration on the surface and inside tomato leaves was assessed using spectrophotometric methods. It was found that the introduction of piperidinium surfactants with carbamate fragment at a concentration of 0.1% wt. allows for decrease in lethal concentration of imidacloprid up to 10 times, thereby testifying the marked increase in the effectiveness of imidacloprid against the greenhouse whitefly insect pest (Trialeurodes vaporariorum). It was shown that the main factors responsible for the enhanced efficacy of the insecticide were the ability of the surfactant to increase the concentration of imidacloprid on the leaf surfaces and improve their penetration into the plant.
CONCLUSION
The presented work employed a comprehensive approach, which significantly increases the generalizability of the results obtained and provides the ability to predict the effect and target selection of adjuvants. © 2024 Society of Chemical Industry.
... For instance, vegetable production has tripled since 1976, driven by advancements in irrigation technology, the use of plastic greenhouses, and the introduction of high-yield hybrid varieties, alongside an increasing demand for fresh produce [3]. However, agricultural yields face various abiotic and biotic stresses, with the whitefly, B. tabaci (Hemiptera: Aleyrodidae), posing a considerable threat to many vegetable and ornamental crops in both field and greenhouse environments [4,5]. This polyphagous pest can infest around 600 host plants [6,7], causing significant damage by feeding on plant sap [8] and injecting toxic saliva, which leads to physiological alterations in plant tissues [9]. ...
The whitefly, B. tabaci, poses a significant threat to cucumber cultivation. While traditional insecticides are commonly used to manage this pest, they frequently raise ecological and health concerns. In contrast, naturally derived biopesticides offer a promising and environmentally friendly alternative for controlling whitefly populations, thereby reducing negative impacts on non-target organisms. This study evaluates the efficacy of two novel Betaproteobacteria-based insecticides: Burkholderia spp. strain A396 (Venerate XC) and Chromobacterium subtsugae strain PRAA4-1 (Grandevo WDG) against B. tabaci. Leaf-dipping bioassays were performed to compare the effectiveness of these biopesticides with spirotetramat (Movento® 240 SC) as a standard control. Both biopesticides significantly reduced egg hatching rates and decreased survival rates in nymphs and adults by 74.5, 94.8, and 76.5%, respectively, indicating concentration-dependent effects. Direct exposure to Venerate and Grandevo exhibited toxicity levels comparable to spirotetramat across all tested concentrations. However, spirotetramat residues were found to be more toxic to adult whiteflies than the other products, while the mortality associated with Venerate residues was relatively low. Both Venerate and spirotetramat produced significant sublethal effects on the duration of nymph development, although these effects were not consistently concentration-dependent; Grandevo did not affect nymph development. These findings suggest that the novel insecticides may effectively manage B. tabaci populations in Jordan, warranting further investigation under field conditions.
... Managing whiteflies is challenging due to their rapid reproduction and their ability to develop resistance to many insecticides. Common control strategies include the use of chemical insecticides, particularly neonicotinoids like imidacloprid, as well as biological control through the introduction of natural enemies such as parasitic wasps (Encarsia formosa) and predatory mites (Jones, 2003). ...
... It is a phloem-feeding polyphagous insect that attacks more than 100 species of plants belonging to 89 families. It is also a devastating vector which transmits more than 111 viruses such as Begomoviruses, Carlaviruses, Clostero viruses, Criniviruses and Ipomoviruses [5][6][7][8] . B. tabaci is labelled as a cryptic species complex because of its high level of genetic diversity in the worldwide distributed genetic groups. ...
... MYMD was first documented by Nariani (1960) in fields at IARI, New Delhi, India. This disease is a major cause of loss in the production of mungbean in India, Sri Lanka, Pakistan, Bangladesh, Papua New Guinea and Thailand (Varma et al., 1992, Jones, 2003and Haq et al., 2011. MYMV was found to be most devastating, especially in South Asian countries (Jyothi et al., 2020). ...
... Whiteflies weaken the plant by directly biting and sucking the plant sap, which is secreted over feeding area causing fumagine damage as a result of saprophytic fungi development. Furthermore, they are vectors of many plant virus diseases (Jones, 2003). Whiteflies are very difficult pests to control because they prefer abaxial part of leaves for feeding during both adult and larval stages, have a rapid reproduction capacity, and also produce many offspring within a production season, have a very large number of host series, and develop resistance to insecticides. ...
Tobacco whitefly Bemisia tabaci and greenhouse whitefly Trialeurodes vaporariorum, which have a wide host range, are among the most important plant protection problems in agricultural areas all over the world. Within the scope of the study, the infection status of endosymbiont bacteria Wolbachia, Rickettsia and Arsenophonus in the whiteflies was determined by molecular methods. Whiteflies T. vaporariorum and B. tabaci populations were collected from tomato greenhouses at five different locations in Antalya province. This study is the first for endosymbionts of Turkish T. vaporariorum populations. All the three endosymbionts were found in T. vaporariorum and B. tabaci populations. While Arsenophonus was the most frequently found endosymbiont in both whitefly populations, Wolbachia was found in high rates in T. vaporariorum and Rickettsia in B. tabaci. In addition, endosymbiont compositions in individuals belonging to both species were revealed as single, double and triple. Wolbachia (W) and Rickettsia (R) were not found together in any individual of both whitefly species. Out of WR, all single and other multiple endosymbiont combinations were detected in the individuals. However, any infection was not recorded for few individuals from the populations of both species.
... The growth of sooty mold fungus on honey-dew excreted by whiteflies on leaves cause indirect damage by obstructing respiration and photosynthesis and causing the development of ailments such as silver leaf and irregular fruit ripening (Oliveira et al., 2001 andByrne et al., 2003). Furthermore, more than 100 different virus species are spread by B. tabaci (Jones, 2003). ...
... Bemisia tabaci causes severe damage to more than 600 plant species, directly by feeding and excreting honeydew that causes sooty mold, and indirectly by transmitting more than 200 plant viruses (Brown et al. 1995;Perring 2001) such as begomoviruses and criniviruses that cause emerging diseases worldwide (Navas-Castillo et al. 2011;Jones 2003). It also has a wide range of hosts and a short life cycle, which shortens as temperature increases (Takahashi 2008). ...
... The Begomovirus genus accounts for 90% of the virus species spread by whiteflies, followed by the Crinivirus genus at 6%, the Closterovirus, Ipomovirus, and Carlavirus genera at 4% (Fig. 1). As of yet, other viruses that are named and spread by whiteflies are not classified as species (Jones 2003). ...
Okra yellow vein mosaic disease (OYVMD) is a major constraint to okra production globally. It is caused by several distinct begomoviruses, including okra yellow vein mosaic virus (OYVMV), that are transmitted by the whitefly. This study synthesizes current knowledge on the complex interactions between whiteflies, begomoviruses, and okra plants that enable viral spread and cause OYVMD. The acquisition and transmission cycle involves specific processes including virion ingestion during phloem-feeding, endocytosis and passage across insect tissues, secretion in saliva, and inoculation into plants. Molecular compatibilities between vector coat proteins, midgut proteins, and plant factors modulate virus replication and movement through barrier tissues. Abiotic stresses and host traits also impact whitefly behavior and virus epidemiology. Begomoviruses such as OYVMV have spread globally wherever whitefly vectors and susceptible okra varieties occur. Integrated management of the tripartite pathosystem that incorporates host resistance, cultural tactics, and biological control is required to mitigate the transmission of begomoviruses and OYVMD impact. Finally, resolving vector-virus interactions and developing interference strategies will help contribute to strengthening okra germplasm resistance which can support sustainable food production.
... Whiteflies are classified as pests with great destructive potential for crops worldwide, causing damage by feeding, the excretion of honeydew, and the transmission of different types of viruses [4][5][6]. Furthermore, this species has a wide geographic distribution, present across almost the entire globe, except in polar zones [7,8]. Among the main genera of transmitted viruses, Begomoviruses are mostly transmitted by Bemisia spp. with more than 400 species reported [9][10][11][12][13][14]. ...
The tomato (Solanum lycopersicum) is an important crop to the economy of Brazil, and the whitefly Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae) is one of the limiting factors responsible for reducing its yields. These insects are part of a cryptic species group present across almost the entire globe. The most relevant cryptic species in the world are B. tabaci MEAM1 and MED due to their capability to adapt and cause damage to vegetables, grain, and ornamental crops. The arrival of MED in Brazil through the state of São Paulo represents risks to farmers in the region due to the difficulty in managing these insects. This study assessed the occurrence of both species in tomato crops in the southeastern region of Brazil in 2020 and 2021. An amount of 79 samples containing 767 insects were collected throughout the study period, and in the cities of Sumaré (SP) and Monte Mor (SP), several samples were collected from the same location throughout the year. The insects were stored and sent for molecular analysis. The results showed an increase in MED compared to MEAM1. The presence of MED in the Minas Gerais samples was not recorded. However, a higher percentage of MED was observed in the state of São Paulo, which was detected in the municipalities of Sumaré and Monte Mor. These results possibly indicate that MED could be starting to stabilize in open tomato fields in Brazil.
... These issues lead to decreased crop quantity and quality in a number of nations, including Ethiopia (Dube et al., 2020;Yankova, 2012). Among the insect pests, sucking insect pests are the major ones in tomato causing significant yield loss ranging from 20 to 100% (Papisarta and Garzia, 2002;Ram and Parihar, 2002;Jones, 2003). Whitefly, Bemisia tabaci, aphid, Aphis sp. and thrips, Thrips sp. ...
Tomato production is constrained by arthropod pests and diseases. Among the arthropod pests, sap-sucking insect pests such as whiteflies (Bemisia tabaci (Gennadius 1889)), aphids (Aphis spp.) and Thrips sp. are the insect pests of economic importance in the study area. The overall result indicated that intercropping significantly reduced the population of these insect pests compared to sole tomato. The most effective population reduction was recorded on tomato-onion (63.13, 56.46 and 25% in aphids, whiteflies and thrips, respectively) next to karate (83.51, 73.74 and 66.04%) and tobacco leaf extract (77.31, 71.51 and 69.34 in aphids, whiteflies and thrips, respectively). The companion crops harbored the predators and parasitoids of diverse species predominantly. Tomato onion intercropping led the best performances in guarding tomato crop from major insect pests compared to other companion crops. Therefore, tomato onion intercrops may be used as the first options in boosting tomato production as an alternative to karate and tobacco leaf extract in sap-sucking insect pests' management. Further study on the detailed morphological and molecular-based parasitoid species identification and their ecological host ranges are of utmost importance in the sustainable integrated pest management (IPM) strategies in tomatoes.
... It can attack approximately 859 host plant species, which belong to 469 genera in 121 families, demonstrating its adaptability polyphagy [3]. T. vaporariorum poses a threat to crops through its feeding behavior; the secretion of honeydew that serves as a substrate for fungi, which in turn affects photosynthesis; and its ability to transmit viruses, further compounding the damage inflicted on the plants [4][5][6][7]. Currently, the control of this pest primarily relies on chemical agents such as neonicotinoids, organophosphates, and novel nicotine-based insecticides [8][9][10]. ...
Trialeurodes vaporariorum Westwood poses a significant threat to vegetable and ornamental crops in temperate zones, resulting in notable reductions in yield and substantial economic burdens. In order to find compounds with high insecticidal activity against T. vaporariorum, five compounds were isolated and identified from the crude extract of Streptomyces sp. SA61. These include three new polyketides, named strekingmycins F–H (1–3); one new diterpenoid, named phenalinolactone CD8 (4); and one known compound, strekingmycin A (5). Their structures were analyzed using high-resolution electrospray ionization mass spectrometry and one-dimensional and two-dimensional nuclear magnetic resonance spectroscopy data and by comparing them with previously reported data. The insecticidal activities of compounds 1–5 against T. vaporariorum were evaluated. Among them, compound 5 exhibited the highest insecticidal activity, with an LC50 of 6.949 mg/L against T. vaporariorum at 72 h using the leaf-dip method. Lower insecticidal activities were found in compounds 1–4, with LC50 values of 22.817, 19.150, 16.981 and 41.501 mg/L, respectively. These data indicate that strekingmycin could be a potential candidate for a novel insecticide to control T. vaporariorum.
... The most relevant economic damage caused by whiteflies is indirect, by the transmission of more than 400 plant viruses [25][26][27] that are responsible for significant crop losses. The majority of virus diseases that have become economically important in the last decades are transmi ed by whiteflies [27]. ...
Common bean (Phaseolus vulgaris L.) is a widely cultivated crop, representing an important protein source in the human diet in developing countries. The production of this crop faces serious challenges, such as virus diseases transmitted by the whitefly Bemisia tabaci. Although there is a lot of information about some of these viruses, most of what we know has been developed using model systems, such as tomato plants and tomato yellow leaf curl virus (TYLCV). There is still very little information on the most relevant common bean viruses, such as bean golden mosaic virus (BGMV), bean golden yellow mosaic virus (BGYMV), bean dwarf mosaic virus (BDMV), cowpea mild mottle virus (CPMMV), and bean yellow disorder virus (BnYDV). In this review, we discuss the available data in the most up-to-date literature and suggest future research avenues to contribute to the development of management tools for preventing or reducing the damage caused by viruses in this important crop.
... The sweet potato whitefly, Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae), is a polyphagous whitefly with an extremely wide range of host plants [1][2][3] and is known to vector many virus species, including begomovirues, criniviruses, torradoviruses, ipoviruses, and carlaviruses [4]. Bemisia tabaci is a major invasive species across the world and is responsible for significant agricultural losses [5,6]. ...
Traditionally, olfaction was thought to play a minor role in the behavioral ecology of the sweet potato whitefly, Bemisia tabaci (Gennadius). However, recent research is uncovering significant potential for whitefly management based on olfaction. Incorporating chemical attractants with standard whitefly management programs could significantly improve control. The integration of attractants with biological control is exceptionally promising. Therefore, the behavioral response of B. tabaci and two generalist predators to the green leaf volatiles (E)-2-hexenal, (Z)-3-hexenal, (Z)-3-hexenyl acetate, and (Z)-3-hexe-1-ol were investigated in Y-tube olfactometers. Three of the four green leaf volatiles resulted in the attraction of female B. tabaci. Blend optimization indicated a two-chemical blend to be the most attractive blend for female B. tabaci. In addition, this blend was attractive to female Macrolophus praeclarus (Distant) but did not elicit a behavioral response from either male or female Delphastus catalinae (Horn). The two-chemical blend of green leaf volatiles could be further developed as a lure to attract B. tabaci and its predator, M. praeclarus.
... In addition to these direct effects, whiteflies also transmit a number of plant viruses that can result in significantly greater yield losses relative to pest-induced damage alone. For instance, B. tabaci MEAM1 is a key vector to the great majority of begomoviruses, the recent global prevalence of which has largely been mediated by range expansion of this whitefly species (Jones, 2003;Gilbertson et al., 2015). On vegetable crops, B. tabaci MEAM1 vectors the Begomovirus tomato yellow leaf curl (Geminiviridae) (TYLC) (CARM, 1996;Prasad et al., 2020). ...
Important species of whiteflies in greenhouses are Trialeurodes vaporariorum and Bemisia tabaci, but other whitefly species may also be considered pests of greenhouse crops. Similar to aphids, whiteflies cause damage that affects the marketability of crops and can transmit important plant diseases. Biological control programmes for whiteflies have been used in Canada for many years and commonly employ the parasitoids Encarsia formosa and Eretmocerus eremicus. A number of generalist predators have also been investigated for use in whitefly biological control, and recent research has focused on improving the efficacy of generalist omnivorous predators for biological control. Advances in whitefly biological control are highlighted, as are future opportunities for research.
... The tobacco whitefly Bemisia tabaci (Gennadius) and the greenhouse whitefly Trialeurodes vaporariorum (Westwood) are destructive global pests in vegetable crops worldwide, causing severe damage by direct feeding and their ability to transmit a large number of plant viruses (Nauen et al., 2014). Bemisia tabaci is extremely polyphagous, being reported to exist on more than 600 species of host plants , and transmits geminiviruses in a circulative manner (Brown, 1994;Brown and Bird, 1992;Jones, 2003), causing catastrophic damage to agricultural production.Trialeurodes. vaporariorum is also a significant pest attacking more than 82 host plant species. ...
... Three TI torradoviruses-ToTV, ToMarV, and ToChV-are transmitted by three whitefly species: T. vaporariorum, B. tabaci, and T. abutilonea (Haldeman) [37]. In the NTI group, CaTV is transmitted by aphids Myzus persicae, M. persicae biotype, and Cavariella aegopodii [38,39]. The transmission vectors of NTI torradovirus affecting cassava (CsTLV), lettuce (LNLCV), and motherwort (MYMoV) have not been identified. ...
Rehmannia glutinosa, a crucial medicinal plant native to China, is extensively cultivated across East Asia. We used high-throughput sequencing to identify viruses infecting R. glutinosa with mosaic, leaf yellowing, and necrotic symptoms. A novel Torradovirus, which we tentatively named “Rehmannia torradovirus virus” (ReTV), was identified. The complete sequences were obtained through reverse-transcription polymerase chain reaction (RT-PCR), 5′ and 3′ rapid amplification of cDNA ends, and Sanger sequencing. The amino acid sequence alignment between the ReTV-52 isolate and known Torradovirus species in the Pro-Pol and coat protein regions were 51.3–73.3% and 37.1–68.1%, respectively. Meanwhile, the amino acid sequence alignment between the ReTV-8 isolate and known Torradovirus species in the Pro-Pol and coat protein regions were 52.7–72.8% and 36.8–67.5%, respectively. The sequence analysis classified ten ReTV strains into two variants. The ReTV-52 genome has two RNA segments of 6939 and 4569 nucleotides, while that of ReTV-8 consists of two RNA segments containing 6889 and 4662 nucleotides. Sequence comparisons and phylogenetic analysis showed ReTV strains clustered within the Torradovirus, exhibiting the closet relation to the squash chlorotic leaf spot virus. The RT-PCR results showed a 100% ReTV detection rate in all 60 R. glutinosa samples. Therefore, ReTV should be classified as a novel Torradovirus species. ReTV is potentially dangerous to R. glutinosa, and necessitating monitoring this virus in the field.
... The indirect damage occurs due to the accumulation of honey dew that attracts the sooty mold to growth on the leaf surface and disrupts the process of photosynthesis [4]. In addition, whiteflies are known to transmit over 100 plant viruses [5]. ...
... The whitefly Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae), also known as the silverleaf whitefly or sweet potato whitefly, provides an interesting case study for dissecting the genetic factors that contribute to invasive success and population displacement. It is one of the most widespread and insidious pests plaguing agriculture and horticulture worldwide [6] and is notorious for its ability to transmit plant viruses, cause direct damage through sap feeding, and induce the growth of sooty mold on plants, causing severe economic losses globally [7,8]. This pest is generally considered to consist of a complex of more than 44 cryptic species that are morphologically identical but exhibit significant variation in biological traits, such as the ecological niche, plant host range, endosymbionts, insecticide resistance, and ability to transmit viruses [9][10][11][12][13][14]. ...
Within the whitefly Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae) complex, two cryptic species, namely Middle East-Asia Minor 1 (MEAM1) and Mediterranean (MED), are important invasive pests affecting global agriculture and horticulture. They were introduced into China sequentially in the mid-1990s and around 2003, respectively. Subsequently, the latter invader MED has outcompeted the earlier invader MEAM1, becoming the dominant population in the field. Although extensive studies have explored the underlying mechanisms driving this shift, the contribution of population genetics remains notably underexplored. In this study, we analyzed the genetic diversity and structure of 22 MED and 8 MEAM1 populations from various regions of China using mitochondrial DNA sequencing and microsatellite genotyping. Our results indicate low and moderate levels of genetic differentiation among geographically separate populations of MED and MEAM1, respectively. Median-joining network analysis of mtCOI gene haplotypes revealed no clear geographic structuring for either, with common haplotypes observed across provinces, although MED had more haplotypes. Comparative analyses revealed that MED presented greater genetic diversity than MEAM1 on the basis of two markers. Furthermore, analysis of molecular variance supported these findings, suggesting that while some genetic variation exists between populations, a significant amount is also present within populations. These findings reveal the population genetics of the two invasive cryptic species of the B. tabaci complex in China and suggest that the disparities in genetic diversity drive the displacement of their populations in the field. This work also provides valuable information on the genetic factors influencing the population dynamics and dominance of these invasive whitefly species.
... This pest can seriously damage tomato plants by feeding on plant sap and by excreting honeydew on which fungi can grow, which decreases the rate of photosynthesis and consequently leads to significant yield reductions (Brown et al. 1995;Oliveira et al. 2001;Calvo et al. 2009). Moreover, B. tabaci can transmit a large number of plantpathogenic viruses (Jones 2003;Navas-Castillo et al. 2011), including the devastating tomato yellow leaf curl virus (TYLCV) (Navot et al. 1991;Varma and Malathi 2003) Communicated by Jay Rosenheim. ...
Several natural enemies are known as predators of the whitefly Bemisia tabaci, which is one of the most invasive pests worldwide and has developed high resistance to pesticides. However, biological control of this pest on tomato is often difficult because the plant’s glandular trichomes release substances that are toxic to arthropods and hinder the foraging of natural enemies. Therefore, adaptation of natural enemies to this crop is one of the selection criteria for potential biocontrol agents. We collected predatory mites from wild and feral tomato plants and found the species Amblyseius herbicolus and A. tamatavensis. Whereas the latter is known to feed on B. tabaci eggs, we investigated the ability of A. herbicolus to develop and reproduce when feeding on this prey stage, and assessed whether both species can feed and develop on B. tabaci crawlers. To verify the adaptation of these predators to tomato, we assessed their ability to disperse on tomato plants and their establishment on clean tomato plants with pollen as an alternative food. Finally, we evaluated whether the predators were effective in controlling B. tabaci on tomato plants with different pollen dosages as alternative food. We show that both predators fed and reproduced on B. tabaci immatures. A. herbicolus established and dispersed better on tomato plants supplemented with cattail pollen than A. tamatavensis and only A. herbicolus was able to control B. tabaci in two population dynamics experiments. Our results suggest that A. herbicolus is better adapted to tomato than A. tamatavensis and may therefore be a promising biocontrol agent on tomato.
... However, the most important damage caused by B. tabaci to cassava is the transmission of plant viruses [4,5]. B. tabaci vectors over 200 virus species, including cassava brown streak ipomoviruses (CBSIs) and cassava mosaic begomoviruses (CMBs), which cause cassava brown streak disease (CBSD) and cassava mosaic disease (CMD), respectively [6][7][8]. CMD and CBSD are the two devastating viral diseases of cassava in Africa [9,10]. The viral diseases and the high populations of B. tabaci reported on cassava are the most important threats to cassava production in Africa [8,9]. ...
The whitefly, Bemisia tabaci, is a major pest of cassava in Africa. Developing whitefly-resistant cassava can control both whiteflies and viral diseases. The main aim of this study was to identify cassava genotypes resistant to four B. tabaci populations, sub-Saharan Africa 1—subgroups 1, 2, and 3 (SSA1-SG1, SSA1-SG2, and SSA1-SG3) and sub-Saharan Africa 2 (SSA2) that colonize cassava, as well as understand the mechanisms of resistance. Utilizing the antixenosis and antibiosis techniques in the choice and no-choice tests, respectively, to screen for whitefly resistance, we tested 46 cassava genotypes. Of these, 11 (Njule Red, Nase 3, Nase 1, Kibandameno, Sagonja, Aladu, Kiroba, Magana, 72-TME-14, Sauti, and PER 415) exhibited antixenosis, as they were least preferred for oviposition by all four whiteflies population in choice tests. Ten genotypes exhibited antibiosis (nymph mortality) against SSA1-SG1 and SSA1-SG3 in no-choice tests, and these were, Pwani, Nase 14, Kalawe, Eyope, NGA11, CoI2246, Mkumbozi, KBH2002/0066, Yizaso, and PER 608. Eight genotypes—Tongolo, Mbundumali, Colicanana, Orera, Ofumbachai, Nam 130, Tajirika, and MECU72—exhibited both antixenosis and antibiosis mechanisms against SSA1-SG1 and SSA1-SG3. And these can be considered the best sources of resistance for the potential development of whitefly-resistant cassava varieties in African countries.
... This family comprises six genera, each transmitted by different vectors: aphids (Potyvirus, Macluravirus), mites (Rymovirus, Tritimovirus), plasmodiophorids (Bymovirus), and whiteflies (Ipomovirus derived from Ipomoea, the genus for sweet potatoes). Additionally, there's a seventh genus, Bramvyvirus, recently proposed with no known vector assignment (Carstens, 2010).The genus Ipomovirus consists of viruses transmitted by the whitefly B. tabaci in a semipersistent manner, as outlined by (Jones in 2003). This genus comprises four members: Cassava Brown Streak Virus (CBSV), Cucumber Vein Yellowing Virus (CVYV), Squash Vein Yellowing Virus (SqVYV) and Sweet Potato Mild Mottle Virus (SPMMV). ...
In the last two decades, newly emerged virus diseases have
significantly hampered the production of crucial vegetable crops worldwide,
especially in tropical, subtropical, and temperate areas. These diseases, largely
transmitted by whiteflies of the Hemiptera order and Aleyrodidae family,
consist mostly of begomoviruses, but whiteflies also carry criniviruses,
ipomoviruses, torradoviruses, and a few carlaviruses. Several factors drive the
rise and establishment of whitefly-transmitted diseases, including genetic viral
changes through mutation and recombination, alterations in vector
populations linked to the diverse feeding habits of the main vector, Bemisia
tabaci, and the extensive movement of plants and vectors due to global trade in
vegetables and ornamental plants. Human activity significantly contributes to
the increased emergence of these viral diseases, although the specific impact of
climate change remains uncertain.
... The genome is enclosed in a twinned icosahedral structure (Czosnek and Laterrot, 1997;Ghanim et al., 1998). TYLCV is limited to the phloem tissues of its hosts and is transmitted by the whitefly (Bemisia tabaci) (Jones, 2003). Stunting, extreme leaf curling, and yellowing are the classic symptoms of tomato plants infected by TYLCV. ...
Tomato yellow leaf curl virus (TYLCV) and tomato spotted wilt virus (TSWV) are well-known examples of the begomovirus and orthotospovirus genera, respectively. These viruses cause significant economic damage to tomato crops worldwide. Weeds play an important role in the ongoing presence and spread of several plant viruses, such as TYLCV and TSWV, and are recognized as reservoirs for these infections. This work applies a comprehensive approach, encompassing field surveys and molecular techniques, to acquire an in-depth understanding of the interactions between viruses and their weed hosts. A total of 60 tomato samples exhibiting typical symptoms of TYLCV and TSWV were collected from a tomato greenhouse farm in Nonsan, South Korea. In addition, 130 samples of 16 different weed species in the immediate surroundings of the greenhouse were collected for viral detection. PCR and reverse transcription-PCR methodologies and specific primers for TYLCV and TSWV were used, which showed that 15 tomato samples were coinfected by both viruses. Interestingly, both viruses were also detected in perennial weeds, such as Rumex crispus, which highlights their function as viral reservoirs. Our study provides significant insights into the co-occurrence of TYLCV and TSWV in weed reservoirs, and their subsequent transmission under tomato greenhouse conditions. This project builds long-term strategies for integrated pest management to prevent and manage simultaneous virus outbreaks, known as twindemics, in agricultural systems.
... Whitefly control is especially crucial for tomato production (Cohen and Harpaz 1964, Jones 2003, Jones 2009, Ghanim 2014. Tomatoes (Solanum lycopersicum L.) (Solanales: Solanaceae) are mainly grown in greenhouses in Japan for commercial purposes. ...
The sweetpotato whitefly Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae) is challenging to control using chemical pesticides owing to its resistance to many insecticides. Thus, there has been an increasing demand for alternative control measures. Thus, this study evaluated the efficacy of a newly designed pest suction machine to manage whiteflies on tomato plants (Solanum lycopersicum L.) (Solanales: Solanaceae) in greenhouses over 2 seasons. The suction machine comprised a battery-powered cart with a mounted suction unit, an ultrasonic device, and green lights. Ultrasonic irradiation provided non-contact vibration, facilitating the movement of adult whiteflies away from the plants, and green lights attracted them to the suction device. This combination effectively captured whitefly adults, even with a weak suction force, saving electricity consumption. The efficacy of suction machine was further evaluated by measuring the number of whitefly adults caught by the machine and the number of adults and nymphs remaining on the tomato leaves. The whitefly population was considerably lower in the treated blocks than in the non-treated blocks in the autumn trial. The machine reduced the density of whitefly adults without using chemical pesticides. Although a lot of optimizations would be required, suction control is an additional and alternative strategy that may be incorporated in the integrated pest management of whiteflies on greenhouse tomato plants.
... Host plant damage may be happened directly by adults and nymphs feeding on phloem sap [3] , and indirectly by honeydew secretion which promotes the growth of sooty mold that impairs photosynthesis [4] and adversely affecting on crop productivity [5,6] . In addition, B. tabaci is a transporter of more than 300 plant virus species [7,8] including Begomovirus, Crinivirus, Carlavirus, Ipomovirus, and Torradovirus [9][10][11][12] . In some crops, the plant viral infections lead to plant growth suppression or total crop loss [13] . ...
... Specifically, B. tabaci is a major pest of the cotton-vegetable belt in Georgia, USA, and causes economic losses averaging .US $160 million/yr (Li et al. 2021). Direct and indirect crop injuries are rampant in B. tabaciinfested crop systems, highlighting a need for an effective management program to suppress B. tabaci populations (Brown and Bird 1992, Carriere et al. 2014, Ghosh et al. 2019, Jones 2003, Li et al. 2021, Polston and Capobianco 2013, Shi et al. 2018. Such a management program proved to be challenging given the rapid development of resistance in B. tabaci to insecticides, spurring a need for constant insecticide resistance monitoring (De Marchi et al. 2021, Gravalos et al. 2015, Horowitz et al. 2020, Mohammed et al. 2020, Wang et al. 2020a, Zheng et al. 2021. ...
The sweetpotato whitefly, Bemisia tabaci (Gennadius) MEAM1 (Hemiptera: Aleyrodidae), continues to be a major pest of vegetable cultivation in Georgia, USA. Field-by-field surveying is an effective approach to determining the susceptibility status of a B. tabaci population to an insecticide. During 2020–2022, a modified maximum dose bioassay method was tested to characterize the insecticide response of B. tabaci field populations to several commonly used insecticides for whitefly management in Tift Co., GA, and the surrounding areas. A rapid bioassay was used for these evaluations that allowed for field assessments before spray applications to reduce the adult life stage of this species. The results of the evaluations were produced within 24-h following a 24-h root drench period. Our survey suggests that the neonicotinoids dinotefuran and flupyradifurone were the most effective insecticides from the Insecticide Resistance Action Committee (IRAC) group 4A. Cyantraniliprole was also effective, with 88 and 86% adult mortality following exposure to the high (maximum) and low doses, respectively. Conversely, the levels of control using another diamide, cyclaniliprole, were notably lower. Adding a low dose to the high dose provided an early indication of inefficient control with a product potentially indicating an increase in resistance. Specifically, a significant difference between the high and low doses suggests that the dose–response curve had shifted toward resistance development in each B. tabaci field population. The proposed bioassay method is meant for systemic insecticides that offer quick responses on adults. The use of this efficient method will improve evaluations prioritizing insecticides for use or rotation in an insecticide resistance management program.
... Bõ phçn Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae) là sinh vêy häi nguy hiểm, có phù ký chþ rûng (Đàm Ngõc Hân, 2012;Lê Thð Tuyết Nhung, 2014) và phân bø rûng Ċ vùng nhiệt đĉi và á nhiệt đĉi (Delatte & cs., 2007). Nguy hiểm hćn, chýng là môi giĉi truyền bệnh cþa hćn 110 loài virus gåy bệnh nghiêm trõng trên nhiều loäi cây tr÷ng (Jones, 2003). Bên cänh đò, B. tabaci còn thâi ra honeydew, täo điều kiện cho nçm b÷ hóng phát triển, hän chế quá trình quang hČp và hô hçp cþa cây (Matsui, 1995). ...
Ngày nhận bài: 29.08.2023 Ngày chấp nhận đăng: 07.03.2024 TÓM TẮT Nghiên cứu này nhằm xác định khả năng ký sinh của Encarsia sp. trên bọ phấn B. tabaci hại cà tím trên đồng ruộng và dưới ảnh hưởng của một số yếu tố bao gồm tuổi, mật độ bọ phấn và ong ký sinh cái. Tỷ lệ ký sinh của ong ký sinh trên bọ phấn hại cà tím được tiến hành điều tra tại Gia Lâm, Hà Nội vụ Xuân 2023 định kỳ 7 ngày/lần. Kết quả cho thấy Encarsia sp. có tỷ lệ ký sinh cao nhất (58,57%) vào giữa tháng 6, sau đó giảm dần. Ong ký sinh và bọ phấn được nhân nuôi quần thể trong phòng thí nghiệm và theo dõi tỷ lệ ký sinh sau 24 giờ khi cho ong ký sinh tiếp xúc với bọ phấn tuổi 1-tuổi 4, ở mật độ bọ phấn 5-80 con (tuổi 3-4)/lá và mật độ 1-4 ong cái/50 bọ phấn (tuổi 3-4). Ong ký sinh Encarsia sp. có tỷ lệ ký sinh cao nhất ở bọ phấn tuổi 3 và thấp nhất ở tuổi 1. Mật độ ký chủ tăng, tỷ lệ ký sinh của ong ký sinh giảm nhưng tỷ lệ vũ hoá tăng. Ngược lại, khi mật độ ong ký sinh tăng, tỷ lệ ký sinh tăng nhưng tỷ lệ ký sinh trung bình/con cái giảm. Ở mật độ 1-2 ong cái/50 bọ phấn, tỷ lệ vũ hoá trưởng thành đạt cao hơn tỷ lệ này ở mật độ 3-4 ong cái/50 bọ phấn. Như vậy, Encarsia sp. có tỷ lệ ký sinh cao trên đồng ruộng; tuổi và mật độ bọ phấn, mật độ ong ký sinh có ảnh hưởng khả năng ký sinh của chúng. Từ khóa: Ong ký sinh, bọ phấn, tỷ lệ kí sinh, tuổi vật chủ, mật độ vật chủ, tỷ lệ vũ hoá. ABSTRACT This study aimed to investigate the parasitism rate of Encarsia sp. on B. tabaci as well as the impact of host age, host density and parasitoid density on its parasitism. The survey on natural Encarsia parasitism was conducted on the eggplant fields at Gia Lam, Hanoi at 7 days interval. The results showed that Encarsia sp. had the highest parasitism rate (58.57%) in the middle of June and declined afterward. The parasitoid and whiteflies were mass rearing in the laboratory and recorded for the parasitism rate in 24 hours with different host age (1 st-4 th instar nymphs), host densities (5-80 nymphs (3 rd-4 th instar)/ leave) and parasitoid densities (1-4 females/ 50 nymphs (3 rd-4 th instar). Encarsia sp. reached the highest parasitised percentage at 3 rd instar nymph and lowest at 1 st instar nymph. As the host density increased the parasitism rate decreased, but the emerge rate increased, however. Nevertheless, parasitism increased with increased parasitoid density, but the average parasitism per female decreased. At densities of 1-2 female parasitoids the emerge rate was higher than at 3-4 female parasitoids. Overall, Encarsia sp. had high parasitism rate on the field and host age, host and parasitoid density influenced its parasitism.
... With more than 1,000 hosts, including cultivated and wild plants (Oliveira et al. 2001, Simmons et al. 2008, Abd-Rabou 2010, the whitefly causes direct damage to horticultural and ornamental crop plants by feeding and excreting honeydew sugars that facilitate development of fungi such as Cladosporium (Davidiellaceae) and Capnodium (Capnodiaceae) on leaves and fruit (Van Lenteren and Noldus 1990, Fox 1997, Horowitz and Ishaaya 2014. Whiteflies cause indirect damage by being an efficient vector of more than 120 phytopathogenic viruses of the genera Begomovirus (Geminiviridae), Crinivirus (Closteroviridae), and Carlavirus or Ipomovirus (Potyviridae) (Jones 2003, Li et al. 2021. ...
Whitefly, Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae), poses a significant threat to agricultural and horticultural crops, causing economic damage by direct feeding on plant foliage and through indirect transmission of plant viruses. The current study investigated the occurrence and population dynamics of B. tabaci and its natural enemies in both Bacillus thuringiensis (Bt) and non-Bt cotton fields over a period of 3-years. The study found endurance of B. tabaci populations in both Bt and non-Bt cotton for a period of 23 weeks. Comparatively, in Bt cotton the higher densities of B. tabaci adult population (13.47 ± 8.03 adults/leaf) were recorded during the last week of July (30th SMW) and nymphal population (91.16 ± 82.67 nymphs/leaf) mid-August (33rd SMW. Similarly, in non-Bt cotton, the peak densities were observed during the last week of July (30th SMW) for adults and during the last week of August (34th SWM) for nymphs with the correspondent value of 7.73 ± 3.64 adults/leaf and 35.66 ± 33.37 nymphs/leaf, respectively. Referring to natural enemies’ diversity, a total of 25 natural enemies were identified, comprising of 23 predators and each one species each of parasitoid and entomopathogenic fungi in both Bt and non-Bt cotton. Primarily, the aphelinid parasitoid Encarsia lutea (Masi) (71.29%) and coccinellid predator, Serangium parcesetosum Sicard (7.76%) were prevalent across the 3 years study period. It was perceived from the study that no significant differences in natural enemies’ abundance was observed between Bt and non-Bt cotton. Furthermore, in both Bt and non-Bt cotton the population dynamics of B. tabaci and its natural enemies was greatly influenced by the climatic variables like maximum and minimum relative humidity, temperature, and precipitation. The study revealed a higher population of B. tabaci in Bt cotton compared with non-Bt cotton, and observed regulating of this insect population by natural enemies and climatic conditions. These findings underscore the importance giving consideration to natural enemies of B. tabaci and their population dynamics in the development of Integrated Pest Management (IPM) strategies for sustainable cotton production. Conservation efforts targeting the diverse natural enemies community could further contribute to effective pest management.
To assess the prospects for the joint use of entomopathogenic fungi (EPF) and entomophages in plant protection from greenhouse whitefly, the influence of volatile organic compounds (VOCs) of fungi on the behavior of the phytophage and its parasitoid encarsia in 2 types of olfactometers was studied. In the Y-shaped olfactometer, it was revealed that 3 out of 9 EPF strains had a significant effect on the behavior of the imago phytophagus. The mycelium of the Vl 72 strain of the L. muscarium species showed an attractive effect (AE = +16), and for the Vl 61 strain of the same species and the Vit 71 strain of the L. attenuatum has been found to have a repellent effect against the pest (AE = –28 and –20, respectively). Experiments in two-chamber olfactometers, where T. vaporariorum was tested not individually, but in groups (15 individuals each), showed that all the studied strains did not affect the reactions of the phytophage. The activity of VOCs fungi against encarsia was less pronounced compared to whitefly. In the Y-shaped olfactometer, it was shown that only Vit 71 (L. attenuatum) showed an attractive effect, the remaining strains did not cause reactions in the parasitoid or showed a tendency to attract it.
The cotton or sweet potato whitefly, Bemisia tabaci, is a major pest in Algeria, affecting various greenhouse-grown crops. This study aimed to monitor B. tabaci population dynamics on tomatoes, peppers, zucchinis, and strawberries to understand its infestation patterns. The methodology involved regular monitoring of pest activity on these crops and a laboratory bioassay to assess the efficacy of two entomopathogenic fungi, Verticillium sp. and Paecilomyces sp., in controlling the whitefly. Results revealed that B. tabaci was most prevalent on tomatoes, with a 43.73% infestation rate, followed by peppers at 24%, zucchinis at 19.14%, and strawberries at 13.11%. In addition, laboratory trials were conducted to evaluate the efficacy of two entomopathogenic fungi, Verticillium sp. and Paecilomyces sp., in controlling the whitefly. Verticillium sp. showed higher efficacy, achieving a 73% mortality rate, while Paecilomyces sp. resulted in a significantly lower mortality of 23%. These findings suggest that Verticillium sp. holds promise as a biological control agent for managing B. tabaci in Algeria, particularly on tomato crops.
Silverleaf whitefly, Bemisia tabaci (Hemiptera: Aleyrodidae), is a destructive insect pest damaging to diverse crops by vectoring several plant pathogenic viruses, which consequently causes economic losses in crop production. As the resistance of whiteflies to chemical insecticides is increasing, this study aimed to investigate the potential of entomopathogenic fungi as an alternative. A total of 72 entomopathogenic fungal isolates, collected from soils using Tenebrio molitor larvae as an insect baiting method, were assessed for their virulence against 2nd nymphs of whitefly. Their virulence was assayed by dipping whitefly‐infested tomato leaves in fungal conidia suspensions at 1.0 × 10 ⁷ conidia/mL. Among the tested isolates, two isolates of Beauveria bassiana JEF‐462 and JEF‐507 showed high virulence. In the assessment of virulence depending on conidia concentrations, the estimated LC 50 values for JEF‐462 and JEF‐507 were similarly 8.7–14.0 × 10 ⁷ conidia/mL. However, B. bassiana JEF‐507 showed higher conidial productivity and thermotolerance on most of tested 12 grain substrates than B. bassiana JEF‐462, and millet was the most suitable grain substrate. Additionally, siloxane as a surfactant was able to sufficiently exhibit the insecticidal activity of JEF‐507 against whitefly nymphs compared with other surfactants. In a pot‐based greenhouse trial, JEF‐507 showed higher control efficacy than chemical insecticides, dinotefuran and spinetoram. This work suggests that B. bassiana JEF‐507 could be competitively used as a biopesticide to control silverleaf whiteflies while overcoming current resistance issues. The JEF‐507 isolate has been registered in Korea, 2022 and successfully commercialised as the name of Chongchae‐Stop in this local market to control whitefly and thrips.
Silverleaf whitefly (Bemisia tabaci (Gennadius), (Hemiptera: Aleyrodidae)) is an important pest of crops worldwide. It is among the most harmful species, especially in subtropical and tropical regions. Chemical control methods are commonly used in the control against this very significant pest. However, essential oils, composed of various components, can act against insect pests through complex mechanisms. This study investigated the behavioral preferences of silverleaf whiteflies on basil genotypes with different main components, including eucalyptol, estragole, geraniol, methyleugenol, methyl cinnamate, citral, and linalool based on the completely randomized design. In the genotypes, during the initial observation on July 2, 2022, the density of silverleaf whiteflies recorded was 12.58 individuals per leaf, whereas in the subsequent observation on July 19, 2022, the density decreased to 4.66 individuals per leaf. Across both observations, the highest mean number of silverleaf whiteflies per leaf was found in genotype PI 172998 (Estragole chemotype) with a mean observation of 20.08 individuals, while the lowest mean was in genotype PI 652070 (Linalol-Estragole chemotype) with a mean observation of 1.43 individuals. Since the linalool-methyleugenol and linalool-estragole chemotypes exhibited the lowest frequency of occurrence in both sets of observations, it is advisable to investigate the potential of these components as insect repellents. Furthermore, since the estragole, linalool-eucalyptol, and citral-neral chemotypes appeared most frequently in both observation groups, it is recommended to investigate the potential of these compounds as insect attractants. This study hig hlights the varying behavioral responses of silverleaf whiteflies to distinct basil chemotypes, offering valuable insights for pest management approaches.
Potato (Solanum tuberosum L.) is one of the most important staple crops in the world. However, potato cultivation is constrained by several biotic factors, the most important of which are viruses spread by insects and soil-borne vectors. In the potato pathosystem, about 50 phytopathogenic viruses have been reported to affect cultivated potatoes across various countries under diverse climatic conditions. Particularly, hemipteran vectors such as aphids and whiteflies play a dominant role in spreading potato viruses. For these diseases to be effectively controlled, it is essential to comprehend how viruses and their vectors interact. Therefore, in this chapter, we highlighted the ecology and transmission biology of potato viruses transmitted by aphid and whitefly vectors. We also review the tripartite interactions (virus-vector-host) and different management strategies that could be explored to interrupt the inter-relationship for sustainable management.
A cost-effective DNA extraction approach was developed and applied to PCR-based identification of yellow mosaic disease (YMD) causing viruses in individual whiteflies. Whiteflies were collected from urdbean and eggplant, representing host and non-host plants of target viruses, respectively. DNA from whiteflies was successfully extracted using the nuclease-free water boiling method and optimised template concentration for PCR assays. An average nucleic acid content of 3.844 ± 0.14 ng/µl was extracted from individual whiteflies in 50 µl nuclease-free water. PCR assays revealed Mungbean yellow mosaic India virus (MYMIV) presence in 90% of the whiteflies collected from urdbean. Conversely, YMD-causing viruses were not present in whiteflies collected from eggplant or in the eggplant plants themselves. The use of this low-cost approach for detecting YMD-causing viruses in whiteflies is very effective for the surveillance and monitoring of viruses. Early detection facilitates the deployment of appropriate management strategies, reducing both crop losses and the potential for outbreaks.
Introduction: Greenhouse whitefly, Trialeurodes vaporariorum Westwood (Hemiptera: Aleyrodidae), is a
serious pest of a wide range of plants, such as common bean, cucumber, tomato, pepper, lettuce, etc, in both field
and greenhouse production. It typically feeds on the underside of leaves, sucking phloem sap from the plant,
which causes both direct damage, by overall weakening the plant and reducing yield, and indirect damage, by
excreting honeydew, on which sooty mold grows, as well as transmission of several plant viruses. The
widespread use of insecticides to control T. vaporariorum has resulted in developing resistance to the
insecticides and affected human’s health and safety. The utilization of plant extract and elicitors is an
environmentally safe method that is used in the control recently. Therefore, alternative control strategies are
required to minimize the harmful effects of insecticides. In order to control this pest, environmentally friendly
methods, especially of plant origin are recently considered by researchers. For this regard, the effect of some
organic compounds including methanolic and n-hexanic extract of walnut’s husk or dill’s seeds and salicylic
acid, individually and in combination with spirotetramat on population density of greenhouse whitefly’s nymphs
and some secondary compounds of bean plant were investigated.
Materials and Methods: Seeds of common bean, Phaseolus vulgaris L. (Berloty cultivar) were sown and
grown in 15-cm-plastic pots in a greenhouse at 25 ± 3°C, 50 ± 10% RH, and a natural photoperiod. For the
experiments, potted bean plants at 6-8 leaf stage, highly infested with T. vaporariorum nymphs, were sprayed
with 12 different treatments, including: (1) spirotetramat (SP), (2) methanolic extract of walnut husk (MW), (3)
n-hexanic extract of walnut husk (NW), (4) methanolic extract of dill seed (MD), (5) n-hexanic extract of dill
seed (ND, (6) salicylic acid (SA), (7) spirotetramat in combination with salicylic acid (SP+SA), (8) spirotetramat
in combination with methanolic extract of dill seed (SP+MD), (9) spirotetramat in combination with methanolic
extract of walnut husk (SP+MW), (10) spirotetramat in combination with n-hexanic extract of dill seed
(SP+ND), (11) spirotetramat in combination with n-hexanic extract of walnut husk (SP+NW), and (12) water as
a control (CO). After five days, the population density of T. vaporariorum nymphs on bean plants leaves was
recorded. Furthermore, the effects of tested treatments on the total phenol and flavonoid contents of bean plants
were evaluated. For this reason, dried leaves (5 g) from each treatment were used for the preparation of extracts.
The total phenolic of the extracts were determined using the Folin - Ciocalteu reagent. Sample and standard
readings were made using a spectrophotometer (Lambda 45-UV/Visible) at 765 nm against the reagent blank.
Furthermore, the aluminum chloride colorimetric method was used for determination of the total flavonoid
content of treatments. For total flavonoid determination, quercetin was used to make the standard calibration
curve. The absorbance was read using a spectrophotometer (Lambda 45-UV/Visible) in the wavelengths of 415
nm. Data were analyzed by one-way ANOVA using SPSS 23.0 software. Comparison of means for nymph
density using SNK (Student-Newman-Keuls) multi-range test and comparison of means for secondary chemical
compositions using Tukey's test at probability level five Percentage occurred.
Results and Discussion: Results showed that the population density of greenhouse whitefly and the
secondary metabolites of plant were significantly affected by the tested treatments. The lowest number of
whitefly’s nymphs was on spirotetramat and spirotetramat in combination with methanolic extract of dill seed
and the highest number was on control. Total phenolic contents ranged from 58.96 to 114.07 mg g
dry weight
on different treatments, which the highest and lowest amount of it was obtained in spirotetramat in combination
with methanolic extract of dill seed and spirotetramat in combination with n-hexanic extract of walnut husk,
respectively. The highest amount of total flavonoid content of bean plants was in spirotetramat in combination
with salicylic acid. The results of the present study showed that the density of greenhouse whitefly population in
spirotetramate treatment was lower than other treatments but there was no significant difference with the combined treatments and methanolic extract of walnut husk. Also, all the treatments compared to the control
significantly changed the population density of this pest and increased the amount of total phenolic compound in
bean plant. Therefore, these compounds, especially the methanolic extract of walnut husk, can be used in
integrated management programs of this pest.
Conclusion: This research could provide valuable information for control of T. vaporariorum in other plants
like ornamental plants in the field and greenhouse and thus can be useful for the production of healthy and
organic crops. So it can be used in the IPM programs of this pest.
Multi-environment trials (MET) are crucial for selecting genotypes that are well-suited to different environmental conditions. Incorporating multiple traits in the analysis can provide more reliable recommendations for selecting genotypes with desirable traits, including resistance to the Mungbean Yellow Mosaic Virus (MYMV) and high yield potential. The use of a Multi-Trait Stability Index (MTSI) is a good approach for analyzing the stability of genotypes across multiple traits under MYMV stress. In the present investigation, the performance of thirteen green gram genotypes were evaluated for traits such as yield, plant height, number of branches per plant, and resistance to MYMV. The main objective of the study is to identify highly productive and stable mung bean genotypes resistant to MYMV. MTSI can be calculated by combining information on the performance of genotypes across multiple traits and environmental conditions to provide a single index that indicates the overall stability of genotypes across traits and environments. The results helped to identify two green gram genotypes (Yadadri and JNG-18) that were high-yielding with stable resistance to MYMV stress across multiple environmental conditions. This can provide useful information to breeders for the development of suitable genotypes against MYMV in the affected areas.
Oligonucleotide insecticides is not only new class of insecticides, it is an easy algorithm for fast creation of plethora of species-specific, genus-specific and family-specific pest control agents based on sequences of rRNAs of insect pests.
Материал по ДНК-инсектицидам излагается в исторической ретроспективе: от первых успешных экспериментов на непарном шелкопряде до опытов с грудохоботными, на которых ДНК-инсектициды проявляют наибольшую эффективность. Можно сразу прочитать о наиболее свежих успешных исследованиях, а можно проследить всю историю становления данного направления, начиная с антисмысловых олигонуклеотидов антиапоптозных генов и заканчивая генами рРНК насекомых.
Учебник рассказывает о современных инсектицидах, раскрывает потенциал создания средств защиты растений на основе нуклеиновых кислот: ДНК-инсектицидов и РНК-препаратов. Средства защиты растений на основе нуклеиновых кислот способны объединить наилучшие качества современных инсектицидов и обеспечить продовольственную безопасность странам, которые внедрят данные инновации. Издание рассчитано на широкий круг читателей: студентов, аспирантов и специалистов в области защиты растений, экологии, энтомологии, биотехнологии и молекулярной генетики.
Production of tomato (Lycopersicon esculentum) in Bangladesh, Malaysia, Myanmar, Vietnam, and Laos has been severely affected by yellow leaf curl disease. Tomato leaf samples were collected from symptomatic tomato plants from farmers' fields in the five countries from 1997 to 1999. DNA was extracted from all samples, four from Vietnam, two each from Malaysia, Laos, and Myanmar, and seven from Bangladesh. Virus DNA was amplified by polymerase chain reaction (PCR) using the begomovirus-specific degenerate primer pair PAL1v 1978/PAR1c 715(1), which amplifies the top part of DNA A. All samples gave the expected 1.4-kb PCR product. The PCR product of one sample per country was cloned and sequenced. Based on the sequences of the 1.4-kb DNA products amplified by the first primer pair, specific primers were designed to complete each of the DNA A sequences. Computer-assisted sequence comparisons were performed with begomovirus sequences available in the laboratory at the Asian Vegetable Research and Development Ce...
The molecular characterization of bipartite geminiviruses infecting the common leguminous weed Macroptilium lathyroides was accomplished using polymerase chain reaction (PCR), deoxyribonucleic acid (DNA) hybridization, and nucleotide sequence analysis. The predicted PCR-amplified fragments for DNA-A and DNA-B showed that M. lathyroides was infected with bipartite geminiviruses with a genome organization similar to other Western Hemisphere geminiviruses. Nucleotide sequence analysis showed that M. lathyroides from Jamaica was infected with two different viruses. Phylogenetic analysis of these macroptilium viruses from Jamaica and Western Hemisphere viruses, including three viruses from Jamaica indicated that macroptilium golden mosaic virus Jamaica strain 1 (MacGMV-JM1) was phylogenetically related to PYMV and SiGMV-JM, while the other virus, macroptilium golden mosaic virus Jamaica strain 2 (MacGMV-JM2) was closely related to two Jamaican viruses, TDLCV and WGMV. The results suggest that crop and weed geminiviruses from Jamaica are related but distinct, and that M. lathyroides is not host to previously described crop-infecting geminiviruses from Jamaica.
During winter 2000-2001, an unusual disease of tomato was observed in some greenhouses in Sardinia, Sicily, and Apulia, in southern Italy. Plants were chlorotic and reduced in size, expanded leaves showed interveinal yellowing, and older leaves developed interveinal reddish-bronze necrosis and downward rolling. The symptoms resembled those recently reported from Portugal (1) as induced by Tomato chlorosis virus (ToCV) (family Closteroviridae, genus Crinivirus), a whitefly-transmitted virus new to Europe. Symptomatic leaf tissues were extracted and analyzed by reverse transcription-polymerase chain reaction as described by Louro et al.(1). The 439-bp ToCV-specific DNA fragment was amplified in samples collected from 6 of 14 greenhouses in Sardinia, 2 of 5 greenhouses in Sicily, and 1 of 1 greenhouse in Apulia. The sequence of the fragment obtained from a Sicilian isolate (GenBank Accession No. AY048854) showed more than 99% identity to ToCV isolates (Accession Nos. AF024630 and AF234029) from the United States and Portugal, respectively. Infestations of Trialeurodes vaporariorum and Bemisia tabaci have been reported in autumn. To our knowledge, this is the first report of ToCV in Italy. Although we found the virus in three regions of the country, its distribution is likely to be wider, since the symptoms can be mistaken for those of a physiological disorder or of Tomato infectious chlorosis virus, another crinivirus infecting tomato.
Reference: (1) Louro et al. Eur. J. Plant Pathol. 106:589, 2000.
A newly discovered geminivirus [Family Geminiviridae, Genus "Subgroup III geminivirus"] which infects hollyhock (Althaea rosea) plants is reported in this study for the first time in Egypt. The name hollyhock leaf crumple virus (HLCrV) was given to this virus due to crumpling of the leaf blades of infected A. rosea. Additional symptoms included small vein thickening (SVT), epinasty, and cupping of leaves. HLCrV was transmitted by the silverleaf whitefly Bemisia argentifolii after acquisition and inoculation access periods of 30 and 15 min., respectively. Only one viruliferous whitefly insect could elicit disease syndrome. Host-range studies of HLCrV were restricted in the Malvaceae, viz. cheeseweed, cotton, and okra. HLCrV migrated in sucrose density gradients forming two peaks with A max and A min of 259, 240 nm (peak 1) and 258, 240 nm (peak 2), respectively. Purified H LCrV coat protein was separated in SDS-polyacrylamide gel electrophoresis into two components (25 kDa and 27 kDa). Gamma-globulin fraction of HLCrV-induced antiserum was prepared and used through direct ELISA to detect the virus in infected tissues. HLCrV-induced antiserum had a titer of 1/4000 when measured with indirect ELISA. Indirect ELISA failed to measure any serologic relatedness between HLCrV and the following geminiviruses: African cassava mosaic virus (ACMV), beet curly top virus (BCTV), cotton leaf curl virus (CLCuV), maize streak virus (MSV), squash leaf curl virus (SLCV), and tomato yellow leaf curl virus (TYLCV). On the otherhand, dot blot immunobinding assay (DBIA) detected positive relatedness between HLCrV, ACMV, and CLCuV; but not with BCTV, MSV, and SLCV. Ultrathin sections of infected A. rosea leaves indicated the restriction of HLCrV into the phloem tissues. Geminivirus-like particles in paracrystalline arrays were observed in the nucleus and the cytoplasm of parenchyma cells of the phloem.
Macroptilium lathyroides (L) is a weed that is widely distributed in Cuba. Frequently, leaves show bright yellow mosaic symptoms, which suggest the incidence of a viral disease. Since begomovirus occurrence in Macroptilium lathyroides has been previously reported in other islands of the Caribbean (1,3), symptomatic plants from three distant places in Cuba (Havana, Villa Clara, and Camaguey), were collected and tested for the presence of begomoviruses. Plant DNA extracts were analyzed by Southern blot hybridization and polymerase chain reaction with two sets of degenerate primers (2). The presence of a bipartite begomovirus was evident through strong hybridization signals obtained with the DNA-A and DNA-B of Taino tomato mottle virus as probes at low stringency. Furthermore, 1.4-kb and 1.2-kb PCR amplified fragments were obtained with DNA-A degenerate primers, PAL1v1978-PAR1c715 and PAL1c1960-PAR1v722, respectively. Both PCR fragments from the samples from the three locations were cloned, and restriction f...
Bitter melon, Momordica charantia (Cucurbitaceae), is a vegetable of nutritive and medicinal value that is cultivated throughout India and other tropical countries. In September 2001, a severe disease of bitter melon with virus-like symptoms was observed at Lucknow, India. Symptoms consisted of upward curling, shortening, and distortion of leaves. Diseased melon fruits were stunted and deformed. Disease incidence was as high as 100%. Whitefly (Bemicia tabaci) can transmit the associated virus from diseased bitter melon to Nicotiana tabacum cv. White burley. The development of leaf curl symptoms in N. tabacum indicated the pathogen could be a begomovirus. Total nucleic acids were extracted from diseased bitter melon leaves, and polymerase chain reaction (PCR) tests were performed. Three pairs of primers, AV494 and AC1048 (1), CL-CR/F2 and CL-CR/R2, CL/11F and CL10/R (2), specific to DNA-A of begomoviruses were used in PCR. Virus-specific DNA-A fragments of expected sizes were identified (≈0.5, 0.7 and 1.2 kb, respectively). The presence of a begomovirus in all PCR-amplified DNA fragments was confirmed by Southern hybridization. Cloned DNA-A fragments of Tomato leaf curl virus and Cotton leaf curl virus (both begomoviruses) cross-hybridized with the PCR products gave strong signals under high stringency conditions. These data suggest that a begomovirus is associated with this bitter melon disease. Watermelon mosaic 1 virus is the only virus previously reported to naturally infect bitter melon; however, this virus has not been identified in India. Bitter melon is also an experimental host of Ribgrass mosaic virus (genus Tobamovirus) and Trichosanthes mottle virus (genus Potyvirus). To our knowledge, this is the first report of the occurrence of begomovirus infecting bitter melon.
References: (1) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288, 1996. (2). X. Zhou et al. J. Gen. Virol. 79:915, 1998.
Tomato yellow leaf curl virus (TYLCV) is a major constraint to tomato production in Spain. This virus was observed for the first time in several tomato fields in Murcia (Spain) in the autumn of 1992 and Canary Islands in 1999. Currently the virus is prevalent along the Mediterranean coast of Spain (provinces of Malaga, Granada, Almeria, Murcia, Alicante, Valencia, and Barcelona) and in the Canary Islands. Two viral species have been identified in Spain, TYLCV-Sar in 1992 and TYLCV-Is in 1997. TYLCV-Is is more severe than TYLCV-Sar and produces the greatest economic losses. Curling of leaflets, yellowing, and growth reduction are more pronounced in plants infected with TYLCV-Is than in those infected with TYLCV-Sar. In order to study the presence and behavior of both viral species in the affected area, over 1,320 tomato plants were sampled. DNA was extracted from the samples and analyzed by polymerase chain reaction (PCR) amplification. The degenerate primer pair for Begomovirus detection (AV494/AC1048) (2...
Bean golden yellow mosaic virus (BGYMV, GenBank Accession No. M91604) is reported to be the main bean-infecting (Phaseolus vulgaris) begomovirus in Central America (1,2). Another begomovirus, Bean calico mosaic virus (BCaMV, GenBank Accession No. AF110189), is known to infect P. vulgaris in central Mexico. Bean samples with the viral symptom of foliar chlorosis were collected in different regions of Costa Rica from 1994 to 2001. Total nucleic acids were extracted and tested using polymerase chain reaction (PCR) with degenerate primer pair PBL1v2039/PCRc2 for DNA-B, which can give a different fragment size for some begomoviruses (4). PCR fragments were obtained from 119 bean samples. Fifty samples from the central valley produced 600-bp PCR fragments, which is typical for BGYMV (4), and one sample produced two fragments (500 and 600 bp). One sample from western Costa Rica had a 550-bp fragment, and 69 samples from the western and northern regions produced 500-bp fragments. One of the latter samples (No. 01...
Cabbage and collard greens were inflicted with a previously undescribed virus-like disease during the fall 2000. Symptoms on leaves were yellow spots, vein clearing, mosaic, curling, and puckering. Symptomatic plants were widespread in Brooks, Colquitt, Grady, and Pierce counties in Georgia. Disease incidence ranged from 10 to 20% in the majority of the fields surveyed but some fields had 100% incidence. Fields were heavily infested by Bemisia argentifolii and the symptoms were suggestive of a whitefly-transmitted geminivirus infection. A polymerase chain reaction (PCR)-based diagnostic test for geminivirus was conducted. Total DNA was extracted from symptomatic cabbage and collard green plants collected from commercial fields. The two primers, 5'-GCCCACATYGTCTTYCCNGT-3' and 5'- GGCTTYCTRTACATRGG-3' (2,3), are “universal” for genus Begomovirus of family Geminiviridae. The primer pair could amplify a part of the replicase-associated protein and coat protein and the complete common region of DNA-A. The PCR gave a DNA band of expected size (1.1 kb) from both symptomatic cabbage and collard green samples, whereas no such product was obtained from healthy samples, suggesting that the causal agent could be a geminivirus. To establish the identity of the virus, the 1.1 kb PCR product was cloned into pGEM-T Easy (Promega) and sequenced. GenBank search showed that the geminivirus isolated in Georgia was most closely related (98% sequence identity) to Cabbage leaf curl virus (accession number U65529) reported from Florida (1). The virus was mechanically transmitted to healthy cabbage and collard green plants under experimental conditions. To our knowledge, this is the first report of Cabbage leaf curl virus from Georgia.
References: (1) A. M. Abouzid et al. Phytopathology 82:1070, 1992. (2) S. S. Pappu et al. Plant Dis. 84:370, 2000. (3) M. R. Rojas et al. Plant Dis. 77:340–347, 1993.
Acalypha indica, Croton sparsiflorus and Vernonia cinerea, that grow around Vigna radiata and Vigna mungo fields and exhibit viral symptoms, were tested whether they serve as the reservoirs of Vigna yellow mosaic virus (YMV), a geminivirus. DNA A of Indian cassava mosaic virus (ICMV) was used as a general probe and DNA B of ICMV and YMV were used as specific probe. ICMV DNA A hybridized intensely to DNA from infected V. radiata, V. mungo, A. indica, C. sparsiflorus and V. cinerea, indicating that all these plants harboured whitefly-transmitted geminiviruses. The presence of single-stranded virion DNA and double-stranded replicative form in these plants was characterized by non-denaturing Southern analysis and by nuclease-sensitivity analyses. DNA B of ICMV, a specific probe, hybridized only to DNA from infected cassava and Acalypha suggesting that the geminiviruses that infected cassava and Acalypha are related. DNA B of YMV hybridized only to the DNA from infected V. mungo and V. radiata but not to the DNA of any of the weeds. Our results show that geminiviruses that infect the weeds A. indica, C. sparsiflorus and V. cinerea are not related to Vigna YMV and do not serve as reservoirs of V. mungo YMV.
A previously undescribed disease of the yellowing type was found to occur on cucumber and muskmelon in commercial greenhouses in Kanto area. Long, flexuous, rod-shaped virus particles, 12×1, 000nm approximately, were detected in dip preparations from diseased plants of cucumber and muskmelon. The detection was not easy, because the particles were small in number and labile in nature. The particles were also observed in thin sections prepared from both naturally and artificially infected plants of cucumber and muskmelon. Their presence was always restricted to phloem cells, but sometimes they were found in xylem parenchyma cells of vascular bundles. Virus-infected cells were also characterized by the development of amorphous granular structures and small vesicles containing fibrous materials in the cytoplasm. Both of them seemed to be closely related to virus multiplicaiton, and was considered to be viroplasms. Phloem necrosis was usually observed in diseased plants. It caused a remarkable accumulation of starch grains in chloroplasts in mesophyll cells. The virus was transmitted to healthy seedlings of cucumber and muskmelon by viruliferous greenhouse whiteflies, but not by inoculation of sap. From these results, the yellowing disease of cucumber and muskmelon was concluded to be caused by the long, flexuous, rod-shaped virus, which was named cucumber yellows virus.
A whitefly-transmitted virus was purified from tomato leaves affected by tomato yellow dwarf disease. Diseased leaves were extracted with 0.2M borate buffer (pH 8.5), containing 0.1% 2-mercaptoethanol and 1% Antifoam A emulsion. After clarification of the extract with 10% n-butanol, the virus was concentrated by precipitation with 6% polyethylene glycol (PEG) and by sucrose cushion centrifugation. The concentrated virus was partially purified by reverse concentration PEG solubility gradients, then further purified by sucrose density gradients. The ultraviolet absorption spectrum of the purified preparation was typical for nucleoprotein and the A280:A260 ratio was 0.6-0.7. The preparation contained small isometric particles, 15-20nm in diameter, that often occured as pairs, forming a structure of 15-20×25-30nm. The ratio of paired to single particles was approximately 3:1. These particles were disrupted by heavy metal salts used as negative staines, unless they were fixed previously. Very similar particles were also observed in purified preparations obtained from tobacco leaves infected with tobacco leaf curl virus (TLCV). No such particles were found in preparations from healthy control plants.
Electron microscopy of thin sections of infected tomato, Datura stramonium, and Nicotiana glutinosa leaves revealed the presence of crystalline inclusion showing a rigid rod structure in some of the nuclei in phloem cells. The rods, each of which was approximately 25nm wide, appeared to consist of a large number of geminate particles. Spherical particles of about 16nm in diameter were also found to exist randomly in the nuclei. Similar rods and spherical particles were observed in the leaf cell nuclei of tomato and D. stramonium infected with TLCV. No such structures were found in cells of the mesophyll or the epidermis in diseased plants, nor in cells from healthy plants.
The results obtained here and from our previous reports indicate that the virus associated with tomato yellow dwarf disease may be identical or closely related to TLCV. It also appears that the geminate particles are the possible causal agent of the two diseases, although infectivity of the purified preparation, containing such particles, is still under investigation.
Whitefly-transmitted disease agents cause significant losses throughout the world. Although not considered as important as aphids on a worldwide basis, they are responsible for the natural spread of a large number of economically important diseases in the tropical and subtropical areas. Recent years have shown an increase in losses in wide areas north and south of the tropics, approaching areas of intensive agricultural production such as the southern United States, Jordan, and Israel (26, 28, 32, 43). These areas are in the apparently increasing range of Bemisia tabaci (Gennadius), the most intensively studied whitefly vector. Recent years have shown, if not an absolute increase, at least an increase in the awareness of disease losses caused by two other whitefly species, Trialeurodes vaporarium (Westwood) and T. abutilonea (Hald.), in temperate areas of the United States, Europe, Australasia, and Asia (41, 42, 58, 60, 86, 102).
Symptoms of interveinal chlorosis (yellowing) are commonly observed in melon or cucumber plants grown in greenhouses in the southeastern coast of Spain. The agent of the disease was determined to be cucurbit yellow stunting disorder virus (CYSDV). CYSDV was shown to be transmitted specifically by the tobacco whitefly (Bemisia tabaci), was retained by the vector for at least 7 days, and had an experimental host range restricted to members of the family Cucurbitaceae. Filamentous, flexuous virus particles typical of the closteroviruses were observed in infected plants. The length distribution of the virus particles showed two peaks at 825 to 850 nm and 875 to 900 nm. Analysis of double-stranded (ds) RNA extracts revealed two major dsRNA species of approximately 8 and 9 kbp. Random cDNA cloning of viral dsRNA was performed, and a virus-specific cDNA clone (p410) of 557 nucleotides that hybridized with the smaller of the two vital dsRNA species was identified. Computer-assisted analysis showed that the deduced amino acid sequence of p410 was significantly similar to the HSP70 homologs of the closteroviruses and showed greater similarity to the HSP70 homolog of the B. tabaci- transmitted lettuce infectious yellows closterovirus (LIYV) than to the HSP70 homologs of the aphid transmitted closteroviruses. The data suggest that CYSDV is a member of a newly recognized subgroup of closteroviruses with bipartite genomes exemplified by LIYV.
Whiteflies, as vectors of disease agents, although not considered as important as aphids on a worldwide basis, caused significant losses throughout the world. There has been an increasing awareness of the losses caused by whitefly-transmitted viruses in the temperate areas. The number of articles dealing with whiteflies and viruses almost doubled in the last 10 years, whereas the number of articles on aphids and viruses remained almost constant. About one-tenth of the papers on whitefly-borne viruses discuss problems within Europe. The increasing menace of whitefly-borne viruses caused the European Union (EU) to set up the “European network on European whiteflies, their associated plant pathogens and disorders,” or more briefly, the European Whitefly Studies Network (EWSN), in 1999. Geographical Europe includes many more countries than those in the EU, and whitefly-borne viruses and their vectors tend to ignore borders, being more affected by geographical than political barriers. Therefore, this chapter includes the continental Europe countries extending over the Caucasus mountains (traditionally, one of the geographical limits of Europe) and Turkey, which is geographically mostly in Asia.
Okra leaf curl disease (OLCD), characterized by either upward or downward leaf curl and stunted plant growth, is one of the major diseases of okra (Hibiscus esculentis L.) in Pakistan. OLCD is transmitted by the whitefly Bemisia tabaci and is suspected of being associated with a whitefly-transmitted geminivirus (Genus Begomovirus). Total DNAs isolated from both symptomatic and healthy okra plants collected from several locations in Pakistan were resolved on agarose gels and blotted to nylon membranes. A full-length DNA A clone of Cotton leaf curl virus (CLCuV) from Pakistan (2) was labeled with 32PdCTP and used as a probe at medium stringency. The probe detected the presence of characteristic geminivirus DNA forms in infected plants, while no hybridization was observed to healthy plant extracts, confirming the association of a begomovirus with OLCD. Degenerate oligonucleotide primers based on conserved sequences of DNA B components of begomoviruses were used in PCR for the detection of a potential DNA B (...
In 1992 viruslike symptoms appeared on lisianthus plants grown at different locations in Israel. The symptoms included distortion of the growing tips, cup-shaped leaves, and swelling of veins on the lower surface of the leaves. Plants infected at an early stage did not yeld flowers, but late infections did not impair flowering. The viral causal agent of the disease was purified from infected plants and identified with a molecular probe prepared from cloned tomato yellow leaf curl virus (TULCV) DNA and a specific antiserum against the virus. Purified preparations were infectious to healthy lisianthus in transmission experiments with Bemisia tabaci. These data confirmed that lisanthus leaf curl is caused by TYLCV. This devastating disease has become a limiting factor in the expansion of lisianthus cultivation in Israel.
An epidemic of bean golden mosaic virus (BGMV-H) was observed in the winter of 1993 in South Florida. The disease was found in common bean, Phaseolus vulgaris, and lima beans, P. lunatus, in southwest Dade County and southeast Palm Beach County. In a survey of 125 fields in Dade County, there was an average disease incidence of 26%, with higher disease incidences in fields of cranberry beans and pole beans than in snap beans. Approximately 30% of the estimated 11,000 ha planted to snap beans in South Florida was affected. In snap bean fields where BGMV-H was most severe, growers reported yields of 26-87 hL/ha compared to expected yields of 175 hL/ha. In some cases, fields were completely abandoned or destroyed. The disease was not detected in the other winter bean production areas in South Florida. An isolate of the virus from Homestead (BGMV-H) was mechanically transmissible to P. vulgaris cv. Topcrop, and the whitefly Bemisia labaci (also known as Bemisia argentifolii) was an efficient vector of the virus in transmission tests. Plants with bright golden mosaic symptoms tested positive for geminivirus infection when extracts were probed (dot blots) with A component DNA from a geminivirus infecting the weed Macroptilium lathyroides or from the recently identified tomato mottle geminivirus, both from Florida. The bean samples did not react with probes prepared to the B components for either of these viruses. Hybridization probes prepared to A and B components of BGMV-H gave strong reactions with extracts from beans infected with BGMV isolates from Guatemala and from the Dominican Republic. This is the first report of an epidemic of BGMV occurring in the continental United States.
Symptoms of interveinal chlorosis, necrotic flecking, thickening, and rolling of leaves were observed on leaves of field-grown tomato (Lycopersicon esculentum) plants in Jauna Diaz, Puerto Rico. These symptoms are indicative of those produced by the whitefly-transmitted criniviruses, Tomato infectious chlorosis virus (TICV) and Tomato chlorosis virus (ToCV) (1). Samples collected from two symptomatic plants were examined by leaf dip and were found to contain long flexuous rods approximately 800 nm in length, characteristic of criniviruses. Symptomatic leaves were used for extraction of total nucleic acid and for whitefly transmission studies. The greenhouse whitefly, Trialeurodes vaporariorum (Westwood), is a highly efficient vector of TICV, but an inefficient vector of ToCV, whereas the banded wing whitefly, T. abutilonea (Haldeman), is an efficient vector of ToCV but does not transmit TICV (2). Whiteflies of both species were allowed to feed separately on symptomatic tomato leaves for 24 h and then tran...
Whitefly-mediated transmission of circulative plant viruses involves highly specific, coevolved intramolecular interactions between the viral-encoded determinants and the receptor-like molecules of insect origin that interact to confer virus–vector specificity. This chapter describes the current physical, behavioral, cellular, and molecular aspects of whitefly-mediated transmission for the four plant virus genera known to be transmitted by one or more whitefly vector species: Begomoviruses, Carlaviruses, Criniviruses and Potyviruses. However, as very little is known about the cellular or molecular mechanisms of transmission of noncirculative whitefly-transmitted viruses, much of the review in the chapter concerns results of recent studies for begomoviruses and their whitefly vector, B. tabaci, and analogies that may be drawn from knowledge of other wellstudied circulative plant virus groups and their vector relations. Understanding the basis for the behavioural, cellular, and molecular phenomena that underlie whitefly-mediated transmission of plant viruses should provide great opportunities for directing the disruption of specific targets to interfere with the transmission process at critical and vulnerable points in the pathway.
During the summer and autumn of 2001, symptoms of interveinal yellowing, bronzing, brittleness, and rolling of lower leaves were observed in greenhouse- and field-grown tomato (Lycopersicon esculentum) plants in Castellon Province in eastern Spain. Symptoms resembled those caused by the whitefly-transmitted criniviruses (1,2). Total RNA was extracted from 28 samples of symptomatic leaves collected in three greenhouses and one field and analyzed by reverse transcription-polymerase chain reaction using primers specific for Tomato chlorosis virus (ToCV) (1) and Tomato infectious chlorosis virus (TICV) (2). The 501-bp TICV-specific DNA fragment was amplified in four samples collected during the summer in three greenhouses and one field, and the 439-bp ToCV-specific DNA fragment was amplified in 15 samples collected during the autumn in the same three greenhouses; no mixed infections were found. The DNA fragments amplified from TICV were sequenced and showed 99 to 100% identity with the TICV isolates (GenBank Accession Nos. U67449 and AY048855) from the United States and Italy, respectively, confirming the diagnosis. One sequence was deposited as GenBank Accession No. AF479662. To our knowledge, this is the first report of TICV in Spain and the second in Europe.
References: (1) D. Louro et al. Eur. J. Plant Pathol. 106:539, 2000. (2) A. M. Vaira et al. Phytoparasitica. In Press.
Tomato yellow leaf curl virus (TYLCV, formerly TYLCV-Is) and Tomato yellow leaf curl Sardinia virus (TYLCSV, formerly TYLCV-Sar) are geminivirus species of the genus Begomovirus that cause the disease known as tomato yellow leaf curl. In Spain, TYLCV and TYLCSV have coexisted in field and greenhouse tomato (Lycopersicon esculentum) crops since 1996 (2). TYLCV is also the causal agent of the leaf crumple disease of common bean (Phaseolus vulgaris) (1), a species that TYLCSV is unable to infect (2). Analysis of field samples from common bean plants affected by leaf crumple disease collected in Almeria (southeastern Spain) during 1999 showed that, unexpectedly, several samples hybridized with TYLCV- and TYLCSV-specific probes prepared to the intergenic region (IR) as previously described (1). Polymerase chain reactions (PCR) performed with total nucleic acids extracted from one of these samples (ES421/99) using primer pairs specific to the IR of TYLCV (MA-30/MA-31) or TYLCSV (MA-14/MA-15) (1) gave no amplifi...
The begomovirus Tomato yellow leaf curl virus (TYLCV) is one of the major threats to tomato production in tropical and subtropical regions worldwide. TYLCV was found in Cuba in 1994 and later became the most serious constraint to tomato production (2). During a field survey in 2001, pepper plants (Capsicum annuum) were observed in a greenhouse in Camagüey Province, showing mild interveinal yellowing and curling of leaves. Total nucleic acids were extracted from these plants and from pepper samples collected in previous years that showed similar symptoms. Polymerase chain reaction (PCR) was performed on extracts using a primer pair (TY-1/TY-2) (1) specific for the capsid protein (CP) gene of begomoviruses and a second primer pair (IR2353+: CTGAATGTTTGGATGGAAATGTGC; IR255-:GCTCGTAAGTTTCCT CAACGGAC) designed to amplify the part of the genome encompassing the intergenic region (IR) of the Cuban isolate of TYLCV-IS (2). With these primer pairs, amplicons of the expected size were obtained from five samples (one collected in 1995 in Havana Province, two in 1999 in Sancti Spiritus, and two in 2001 in Camagüey.) The CP fragment was digested with RsaI, while the IR amplicon was digested with AvaII and EcoRI. In all cases the patterns obtained corresponded to digestion patterns for identical PCR fragments obtained from TYLCV-infected tomatoes. The IR amplicon sequence from one sample showed ≈99% identity with the corresponding region of the TYLCV-IS isolated from tomato in Cuba. To our knowledge, this is the first report of TYLCV-IS infection in peppers in Cuba.
References: (1) G. P. Accotto et al. Eur. J. Plant. Pathol. 106:179, 2000. (2) Y. Martínez et al. J. Phytopathol.144:277, 1996.
Field tomato plants exhibiting upward curling of leaflets, chlorosis, and stunting symptoms described for tomato leaf curl disease in Sudan (2) were collected in 1996 from Gezira (GZ) and Shambat (SH), Sudan. Disease symptoms were reproduced following experimental transmission of the causal agent(s) by the whitefly Bemisia tabaci from field tomato to virus-free tomato seedlings in a glasshouse at Gezira Research Station, Wad Medani, Sudan. Total nucleic acids were extracted from symptomatic tomato test plants. An ≈1.3-kbp fragment, diagnostic for begomovirus, was obtained from extracts by polymerase chain reaction using degenerate primers that amplify the coat protein gene (CP) and the respective flanking sequences for most begomoviuses (1). A second pair of degenerate primers was used to amplify a 2.3-kbp begomoviral fragment that overlaps both ends of the (CP) amplicon by >200 nt (1). At least 10 amplicons for each were cloned, and their sequences were determined, revealing three unique, tomato-infectin...
Thirty-five-day-old tomato plants (cultivar Florasette) exhibited yellow leaf curling, stunting, and extremely reduced fruit set in spring 2001, in Guanica, Puerto Rico (PR). Twenty percent disease incidence was observed in this field and, 8 weeks later, 75% of the plants showed symptoms. These symptoms were distinct from those caused by other tomato-infecting begomoviruses reported previously from PR, namely Merremia mosaic virus, Tomato mottle virus (ToMoV), and Potato yellow mosaic virus (1). A colony of the B biotype of Bemisia tabaci (Genn.) was used to transmit the suspect virus from symptomatic plants collected in the field and established in the greenhouse in Rio Piedras, PR. The suspect virus was transmitted readily to tomato cultivar Roma (10 of 10 plants), and symptoms were like those observed in the field. Symptoms also were reminiscent of those described for several Old World begomoviruses, referred to as Tomato yellow leaf curl virus (TYLCV). Total nucleic acids were isolated from three symp...
In 2000, geminivirus-like symptoms were widespread in muskmelon (Cucumis melo L.) fields (70 to 80% incidence) in Zacapa Valley, Guatemala. Muskmelon fields were infested with the whitefly Bemisia tabaci (Genn.), and plants exhibited patchy foliar chlorosis, leaf curling, and reduced fruit set, which is reminiscent of symptoms caused by certain whitefly-transmitted geminiviruses. Quarantine restrictions prevented experimental transmission experiments from being carried out with the whitefly vector or biolistic inoculation. Leaves collected from six symptomatic plants were assessed for the presence of begomovirus DNA by polymerase chain reaction (PCR) with the use of degenerate primers that amplify the core region of the coat protein (CP) gene of most begomoviruses (1). PCR products of the expected size (approximately 576 bp) were obtained from all three melon samples. The core CP amplicons were cloned, and their nucleotide sequences were compared. Nucleotide sequences of core CP fragments shared 99.7% ide...
A begomovirus (family Geminiviridae) has long been suspected to be associated with Rhynchosia mosaic (RhM) disease of Rhynchosia minima (L.) DC., a weed that is widespread in Puerto Rico (PR). The suspect virus has been transmitted by the Sida biotype of Bemisia tabaci (Genn.) and has been designated RhM virus-PR (RhMV-PR) (1) (synonym, Rhynchosia mosaic virus [RMV]). RhM symptoms in R. minima included yellow foliar mosaic and stunting. The virus has a broad experimental host range and infects species in the Fabaceae, including R. minima, pigeon pea (Cajanus cajan (L.) Millsp.), and Clitoria falcata L. (1). However, until now RhMV has not been identified from naturally infected pigeon pea or Clitoria falcata. R. minima and C. cajan plants exhibiting yellow foliar mosaic and stunting symptoms were collected in Puerto Rico. Using the B biotype of B. tabaci as the vector, their whitefly transmissibility from the respective source plant to R. minima and C. cajan test plants was confirmed, and symptoms in inoc...
In late summer 2000, tomato (Lycopersicon esculentum Mill.) grown in greenhouses in Ierapetra, Tympaki, and Chania (Crete) showed leaf curling, reduced leaf size, yellowing, shortened internodes, and a bushy appearance. More than 30 ha of tomato greenhouses were affected and the disease incidence ranged from 15 to 60% with estimated crop losses of over $500,000. Similar symptoms were observed in tomato samples from Marathon (Attiki) and Southern Peloponnese. All greenhouses with infected plants were infested with high populations of Bemisia tabaci (Gennadius), which were also observed outside the greenhouses on several weeds. Tomato symptoms were similar to those caused by Tomato yellow leaf curl virus (TYLCV). The assumed virus could not be transmitted mechanically but successful transmission was obtained by grafting onto healthy tomato plants. Over 100 samples of symptomatic tomato plants collected from Crete and southern Peloponnese gave positive reactions when tested by ELISA using monoclonal antibodi...
The recent discovery that monopartite begomoviruses on ageratum and cotton essentially require a DNA satellite called DNA β (2,4) is leading to identification of several other hosts that have similar disease complexes. A weed species (Croton bonplandianus) belonging to the family Euphorbiaceae is one such example. C. bonplandianus is widely distributed on wastelands throughout the Punjab Province in Pakistan. It very often shows yellow vein symptoms indicating infection by a begomovirus. To detect a begomovirus, both symptomatic and asymptomatic plants were collected from several widely separated locations in the Punjab Province. Total DNA was isolated from these samples by the cetyltrimethylammoniumbromide (CTAB) method, resolved in an agarose gel, and blotted on a nylon membrane (2). A full-length clone of DNA A of Cotton leaf curl virus (CLCuV) labeled with 32PdCTP was used as a probe in Southern hybridization (2). The probe detected hybridizing bands only in symptomatic plants, confirming the presence...
Tomato yellow leaf curl virus (TYLCV) is a begomovirus (family Geminiviridae) that causes severe chlorosis, stunting, and cupping of leaves in tomato (Lycopersicon esculentum) throughout the world. The disease was first reported in the United States in Florida in 1997 (2). In 2000, TYLCV was confirmed as the cause of severe chlorosis, stunting, and cupping of leaves in tomato in Louisiana (3). In January of 2001, mild symptoms consistent with TYLCV were observed in a greenhouse-tomato production operation in east-central Mississippi. Whiteflies (Bremisia tabaci) were present in the greenhouse during the previous month, but in relatively low numbers. Symptom severity slightly increased over time with chlorosis in the terminal, reduction in terminal leaf size, and upward cupping of leaves observed. Approximately 4% of plants in the greenhouse developed symptoms. Yield reductions are thought to be negligible since the tomato plants harbored most fruit for that growing season. Terminal growth was halted, and ...