Aptamer-Mediated Delivery of Splice-Switching Oligonucleotides to the Nuclei of Cancer Cells

Department of Surgery, Duke University Medical Center, Durham, North Carolina 27710, USA.
Nucleic acid therapeutics 06/2012; 22(3):187-95. DOI: 10.1089/nat.2012.0347
Source: PubMed
ABSTRACT
To reduce the adverse effects of cancer therapies and increase their efficacy, new delivery agents that specifically target cancer cells are needed. We and others have shown that aptamers can selectively deliver therapeutic oligonucleotides to the endosome and cytoplasm of cancer cells that express a particular cell surface receptor. Identifying a single aptamer that can internalize into many different cancer cell-types would increase the utility of aptamer-mediated delivery of therapeutic agents. We investigated the ability of the nucleolin aptamer (AS1411) to internalize into multiple cancer cell types and observed that it internalizes into a wide variety of cancer cells and migrates to the nucleus. To determine if the aptamer could be utilized to deliver therapeutic oligonucleotides to modulate events in the nucleus, we evaluated the ability of the aptamer to deliver splice-switching oligonucleotides. We observed that aptamer-splice-switching oligonucleotide chimeras can alter splicing in the nuclei of treated cells and are effective at lower doses than the splice switching oligonucleotides alone. Our results suggest that aptamers can be utilized to deliver oligonucleotides to the nucleus of a wide variety of cancer cells to modulate nuclear events such as RNA splicing.

Full-text

Available from: Elizabeth Pratico
Aptamer-Mediated Delivery of Splice-Switching
Oligonucleotides to the Nuclei of Cancer Cells
Jonathan W. Kotula,
1
Elizabeth D. Pratico,
1
Xin Ming,
2
Osamu Nakagawa,
2
Rudolph L. Juliano,
2
and Bruce A. Sullenger
1
To reduce the adverse effects of cancer therapies and increase their efficacy, new delivery agents that specifically
target cancer cells are needed. We and others have shown that aptamers can selectively deliver therapeutic
oligonucleotide s to the endosome and cytoplasm of cancer cells that express a particular cell surface receptor.
Identifying a single aptamer that can internalize into many different cancer cell-types would increase the utility
of aptamer-mediated delivery of therapeutic agents. We investigated the ability of the nucleolin aptamer
(AS1411) to internalize into multiple cancer cell types and observed that it internalizes into a wide variety of
cancer cells and migrates to the nucleus. To determine if the aptamer could be utilized to deliver therapeutic
oligonucleotide s to modulate events in the nucleus, we evaluated the ability of the aptamer to deliver splice-
switching oligonucleotides. We observed that aptamer-splice-switching oligonucleotide chimeras can alter
splicing in the nuclei of treated cells and are effective at lower doses than the splice switching oligonucleotides
alone. Our results suggest that aptamers can be utilized to deliver oligonucleotides to the nucleus of a wide
variety of cancer cells to modulate nuclear events such as RNA splicing.
Introduction
S
tandard cancer therapies such as chemotherapeutics
and radiation are not only toxic to tumor cells but to
healthy cells as well, which causes toxicity to the patient. This
toxicity adversely affects patients, creating many serious con-
ditions such as gastrointestinal distress, organ damage, and
death. To attempt to reduce the adverse effects of cancer therapy
and concurrently increase their efficacy, new therapeutics that
specifically target cancer cells are needed. Aptamer-mediated
delivery of therapeutic agents to targeted cells represents an
emerging strategy that may be useful in treating cancer patients
(Chu et al., 2006a; Chu et al., 2006b; Farokhzad et al., 2006;
McNamara et al., 2006; Wullner et al., 2008; Dassie et al., 2009;
Zhou and Rossi, 2010; Min et al., 2011; Wu et al., 2011).
Aptamers that recognize cell surface receptors have been
utilized to deliver various cargos including toxins and small
interfering RNA (siRNA) (Chu et al., 2006a; Chu et al.,
2006b; Farokhzad et al., 2006; McNamara et al., 2006; Wullner
et al., 2008; Dassie et al., 2009; Tiemann and Rossi, 2009; Kim
et al., 2010; Li et al., 2010; Zhou and Rossi, 2010). Aptamer–
oligonucleotide chimeras may be particularly safe for treating
cancer because they can be engineered to contain 2 layers of
selectivity: (a) an aptamer domain that binds to a receptor
overexpressed on cancer cells and (b) a therapeutic oligonu-
cleotide that affects an essential pathway in cancer but not
normal cells. For example, we and others have described the use
of an aptamer targeting prostate specic membrane antigen
(PSMA) to deliver siRNAs to inhibit the expression of genes that
are upregulated in prostate cancer cells such as polo-like kinase
1 (Plk1), elongation factor2 (EEF2), and B-cell lymphoma-extra
large (Bcl-xL) (McNamara et al., 2006; Wullner et al., 2008;
Dassie et al., 2009; Kim et al., 201 0). This double layer of spec-
ificity has the potential to dramatically increase the selectivity of
therapeutics, which may greatly reduce their side effects.
Recently, our lab and others have generated aptamers that
recognize a limited number of other cell surface receptors
(Dollins et al., 2008a; Li et al., 2011) and have demonstrated that
such aptamers can be internalized into cells and carry cargoes
into them. Therefore this approach holds much promise for
therapeutic development but unfortunately its utility is still
hindered by significant limitations (Dollins et al., 2008b; Tie-
mann and Rossi, 2009; Zhou and Rossi, 2010). Currently, each
aptamer can only bind a specific subset of cancer cells based on
the biomarkers expressed on the cell surface. Additionally, such
aptamers appear to usually internalize into the cells through
receptor-mediated endocytosis, which greatly limits their effi-
cacy because their escape from the endosomal compartment
1
Departments of Surgery and Molecular Genetics and Microbiology, Duke University Medical Center, Durham, North Carolina.
2
Division of Molecular Pharmaceutics, Eshelman School of Pharmacy, University of North Carolina, Chapel Hill, North Carolina.
NUCLEIC ACID THERAPEUTICS
Volume 22, Number 3, 2012
ª Mary Ann Liebert, Inc.
DOI: 10.1089/nat.2012.0347
187
Page 1
appears to be inefficient. Thus, in these studies we began to
explore whether an aptamer could be identified that can cir-
cumvent these problems by binding to and internalizing into
multiple cancer cell types and escape the endosomal pathway.
Nucleolin, a protein traditionally found in the nucleolus,
where it regulates ribosome biogenesis (Ginisty et al., 1998;
Ginisty et al., 1999) and binds telomeres (Pollice et al., 2000),
has emerged as a unique biomarker found on the cell surface
of rapidly proliferating tumor cells (Hovanessian et al., 2010).
Cell surface nucleolin has a short half-life and traffics from the
cell surface to the nucleus through a nontraditional mecha-
nism (Huang et al., 2006; Hovanessian et al., 2010). AS1411, a
G-quartet DNA aptamer (Girvan et al., 2006; Ireson and Kel-
land, 2006), has been shown to selectively bind to nucleolin
(Teng et al., 2007; Soundararajan et al., 2008) and internalize
into a variety of cancer cell lines including renal, breast, and
other adenocarcinoma cell lines (Bates et al., 2009a; Bates et al.,
2009b; Reyes-Reyes et al., 2010). Because of these properties,
we hypothesized that an aptamer chimera engineered with
the AS1411 nucleolin aptamer might have potential advan-
tages over other aptamer chimeras. Here we examined the
cellular localization of the nucleolin aptamer and chimeras,
showing that the aptamer and chimeras localize to the nu-
cleus, a unique property compared to previously described
aptamers. We began to examine the mechanism responsible
for nuclear localization to determine whether the nucleolin
aptamer internalized through the receptor-mediated endo-
cytosis pathway, as well as evaluate the aptamer’s ability to
deliver therapeutic agents that would take advantage of the
nuclear localization of aptamer-based chimeras.
We engineered aptamer-based chimeras to contain splice-
switching oligonucleotides (SSOs) as cargoes. SSOs are a form
of antisense technology, where single-stranded oligonucleo-
tides bind to a splice site or splicing enhancer, blocking access
to the endogenous splicing machinery, causing an alternate
version of a mature mRNA to be generated and translated
(Kang et al., 1998; Kole et al., 2004a; Kole et al., 2004b; Ming
et al., 2010). SSOs are an emerging tool for generating phe-
notypic changes in cells (Kang et al., 1998; Bauman et al., 2009;
Wan et al., 2009; Ming et al., 2010), and are easy to append to
aptamers because they usually contain 2¢O-Me modified ba-
ses and a phosphorothioate backbone that render the mole-
cules nuclease resistant (Kang et al., 1998). However, to
enhance the potential therapeutic utility of SSOs it would be
useful to target and efficiently deliver them to the nuclei of
specific cells (Lundin et al., 2008; Bauman et al., 2009; Wan
et al., 2009; Alam et al., 2010). The nucleolin aptamer–SSO
chimera described here effectively delivered SSOs to the nu-
clei of cells and enhanced splice correction.
Materials and Methods
RNA and DNA oligonucleotides
Fluorescently tagged DNA aptamers were ordered from
IDT. The splice-switching oligonucleotides and chimeras
were prepared according to the method previously reported
(Alam et al., 2008).
Oligonucleotide sequences
AS1411: 5¢- GGTGGTGGTGGTTGTGGTGGTGGTGG-3¢
Control: 5¢- CCTCCTCCTCCTTCTCCTCCTCCTCC-3¢
EGFR aptamer: 5¢- GGCGCUCCGACCUUAGUCUCUGUG
CCGCUAUAAUGCAC GGAUUUAAUCGCCGUAGAA
AAGCAUGUCAAAGCCGGAACCGUGUAGCACAGC
AGA-3¢
Luciferase splice-switching oligo: 5¢- GUUAUUCUUUAG
AAUGGUGC-3¢
Control splice-switching oligo: 5¢- AUGGCCUCGACGUGC
GCGCU-3¢
AS1411–Luciferase SSO chimera: 5¢- TGGTGGTGGTGGTT
GTGGTGGTGGTGGAAA GUUAUUCUUUAGAAUGGU
GC-3¢
All splice-switching oligos have a 2¢-O-Me phosphor-
othioate chemistry backbone.
siRNA transfections
All siRNAs were ordered from Dharmacon. Transfections
were performed with Lipofectamine 2000 (Invitrogen: 11668-
019) according to manufacturer’s protocol with siRNA at
specified concentrations.
Cell culture
All cells were maintained at 37C and 5% CO
2
in appro-
priate growth media: HeLa, 786-0 renal adenocarcinoma
(ATCC: CRL1932), PC-3 prostate adenocarcinoma (ATCC:
CRL1435) and Panc-1 pancreatic epithelioid carcinoma
(ATCC: CRL1496), human pancreatic ductal epithelial cells,
primary prostate epithelial cells (Lonza: CC-255), and human
renal proximal tubule epithelial cells (Lonza: CC-2553)
Cellular uptake and localization
Non-confocal microscopy was performed on a Zeiss Axio
Imager widefield fluorescence microscope with 63 · oil im-
mersion objectives. Cells were seeded and grown on cover
slips in multiwell plates for 24 hours before staining.
Aptamer staining. Depending on the assay, aptamers
with Alexa 488 or Cy5 conjugated to the 5¢ end were ordered
from IDT. Fluorescently labeled aptamer was added directly
to cell growth media at a concentration of 400nM and incu-
bated at 37C and 5% CO
2
for 1 hour. Cells were washed 3 in
Dulbecco’s phosphate-buffered saline (DPBS), then fixed in
4% paraformaldehyde and washed again 3 · in DPBS.
Antibody staining. Cells were incubated at 37C for 1 hour
with rabbit anti-nucleolin immunoglobulin G (IgG) antibody
(Abcam) at a concentration of (1mg/mL). Cells were then
washed 3 · in DPBS, then incubated at 37C for 1 hour with a
Cy5 conjugated, goat anti-rabbit IgG antibody (GE Healthcare
Lifesciences: PA45011) at a dilution of (1:1000). Cells were
washed 3 · in DPBS.
For all experiments, cells were then counterstained with
4¢,6-diamidino-2-phenylindole (DAPI) (Invtirogen: D3571)
and mounted to slides with fluoromount-G (Southern Bio-
tech: 0100-01).
Flow cytometry. Cells were incubated in a 12-well plate
with AS1411 (AF488) or control aptamer (AF488) at 100 nM
for 3 hours (37C, 5% CO
2
) then treated with DNase for 10
minutes to degrade any noninternalized aptamer. Cells were
washed with PBS and trypsinized with 0.05% Trypsin for
188 KOTULA ET AL.
Page 2
fluorescence-activated cell sorting (FACs) analysis (Becton
Dickinson FACSCalibur flow cytometer).
Internalization assays
HeLa cells in a 24-well plate were incubated with the fol-
lowing drugs: chlorpromazine (7.5 mg/mL, 2 hours at 37C),
amiloride (1 mM, 2 hours at 37C), and genistein (150 mM, 2
hours at 37C) then washed with Dulbecco’s modified Eagle
medium/10% fetal bovine serum (FBS) media. HeLa cells
were incubated with 400 nM AS1411 aptamer (AF488) or
400 nM control aptamers (AF488) for 3 hours. HeLa cells
were incubated with Alexa 488-transferrin for 30 minutes
(10 mg/mL at 37C). Cells were washed with PBS/4% FBS
and trypsinized with 0.05% Trypsin for FACs analysis (Becton
Dickinson FACSCalibur flow cytometer).
RNAi assays against nucleolin
Cells were plated to 50% confluence 24hours before treat-
ment with siRNA. The cells were transfected with 50mM
siRNA against nucleolin and incubated for 48hours (37C and
5% CO
2
) then collected by trypsinization or prepared for cell
staining according to the method described above. Trypsi-
nized cells were then separated into fractions using a sub-
cellular protein fractionation kit (Thermo Scientific: 78840).
Fractions were then run on 4%–20% polyacrylamide Ready
Gel (BioRad: 161-1237) and transferred to a polyvinylidene
difluoride membrane. The membrane was probed with rabbit
anti-nucleolin IgG antibody (Abcam) 1:1000 then probed with
a Cy5 conjugated, goat anti-rabbit antibody 1:1000 (GE
Healthcare Lifesciences: PA45011) secondary antibody. The
blot was then analyzed on a Typhoon 9410 variable mode
imager (GE Healthcare Lifesciences) and quantified.
Oligonucleotide treatment and luciferase assay
Varying amounts of the Cy5-aptamer-luciferase SSO and
free Cy5-luciferase SSO were added to the OPTI-MEM media
to give increasing total substrate concentrations. Luciferase
induction was determined in the human prostate cancer
(PC3)/Luc705 cells over a 24-hour treatment followed by a 2-
day culture. The luciferase activity was determined using a
Luciferase Assay Kit (Promega). Luciferase assay was per-
formed on a FLUOstar Omega microplate reader (BMG Lab-
tech). Protein content was determined by Bradford protein
assay (Pierce) with bovine serum albumin as a standard.
Background luciferase expression was determined by mea-
suring luciferase activity in the cells without the oligonucle-
otide treatment, and these values were then subtracted from
the results in the treated cells to obtain response values and
the final dynamic data. Calculation of the percentage of
transcripts switched was performed as previously described
(Kang et al., 1998).
Confocal fluorescence microscopy
Intracellular distribution of the oligonucleotide in living
cells was examined using a Zeiss 510 Meta Inverted Laser
Scanning Confocal Microscope with 63 · oil immersion
objectives. PC3/Luc705 cells were plated in 35-mm glass-
bottom microwell dishes (MatTek). After transfection of
dynamin DN plasmid, intracellular uptake of the oligonu-
cleotide or of Alexa-594-transferrin (Molecular Probes) as a
marker for clathrin-coated vesicles was visualized by con-
focal microscopy.
Data analysis
Data are expressed as mean standard deviation from 3
measurements unless otherwise noted. Statistical significance
was evaluated using t-test. The data were analyzed with
GraphPad Prism 5 (GraphPad Software, Inc.).
Results
Differential cellular localization of nucleolin
and epithelial growth factor receptor aptamers
We and others have reported the evaluation of aptamer–
oligonucleotide chimeras. These chimeras have been shown
to internalize through a receptor-mediated endocytosis
mechanism that leads to endosomal and cytoplasmic lo-
calization of the chimeras (McNamara et al., 2006; Dassie
et al., 2009; Li et al., 2010). To determine if the nucleolin
aptamer localized to a different compartment within treated
cells than previously identified aptamers, we performed
internalization studies using fluorescently labeled aptamers
and fluorescent microscopy. Pancreatic cancer cells, Panc-1,
were simultaneously treated with the nucleolin aptamer
AS1411 and an aptamer that binds epithelial growth factor
receptor (EGFR) (Li et al., 2011). The nucleolin aptamer was
conjugated to the red fluorescent dye Cy5 and the EGFR
aptamer was conjugated to the green fluorescent dye Alexa-
488. As shown in Fig. 1A, the EGFR aptamer localized to
the cytoplasm and did not enter the nuclei of the Panc-1
cells. By contrast, the nucleolin aptamer localized primarily
to the nuclei and nucleoli of the Panc-1 cells with a lower
percentage localizing to the cytoplasm (Fig. 1B). When we
overlaid the images of the two aptamers, the differences in
their localization became even more apparent, especially
when the DAPI-stained nuclei were highlighted (Fig. 1C,
D). Thus a significant fraction of the nucleolin aptamer lo-
calizes to the nuclei of Panc-1 cells and as such shows a
distinct subcellular localization compared to other aptamers
such as the EGFR aptamer, which predominately localize to
the endosomal and cytoplasmic compartments.
Selectivity of the nucleolin aptamer
To confirm that the internalization and nuclear localization
of the nucleolin aptamer in Panc-1 cells is dependent upon
nucleolin, we performed siRNA knockdown studies. Panc-1
cells were treated with siRNA against nucleolin mRNA then
analyzed for nucleolin aptamer internalization and localiza-
tion. As shown in Supplementary Fig. S1A, the nucleolin
aptamer internalizes and localizes to the nuclei of Panc-1 cells
treated with a control siRNA (Supplementary Data are
available online at www.liebertpub.com/nat). However,
siRNA-mediated knockdown of nucleolin expression greatly
reduced such internalization and localization (Supplementary
Fig. S1B). To confirm that cell surface expression of nucleolin
was knocked down in the Panc-1 cells treated with the siRNA
against nucleolin, we stained the treated cells with an anti-
nucleolin antibody (Supplementary Fig. 1C, D). These studies
confirmed the effectiveness of the siRNA for knocking down
cell surface expression of nucleolin and demonstrated that
APTAMER–SSO CHIMERAS 189
Page 3
nucleolin is required for the internalization and nuclear lo-
calization of the aptamer in Panc-1 cells.
Next we investigated nucleolin aptamer uptake in a variety
of cancer cell types and corresponding noncancerous cell
types. Using Western blot analysis, we observed that a much
higher level of nucleolin is expressed on the surface of cancer
cells compared with their corresponding noncancerous cell
types (Supplementary Fig. S2A). Cells were then analyzed to
determine whether the difference in surface nucleolin ex-
pression would lead to differences in nucleolin aptamer
binding and uptake using flow cytometry and fluorescent
microscopy. As shown in Supplementary Fig. 2, the nucleolin
aptamer bound and internalized into various cancer cell lines
(Supplementary Fig. 2B–D and unpublished results), and not
the corresponding noncancerous cell types (Supplementary
Fig. 2E, and unpublished results). A labeled control aptamer
did not bind or internalize into any of the cell types, demon-
strating the specificity of the aptamer.
Mechanism of internalization
The observation that the nucleolin aptamer localized to the
nucleus and the EGFR aptamer to the cytoplasm suggested
that the nucleolin aptamer was internalizing through a dis-
tinct mechanism compared with other aptamers tested to
date. However, cell surface nucleolin has not been well
characterized, and its mechanism of internalization remains
largely unknown, though recent publications suggest that
FIG. 1. The nucleolin and epithelial
growth factor receptor (EGFR) apta-
mers show differential cellular locali-
zation. Panc-1 cells were grown to
near confluence on coverslips and
then incubated with Cy5-AS1411 and
Alexa488-EGFR aptamers at a concen-
tration of 100 nM each for 1hour. Cells
were then fixed, stained with DAPI,
and analyzed by fluorescent micros-
copy. (A) The Alexa488-EGFR apta-
mer. (B) The Cy5-AS1411 aptamer. (C)
An overlay image of the 2 aptamers.
(D) An overlay image of the 2 apta-
mers with nuclei stained with DAPI.
FIG. 2. The nucleolin aptamer internalizes through a dynamin-independent mechanism. (A) PC-3/Luc 705 cells were
grown to near confluence and then transfected with a dynamin-DN/GFP encoding plasmid. Alexa-594 labeled aptamer was
added to cells, and intracellular uptake of the nucleolin aptamer or of Alexa-594-labeled transferrin was analyzed and
quantified. PC-3/Luc 705 cells that did not contain the dynamin-DN/GFP plasmid were used as the control for the con-
tribution of dynamin. (B) A representative confocal microscopy image of the data from panel A: from the left, the first panel
shows the cells transfected with the dynamin-DN/GFP plasmid in green, the second panel shows the location of either
transferrin (top) or aptamer (bottom), and the third panel is a merged overlay of the first 2. White arrows indicate GFP/
dynamin-DN positive cells, and blue arrows indicate GFP/dynamin-DN negative cells. GFP, green fluorescent protein.
190 KOTULA ET AL.
Page 4
nucleolin may associate with a myosin motor that traffics
along actin filaments (Huang et al., 2006). To begin to deter-
mine the mechanism of the nucleolin aptamer’s internaliza-
tion, we initially evaluated whether the aptamer
internalization was dependent upon dynamin using a domi-
nant negative mutant version of the protein. Dynamins are a
class of motor proteins responsible for the scission of newly
formed vesicles, playing a large role in endocytosis (Vallee
et al., 1993); therefore, in cells lacking dynamin, receptor-
mediated endocytosis was inhibited. As shown in Fig. 2, the
nucleolin aptamer internalized into PC3 cells expressing a
dominant negative mutant version of dynamin (dynamin-
DN) as well as it did into wild-type PC3 cells (Fig. 2A). By
contrast, transferrin, a cell surface receptor that internalizes
through endocytosis, was greatly inhibited in the dynamin-
DN expressing cells compared with cells not expressing dy-
namin-DN (Fig. 2A). Cells from these internalization studies
were further examined through fluorescent microscopy. PC3
cells expressing the dominant negative dynamin, labeled with
green fluorescent protein (GFP), were treated with a Cy5
conjugated nucleolin aptamer. As shown in Fig. 2B (bottom),
the aptamer internalized into the cytoplasm and nucleus
of the dynamin-DN cells, indicating that the aptamer inter-
nalized through a dynamin-independent mechanism. In
dynamin-DN/GFP expressing cells, internalization of Alexa-
594-transferrin was assessed. Transferrin was not able to in-
ternalize into the dynamin-DN expressing cells and was seen
associated with only the outer membrane of the dynamin-DN
cells (Fig.2B, top, white arrows). However, transferrin was
able to internalize into cells lacking the dominant negative
mutant protein as noted by the blue arrows (Fig. 2B, top).
Thus the nucleolin aptamer enters PC-3 cells through a
dynamin-independent mechanism.
To further evaluate the mechanism of nucleolin aptamer
internalization, we employed a panel of internalization in-
hibitors and HeLa cells. As shown in Fig. 3A, the nucleolin
aptamer rapidly internalizes and localizes to the nuclei of
HeLa cells. Next we tested 3 uptake inhibitors to determine if
they could inhibit aptamer uptake in HeLa cells. Amiloride
(AML) lowers submembranous pH, which reduces actin re-
modeling at the cell membrane (Mercer and Helenius, 2009;
Mercer et al., 2010). AML has traditionally been used as an
inhibitor of macropinocytosis but has been shown to block
some clathrin-mediated endocytosis and internalization
through lipid rafts (Ivanov et al., 2004; Wadia et al., 2004;
Mercer and Helenius, 2009; Koivusalo et al., 2010; Mercer
et al., 2010) (Fig. 3B). Chlorpromazine (CPZ) prevents the
recycling of clathrin, which inhibits clathrin-mediated endo-
cytosis, a form of receptor-mediated endocytosis in which
small molecules aggregate around an invagination and close a
vesicle into the cell (Sieczkarski and Whittaker, 2002) (Fig. 3B).
Genistein (GEN) inhibited caveolar endocytosis, which is a
form of clathrin-independent endocytosis caused by invagi-
nation of lipid rafts (Parton et al., 1994; Sieczkarski and
Whittaker, 2002) (Fig. 3B). The uptake of the nucleolin apta-
mer was moderate but significantly inhibited by both CPZ
and AML, but neither totally prevented aptamer internaliza-
tion (Fig. 3C). GEN had no effect on either transferrin or ap-
tamer uptake, which indicated that neither caveolar
endocytosis nor lipid-raft-mediated endocytosis were the
mechanisms of internalization (Fig. 3C). Transferrin, a well-
characterized cell surface receptor, served as a positive control
throughout these uptake studies, and cells treated with di-
methyl sulfoxide (DMSO) served as negative control because
all uptake inhibitors were dissolved in DMSO. As expected,
transferrin was inhibited by CPZ, but it was also inhibited
somewhat by AML, which may have been caused by the
toxicity of AML or its effects on the clathrin-mediated endo-
cytosis pathway (Fig. 3C). The mechanism of nucleolin apta-
mer internalization and nuclear localization cannot be
explained by the standard model of receptor-mediated en-
docytosis or macropinocytosis alone and requires further in-
vestigation. However, we observed that the aptamer did not
internalize through receptor-mediated endocytosis, which is
the accepted mechanism of uptake for other aptamers (eg, the
PSMA and EGFR aptamers). These data demonstrate that the
nucleolin aptamer internalizes through a nonstandard
mechanism, which allows for nuclear localization and the
apparent ability to escape the endosomal compartment.
Efficacy of nucleolin aptamer–SSO Chimeras
Because the nucleolin aptamer selectively localizes to the
nuclei of cancer cells and efficiently internalizes into PC3 cells,
we investigated whether the nucleolin aptamer could be uti-
lized to deliver SSOs to the nucleus of PC3 cells containing a
splice-switching luciferase report construct (PC3/Luc 705
cells). We examined whether an aptamer–SSO chimera could
deliver the SSO to the nucleus and increase the efficacy of SSO
activity. In our proof-of-principle experiments we employed
PC3/Luc 705 cells, a prostate cancer cell type containing a
luciferase reporter construct with a premature stop codon,
which prevents full-length luciferase from being translated.
When treated by an SSO, the splicing of the pre-mRNA de-
rived from the luciferase gene is altered to exclude the stop
codon, allowing the repaired luciferase mRNA to be trans-
lated and luciferase to be produced (Ming et al., 2010). PC3/
Luc 705 cells were incubated with various oligonucleotides
without transfection agent to determine if the aptamer–
luciferase SSO chimera could alter splicing and enhance lu-
ciferase production. As shown in Fig. 4A, the aptamer–SSO
chimera significantly increased luciferase production com-
pared with untreated cells, cells treated with a control SSO, a
mutant aptamer–SSO chimera, and the SSO alone. To assess
the effect of the oligonucleotide treatments on pre-mRNA
splicing, we examined the ratio of mutant versus repaired
RNA produced. Total RNA was isolated from treated cells and
quantitative competitive reverse transcription-polymerase
chain reaction (qcRT-PCR) was performed with primers to
differentiate between the 2 versions of the luciferase mRNA
(Kang et al., 1998). The products of the qcRT-PCR were
separated on a gel and quantified. As shown in Fig. 4B, the
aptamer–luciferase SSO chimera increased the percentage of
repaired mRNA by 13% over the baseline 10% found in
untreated cells and cells treated with a mutant aptamer–SSO.
Moreover, even though the nucleolin aptamer–SSO chimera is
much longer than the luciferase SSO alone (50 nt vs. 20 nt), the
chimera was still more efficient than the SSO alone (Fig. 4B).
These results demonstrated that the aptamer–SSOs can alter
pre-mRNA splicing in PC-3 prostate cancer cells.
To further examine the efficiency of the aptamer-luciferase
SSO chimera compared to the SSO alone, we treated PC3/Luc
705 cells with various concentrations of either the aptamer–
SSO chimera or the SSO alone. At a concentration of 100 nM,
APTAMER–SSO CHIMERAS 191
Page 5
the amount of luciferase correction generated by the SSO
alone began to plateau and produce a maximal amount of
protein. This amount of luciferase was produced in cells
treated with *20 nM of the aptamer–luciferase SSO chimera
and higher levels of aptamer–SSO produced higher levels of
luciferase activity than achieved by the SSO alone (Fig. 5).
Thus the aptamer–SSO is approximately 5-fold more potent
than the SSO alone.
Discussion
Our results demonstrate that the nucleolin aptamer can be
utilized to deliver oligonucleotides to the nucleus of cancer-
ous cells and alter nuclear events such as pre-mRNA splicing.
The nucleolin aptamer bound to cell-membrane-associated
nucleolin and internalized through a novel mechanism that
directs the aptamer chimera to the nucleus. Internalization of
the nucleolin aptamer is dynamin independent, while results
using other internalization inhibitors suggest that more than
one internalization pathway may be involved in nucleolin
aptamer uptake. Even though the trafficking mechanism has
not been totally elucidated, our results demonstrate that nu-
cleolin is important for the uptake and transport of nucleolin
aptamer chimeras to the nucleus and that such aptamer chi-
meras are not trapped in the endosomal compartment. The
ability to avoid or escape the endosomal pathway may make
the nucleolin aptamer particularly useful for the delivery of
other cargoes to cells.
Aptamer chimeras containing the nucleolin aptamer and a
splice-switching oligonucleotide localize to the nucleus and
enhance splice-switching activity. Compared to mRNA
knockdown approaches, such as siRNA, one major advantage
FIG. 3. Evaluating aptamer internali-
zation with uptake inhibitors. (A) HeLa
cells were grown to *60% confluence on
coverslips and then incubated wit h
Alexa488-nucleolin aptamer or Alexa488-
control aptamer at a concentration of
100nM for 1hour. Cells were then fixed,
stained with DAPI, and analyzed by
fluorescent microscopy. (B) The clathrin-
mediated pathway was inhibited by
chlorpromazine (CPZ). The caveloar-
mediated and lipid raft-mediated path-
ways are inhibited by genistein (GEN).
The macropinocytosis pathway is in-
hibited by amiloride (AML). To some
extent, AML also inhibits other pathways
that require actin synthesis at the cell
membrane. The dynamin-DN mutant
protein prevents dynamin dependent
pathways. (Adapted from Mercer, J. and
Helenius, 2009.) (C) HeLa cells were
grown to near confluence then incubated
with AML (1 mM, 2 hours at 37C),
CPZ(7.5 mg/mL, 2 hours at 37C), or
GEN(150 mM, 2 hours at 37C), then wa-
shed. The 3 inhibitors were solubilized in
dimethyl sulfoxide (DMSO); therefore,
the untrea ted-control group was treated
with an equal amount of DMSO. Cells
were incubated with Alexa488-nucleolin
aptamer or Alexa488-control aptamer for
3 hours at a concentration of 400 nM. The
cells were treated with DNase to degrade
any aptamer on the cell surface that had
not been endocytosed then washed,
evaluated by flow cytometry, and quan-
tified (statistical analyses were per-
formed against the nucleolin aptamer
treated DMSO control ***P = 0 .0051,
**P = 0.0451, *P = 0.1353). Uptake of
Alexa-488-transferrin was evaluated as
well.
192 KOTULA ET AL.
Page 6
of SSO-based therapies is that only a small percentage of pre-
mRNA has to be repaired to generate a phenotypic effect. We
observed that the nucleolin aptamer–luciferase SSO increased
proper splicing of luciferase by 13% (Fig. 4), a level of repair
that would be expected to result in correction of the pheno-
types associated with many genetic mutations. For example,
encouraging studies from the Kole lab indicate that only a
small percentage of Bcl-xL needed to be ‘switched’ to Bcl-xS
by SSOs in order to induce apoptosis (Zhang et al., 2007;
Bauman et al., 2010; Bauman and Kole, 2011). However, no
effective method for selective delivery of proapoptotic SSOs to
cancer cells has been described. Our lab and others have
shown that aptamer chimeras possess the properties neces-
sary for in vivo targeting of oligonucleotides (McNamara
et al., 2006; Dassie et al., 2009) and the work described herein
demonstrates for the first time that an aptamer can selectively
deliver a cargo to the nucleus. Thus we believe that by ap-
pending therapeutic SSOs to the nucleolin aptamer such as the
one described for Bcl-xL (42, 44), such aptamer–SSO chimeras
may be particularly useful at delivering SSOs to the nuclei of
cancerous cells and selectively inducing apoptosis. Within the
nucleus, the aptamer chimera appears to further concentrate
in the nucleolus, which is likely because nucleolin is more
concentrated in the heterochromatin-rich nucleolus. Never-
theless, the splice-switching oligonucleotide is still free to in-
teract with nuclear pre-mRNA and alter impact splicing.
However, such aptamer chimeras may be particularly well
suited for targeting nucleolar events such as sequestering
genes into heterochromatin or ribosome biogenesis. In addi-
tion, it may be possible to further optimize the potency of
aptamer–SSO chimeras for modulating pre-mRNA splicing
by engineering chimeras that release their SSO once they
reach the nucleus. Moreover, other types of oligonucleotide-
based therapies such as aptamers against intracellular or nu-
clear targets and other antisense agents such as LNAs can
likely be delivered to the nuclei of cancer cells with the nu-
cleolin aptamer.
FIG. 4. Aptamer–splice-switching oligonucleotide (SSO)
chimeras alter pre-RNA splicing and induce luciferase pro-
duction. PC-3/Luc 705 cells were grown to *60% confluence
then incubated for 48 hours with the various oligonucleo-
tides indicated. (A) RNA was isolated from cells and qcRT-
PCR was performed to examine the ratio of unswitched
mutant (longer product) to switched or repaired RNA
(shorter product) present. The numbers indicate the percent
of mRNA repaired by each treatment. Untreated cells show a
background level of repaired luciferase mRNA of 10%. (B)
Cells were incubated with the various oligonucleotides
(100 nM) indicated without transfection reagents. A micro-
plate reader analyzed cell lysates for light emission, and total
protein was determined by Bradford assay. Data was nor-
malized to the untreated cell samples. P-values are shown
between the various treatment groups. qcRT-PCR, quanti-
tative competitive reverse transcription-polymerase chain
reaction.
FIG. 5. Dose response comparing the effects of nucleolin
aptamer–SSO chimera and the SSO alone. PC-3/Luc 705 cells
were grown to *60% confluence then incubated for 48 hours
with various concentrations of the nucleolin aptamer–lucif-
erase SSO chimera or the luciferase SSO alone. A microplate
reader analyzed cell lysates for light emission, and total
protein was determined by Bradford assay.
APTAMER–SSO CHIMERAS 193
Page 7
The use of aptamers as a delivery agent is still a relatively
new field. However, several aptamer chimeras have now
shown promise to selectively deliver therapeutics to targeted
cancer cells (McNamara et al., 2006; Dassie et al., 2009; Zhou
and Rossi, 2010). In principle, this approach can reduce the
adverse effects associated with therapies and potentially re-
duce the cost of the therapeutic approach. Our results dem-
onstrate that aptamer chimeras can enter through a
mechanism that avoids or escapes the endosomal compart-
ment and localizes to the nucleus, and the nucleolus, which
opens new opportunities for delivery of therapeutic agents
that target nuclear events. We believe that the results of our
study have laid the foundation for future work that will
demonstrate the therapeutic value of aptamer chimeras and
nuclear delivery.
Acknowledgments
This research was supported in part by an NIH T32 Post-
doctoral Fellowship (EDP) and an NIH Grant R01CA129190
(BAS).
Author Disclosure Statement
No competing financial interests exist.
References
ALAM, M., MING, X., DIXIT, V., FISHER, M., CHEN, X., and
JULIANO, R. (2010). The biological effect of an antisense oli-
gonucleotide depends on its route of endocytosis and traf-
ficking. Oligonucleotides 20, 103–109.
BATES, P., CHOI, E., and NAYAK, L. (2009a). G-rich oligonu-
cleotides for cancer treatment. Methods Mol. Biol. 542,
379–392.
BATES, P.J., LABER, D.A., MILLER, D.M., THOMAS, S.D., and
TRENT, J.O. (2009b). Discovery and development of the G-
rich oligonucleotide AS1411 as a novel treatment for cancer.
Exp. Mol. Pathol. 86, 151–164.
BAUMAN, J., JEARAWIRIYAPAISARN, N., and KOLE, R.
(2009). Therapeutic potential of splice-switching oligonucleo-
tides. Oligonucleotides 19, 1–13.
BAUMAN, J.A., and KOLE, R. (2011). Modulation of RNA
splicing as a potential treatment for cancer. Bioeng. Bugs 2,
125–128.
BAUMAN, J.A., LI, S.D., YANG, A., HUANG, L., and KOLE, R.
(2010). Anti-tumor activity of splice-switching oligonucleo-
tides. Nucleic Acids Res. 38, 8348–8356.
CHU, T., MARKS, J.R., LAVERY, L., FAULKNER, S., ROSEN-
BLUM, M., ELLINGTON, A., and LEVY, M. (2006a). Apta-
mer:toxin conjugates that specifically target prostate tumor
cells. Cancer Res. 66, 5989–5992.
CHU, T., TWU, K., ELLINGTON, A., and LEVY M. (2006b).
Aptamer mediated siRNA delivery. Nucleic Acids Res. 34,
e73.
DASSIE, J., LIU, X., THOMAS, G., WHITAKER, R., THIEL, K.,
STOCKDALE, K., MEYERHOLZ, D., MCCAFFREY, A.,
MCNAMARA, J.N., and GIANGRANDE, P. (2009). Systemic
administration of optimized aptamer-siRNA chimeras pro-
motes regression of PSMA-expressing tumors. Nat. Bio-
technol. 27, 839–849.
DOLLINS, C., NAIR, S., BOCZKOWSKI, D., LEE, J., LAYZER, J.,
GILBOA, E., and SULLENGER B. (2008a). Assembling OX40
aptamers on a molecular scaffold to create a receptor-activat-
ing aptamer. Chem. Biol. 15, 675–682.
DOLLINS, C., NAIR, S., SULLENGER, B. (2008b). Aptamers in
immunotherapy. Hum. Gene Ther. 19, 443–450.
FAROKHZAD, O.C., CHENG, J., TEPLY, B.A., SHERIFI, I., JON,
S., KANTOFF, P.W., RICHIE, J.P., and LANGER, R. (2006).
Targeted nanoparticle-aptamer bioconjugates for cancer che-
motherapy in vivo. Proc. Natl. Acad. Sci. U. S. A. 103, 6315–
6320.
GINISTY, H., AMALRIC, F., and BOUVET, P. (1998). Nucleolin
functions in the first step of ribosomal RNA processing. EMBO
J 17, 1476–1486.
GINISTY, H., SICARD, H., ROGER, B., and BOUVET, P. (1999).
Structure and functions of nucleolin. J. Cell Sci. 112(6), 761–772.
GIRVAN, A., TENG, Y., CASSON, L., THOMAS, S., JU
¨
LIGER,
S., BALL, M., KLEIN, J., PIERCE, W.J., BARVE, S., and BATES,
P. (2006). AGRO100 inhibits activation of nuclear factor-
kappaB (NF-kappaB) by forming a complex with NF-kappaB
essential modulator (NEMO) and nucleolin. Mol. Cancer Ther.
5, 1790–1799.
HOVANESSIAN, A.G., SOUNDARAMOURTY, C., EL
KHOURY, D., NONDIER, I., SVAB, J., and KRUST, B. (2010).
Surface expressed nucleolin is constantly induced in tumor
cells to mediate calcium-dependent ligand internalization.
PLoS One 5, e15787.
HUANG, Y., SHI, H., ZHOU, H., SONG, X., YUAN, S., and
LUO, Y. (2006). The angiogenic function of nucleolin is me-
diated by vascular endothelial growth factor and nonmuscle
myosin. Blood 107, 3564–3571.
IRESON, C., and KELLAND, L. (2006). Discovery and develop-
ment of anticancer aptamers. Mol. Cancer Ther. 5, 2957–2962.
IVANOV, A.I., NUSRAT, A., and PARKOS, C.A. (2004). En-
docytosis of epithelial apical junctional proteins by a clathrin-
mediated pathway into a unique storage compartment. Mol.
Biol. Cell 15, 176–188.
KANG, S.H., CHO, M.J., and KOLE, R. (1998). Up-regulation of
luciferase gene expression with antisense oligonucleotides:
implications and applications in functional assay develop-
ment. Biochemistry 37, 6235–6239.
KIM, E., JUNG, Y., CHOI, H., YANG, J., SUH, J.S., HUH, Y.M.,
KIM, K., and HAAM, S. (2010). Prostate cancer cell death
produced by the co-delivery of Bcl-xL shRNA and doxorubi-
cin using an aptamer-conjugated polyplex. Biomaterials 31,
4592-9.
KOIVUSALO, M., WELCH, C., HAYASHI, H., SCOTT, C.C.,
KIM, M., ALEXANDER, T., TOURET, N., HAHN, K.M., and
GRINSTEIN, S. (2010). Amiloride inhibits macropinocytosis
by lowering submembranous pH and preventing Rac1 and
Cdc42 signaling. J. Cell Biol. 188, 547–563.
KOLE, R., VACEK, M., and WILLIAMS, T. (2004a). Modification
of alternative splicing by antisense therapeutics. Oligonu-
cleotides 14, 65-74.
KOLE, R., WILLIAMS, T., and COHEN, L. (2004b). RNA mod-
ulation, repair and remodeling by splice switching oligonu-
cleotides. Acta Biochim. Pol. 51, 373–378.
LI, N., LARSON, T., NGUYEN, H., SOKOLOV, K., and EL-
LINGTON, A. (2010). Directed evolution of gold nano-
particle delivery to cells. Chem. Commun. (Camb.) 46,
392–394.
LI, N., NGUYEN, H.H., BYROM, M., and ELLINGTON, A.D.
(2011). Inhibition of cell proliferation by an anti-EGFR apta-
mer. PLoS One 6, e20299.
LUNDIN, P., JOHANSSON, H., GUTERSTAM, P., HOLM, T.,
HANSEN, M., LANGEL, U., and EL ANDALOUSSI, S. (2008).
Distinct uptake routes of cell-penetrating peptide conjugates.
Bioconjug. Chem. 19, 2535–2542.
194 KOTULA ET AL.
Page 8
MCNAMARA, J.N., ANDRECHEK, E., WANG, Y., VILES, K.,
REMPEL, R., GILBOA, E., SULLENGER, B., and GIAN-
GRANDE, P. (2006). Cell type-specific delivery of siRNAs
with aptamer-siRNA chimeras. Nat Biotechnol 24, 1005–1015.
MERCER, J., and HELENIUS, A. (2009). Virus entry by macro-
pinocytosis. Nat. Cell Biol. 11, 510–520.
MERCER, J., SCHELHAAS, M., and HELENIUS, A. (2010).
Virus entry by endocytosis. Annu. Rev. Biochem. 79, 803–833.
MIN, K., JO, H., SONG, K., CHO, M., CHUN, Y.S., JON, S., KIM,
W.J., and BAN, C. (2011). Dual-aptamer-based delivery vehi-
cle of doxorubicin to both PSMA ( + ) and PSMA (-) prostate
cancers. Biomaterials 32, 2124–2132.
MING, X., ALAM, M., FISHER, M., YAN, Y., CHEN, X., and
JULIANO, R. (2010). Intracellular delivery of an antisense ol-
igonucleotide via endocytosis of a G protein-coupled receptor.
Nucleic Acids Res. 38, 6567–6576.
PARTON, R.G., JOGGERST, B., and SIMONS, K. (1994). Regu-
lated internalization of caveolae. J. Cell Biol. 127, 1199–1215.
POLLICE, A., ZIBELLA, M., BILAUD, T., LAROCHE, T., PU-
LITZER, J., and GILSON, E. (2000). In vitro binding of nu-
cleolin to double-stranded telomeric DNA. Biochem. Biophys.
Res. Commun. 268, 909–915.
REYES-REYES, E.M., TENG, Y., and BATES, P.J. (2010). A new
paradigm for aptamer therapeutic AS1411 action: uptake by
macropinocytosis and its stimulation by a nucleolin-depen-
dent mechanism. Cancer Res. 70, 8617–8629.
SIECZKARSKI, S.B., and WHITTAKER, G.R. (2002). Influenza
virus can enter and infect cells in the absence of clathrin-
mediated endocytosis. J. Virol. 76, 10455–10464.
SOUNDARARAJAN, S., CHEN, W., SPICER, E., COURTENAY-
LUCK, N., and FERNANDES, D. (2008). The nucleolin tar-
geting aptamer AS1411 destabilizes Bcl-2 messenger RNA in
human breast cancer cells. Cancer Res. 68, 2358–2365.
TENG, Y., GIRVAN, A., CASSON, L., PIERCE, W.J., QIAN, M.,
THOMAS, S., and BATES, P. (2007). AS1411 alters the locali-
zation of a complex containing protein arginine methyl-
transferase 5 and nucleolin. Cancer Res. 67, 10491–10500.
TIEMANN, K., and ROSSI, J. (2009). RNAi-based therapeutics-
current status, challenges and prospects. EMBO Mol. Med. 1,
142–151.
VALLEE, R.B., HERSKOVITS, J.S., AGHAJANIAN, J.G., BUR-
GESS, C.C., and SHPETNER, H.S. (1993). Dynamin, a GTPase
involved in the initial stages of endocytosis. Ciba Found.
Symp. 176, 185–193; discussion 193–197.
WADIA, J.S., STAN, R.V., and DOWDY, S.F. (2004). Transdu-
cible TAT-HA fusogenic peptide enhances escape of TAT-fu-
sion proteins after lipid raft macropinocytosis. Nat. Med. 10,
310–315.
WAN, J., SAZANI, P., and KOLE, R. (2009). Modification of
HER2 pre-mRNA alternative splicing and its effects on breast
cancer cells. Int. J. Cancer 124, 772–777.
WU, X., DING, B., GAO, J., WANG, H., FAN, W., WANG, X.,
ZHANG, W., YE, L., ZHANG, M., DING, X. et al. (2011).
Second-generation aptamer-conjugated PSMA-targeted deliv-
ery system for prostate cancer therapy. Int. J. Nanomedicine 6,
1747–1756.
WULLNER, U., NEEF, I., ELLER, A., KLEINES, M., TUR, M.K.,
and BARTH, S. (2008). Cell-specific induction of apoptosis by
rationally designed bivalent aptamer-siRNA transcripts si-
lencing eukaryotic elongation factor 2. Curr. Cancer Drug
Targets 8, 554–565.
ZHANG, N., PEAIRS, J.J., YANG, P., TYRRELL, J., ROBERTS, J.,
KOLE, R., and JAFFE, G.J. (2007). The importance of Bcl-xL in
the survival of human RPE cells. Invest. Ophthalmol. Vis. Sci.
48, 3846–3853.
ZHOU, J., and ROSSI, J. (2010). Aptamer-targeted cell-specific
RNA interference. Silence 1,
4.
Address correspondence to:
Dr. Bruce A. Sullenger
Department of Surgery
Duke University Medical Center
Box 103035
Durham, NC 27710
E-mail: bruce.sullenger@duke.edu
Received for publication March 9, 2012; accepted after
revision May 7, 2012.
APTAMER–SSO CHIMERAS 195
Page 9
    • "MUC1 is a targeting ligand and is internalized into target cells by receptor-mediated endocytosis (RME) [34]. AS1411 aptamer is internalized into target cells using a nonstandard mechanism, leading to its accumulation in the nucleus [27]. So, the combination of these two mechanisms is assumed as the internalization mechanism for Apts-Dendrimer-Epi complex. "
    [Show abstract] [Hide abstract] ABSTRACT: Clinical use of epirubicin (Epi) in the treatment of cancer has been limited, due to its cardiotoxicity. Targeted delivery of chemotherapeutic agents could increase their efficacy and reduce their off-target effects. High drug loading and excellent stability of DNA dendrimers make these DNA nanostructures unique candidates for biological applications. In this study a modified and promoted dendrimer using three kinds of aptamers (MUC1, AS1411 and ATP aptamers) was designed for targeted delivery of Epi and its efficacy was evaluated in target cells including MCF-7 cells (breast cancer cell) and C26 cells (murine colon carcinoma cell). Aptamers (Apts)-Dendrimer-Epi complex formation was analyzed by fluorometric analysis and gel retardation assay. Release profiles of Epi from the designed complex were assessed at pHs 5.4 and 7.4. For MTT assay (cytotoxic study) MCF-7 and C26 cells (target cells) and CHO cells (Chinese hamster ovary cell, nontarget) were treated with Epi, Apts-Dendrimer-Epi complex and Apts-Dendrimer conjugate. Internalization was evaluated using flow cytometry analysis. Finally, the developed complex was used for inhibition of tumor growth in vivo. 25 μM Epi was efficiently intercalated to 1 μM dendrimer. Epi was released from the Apts-Dendrimer-Epi complex in a pH-sensitive manner (more release at pH 5.5). The results of flow cytometry analysis indicated that the designed complex was efficiently internalized into target cells, but not into control cells. The internalization data were confirmed by the results of MTT assay. Apts-Dendrimer-Epi complex had less cytotoxicity in CHO cells compared to Epi alone. The complex had more cytotoxicity in C26 and MCF-7 cells compared to Epi alone. Moreover, the Apts-Dendrimer-Epi complex could efficiently prohibit tumor growth in vivo. In conclusion, the designed targeted drug delivery system inherited characteristics of pH-dependent drug release, high drug loading and tumor targeting in vitro and in vivo.
    No preview · Article · Mar 2016 · European Journal of Pharmaceutics and Biopharmaceutics
    • "Nucleolin is a nuclear protein which could be overexpressed on plasma membrane of certain cancer cells such as lung and pancreatic cancers [23] [24] [25]. So, after the internalization of PA-Dau-AuNPs complex into Molt-4 cells by sgc8c aptamer, the complex could be internalized into the nuclei of cancer cells through AS1411 aptamer [26], leading to enhancement of the therapeutic efficacy of Dau. Also, in this study AuNPs were used as carriers for delivery of Dau and polyvalent aptamers to increase the therapeutic efficacy of the targeted drug delivery system because of their high capacity for loading of drug and polyvalent aptamers. "
    [Show abstract] [Hide abstract] ABSTRACT: Clinical use of daunorubicin (Dau) in treatment of leukemia has been restricted because of its cardiotoxicity. Targeted delivery of anticancer drugs could decrease their off-target effects and enhance their efficacy. In this study a modified polyvalent aptamers (PA)-Daunorubicin (Dau)-Gold nanoparticles (AuNPs) complex was designed and its efficacy was assessed in Molt-4 cells (human acute lymphoblastic leukemia T-cell, target). Dau was efficiently loaded (10.5 µM) onto 1 mL of PA-modified AuNPs. Dau was released from the PA-Dau-AuNPs complex in a pH-sensitive manner (faster release at pH 5.5). The results of flow cytometry analysis indicated that the PA-Dau-AuNPs complex was efficiently internalized into target cells, but not into nontarget cells. The results of MTT assay were consistent with the internalization data. PA-Dau-AuNPs complex had less cytotoxicity in U266 cells compared to Dau alone and even Apt-Dau-AuNPs complex. The PA-Dau-AuNPs complex had more cytotoxicity in Molt-4 cells compared to Dau alone and even Apt-Dau-AuNPs complex. Cytotoxicity of PA-Dau-AuNPs complex was effectively antagonized using antisense of polyvalent aptamers. In conclusion, the designed drug delivery system inherited properties of efficient drug loading, tumor targeting, pH-dependent drug release and controllable delivery of Dau to tumor cells.
    No preview · Article · Feb 2016 · Materials Science and Engineering C
  • Source
    • "Nucleolin is a phosphoprotein overexpressed in cytoplasm and on plasma membrane of the metastatic cells, and not the normal cells. AS1411 enters many different cancer cell-types via nucleolin-mediated endocytosis[12,13]. Aptamers were conjugated with nanomaterials to enhance cancer cell detection. "
    [Show abstract] [Hide abstract] ABSTRACT: A simple but highly sensitive colorimetric method was developed to detect cancer cells based on aptamer-cell interaction. Cancer cells were able to capture nucleolin aptamers (AS 1411) through affinity interaction between AS 1411 and nucleolin receptors that are over expressed in cancer cells, The specific binding of AS 1411 to the target cells triggered the removal of aptamers from the solution. Therefore no aptamer remained in the solution to hybridize with complementary ssDNA-AuNP probes as a result the solution color is red. In the absence of target cells or the presence of normal cells, ssDNA-AuNP probes and aptamers were coexisted in solution and the aptamers assembled DNA-AuNPs, produced a purple solution. UV-vis spectrometry demonstrated that this hybridization-based method exhibited selective colorimetric responses to the presence or absence of target cells, which is detectable with naked eye. The linear response for MCF-7 cells in a concentration range from 10 to 10(5) cells was obtained with a detection limit of 10 cells. The proposed method could be extended to detect other cells and showed potential applications in cancer cell detection and early cancer diagnosis.
    Full-text · Article · Nov 2015 · Analytica chimica acta
Show more