Content uploaded by Barbara Baker
Author content
All content in this area was uploaded by Barbara Baker on May 30, 2016
Content may be subject to copyright.
Inferred origin of several Native American potatoes
from the Pacific Northwest and Southeast Alaska using SSR
markers
Linhai Zhang •Charles R. Brown •David Culley •Barbara Baker •
Elizabeth Kunibe •Hazel Denney •Cassandra Smith •Neuee Ward •
Tia Beavert •Julie Coburn •J. J. Pavek •Nora Dauenhauer •Richard Dauenhauer
Received: 7 February 2009 / Accepted: 23 November 2009
Springer Science+Business Media B.V. 2009
Abstract Certain Native Americans from the Pacific
Northwest and Alaska of the USA have grown
potatoes in their gardens for many generations. In this
study, the origin of several potatoes collected from
Native gardens was investigated. Fourteen SSR
markers covering the 12 potato homologs yielding a
total of 199 alleles were amplified and scored in
Solanum tuberosum Group Andigena (52 accessions),
S. tuberosum Group. Tuberosum (39 accessions) and
wild species (6 accessions). ‘‘Ozette’’ from the Makah
Nation on the Olympic Peninsula in Washington State
was closely related to ‘‘Maria’s’’ and ‘‘Kasaan’’
potatoes collected from Native Alaskan gardens in
Southeast Alaska. These three potatoes were more
closely related to either two Mexican and one Peruvian
andigena accessions or three Chilean Group Tubero-
sum accessions, while being relatively less related to
the old European or modern varieties and most
distantly related to Group Andigenum. ‘‘To-Le-Ak’’
was closely related to two Chilean tuberosum acces-
sions and one old European variety. All Native
potatoes harbored T-type chloroplast genome indicat-
ing that their maternal lineage is shared with Chilean
Group Tuberosum. Using genetic relationship as a
guide to origin it appears plausible that the Native
American/Alaskan cultivars are either directly or
L. Zhang D. Culley
IAREC, Washington State University, 24106 N. Bunn
Road, Prosser, WA 99350, USA
C. R. Brown (&)
USDA-ARS, 24106 N. Bunn Road, Prosser, WA 99350,
USA
e-mail: chuck.brown@ars.usda.gov
B. Baker
USDA-ARS/UC-Berkeley, Plant Gene Expression Center,
800 Buchanan Street, Albany, CA 94710, USA
Present Address:
D. Culley
Batelle Pacific Northwest Laboratory, Richland, WA,
USA
E. Kunibe N. Dauenhauer R. Dauenhauer
Southeast Alaska University, Juneau, AK, USA
H. Denney C. Smith N. Ward
Makah Nation, Makah Research and Cultural Center,
Neah Bay, WA, USA
T. Beavert
Yakama Nation, Heritage University, Toppenish, WA,
USA
J. Coburn
Haida Nation, Kasaan, AK, USA
J. J. Pavek
USDA/ARS, Aberdeen, ID, USA
123
Euphytica
DOI 10.1007/s10681-009-0092-4
indirectly from Mexico and Chile. These Native potato
cultivars present a possible second route of diffusion
distinct from the South America to Europe transfer
which has been assumed to the sole means by which
potato was spread out of South America.
Keywords Solanum tuberosum Group
Andigenum Chilean potato Chloroplast genome
Simple sequence repeats Phylogenetics Makah
Quillayute Haida Tlingit Ozette Kasaan
Maria’s To-Le-Ak
Introduction
The potato was first cultivated by the natives of
Peruvian and Bolivian Andes more than six thou-
sands years ago (Hawkes 1990). The genetic patterns
of potato distribution indicate that the potato prob-
ably originated in the mountainous west-central
region of the continent. The latest papers by Spooner
et al. (2005a,b) and Spooner and Hetterscheid (2005)
conclude that there was a single origin of the
cultivated potato in Northern Bolivia and Southern
Peru The archaeological remains date from 4000 BC
and have been found on the shores of Lake Titicaca
(Hawkes 1990).
The Spanish explorers were the first Europeans to
come into contact with potatoes after they arrived in
Peru in 1532. They carried potatoes back to Spain
around 1570. From Spain, potatoes slowly spread to
Italy and other European countries. In 1845, late blight
was introduced to Europe and decimated the varieties
of the time. Another introduction took place, in 1861 in
the form of Rough Purple Chili, a clone obtained by the
reverend Chauncey Goodrich of New York State. The
cultivars Russet Burbank and Early Rose were derived
from this and the latter has had a pervasive ancestral
contribution to potatoes bred in the late 1800s and the
following century (Bryan et al. 1999). It has been
assumed that ‘‘Rough Purple Chili’’ originated from
the long-day-adapted Group Tuberosum of Chile.
Today potatoes extant in the long day temperate or
highland tropical areas of the world outside of the
Andes resemble Chilean potato Group Tuberosum.
The most important genetic marker supporting this is
the chloroplast genome in which a 242 bp deletion is
shared by the Chilean potato and all non-Andean
potatoes (denoted T-cytoplasm). As a consequence
two theories of the origin of the potato diaspora have
existed for decades. One purports that central Andean
potato was taken to Europe whereupon it evolved into
a long day adapted form and has spread widely
throughout the world. The conversion to the Chilean
chloroplast genome is explained as occurring later
when Chilean potato became the sole cytoplasmic
donor, perhaps mainly due to the introduction of
Rough Purple Chili into the breeding pool. The
T-cytoplasm is often associated with male sterility,
ensuring maintenance of the original maternal line.
The second hypothesis simply states that Chilean
potato was taken to Europe and is the sole progenitor of
present day long-day-adapted varieties.
Potatoes were first introduced to North America in
the 1620s when the British governor of the Bahamas
sent a gift box of Solanum tuberosum to the governor
of the colony of Virginia. While they spread
throughout the northern colonies in limited quantities,
potatoes did not become widely accepted. Later the
potato continued its long geographical and evolu-
tionary journey, carried by Scottish and Irish settlers
to North American colonies in the 17th century. The
first permanent North American potato patches were
established in New England around 1719.
For thousands of years, the Makah Nation has
made its home on the Northwest corner of the
Olympic peninsula, in present-day Washington State
bordered by the Pacific Ocean on the west, and by the
Strait of Juan de Fuca on the north and northeast.
Originally there were five distinct villages, but
presently most Makah live in and around Neah Bay.
They have grown ‘‘Ozette’’ potatoes in their gardens
for many generations. In addition, the ‘‘To-Le-Ak’’
potato was grown by the Quillayute Nation of
La Push, Washington on the Olympic Peninsula,
‘‘Maria’s Potato’’ by the Tlingit Nation of Alaska,
and lastly ‘‘Kasaan’’ by the Haida living in Kasaan,
Alaska. Historical accounts indicate that the Makah/
Ozette potato has been present in their gardens for
over two hundred years (Swan 1868; MacDonald
1972; Wagner 1933; Suttles 1951; Gill 1983; Kirk
and Alexander 1990). Determination of origin may
add considerably to our knowledge of diffusion of
potato from South America to the rest of the world.
Simple sequence repeats (SSRs) have been
observed in a wide range of genomes, including
mammals, birds, insects, fish and plants (Zane et al.
2002). SSR markers have been applied to the genetic
Euphytica
123
study of many plant species, including potato. The first
generation of SSRs in potato was obtained from the
identification of specific repeat motifs in gene
sequences (Veilleux et al. 1995; Kawchuk et al.
1996; Provan et al. 1996; Schneider and Douches
1997). The second wave of SSRs came from screening
genomic libraries enriched for repeat motifs (Mil-
bourne et al. 1998). More recently, as reported in the
present publication, the search for repeat motifs within
expressed sequence tags (ESTs) from potato showed
that 5% of ESTs evaluated contained SSRs. In this
study, we used a highly informative and user-friendly
set of SSRs.
Chloroplast DNA (cpDNA) restriction site data
documented several chloroplast genotypes in S. tubero-
sum, which included Groups Tuberosum and Andigena.
Group Andigena has all five types and native Chilean
subsp. tuberosum has three types: A, T, and W (Hosaka
and Hanneman 1988). The most frequently observed
type in Chilean Group Tuberosum is T, which is
characterized by a 241-base-pair deletion (Kawagoe
and Kikuta 1991).
In this study, the origin of several potatoes, includ-
ing two potatoes from Native Americans, ‘‘Ozette’’
(Makah Nation) and ‘‘To-Le-Ak’’ (Quillayute Nation),
and two potatoes from Native Alaskans, Kasaan (Haida
Nation), and Maria’s Potato (Tlingit Nation), were
fingerprinted using 14 SSR markers covering the 12
potato chromosomes.
Materials and methods
Plant material and DNA extraction
We sampled a set of 97 potato accessions representing
Solanum tuberosum Group Andigena (52 accessions),
S. tuberosum Group Tuberosum (38 accessions) and
several wild species ranging from South America to
North America. Included in Group Tuberosum were
old European, old American and cultivars and breed-
ing lines bred in recent times. A number of native
Mexican varieties were also included. We included 6
accessions of wild species or cultivated-wild species
hybrids to serve as an outgroup for rooting phylog-
enies. The complete information for the plant mate-
rials, including landrace designation, germplasm bank
accession numbers, and geographical information for
some cultivated potatoes are listed in Table 1.
DNA was extracted from the plants, which were
germinated from the seeds requested from NRSP-6
(United States Potato Genebank) at Sturgeon Bay, WI
or from clonally propagated materials. DNA was
extracted using a modified CTAB method (Doyle and
Doyle 1987; Bonierbale et al. 1988; Gebhardt et al.
1989; Sosinski and Douches 1996). Approximately
0.2 g of young leaf tissue was harvested into 1.5-ml
Eppendorf tubes held in racks suspended above liquid
nitrogen. The frozen tissue was then crushed with
glass rods before addition of extraction buffer. Two
hundred micro liter of extraction buffer was added to
the frozen tissue, and the racks containing the tubes
were placed at room temperature until the extraction
buffer thawed. Samples were then ground for about
5 s each with a power drill fixed with a plastic bit,
rinsing the bit between samples. After grinding, an
additional 550 ll of extraction buffer was added,
samples were mixed, and then placed in a 65C water
bath for 20–60 min. Tubes were removed from the
water bath, mixed, filled with a 24:1 mixture of
chloroform and isoamyl alcohol (550–600 ll) and
then placed on a shaker for 5 min. After mixing, tubes
were centrifuged at 13,000 rpm for 10 m and the
supernatant was removed with a pipette and placed
into a new Eppendorf tube, where it was mixed with
2/3 the volume of cold isopropanol. The tubes were
inverted repeatedly to precipitate the DNA, followed
by another centrifugation at 13,000 rpm for 12 min to
pellet the DNA. The supernatant was discarded, and
the pellet was washed with 800 ll of cold 70% (v/v)
ethanol, precipitated by centrifugation and dried. The
pellet was re-suspended in 50 ll of TE buffer in a
65C water bath.
SSR sequences and amplification conditions
Fourteen SSR primer pairs that covered 12 potato
chromosomes and revealed high polymorphism
according to Ghislain et al. (2004) were used in this
study. These SSR sequences were identified through
potato database searches (Provan et al. 1996),
enriched genomic libraries (Milbourne et al. 1998)
and expressed sequence tags developed at the Scottish
Crop Research Institute, Invergowrie, UK. The degree
of applicability across cultivar groups and the poly-
morphic index content (PIC) of SSRs were used to
select a highly informative set of SSRs for cultivated
potato fingerprinting and phylogenetic studies.
Euphytica
123
Table 1 DNA samples included in this study
NO Name Taxon (as reported
in NRSP-6 database)
Origin Notes Chloroplast
marker
1 160373 S. andigena Mexico T
2 161131 S. andigena Mexico A
3 161348 S. andigena Mexico A
4 161677 S. andigena Mexico T
5 161683 S. andigena Mexico T/A
6 161695 S. andigena Mexico T
7 161716 S. andigena Mexico A
8 161771 S. andigena Mexico A
9 186177 S. andigena Peru A
10 189473 S. andigena Mexico A
11 197757 S. andigena Bolivia A
12 197932 S. andigena Colombia A
13 205388 S. andigena Argentina T
14 214434 S. andigena Peru A
15 225635 S. andigena Venezuela A
16 230470 S. andigena Ecuador A
17 233980 S. andigena Bolivia A
18 234001 S. andigena Bolivia A
19 243361 S. andigena Columbia A
20 243400 S. andigena Ecuador A
21 243429 S. andigena Colombia A
22 243436 S. andigena Colombia A
23 255491 S. andigena Bolivia A
24 279291 S. andigena Guatemala T
25 280907 S. andigena Argentina A
26 280968 S. andigena Bolivia A
27 281032 S. andigena Bolivia A
28 281033 S. andigena Mexico A
29 281105 S. andigena Peru T
30 281119 S. andigena Peru A
31 281186 S. andigena Peru A
32 281233 S. andigena Peru A
33 281245 S. andigena Peru A
34 285019 S. andigena Mexico A
35 285023 S. andigena Mexico A
36 292073 S. andigena Peru A
37 292078 S. andigena Peru A
38 292089 S. andigena Peru A
39 292101 S. andigena Peru A
40 292128 S. andigena Bolivia T
41 306302 S. andigena Guatemala A
42 306303 S. andigena Guatemala T
43 307743 S. andigena Mexico A
Euphytica
123
Table 1 continued
NO Name Taxon (as reported
in NRSP-6 database)
Origin Notes Chloroplast
marker
44 324454 S. andigena Mexico T
45 324461 S. andigena Mexico A
46 365402 S. andigena Mexico A
47 473271 S. andigena Argentina A
48 473296 S. andigena Argentina A
49 473390 S. andigena Bolivia A
50 545744 S. andigena Mexico T
51 546018 S. andigena Bolivia A
52 703606 S. andigena
53 595453 S. tuberosum Chile T
54 595458 S. tuberosum Chile T
55 595459 S. tuberosum Chile T
56 595460 S. tuberosum Chile T
57 700313 S. tuberosum Chile
58 A77715-5 S. tuberosum USDA/ARS, Prosser, WA Breeding line T
59 A89875.5 S. tuberosum USDA/ARS, Prosser, WA Breeding line T
60 Atlantic S. tuberosum Modern Variety T
61 Blueberry
Ripples
S. tuberosum American Heirloom T
62 Bannock S. tuberosum Modern Variety (Bannock Russet) T
63 Chilean Aucud S. tuberosum Chile Chilean cultivar T
64 EDY 12-4 S. tuberosum Eersteling-Duke of York
(old variety-1891)
T
65 EO 34-11 S. tuberosum Early Ohio (old variety-1871) T
66 ER 34-7 S. tuberosum Early Rose (old variety-1861) T
67 GEM S. tuberosum Gem Russet (Modern Variety) T
68 GM 34-4 S. tuberosum Green Mountain (old variety-1875) T
69 Haida S. tuberosum New Massett, Queen
Charlotte Is., Canada
=Ozette T
70 Irish Cobbler S. tuberosum Irish Cobbler (old variety bred in 1876) T
71 Johnny
Gunther
S. tuberosum Oregon heirloom T
72 PA99P20-2 S. tuberosum USDA/ARS, Prosser, WA Breeding Line T
73 PL-17 Bzura S. tuberosum Polish Variety A
74 PL-10 Cisa S. tuberosum Polish Variety A
75 PL11 Frezja S. tuberosum Polish Variety T
76 R4 S. tuberosum R4 gene A
77 Ranger Russet S. tuberosum Modern Variety T
78 RBI S. tuberosum Old variety Russet Burbank-Idaho T
79 TRI 19-10 S. tuberosum Triumph (old variety-1877) T
80 Uma S. tuberosum Umatilla Russet (modern variety) T
81 Mak(ID) Native Ozette in Idaho T
82 Mak 1.2 Native Neah Bay Ozette collected in Neah Bay T
Euphytica
123
PCR reactions were performed in a 10 ll volume
containing 5 ll29CLP TAQ master mix a final
magnesium concentration of 1.5 mM (CLP, San
Diego, CA), 0.5 lM of each primer (forward and
reverse), (Integrated DNA Technologies, Coralville,
IA) and 10 ng of DNA templates. PCR was carried
out in a PTC-200 thermocycler (MJ Research Inc.,
Watertown, Mass.), set to the following program:
3 min at 94C, 2 min at annealing temperature (T a),
1 min 30 s at 72C, 29 cycles of 1 min at 94C,
2 min at T a, and 1 min 30 s at 72C, with a final
extension step of 5 min at 72C. In some cases
(indicated as Td.60–50 in Table 2), a modified PCR
program was used: 3 min at 94C, 16 double cycles
of 1 min at 94C, 2 min at 60C, 1.5 min at 72C,
and 1 min at 94C, 2 min at 50C, 1.5 min at 72C
and one final elongation cycle of 5 min at 72C.
The microsatellite regions were amplified by PCR
with florescent-labeled primers. The PCR products
labeled with 6-FAM were analyzed on an Applied
Biosystems automated Genetic Analyzer (ABI 3100).
PCR samples were prepared by combining 1 ll of the
PCR product with 11.2 ll deionized formamide,
0.5 ll loading dye, and 0.3 ll GENESCAN 500-
TAMRA size standard (Perkin Elmer/Applied Bio-
systems). After denaturing at 90C for 3 min, 0.8 ll
of the sample was loaded into 96 well format plates.
Electrophoresis was performed with the Performance
Optimized Polymer 4 (POP-4TM, PE Applied Bio-
systems). The auto-sampler was calibrated after
setting the temperature at 60C. Denatured working
samples were transferred to sample tubes and covered
with septa before placing them on the sample tray.
The injection time was 5 s at 15 kV and run time was
24–36 min at 15 kV. Fragment Analysis SSR frag-
ment sizing was performed by the ‘‘Local Southern
Method’’ and default analysis settings of the Gene-
Scan (Perkin Elmer/Applied Biosystems). Size stan-
dard peaks were defined by the user. Allele calling
was performed with Genotyper software, version 2.5
(Perkin Elmer/Applied Biosystems). The precise size
of the SSR was determined for each individual.
Chloroplast marker
The T-type chloroplast DNA was distinguished by
the presence of a 241 bp deletion from the A-type
chloroplast DNA found among the Andean potatoes
Table 1 continued
NO Name Taxon (as reported
in NRSP-6 database)
Origin Notes Chloroplast
marker
83 Mak 2.2 Native Neah Bay Ozette collected in Neah Bay T
84 OZ (Gilmore) Native Reno, Nevada Ozette in Nevada T
85 OZ (Kirk) Native Lacey WA Ozette in Washington T
86 OZ (Victoria) Native Victoria B.C. Canada Ozette on Vancouver Island,
Canada
T
87 Ozette Native Neah Bay Ozette, Olympic Peninsula,
Washington State
T
88 SB (OZ) Native NRSP-6 Sturgeon Bay,
WI
Ozette in Wisconsin T
89 Kasaan Native Kasaan, Alaska Haida Nation, southeast Alaska
90 Maria’s Potato Native Juneau, Alaska Tlingit Nation, southeast Alaska T
91 To-Le-Ak Native Oil City, WA USA Quillayute Nation, Olympic Peninsula,
Washington State
T
92 SB22 S. bulbocastanum 2n =24 A
93 95H3.3 S. hjertingii hybrid 2n =36 A
94 95A2.8 S. hougasii 2n =72, Wild species parent A
95 96A2-1 S. hougasii 2n =60, Hybrid A
96 91E22 S. phureja 2n =24 A
97 EGA9706-14 S. phureja 2n =24, Polish Breeding Line,
IHAR, Młochow, Poland
A
Euphytica
123
Table 2 The SSR primers used for this study
SSR ID Repeat Sequences AT Chrom Copies Type Number
of alleles
Size
STM1049 (ATA)6 CTACCAGTTTGTTGATTGTGGTG 57 I [1 3’ UTR 9 184–254
AGGGACTTTAATTTGTTGGACG
STM2022 (CAA)3…(CAA)3 GCGTCAGCGATTTCAGTACTA 53 II [1 Intergenic 13 184–244
TTCAGTCAACTCCTGTTGCG
STM1053 (TA)4 (ATC)5 TCTCCCCATCTTAATGTTTC 55 III 1 3’ UTR 7 168–184
CAACACAGCATSCAGATCATC
STM3023 (GA)9 (GA)8 (GA)4 AAGCTGTTACTTGATTGCTGCA 50 IV 1 Intergenic 5 169–201
GTTCTGGCATTTCCATCTAGAGA
STPoAc58 (TA)13 TTGATGAAAGGAATGCAGCTTGTG 57 V 1 3’ UTR 13 203–277
ACGTTAAAGAAGTGAGAGTACGAC
STM0019 (AT)7(GT)10(AT)4(GT)5 (GC)4 (GT)4 AATAGGTGTACTGACTCTCAATG 47 VI 1 Intergenic 27 155–241
TTGAAGTAAAAGTCCTAGTATGTG
10 83–124
STM0031 (AC)5…(AC)3(GCAC) (AC)2(GCAC)2 CATACGCACGCACGTACAC 57 VII 1 Intergenic 11 155–205
TTCAACCTATCATTTTGTGAGTCG
STM1052 (AT)14 GT (AT)4(GT)6 CAATTTCGTTTTTTCATGTGACAC Td.60–50 VII 1 Intron 16 212–268
ATGGCGTAATTTGATTTAATACGTAA
STM2013 (TCTA)6 TTCGGAATTACCCTCTGCC 55 VII 2 Intergenic 20 146–172
AAAAAAAGAACGCGCACG
STM1104 (TCT)5 TGATTCTCTTGCCTACTGTAATCG 57 VIII 1 3’ UTR 17 164–185
CAAAGTGGTGTGAAGCTGTGA
STM1106 (ATT)13 TCCAGCTGATTGGTTAGGTTG 55 X 1 Intron 15 131–197
ATGCGAATCTACTCGTCATGG
STM3012 (CT)4, (CT)8 CAACTCAAACCAGAAGGCAAA 57 IX 1 Intergenic 8 168–213
GAGAAATGGGCACAAAAAACA
STM0037 (TC)5 (AC)6 AA (AC)7 (AT)4 AATTTAACTTAGAAGATTAGTCTC 53 XI 1 Intergenic 13 75–125
ATTTGGTTGGGTATGATA
STM0030 Compound (GT/GC)(GT)8 AGAGATCGATGTAAAACACGT 53 XII [1 Intergenic 15 122–191
GTGGCATTTTGATGGATT
Euphytica
123
(Hosaka et al. 1988; Kawagoe and Kikuta 1991).
PCR amplification was performed as described
previously (Hosaka 2002). PCR products from were
separated by electrophoresis in 2% agarose (Fisher
Scientific) gels.
Data analysis
Presence or absence of each SSR fragment was coded
as ‘‘1’’ and ‘‘0’’, where ‘‘1’’ indicated the presence of a
specific allele and ‘‘0’’ indicated its absence. Genetic
diversity for each locus was then calculated by D
SA
(Chakraborty and Jin 1993). We used the proportion of
shared alleles distance that is free of the stepwise
assumption. We used the FITCH program in the
PHYLIP package with the log-transformed proportion
of shared alleles distance (Felsenstein 1993). Genetic
similarities between pairs of accessions were mea-
sured by the DICE similarity coefficient based on the
proportion of shared alleles (Dice 1945; Nei and Li
1979). The Dice similarity coefficient =2a/(2a ?
b?c), where a is the number of positive matches
(presence of a band in both accessions), and b ?cis
the number of no matches (presence of a band either in
one accession but absent in the other accession). The
accessions were clustered based on a similarity matrix
using an unweighted pair group method with the
arithmetic average (UPGMA) algorithm. The result
was used to construct a dendrogram with the TREE
module. Principal components analysis for the SSR
data was conducted using the NYSYSpc 2.2 and
plotted using Mod3Dplot in the NTSYSpc (Rohlf
2007). The first and second principal components were
plotted with identifiers relating to the major clusters
seen on the UPGMA dendrograms.
Results
In this study, a total of 199 alleles were amplified and
scored in a set of 97 Solanum tuberosum Group
Andigena,S. tuberosum Group Tuberosum and wild
species. Amplification of the genomic DNA from
these potato cultivars with fourteen SSR primer sets
produced fragments ranging in size from 66 to 260 bp
from 26 different loci. The number of amplified
fragments was dependent on the cultivar and primer
set. The total number of microsatellite alleles varied
from the lowest of 28 in Irish Cobbler (Group
Tuberosum) to the highest of 62 in PI 306303 (Group
Andigena; from Guatemala), with the mean number
of alleles per cultivar of 41. The number of amplified
fragments detected by individual primer sets varied
from 5 to 27. A minimum of 5 alleles were amplified
with primer set STM3023, while primer set STM0019
amplified a maximum of 27 alleles from 4 loci.
The estimated genetic distance between the culti-
vars as calculated using Log-Shared-Allele using
PHYLIP and ranged from 0.43 between EGA970614
and PI306303 to 0.02 between PI595458 and
PI595459. High genetic distance values suggested a
further genetic base of the cultivars tested in the
present study. All 97 cultivars could be grouped into
three major groups as shown in the dendrograms
(Figs. 1,2). None of the primer sets could distinguish
between all 97 cultivars singly.
The phylogenetic analysis showed that Group
Andigena was separated from Group Tuberosum,with
some exceptions (Huama
´n and Spooner 2002). The
wild species formed a well-defined outgroup. ‘‘Ozette’’
from the Makah Nation on Olympic Peninsula in
Washington State was most closely related to ‘‘Mar-
ia’s’’ and ‘‘Kasaan’’ potatoes collected from Native
Alaskan gardens. These three potatoes, ‘‘Ozette’’,
‘‘Maria’s’’ and ‘‘Kasaan’’, were least closely related
to Central Andean cultivars, but were more closely
related to either two Mexican and Peruvian Andigena
accessions or three Chilean Tuberosum accessions, and
less closely related to old European old American or
modern varieties. They appear to be less related to most
of the accessions from the Andes (i.e. Group. Andige-
na). ‘‘To-Le-Ak’’ was not closely related to either
‘‘Ozette’’ or ‘‘Maria’s’’ or the ‘‘Kasaan’’ cultivars. ‘‘To-
Le-Ak’’ was closely related to two Chilean Tuberosum
accessions and one old European variety.
There are two types of ctDNA revealed in this
study by using the PCR primer from Hosaka (1995).
Among 97 accessions, 51 A-type, 44 T-types and 3
undecided were found respectively. For Andigena
accessions,41 A-type and 11 T-type of ctDNA were
found. For Group Tuberosum accessions, 33 T-type
and 3 A-type of ctDNA were found. In the large
Andigena clade, all possessed A-type. All the wild
species included in this study were A-type. However,
in the Tuberosum clade, A-and T-types were present.
Furthermore, Group Andigena with T-type of ctDNA
were all co-related in the second clade of the Group
Tuberosum. Mexican accessions were assigned to
Euphytica
123
both A-type and T-types. All Native potatoes in this
study all were T-type.
Discussion
Groups Tuberosum and Andigena are not strongly
differentiated genetically and attribution of relation-
ship to one or other is often difficult to support.
Recently Spooner (2005a) concluded that there was
a single origin of the cultivated potato represented
today by assigning certain wild species in Southern
Peru and Northern Bolivia, as ancestors of mono-
phyletic cultivated potato origin. Native cultivated
potatoes or landraces are distributed widely in the
Andes, although the long day adapted Chilean
cultivars are supposed to be derived from secondary
hybridization with most likely Bolivian and/or
0.1
18
23
28
50
15
21
3
5
10
24
41
44
46
35
34
45
8
11
1
25
36
37
26
14
48
19
17
40
13
12
27
30
31
16
9
32
29
38
4
6
43
42
51
69
82
88
85
86
83
81
87
84
7*
89
67
33*
53
56
90
57
68
70
63
77
78
65
60
22*
54
55
52*
91
64
74
75
20*
47*
49*
62
66
79
80
59
72
58
61
73
76
71
96
93
92
94
95
97
Tuberosum
Ozette
Kasaan
Maria’s potato’
To-Le-Ak
0.1
39
2
Andigena
Outgroup
Fig. 1 The UPGMA tree resulting from phylogenetic analysis (Log-Shared-Allele in Phylip) of 97 Solanum tuberosum Group
Andigena,S. tuberosum Group Tuberosum and wild species (outgroup) using 14 SSR markers
Euphytica
123
Argentinean wild species. All previous hypotheses
had proposed that the cultivated potato had devel-
oped in a number of different points from a variety
of wild species. The native Chilean cultivars and the
European cultivars are very similar, not only
morphologically but also in their photoperiodic
response. Grun and Staub (1979) originally found
that the cytoplasmic constitution of Groups Andige-
na and Tuberosum was different, as expressed in the
types of male sterility. Grun (1990) suggested that
Group Tuberosum was distinct from Group Andige-
na based on cytoplasmic sterility factors, geograph-
ical isolation, and ecological differences. Hawkes
(1990) distinguished the two subspecies by subsp.
tuberosum having fewer stems with foliage aligned
at a broad angle to the stem and having less-
dissected leaves with wider leaflets and thicker
pedicels. Raker and Spooner (2002) showed that
Chilean potato is distinct, but still closely related to
Group Andigena based on the SSR markers. In a
separate study these researchers surveyed an assort-
ment of heirloom potato varieties from India
considered to be remnants of some of the first
potatoes introduced to Europe and transferred to
India during the time of the British Colonial control
(Spooner et al. 2005b). They found that these
descendants share specific molecular traits, includ-
ing SSR’s and a cytoplasmic marker that establish a
closer relationship with potatoes from Chile than
with Central Andean potatoes (Group Andigena).
In our study the phylogenetic tree divided Tubero-
sum and Andigena into two distinct clades. Three of the
Native potatoes, ‘‘Ozette,’’ ‘‘Maria’s,’’ and ‘‘Kasaan’’
fall into an intermediate position in three methods of
analysis, the phylogenetic tree (Fig. 1), the unrooted
phylogenetic tree (Fig. 2), and Principal Component
Analysis (Fig. 3). Based on the three analyses these
three clones are more closely related to several
0.1
66
62
80 79
59 61
58
72
73
78
77 55
54
52
To-Le-Ak
71
70
68
75
74
64
65
63
60
67
76
56
53
94
95
93
92
97
96
57
OzetteMaria’s potato
Kasaan 7
22 33
8
25
531024
41
42 4
6230
9
32
29
38
43
39
21
15
16
31
20
28
51
11
50
49
48
26
37
36
19
27
14
40
12
17
13
47
23
18
45
46 34
35
44
1
Tuberosum cluster
Andigena cluster
Outgroup
Fig. 2 The un-rooted
phylogeny for 98 potato
accessions using the Fitch-
Margoliash method and the
log-transformed proportion
of shared distance
(PHYLIP) of 97 Solanum
tuberosum Group Andigena,
S. tuberosum Group
Tuberosum and wild species
(outgroup) using 14 SSR
primers (199 alleles)
Euphytica
123
Mexican and Chilean clones. All four clones have T
cytoplasm, a fact that argues against a Central Andean
origin. Their lack of similarity to the Andigena clade
argues that these clones did not come from the central
Andes. Thus it is likely that these three cultivars were
transported on Spanish ships originating from the
Port of San Blas, New Spain (e.i., modern Mexico),
originating from Mexican cultivators, who had prob-
ably received them from Chile in the past. It is also
possible that they came directly from Chile. However,
the time that would be required to travel from Chile to
the Pacific Northwest and Southeast Alaska argues
against this. The Native cultivar ‘‘To-Le-Ak’’ falls into
the Tuberosum clade and is not related to Ozette,
Maria’s or the Kasaan potato. The four abovemen-
tioned Native potatoes all had T-cytoplasm. It should
also be noted that the Mexican Collections denoted
S. tuberosum ssp. andigena in the NRSP-6 collection
were a mixture of A and T type cytoplasm. This
connotes that Mexico may have received cultivars
from the Central Andes and Chile which existed
sympatrically into the Twentieth Century, when the
collections of NRSP-6 were made.
European contact with the Native Americans of the
Pacific Northwest started from the beginning of the
European occupation of the Western Hemisphere.
Both Spanish and English mariners made landfall
along the Pacific coast. The Manila route, taken by
Spanish ships, consisted of voyages from the Pacific
coast of Mexico to Asia, with landfall on the North
American coast often occurring extremely far north of
New Spain (Mexico). A southward coastal route
would then be used to return to Mexico. The last half
of the eighteenth century saw successful voyages up
the North American coast and to Alaska in some
cases. A Spanish fort was established and maintained
for several months in 1792 at Neah Bay by Salvador
Fidalgo (Wagner 1933; Cutter 1991). Apparently a
garden had been planted the year before at the Spanish
settlement of Nootka Bay, and was reported to contain
potatoes among other vegetables (Wagner 1933). In
the same year (1792), a Spanish (native born in the
Mexico of today) naturalist, Jose Mariano Mozin
˜o
accompanied the expedition of Juan Francisco de la
Bodega y Quadra, and listed Solanum tuberosum on
Vancouver Island in the report emanating from his
study (Mozin
˜o1991). James Swan, a naturalist and
schoolteacher of the Makah Nation in the 1860s also
mentioned the potato as a staple of their diet (Swan
1868; MacDonald 1972). Evidence also exists for the
early dissemination of the potato throughout the
land bordering the Strait of Juan de Fuca. A Makah
word for potato, qawic (roughly pronounced ‘‘kaw-
weech’’), possibly referred originally to a native root,
Sagittaria, and various forms of qawic are found in
Coastal Salish languages of the region (Gill 1983).
Anthropologist Steven J. Gill reported that
‘‘Ozette’’ was formerly grown at the Ozette village
and by almost everyone at Neah Bay and supplied to
schooners by local residents. The Makah have been
growing it for so long that some consider it a
traditional food. Like the Makahs, the Haidas in the
-1.01 - - 0.15 0.54
-0.46
-0.16
0.14
0.44
0.74
Maria’s Potato
Ozette
Kasaan
Tuberosum
To-Le-Ak
Andigena
Native potato
-1.01 -0.63 -0.24
-0.46
-0.16
0.14
0.44
0.74
Maria’s Potato
Ozette
Kasaan
Second Principal Component
To-Le-Ak
First Principal Component
Fig. 3 The first and second
principal components of the
SSR fingerprint data for all
of the potato clones
presented based on the
clustering in the
dendrogram shown in Fig. 1
Euphytica
123
Queen Charlotte Islands, also grew potatoes. Dr.
Nancy J. Turner, an ethnobotanist whose work deals
with native peoples of British Columbia, writes that
the potato was a staple crop for the Haidas by the
mid-1880s (Turner 1975). Turner also reported that
the potato was an early agricultural commodity,
traded with vessels and others on the land (Turner
1995). Haida villagers were contracted by Russian fur
seal fleets to produce potatoes for them in the early
1800s (Gibson 1999).
The Haida of Alaska and western Canada tell
similar stories of pre-Columbian traffic in potatoes.
These stories state that the Haida grew ancient
varieties, which they have traded for centuries with
northwest Pacific islanders and inhabitants on the
Russian mainland. Their oral history traces the origin
of one of these varieties to ‘‘Baylu’’ thought to be a
variation of Peru
´(Turner 1995).
The Makah potato was collected and placed in the
Potato Introduction Station Collection at Sturgeon
Bay, Wisconsin in 1988. There were also several
‘‘Ozette’’ potatoes obtained from different sources
included in this study. By using SSR marker, it was
shown they are genetically identical. In this study,
potato known by the name ‘‘Haida,’’ derived from
Haida gardeners on the Queen Charlotte Islands,
Canada, was also identified as ‘‘Ozette.’’
The SSR markers and limitation of SSR markers
Microsatellites are often useful for only closely
related germplasm sources, and even moderately
divergent cross-species amplification can lead to false
positives and provide significant distortion in genetic
similarity estimates (Peakall et al. 1998; Westman
and Kresovich 1998). This was demonstrated in
potato when SSRs developed for modern cultivars
worked very well in a cultivated species gene pool
(Raker and Spooner 2002) but produced limited
amplification and clearly distorted phylogenetic
information in germplasm from another phylogenetic
clade of tuber-bearing Solanum (Lara-Cabrera and
Spooner 2003). However, once SSRs are identified,
their high allele and genetic information content
make them a highly desirable system for fingerprint-
ing large collections of related accessions, and the
system also is amenable to automation (Mitchell et al.
1997).
Although SSRs are useful for phylogenetic study,
it appears there is no consensus among researchers as
to which evolutionary model is most appropriate for
reconstructing phylogenies based on microsatellite
data (Feldman et al. 1999; Goldstein and Pollock
1997). Trees of S. tuberosum (Grun 1990; Miller and
Spooner 1999) were constructed using both the SMM
model (Goldstein et al. 1995a,b) and the IAM model
of Nei (1972). Both models failed to absolutely
distinguish subsp. andigena from subsp. tuberosum,
or from the other cultivated species. Neither method
will clearly separate subsp. andigena from some of its
in-group relatives in the S. brevicaule complex and
other cultivated species. Obtaining a reliable phylog-
eny requires a genetic distance measure that fits the
pattern of mutation displayed by the microsatellites.
Therefore, we used the proportion of shared alleles
distance that is free of the stepwise assumption, and is
widely used with multilocus microsatellite data
(Matsuoka et al. 2002). We used the FITCH program
in the PHYLIP package with the log-transformed
proportion of shared alleles distance as implemented
in the program to construct phylogenetic trees. This
approach has been successfully applied in maize
(Matsuoka et al. 2002). Because many microsatellites
of potato and other species do not evolve in a
stepwise manner, they violate the assumptions for the
genetic distance measures that are based on the
stepwise mutation model.
The Chloroplast marker
Two known types of ctDNA were assigned to
cultivated potatoes as reported previously (Hosaka
1995). The major types were found A and T among
cultivated potatoes. All the other wild species were
polymorphic with W-, C-, S- or A-type ctDNA.
However, only Type-A was found among the wild
species included in this study. The Mexican culti-
vated supposedly all belong to T-type. However, in
this study, the Mexican accessions were a mixture of
both A- and T- types.
Origin of the Native Indian potatoes
Since the potato came to the American colonies with
Scottish and Irish immigrants in the early 17th
century (having made a long geographical and
evolutionary journey from its Andean birthplace), it
Euphytica
123
is a virtual certainty that Native Indian potato comes
from a different foreign donor because they are
different from the old European cultivated potatoes
based on the SSR results from this study. But who
first gave them the potato, and where did this one
originate? ‘‘Ozette,’’ ‘‘Kasaan,’’ and ‘‘Maria’s’’ pota-
toes originated from sources other than the old and
modern European, and North American, and Central
Andean cultivars. Originating from Mexican and
Chilean sources is not difficult to explain considering
the trade along the Pacific Coast of South and North
America that was carried on for centuries. However,
Spanish explorers did not succeed in going directly
north and safely returning until the latter half of the
eighteenth century due to prevailing northerly winds
in the boreal summers. SSR data identified certain
links; however, there are still gaps between them. To
answer these questions, additional data and more
powerful molecular analysis are needed.
In conclusion, three Native American and Native
Alaskan potatoes (Ozette, Kasaan and Maria’s)
appear to be closely related to Mexican and Chilean
cultivars, and less aligned with Central Andean, or
various groups of cultivars bred outside of South
America. Among the five possible routes (dash lines
in Fig. 4), Mexico and Chile were the most plausible
sources for the ‘‘Ozette’’ and ‘‘Maria’s’’ and the
‘‘Kasaan’’ cultivars based on this phylogenetic study
and other historical evidence. ‘‘To-Le-Ak’’ falls into
the Tuberosum cluster and does not show a definitive
affinity for a particular origin. This does not exclude
it from a Chilean origin, however, having a T-
cytoplasm as do the other three. These Native potato
cultivars present a possible second route of diffusion
distinct from the South America to Europe transfer
which has been assumed to the sole means by which
potato was spread out of South America.
Acknowledgements This research is a part of the Potato
Genome Project funded by National Science Foundation. We
thank the Makah (Neah Bay, Washington), Tlingit, Quillayute
and Haida Nations for their help and support.
References
Bonierbale MW, Plaisted RL, Tanksley SD (1988) RFLP maps
based on a common set of clones reveal modes of chro-
mosomal evolution in potato and tomato. Genetics 120:
1095–1103
Bryan GJ, McNicoll J, Ramsay G, Meyer RC, De Jong WS
(1999) Polymorphic simple sequence repeat markers in
chloroplast genomes of Solanaceous plants. Theor Appl
Genet 99:859–867
Chakraborty R, Jin L (1993) Determination of relatedness
between individuals by DNA fingerprinting. Hum Biol
65:875–895
Cutter DC (1991) Malaspina and Galiano: Spanish voyages to
the northwest coast, 1791 and 1792. University of
Washington Press, Seattle, p 160
Dice LR (1945) Measurement of the amount of ecological
association between species. Ecology 26:295–302
Doyle JJ, Doyle JL (1987) A rapid DNA isolation procedure
from small quantities of fresh leaf tissues. Phytochem Bull
19:11–15
Feldman MW, Kumm J, Pritchard JK (1999) Mutation and
migration in models of microsatellite evolution. In:
Goldstein DB, Schlotterer C (eds) Microsatellites: evolu-
tion and applications. Oxford University Press, Oxford, pp
98–115
Felsenstein J (1993) PHYLIP, Phylogeny inference package,
Version 3.5c. University of Washington, Seattle
Gebhardt C, Ritter E, Debener T, Schachtschabel U, Walkemeier
B, Uhrig H, Salamini F (1989) RFLP-analysis and linkage
mappingin S olanum tuberosum. Theor ApplGenet 78:65–75
Ghislain M, Spooner DM, Rodrı
´guez F, Villamon F, Nun
˜ez J,
Va
´squez C, Waugh R, Bonierbale M (2004) Selection of
Mexican
Mexican
Cultivars
Cultivars
Andean
Andean
Andigena
Andigena
Chilean
Chilean
Tuberosum
Tuberosum
Ozette
Ozette
To
To-
-Le
Le-
-Ak
Ak
Maria
Maria’
’s
s
1570
1570
Long
Long-
-day Adaptation
day Adaptation
1710
1710
Long
Long-
-day Adaptation
day Adaptation
1
1
4
4
3
3
2
2
5
5
Fig. 4 The potato’s round-
trip journey from the New
World (South America) to
the Old World (Europe) and
back to North America.
Possible sources of the
‘‘Ozette,’’ ‘‘Kasaan,’’
‘‘To-Le-Ak’’ and ‘‘Maria’s’’
cultivars: (1) North
American colonies and
states; (2) Mexico; (3)
Andes; (4) Chile; (5)
Eastern Russia
Euphytica
123
highly informative and user-friendly microsatellites
(SSRs) for genotyping of cultivated potato. Theor Appl
Genet 108:881–890
Gibson JR (1999) Otter skins, Boston ships, and China trade:
the maritime fur trade of the Northwest coast, 1785–1841.
University of Washington Press, Seattle, p 448
Gill SJ (1983) Ethnobotany of the Makah and Ozette people,
Olympic Peninsula, Washington (USA), Doctoral Dis-
sertation. Department of Botany, Washington State Uni-
versity, Pullman WA, pp 441
Goldstein DB, Pollock DD (1997) Launching microsatellites: a
review of mutation processes and methods of phyloge-
netic inference. J Hered 88:335–342
Goldstein DB, Ruiz Linares A, Cavalli-Sforza LL, Feldman
MW (1995a) Genetic absolute dating based on microsat-
ellites and the origin of modern humans. Proc Natl Acad
Sci 92:6723–6727
Goldstein DB, Ruiz Linares A, Cavalli-Sforza LL, Feldman
MW (1995b) An evaluation of genetic distances for use
with microsatellite loci. Genetics 139:463–471
Grun P (1990) The evolution of cultivated potatoes. Econ Bot
44(3 Suppl.):39–55
Grun P, Staub J (1979) Evolution of tetraploid cultigens from
the view of cytoplasmic inheritance. In: Report of the
planning conference on the exploration, taxonomy and
maintenance of potato germ plasm III. International
Potato Center, Lima, Peru pp 141–152
Hawkes JG (1990) The potato: evolution, biodiversity and
genetic resources. Belhaven Press, London, UK, p 259
Hosaka K (1995) Successive domestication and evolution of
the Andean potatoes as revealed by chloroplast DNA
restriction endonuclease analysis. Theor Appl Genet
90:356–363
Hosaka K (2002) Distribution of the 241 bp deletion of chlo-
roplast DNA in wild potato species. Am J Bot 79:119–123
Hosaka K, Hanneman RE Jr (1998) Genetics of self-compati-
bility in a self-incompatible wild diploid potato species
Solanum chacoense. 1. Detection of an S locus inhibitor
(Sli) gene. Euphytica 99:191–197
Hosaka K, de Zoeten GA, Hanneman RE Jr (1988) Cultivated
potato chloroplast DNA differs from the wild type by one
deletion––evidence and implications. Theor Appl Genet
75:741–745
Huama
´n Z, Spooner DM (2002) Reclassification of landrace
populations of cultivated potatoes (Solanum sect. Petota).
Am J Bot 89:947–965
Kawagoe Y, Kikuta Y (1991) Chloroplast DNA evolution in
potato (Solanum tuberosum L.). Theor Appl Genet 81:13–
20
Kawchuk LM, Lynch DR, Thomas J, Penner B, Sillito D,
Kulcsar F (1996) Characterization of Solanum tuberosum
simple sequence repeats and application to potato cultivar
identification. Am Potato J 73:325–335
Kirk R, Alexander C (1990) Exploring Washington’s past: a
road guide to history. University of Washington Press,
Seattle, p 542
Lara-Cabrera S, Spooner DM (2005) Taxonomy of Mexican
diploid wild potato (Solanum sect. Petota) species: mor-
phological and microsatellite data. Monogr Syst Bot Mo
Bot Gard 104:199–205
Matsuoka Y, Vigouroux Y, Goodman MM, Sanchez GJ,
Buckler E, Doebley J (2002) A single domestication for
maize shown by multilocus microsatellite genotyping.
Proc Natl Acad Sci USA 99:6080–6084
McDonald L (1972) Swan among the Indians. Binford and
Mort, Publishers, Portland, OR 233pp
Milbourne D, Meyer RC, Collins AJ, Ramsay LD, Gebhardt C,
Waugh R (1998) Isolation, characterization and mapping
of simple sequence repeat loci in potato. Mol Gen Genet
259:233–245
Miller JT, Spooner DM (1999) Collapse of species boundaries
in the wild potato Solanum brevicaule complex (Solana-
ceae, S. sect. Petota): molecular data. Plant Syst Evol
214:103–130
Mitchell SE, Kresovich S, Jester CA, Hernandez CJ, Szewc-
McFadden AK (1997) Application of multiplex PCR and
fluorescence-based, semi-automated allele sizing tech-
nology for genotyping plant genetic resources. Crop Sci
37:617–624
Mozin
˜o JM (1991) Noticias de Nutka: an account of Nootka
Sound in 1792. University of Washington Press, Seattle,
WA, p 142
Nei M (1972) Genetic distance between populations. Am Nat
106:283–292
Nei M, Li WH (1979) Mathematical model for studying
genetic variation in terms of restriction endonucleases.
Proc Natl Acad Sci 76:5269–5273
Peakall R, Gilmore S, Keys W, Morgante M, Rafalski A (1998)
Cross-species amplification of soybean (Glycine max)
simple sequence repeats (SSRs) within the genus and
other legume genera: implications for the transferability
of SSRs in plants. Mol Biol Evol 15:1275–1287
Provan J, Powell W, Waugh R (1996) Microsatellite analysis of
relationships within cultivated potato (Solanum tubero-
sum). Theor Appl Genet 92:1078–1084
Raker C, Spooner DM (2002) The Chilean tetraploid cultivated
potato, Solanum tuberosum, is distinct from the Andean
populations; microsatellite data. Crop Sci 42:1451–1458
Rohlf JF (2007) NTSYSpc: numerical taxonomy system, Ver.
2.20. Exeter Publishing, Ltd, Setauket, NY
Schneider K, Douches DS (1997) Assessment of PCR-based
simple sequence repeats to fingerprint North American
potato cultivars. Am Potato J 74:149–160
Sosinski B, Douches DS (1996) Use of PCR-based DNA
amplification to fingerprint North American potato culti-
vars. HortScience 31(1):130–133
Spooner DM, Hetterscheid WLA (2005) Origins, evolution,
and group classification of cultivated potatoes. In: Motley
TJ et al (eds) Darwin’s harvest: new approaches to the
origins, evolution and conservation of crops. Columbia
Univ. Press, New York, pp 285–307
Spooner DM, Mclean K, Ramsay G, Waugh R, Bryan GJ
(2005a) A single domestication for potato based on mul-
tilocus amplified fragment length polymorphism geno-
typing. Proc Natl Acad Sci 102(41):14694–14699
Spooner DM, Nun
˜ez J, Rodriguez F, Naik PS, Ghislain M
(2005b) Nuclear and chloroplast DNA reassessment of the
origin of Indian potato varieties and its implications for
the origin of the early European potato. Theor Appl Genet
110:1020–1026
Euphytica
123
Suttles W (1951) The early diffusion of the potato among the
Coast Salish. Southwest J Anthropol 7:272–288
Swan JG (1868) The Indians of Cape Flattery at the entrance to
the Strait of Juan de Fuca, Washington Territory. Smith-
sonian Institution ‘‘Contributions to Knowledge,’’ Fac-
simile Reproduction, 1964, 108 pp
Turner NJ (1975) Food plants of British Columbia Indians, Part
1, coastal peoples. British Columbia Provincial Museum
Handbook, No. 34. British Columbia Provincial Museum,
Victoria
Turner NJ (1995) Food plants of coastal first peoples. Royal
British Columbia Museum Handbook series. UBC Press
Veilleux RE, Shen LY, Paz MM (1995) Analysis of the genetic
composition of anther-derived potato by randomly
amplified polymorphic DNA and simple sequence repeats.
Genome 38:1153–1162
Wagner HR (1933) Spanish explorations in the Strait of Juan
de Fuca. Fine Arts Press, Santa Ana, CA
Westman AL, Kresovich S (1998) The potential of cross-taxa
simple-sequence repeat (SSR) amplification between
Arabidopsis thaliana L. and crop brassicas. Theor Appl
Genet 96:272–281
Zane L, Bargelloni L, Patarnello T (2002) Strategies for
microsatellite isolation: a review. Mol Ecol 11(1):1–16
Euphytica
123
