A Perfect Marker for Fragrance Genotyping in Rice

Abstract

Allele specific amplification (ASA) is a low-cost, robust technique that can be utilised to discriminate between alleles that
differ by SNP's, insertions or deletions, within a single PCR tube. Fragrance in rice, a recessive trait, has been shown to
be due to an eightbp deletion and three SNP's in a gene on chromosome 8 which encodes a putative betaine aldehyde dehydrogenase
2 (BAD2). Here we report a single tube ASA assay which allows discrimination between fragrant and non-fragrant rice varieties
and identifies homozygous fragrant, homozygous non-fragrant and heterozygous non-fragrant individuals in a population segregating
for fragrance. External primers generate a fragment of approximately 580bp as a positive control for each sample. Internal
and corresponding external primers produce a 355bp fragment from a non-fragrant allele and a 257bp fragment from a fragrant
allele, allowing simple analysis on agarose gels.

Full text

-1
A perfect marker for fragrance genotyping in rice
Louis M. T. Bradbury
1,2
, Robert J. Henry
1,2,
*, Qingsheng Jin
1,3
, Russell F. Reinke
4
and Daniel L. E. Waters
1
1
Centre for Plant Conservation Genetics, Southern Cross University, Lismore, NSW 2480 Australia;
2
Grain
Foods CRC, Southern Cross University, Lismore, NSW 2480 Australia;
3
Crop Research Institute, Zhejiang
Academy of Agricultural Sci ences, Hangzhou, China;
4
Yanco Agricultural Institute, Yanco, NSW, 2703,
Australia; *Author forCorrespondence (e-mail: rhenry@scu.edu.au; phone: +61-2-66203010)
Received 22 April 2005; accepted in revised form 6 July 2005
Key words: Aromatic, Assay, Basmati, High-throughput, Jasmine, Oryza sativa
Abstract
Allele sp ecific amplification (ASA) is a low-cost, robust technique that can be utilised to discriminate
between alleles that differ by SNP’s, insertions or deletions, within a single PCR tube. Fragrance in rice, a
recessive trait, has been shown to be due to an eight bp deletion and three SNP’s in a gene on chromosome
8 which encodes a putative betaine aldehyde dehydrogenase 2 (BAD2). Here we report a single tube ASA
assay which allows discrimination between fragrant and non-fragrant rice varieties and identifies homo-
zygous fragrant, homozygous non-fragrant and heterozygous non-fragrant individuals in a population
segregating for fragrance. External primers generate a fragment of approximately 580 bp as a positive
control for each sample. Internal and corres ponding external primers produce a 355 bp fragment from a
non-fragrant allele and a 257 bp fragment from a fragrant allele, allowing simple analysis on agarose gels.
Abbreviations: 2AP – 2-Acetyl-1-pyrroline; ASA – Allele specific amplification; BAD2 – Betaine aldehyde
dehydrogenase 2; SNP – Single nucleotide polymorphism
Introduction
The demand for fragrant rice has increased
markedly in recent years in both traditional and
non-traditional rice growing countries to such an
extent that consumers are willing to pay a pre-
mium price for fragrant rices. In order to assist in
the development of fragrant rice varieties suited to
particular local environmental conditions, rice
breeders have an interest in gaining access to a
simple and inexpensive method for distinguishing
between fragrant and non-fragrant rice.
The flavo ur and fragrance of Basmati and Jas-
mine style rice have been associated with increased
levels of 2-acetyl-1-pyrroline (2AP) (Buttery et al.
1983; Lorieux et al. 1996; Widjaja et al. 1996;
Yoshihashi (2002). A number of sensory methods
have been utilised to assist breeders in selecting
fragrant rice but there are limitations when pro-
cessing large numbers of samples. For example,
tasting individual grains is one of the original
methods for the quality selection of fragrant rice
varieties within the Australian breeding program
(Reinke et al. 1991) and is still the principal means
of identifying fragrance in many breeding pro-
grams worldwide. However, the objective evalua-
tion of fragrance using this method is labour
intensive, difficult and unreliable. A panel of
Molecular Breeding (2005) 16: 279–283 Ó Springer 2005
DOI 10.1007/s11032-005-0776-y

analysts is required as the ability to detect fra-
grance varies between individuals. For any indi-
vidual analyst, the ability to distinguish between
fragrant and non-fragrant samples diminishes with
each successive analysis because the senses become
saturated or physical damage occurs from abra-
sions to the tongue which often result from
chewing the hard grain. Chemical methods are
available which involve smelling leaf tissue or
grains after heating in water or reacting with
solutions of KOH or I
2
-KI (Sood 1978) but these
can cause damage to the nasal passages. An
objective method of 2AP identification using gas
chromatography is available but the assay requires
large tissue samples and is time consuming
(Lorieux et al. 1996; Widjaja et al. 1996).
More recently molecular markers, such as SNPs
and simple sequence repeats (SSRs), which are
genetically linked to fragrance and have the
advantage of being inexpensive, simple, rapid and
only requiring small amounts of tissue, have been
developed for the selection of fragrant rice
(Cordeiro et al. 2002). However, these markers are
only linked with the fragrance gene and therefore
do not allow prediction of the fragrant status of
any one rice sample with 100% accuracy.
Recently, an eight base pair deletion and three
SNPs in exon 7 of the gene encoding betaine
aldehyde dehydrogenase 2 (BAD2) on chromo-
some 8 of Oryza sativa was identified as the likely
cause of fragrance in Jasmine and Basmati style
rice (Bradbury et al. 2005). Non-fragrant rice
varieties possess what appears to be a fully func-
tional copy of the gene encoding BAD2 while
fragrant varieties possess a copy of the gene
encoding BAD2 which contains the deletion and
SNPs, resulting in a frame shift that generates a
premature stop codon that presumably disables
the BAD2 enzyme. This polymorphism provides
an opportunity for the construction of a perfect
marker for fragrance in rice. We report here
the construction of a PCR assay for fragrance
genotyping in rice.
Materials and methods
Plant materials
All rice samples were supplied by Yanco Agricul-
tural Institute, NSW Agriculture. A diverse
collection of 14 fragrant and 74 non-fragrant
varieties (Bradbury et al. 2005) in addition to a
population of 168 field grown F
2
individuals
derived from a cross between Kyeema (Pelde//
Della/Kulu) (tall, Jasmi ne-style, long-grain, Aus-
tralian cultivar) and Gulfmont (Lebonnet//
CI9881/PI 331581) (early-m aturing, semi-dwarf,
non-aromatic long-grain USA cultivar) was used
to validate the marker.
Genetic mapping
Fragrance was evaluated acco rding to Berner and
Hoff (1986). The phenotype of F
2
individuals were
classified as fragrant, segreg ating or non-fragrant
by tasting dehulled F
3
seed. At least 12 F
3
seeds
from individual F
2
plants were chewed individu-
ally. F
2
plants were rated homozygo us fragrant or
non-fragrant if all 12 F
3
seeds were fragrant or
non-fragrant, respectively. F
3
seeds from hetero-
zygous F
2
plants were expected to contain both
fragrant and non-fr agrant seeds, therefore if the
sample from a single F
2
plant was a mixture of
fragrant and non-fragrant, the F
2
plant was con-
sidered heterozygous. The observed segregation
ratio of fragrant:segregating:non-fragrant was
tested by v
2
analysis against the expected ratio for
a single gene.
Primer design
Oligonucleotide prim ers were designed, using Pri-
mer Premier Version 5.0 (Premier Biosoft Inter-
national, Palo Alto, CA). For non-fragrant
varieties the sequence of the gene encoding BAD2
was obtained from the NCBI web site
(www.ncbi.nlm.nih.gov) Gen Bank accession
number – AP004463 and for fragrant varieties the
sequence of the gene encoding BAD2 reported by
Bradbury et al. (2005) was used.
DNA extraction, PCR and genotyping
Genomic DNA was extracted from leaf material
using a Qiagen DNeasy
Ò
96 Plant Kit (Qiagen
GMbH, Germany) and from whole seeds as de-
scribed by Bergman et al. (2001). Rough leaf DNA
extractions were performed by boiling 0.1 g of leaf
280

material in 50 ll 10X PCR Buffer (Gibco BRLÒ)
for 10 min. Oligonucleotide primers were syn-
thesised by Proligo Australia Pty Ltd. PCR was
performed using 0.2 ll PlatinumÒ Taq DNA
Polymerase (Gibco BRLÒ), 1 ll of genomic DNA
10 ng ll
1
, 2.5 ll of 10X buffer (Gibco BRLÒ),
1 ll of 50 mM MgCl
2
(Gibco BRLÒ), 1 llof
dNTPs [5 mM], 2.5 ll of each primer (ESP, IFAP,
INSP and EAP – Table 1) [2 lM], in a total vol-
ume of 25 ll. PCR was performed using a Perkin
Elmer, Gene Amp PCR system 9700. Cycling
conditions were an initial denaturation of 94°C for
2 min followed by 30 cycles of 5 s at 94° C, 5 s at
58°C, 5 s at 72°C; concluding with a final extension
of 72°C for 5 min.
PCR products were analysed by electrophoresis
in ethidium bromide stained (0.5 ug ml
1
) 1.0%
agarose gels. A 100 bp ladder molecular weight
standard (Roche) was used to estimate PCR
fragment size.
Results
Development of the single tube Allele Specific PCR
fragrance assay
Four primers, two that anneal to sequences com-
mon to both fragrant and non-fragrant varieties
and external to the area where the mutat ion occurs
and two that are specific to one of the two possible
alleles were designed and synthesised (Figure 1).
The two external primers were designed to act as
an internal positive control amplifying a region of
approximately 580 bp in both fragrant (577 bp)
and non-fragrant (585 bp) genotypes. Individu-
ally, these external primers also pair with internal
primers to give products of varying size, depending
upon the genotype of the DNA sample. The
internal primers, IFAP and INSP (Table 1), will
anneal only to their specified genotype producing
DNA fragments with their corresponding external
primer pair, ESP and EAP respectively. Using
these four primers in a PCR results in three pos-
sible outcomes. In all cases a positive control band
of approximately 580 bp is produced. In the first
case a band of 355 bp is produced indicating a
variety or individual is homozygous non-fragrant.
In the second case a band of 257 bp is produced
indicating a variety or individual is homozygous
fragrant. In the third case both band s of sizes
355 bp and 257 bp are produced indicating an
individual is heterozygous non-fragrant.
Determination of plant genotype using single tube
ASA PCR fragrance assay
PCR products were easily separated on an agarose
gel. The PCR product of approximately 580 bp
serves as a positive control and is present in every
Table 1. Primers for analysis of fragrance in rice.
Primer name Primer sequence
External Sense Primer (ESP) TTGTTTGGAGCTTGCTGATG
Internal Fragrant Antisense Primer (IFAP) CATAGGAGCAGCTGAAATATATACC
Internal Non-fragrant Sense Primer (INSP) CTGGTAAAAAGATTATGGCTTCA
External Antisense Primer (EAP) AGTGCTTTACAAAGTCCCGC
Figure 1. Relative positions of PCR primers used in fragrance PCR.
281

sample. Fragrant individuals have a second prod-
uct of 257 bp in size while non-fragrant individuals
give a product of 355 bp in size, heterozygotes can
also be discriminated by the presence of all three
PCR products (Figure 2).
The assay predicted the phenotype of 168 F
2
progeny segregating for fragrance with 100%
accuracy (46 homozygous fragrant, 80 heterozyg-
otes, 42 homozygous non-fragrant) (Figure 3).
The assay also allows discrimination between
fragrant and non-fragrant grains using DNA
derived from rice grains using a simple NaOH
extraction protocol (Bergman et al. 2001) and
leaves using a simple 10 min boiling protocol.
Further evaluation demonstrated the capacity of
the assay to work on a broard range of fragran t
varieties such as Basmati 370, Kyeema, Khao
Dwak Mali 105 and Moosa Tarom (results not
shown).
Discussion
Fragrance in Basmati and Jasmi ne style rice is a
recessive trait (Lorieux et al. 1996) which results
principally from the presence of elevated levels of
the compound 2-acetyl-1-pyrroline (2AP) in the
aerial parts of the plant. A deletion in the gene
encoding BAD2 on chromosome 8 which disables
the BAD2 enzyme is the most likely cause of fra-
grance (Bradbury et al. 2005). Functional BAD2 is
either responsible for metabolising 2AP which
means the presence of the non-functional enzyme
results in accumulation of 2AP and hence fra-
grance, or functional BAD2 is active in a pathway
that competes for substrate which would otherwise
be used in the production of 2AP and so a non-
functional BAD2 enzyme resul ts in increased flux
of substrate down the pathway of 2AP production.
Knowledge of the most likely genetic cause of
fragrance has allowed us to develop a perfect assay
for fragrance in rice. A single tube allele specific
PCR which allows determination of the genotypic
status of an individual rice plant, either homozy-
gous fragrant, homozygous non-fragrant or het-
erozygous non-fragrant, has practical utility for
rice breeders worl dwide. The assay is a simple
robust method for screening rice to determine its
fragrance status across a wide range of rice varie-
ties and within segregating populations using
DNA isolated from rice following simple, inex-
pensive and rapid extraction protocols.
The PCR products can be analysed easily and
inexpensively on agarose gel or alternatively using
more sophisticated high throughput equipment,
making the assay a very versatile tool.
Acknowledgements
Thanks are due to Yanco Agricultural Institute,
NSW Agriculture, for supp lying the mapping
population used in this study.
Figure 2. Agarose gel showing (lane 2–5) a non-fragrant variety
(Nipponbare), a fragrant variety (Kyeema), a heterozygous
individual (Kyeema/Gulfmont) and a negative control (water)
flanked by Roche DNA Ladder XIV (100 bp).
Figure 3. Agarose gel showing 96 individuals from an unse-
lected F2 population segregating for fragrance and analysed
using single tube ASA. The band of approximately 580 bp
corresponds to the positive control amplified by both external
primers (ESP and EAP). The 355 bp band corresponds to a
PCR product amplified from the non-fragrant allele by the
internal non-fragrant sense primer (INSP) and the external
antisense primer (EAP). The 257 bp band corresponds to a
PCR product amplified from the fragrant allele by the internal
fragrant antisense primer (IFAP) and the external sense primer
(ESP).
282

References
Bergman C.J., Delgado J.T., McClung A.M. and Fjellstrom
R.G. 2001. An improved method for using a microsatellite in
the rice waxy gene to determine amylose class. Cereal Chem.
78: 257–260.
Berner D.K. and Hoff B.J. 1986. Inheritance of scent in
American long grain rice. Crop Sci. 26: 876–878.
Bradbury L.M.T., Fitzgerald T.L., Henry R.J., Jin Q. and
Waters D.L.E. 2005. The gene for fragrance in rice. Plant
Biotech. J. 3: 363–370.
Buttery R.G., Ling L.C., Juliano B.O. and Turnbaugh J.G.
1983. Cooked Rice aroma and 2-acetyl-1-pyrroline. J. Agric.
Food Chem. 31: 823–826.
Cordeiro G.M., Christopher M.J., Henry R.J. and Reinke R.F.
2002. Identification of microsatellite markers for fragrance in
rice by analysis of the rice genome sequence. Mol. Breed. 9:
245–250.
Lorieux M., Petrov M., Huang N., Guiderdoni E. and
Ghesquiere A. 1996. Aroma in rice: Genetic analysis of a
quantitative trait. Theor. Appl. Genet. 93: 1145–1151.
Reinke R.F., Welsh L.A., Reece J.E., Lewin L.G. and Blakeney
A.B. 1991. Procedures for quality selection of aromatic rice
varieties. Int. Rice Res. Newslett. 16: 10–11.
Sood B.C. and Sidiq E.A. 1978. A rapid technique for scent
determination in rice. Indian J. Genetic Plant Breed. 38: 268–
271.
Widjaja R., Craske J.D. and Wootton M. 1996. Comparative
studies on volatile components of non-fragrant and fragrant
rices. J. Sci. Food Agric. 70: 151–161.
Yoshihashi T. 2002. Quantitative analysis on 2-acetyl-1-pyrro-
line of an aromatic rice by stable isotope dilution method and
model studies on its formation during cooking. J. Food Sci.
67: 619–622.
283