Content uploaded by Fábio Porto-Foresti
Author content
All content in this area was uploaded by Fábio Porto-Foresti
Content may be subject to copyright.
Content uploaded by Fábio Porto-Foresti
Author content
All content in this area was uploaded by Fábio Porto-Foresti
Content may be subject to copyright.
TECHNICAL NOTE
Genetic identification of lamniform and carcharhiniform sharks
using multiplex-PCR
F. F. Mendonc¸a
•
D. T. Hashimoto
•
B. De-Franco
•
F. Porto-Foresti
•
O. B. F. Gadig
•
C. Oliveira
•
F. Foresti
Received: 13 October 2009 / Accepted: 18 October 2009 / Published online: 2 November 2009
Ó Springer Science+Business Media B.V. 2009
Abstract Nowadays, because of the constant increase in
the capture and trade of sharks all over the world and
reports of several species already showing important signs
of over-exploitation, the establishment of registration
mechanisms, evaluation and fishery control become urgent.
Morphological identification of captured sharks is very
difficult, and sometimes impossible, due to the removal of
the animals’ parts. At this point, techniques of genetic
identification through the molecular markers are consid-
ered essential tools for fishery monitoring. In this study, we
present a method of multiplex-PCR, based on the gene
Cytochrome Oxidase I, with species-specific primers
developed for simultaneous identification of nine species of
lamniform and carcharhiniform sharks, some of which are
worldwide distributed.
Keywords Sharks identification Trade monitoring
Molecular markers Cytochrome oxidase I
Multiplex-PCR
Introduction
Historically, the consumption of shark meat was kept
almost restricted to the riverine populations until some
decades ago. However, with the reduction of the traditional
fishery stocks, this resource became more diffuse and
appreciated. The great demand for shark fins by the Asian
kitchen is the most important reason for the depletion of
these animal populations on a large scale. Over the last two
decades, there has been an increasing concern about the
vulnerability of the sharks to fishery exploitation (Camhi
et al. 1998; Castro et al. 1999), as well as about the doc-
umentation of finning (removal of sharks fins and the dis-
card of the carcass at sea). These facts have contributed to
the development of several studies in order to provide a
more adequate management of the shark fishery in many
parts of the world, where it has reached unbearable levels,
causing several species to vanish (Camhi 1999).
Considering that each species responds independently to
environmental pressures, it is essential to know in a more
refined way, the composition of shark captures per species
and their relative abundance, in order to establish recovery
plans for these populations and the consequent ordering of
these activities (Lessa et al. 1999). However, one of the
main obstacles in obtaining data about the capture and
trade of sharks is the difficulty in identifying many species
by using the traditional taxonomic tools (Stevens 2004),
since morphological and meristic criteria are lost during the
carcass processing (from which the head and fins are
removed) or due to the low practicability in field studies
that demand fast morphological identification of numerous
samples. Moreover, economically important sharks in some
particular species of the families Lamnidae and Carcha-
rhinidae can exhibit a conservative external morphology,
without clear differences, resulting in great difficulty in
F. F. Mendonc¸a (&) B. De-Franco C. Oliveira F. Foresti
Laborato
´
rio de Biologia e Gene
´
tica de Peixes, Departamento
de Morfologia, Instituto de Biocie
ˆ
ncias de Botucatu,
Universidade Estadual Paulista—UNESP, Distrito de Rubia
˜
o
Ju
´
nior, s/n, Botucatu, SP CEP 18618-000, Brazil
e-mail: fernandofm@ibb.unesp.br; fernandoffm@yahoo.com.br
D. T. Hashimoto F. Porto-Foresti
Laborato
´
rio de Gene
´
tica de Peixes, Departamento de Biologia,
Faculdade de Cie
ˆ
ncias, Universidade Estadual
Paulista—UNESP, Bauru, SP CEP 17033-360, Brazil
O. B. F. Gadig
Campus Experimental do Litoral Paulista, Universidade Estadual
Paulista—UNESP, Pc¸a. Infante Dom Henrique, s/n, Sa
˜
o Vicente,
SP CEP 11330-900, Brazil
123
Conservation Genet Resour (2010) 2:31–35
DOI 10.1007/s12686-009-9131-7
identifying the species correctly (Bonfil 1994; Castro et al.
1999). In order to put the actions of conservation and
management of sharks in practice, there is an urgent need
to minimize these problems.
For more than 30 years, several different molecular
markers have been used with taxonomical purpose among
the numerous organisms groups (Ward et al. 2005). In
relation to sharks, for instance, the available molecular
markers for species identification developed by Pank et al.
(2001), Shivji et al. (2002), Chapman et al. (2003), Nielsen
(2004), Abercrombie et al. (2005) use the differences
among the nucleotide bases of the ITS2 spacer of ribo-
somal genes. Yet, Blanco et al. (2008) use sequences of the
Cytochrome b gene. Considering the large range of dif-
ferent techniques that can be used for species identification,
exploiting several genomic regions, Hebert et al. (2003)
suggested that a single genetic sequence would be enough
to differentiate all, or at least most of the animal species
and proposed the utilization of mitochondrial DNA Cyto-
chrome Oxidase subunit I (COI) for a global bioidentifi-
cation system for animals, and the consequent description
of each species in a barcode sequence.
Also seeking the unification of a world information
system dedicated to the genetic taxonomic identification,
the present study describes a methodological resource to
characterize nine species of Lamniform and Carcharhini-
form sharks, usually exploited by commercial fishery,
developed from the exclusive characteristics of each spe-
cies and expressed in the COI gene sequences.
Materials and methods
Sample characterization
Among the species for which the genetic identification
methods were developed, three belong to Lamniformes
(Alopias superciliosus, Alopias vulpinus, and Isurus oxy-
rinchus) and six belong to Carcharhiniformes (Prionace
glauca, Galeocerdo cuvier, Carcharhinus falciformis,
Rhizoprionodon lalandii, Rhizoprionodon porosus, and
Sphyrna lewini). Other 16 shark species: Isistius brasili-
ensis, Squatina argentina, Squatina guggenheim, Gingly-
mostoma cirratum, Lamna nasus, Galeorhinus galeus,
Mustelus higmani, Mustelus schmitti, Schroederichthys sp.,
Scyliorhinus sp., Carcharhinus acronotus, Carcharhinus
leucas, Carcharhinus obscurus, Carcharhinus plumbeus,
Carcharhinus porosus, and Sphyrna tudes were jointly
analyzed for the nucleotide diversity evaluation among the
species, verification of false positive in multiplex-PCR, and
later generation of new identification primers.
The shark samples were obtained from fishery unloading
along the Brazilian coast. The lamniform were captured in
the Southeastern coast of Brazil, in a region close to the
State of Sa
˜
o Paulo. Among the carcharhiniform, we
obtained specimens of P. glauca and G. cuvier from the
Southeastern and Northeastern coast. The samples of the
C. falciformes species are from the Northern coast and
the specimens of R. lalandii, R. porosus and S. lewini were
captured in a vast area including the Southern, Southeastern
and Northeastern coast of Brazil. The samples of the other
16 species were obtained in the Brazilian Southeastern
region, except the species G. cirratum and M. higmani that
are from the Northeastern region and the specimens of
C. porosus, from the Northern region. The sharks were
identified according to Gadig (2001). The Carcharhinus
genus was additionally identified based on Garrick (1982).
After the taxonomic identification, tissue samples were
collected for molecular analyses.
DNA extraction, amplification through PCR
and sequencing
The genomic DNA was extracted from epithelial cells, using
the saline extraction method described by Aljanabi and
Martinez (1997). Amplification reactions of the Cytochrome
Oxidase gene subunit I (COI) were carried out in PCR
thermal cycler using 25 ll of solution 0.8 mM of dNTP,
1.5 mM of MgCl2, enzyme buffer Taq DNA polymerase
(Tris–HCl 20 mM pH 8.4 and KCl 50 mM), 1 unit of
enzyme Taq Polymerase (Invitrogen) and 0.5 mM ng of
primers, using the primers F1 5
0
- TCA ACC AAC CAC
AAA GAC ATT GGC AC -3
0
and R1 5
0
- TAG ACT TCT
GGG TGG CCA AAG AAT CA -3
0
, described by Ward et al.
(2005). Each amplification cycle through PCR was basically
formed by denaturation at 95°C for 30 s, hybridization at
50°C for 30 s and extension at 68°C for 2 min, with 35
repetitions. The amplified DNA segments were visualized
on agarose gel at 2%, stained with ethidium bromide, under
ultraviolet light.
The sequences of the COI gene were obtained using ABI
Prism 377 (Perking-Elmer) with the kit DYEnamicTM ET
Terminator Cycle Sequencing (Amersham Biosciences),
and were then manually analyzed and lined using the
program CLUSTAW—Macvector 65 (1998) for identifi-
cation of polymorphic sites among the species.
Multiplex-PCR
From the nucleotide composition of the COI gene, whose
characteristics were exclusive, the polymorphic sites
among the species were identified, and the species- specific
primers designed thereafter. The amplification reactions
were carried out including the F1 primer (Forward) used as
positive control for the reaction, the R1 primer (Reverse),
all the 9 species-specific primers for identification and, in
32 Conservation Genet Resour (2010) 2:31–35
123
each reaction tube, the DNA of one of the species. Besides
the samples of the 9 species that had primers of identifi-
cation developed, PCR reactions were carried out under the
same conditions for the other 16 species of shark, in order
to detect other possible false positive. All the reactions
were carried out using PCR thermal cycler in 25 llof
solution with 0.8 mM of dNTP, 1.5 mM of MgCl2,
enzyme buffer Taq DNA polymerase (Tris–HCl 20 mM
pH 8.4 and KCl 50 mM), 1 unit of enzyme Taq Polymerase
(Invitrogen) and 0.5 mM of each primer. Each amplifica-
tion cycle through PCR was basically formed by denatur-
ation at 95°C for 30 s, hybridization at 50°C for 30 s and
extension at 68°C for 2 min, with 35 repetitions. The
primers developed for each species, the number of ana-
lyzed samples and the estimated size of the amplified DNA
segments are presented in Table 1.
Results
From the identification of 590 nucleotide bases of the gene
COI of the 25 shark species possible to be analyzed, we
observed an average nucleotide divergence of 17.8%.
Among the lamniform shark species, the nucleotide
divergence was as high as 17.4%, and the divergence
among the species of Alopias, 12.1%. Among all the car-
charhiniform species, the genetic divergence was estimated
at 10.8%. The nucleotide difference among the species of
Carcharhinus was 5.1%, whereas among the species of
Rhizoprionodon it was 3.2%.
The species-specific primers were gradually placed
along the sequences of the Cytochrome Oxidase I gene.
Thus, in the PCR reactions each synthesized primer gen-
erates a fragment of a distinct size, presenting diagnostic
bands for each species after electrophoresis. This reaction
containing also the primer COI F1 yielded a 650 bp sec-
ondary band that was used as a reaction positive control.
During the tests we confirmed the efficiency of the primers
in individual reactions including only the specific primer
for a single species, the primers F1 and R1 and the DNA of
the target species. In these reactions, we observed the
amplification of the diagnostic size fragment and the
positive control fragment for the reaction in all the ana-
lyzed samples showing high functionality. In the multiplex-
PCR reactions including all the nine identification primers
species-specific, besides the primers F1 and R1 and the
DNA of only one of each species, we observed a high
stringency reaction for all the 406 shark samples presented
in Table 1. The amplified diagnostic fragments for each
species were used for reaction control (Fig. 1). During the
multiplex-PCR analyses, in order to evaluate the possible
occurrence of false positives using the samples from the
other 16 shark species, only the amplification of the posi-
tive control bands occurred, confirming the primers
specificity.
Discussion
Even though the numbers of species that can be identified
using multiplex-PCR presented in this work is discreet, the
studied species correspond to an extremely exploited group
and represent a great portion of the world captures. From
the commercial point of view, lamniform and carcharhin-
iform sharks are very important. The first represent an
important percentage of the captures of large epipelagic
oceanic sharks in the world and also in Brazil where,
mainly Isurus oxyrinchus stand out among the species
captured by the longline fleet, jumping from 13 tons in
1975, to 138 tons in 1990, based on the boats operating in
the Southeast and South of Brazil (Costa et al. 1996).
Among the carcharhiniform, the families Carcharhinidae
and Sphyrnidae are commercially the most important, with
emphasis on Prionace glauca (Carcharhinidae), which is
the most captured shark species by the longline fleet in
these environments, chiefly in Brazil (Hazin and Lessa
Table 1 Developed primers,
size of the bands generated on
agarose, number of samples per
species (n) and COI GenBank
access numbers
Size of the amplified fragments
in base pairs (bp)
Species Primers Fragment (bp) n GenBank
Lamniform
Isurus oxyrinchus CTTCCACTTGGCTGGGTATCTCG 280 30 FJ895090
Alopias vulpinus CCTCAGCTGGAGTTGAAGCC 410 18 FJ895092
Alopias superciliosus GGTTATACCCGTAATAATTGGG 530 34 FJ895091
Carcharhiniform
Galeocerdo cuvier ACTACATTCTTTGATCCAGCG 50 22 FJ895097
Prionace glauca TCCAGTTCTTGCAGCAGGT 105 80 FJ895098
Carcharhinus falciformis GATCTATTCTTGTAACCACG 145 16 FJ895094
Rhizoprionodon porosus CCCATTAGCTAGTAATA 360 110 FJ895096
Sphyrna lewini GGCCTTCCCACGAATAAAC 480 43 FJ895093
Rhizoprionodon lalandii TCAACCTGGATCTCTTTTAGGT 610 90 FJ895095
Conservation Genet Resour (2010) 2:31–35 33
123
2005), and the small sharks of the genus Rhizoprionodon
that represent more than 50% of the small sharks captured
in the coastal area by the artisanal fleet (Motta et al. 2005).
The hammerhead sharks (Sphyrnidae) are also important
fishery resources in the ocean areas, while large sharks are
target fishery for longliner boats and driftnets (Amorin
et al. 2002), as opposed to fishery in the coastal area,
especially in the Southeast and South of Brazil (Vooren
et al. 2005), where young fish populations are their target.
The efficiency of the COI gene for fish identification has
been strongly supported by several papers (Ward et al.
2005; Hubert et al. 2008; Valdez-Moreno et al. 2009).
Mendonc¸a et al. (2009) analyzed nucleotide sequences of
the same gene in 18 shark species observing a very sig-
nificant divergence, even among species of the same genus,
however, maintaining a strong level of similarity in the
same taxon, where they observed average divergences of
1.2%. The present results agree with those previous studies
showing the existence of high genetic divergence among
shark species, including those from the same genus, but a
high conservation level among individuals of the same
species. The viability of multiplex-PCR application for
identification of shark species with high functionality and
specificity is also supported by the fact that no polymorphic
sign was detected among the binding sites of the species-
specific primers used in this work.
This work makes use of multiplex-PCR techniques
using the COI gene as a safe method to characterize the
global fishery exploitation. Furthermore, considering the
increase in worldwide trade in shark products, low cost
protocols like those developed in the present study also
represent a certification method, adding value to the fish
products.
Acknowledgments The authors thank Fundac¸a
˜
o de Amparo a
`
Pesquisa no Estado de Sa
˜
o Paulo (FAPESP) and Conselho Nacional
de Desenvolvimento Cientı
´
fico e Tecnolo
´
gico (CNPq), for their
financial support.
References
Abercrombie DL, Clarke SC, Shivji M (2005) Global-scale genetic
identification of hammerhead sharks: application to assessment
of the international fin trade and law enforcement. Conservation
Genet Resour 6:775–788
Aljanabi SM, Martinez I (1997) Universal and rapid salt-extraction of
high quality genomic DNA for PCR-based techniques. Nucleic
Acids Res 25:4692–4693
Amorin AF, Arfelli CA, Bacilieri S (2002) Shark data from Santos
longliners fishery off southern Brazil (1971–2000). Collection
Volume Sci Paper ICCAT 54(4):1341–1348
Blanco M, Pe
´
rez-Martı
´
n RI, Sotelo CG (2008) Identification of shark
species in seafood products by forensically informative nucle-
otide sequencing (FINS). J Agric Food Chem 56:9868–9874
Bonfil R (1994) Overview of world elasmobranch fisheries. Fisheries
technical paper 341. Food and Agriculture Organization, Rome
Camhi M (1999) Sharks on the line II: an analysis of Pacific state
shark fisheries. Living oceans program. National Audubon
Society, Islip
Camhi M, Fowler S, Musick J, Fordham FS (1998) Sharks and their
relatives. Occasional Paper of the IUCN Species Survival
Commission 20–39
Castro JI, Woodley CM, Brudek RL (1999) A preliminary evaluation
of the status of shark species. Fisheries technical paper 380
Chapman D, Abercrombie D, Douady C, Pikitch E, Stanhope M,
Shivji M (2003) A streamlined, bi-organelle, multiplex PCR
approach to species identification: application to global conser-
vation and trade monitoring of the great white shark, Carchar-
odon carcharias. Conservation Genet 4:415–425
Costa FES, Braga FMS, Amorim AF, Arfelli CA (1996) Fishery
analysis on Shortfin Mako, Isurus oxyrinchus, off southeast and
south of Brazil (Elasmobranchii: Lamnidae). Arq de Cie
ˆ
ncias do
Mar 30:5–12
Gadig OBF (2001) Tubaro
˜
es da Costa Brasileira. Tese de Doutorado.
Instituto de Biocie
ˆ
ncias, Universidade Estadual Paulista Ju
´
lio de
Mesquita Filho, Sa
˜
o Paulo 343
Garrick JAF (1982) Sharks of the genus Carcharhinus. NOAA
Technical Report, NMFS Circular 445: 194
Hazin FH, Lessa RP (2005) Synopsis of biological information
available on blue shark, Prionace glauca, from the Southwestern
Atlantic ocean. Collection Volume Sci Papers ICCAT 58(3):
1179–1187
Hebert PDN, Cywinska A, Ball SL, Ward JR (2003) Biological
identifications through DNA barcodes. Proc R Soc B 270:313–
322
Hubert N, Hanner R, Holm E, Mandrak NE, Taylor E, Burridge M,
Watkinson D, Dumont P, Curry A, Bentzen P, Zhang J, April J,
Bernatchez L (2008) Identifying Canadian freshwater fishes
through DNA barcodes. Plos One 3(6):2490
Lessa RPT, Santana FM, Rincon G, Gadig OBF, El-Deir ACA (1999)
Biodiversidade de Elasmobra
ˆ
nquios do Brasil. Projeto de
Fig. 1 Band pattern produced by multiplex-PCR reaction using the
nine species-specific identification primers and the universal primers
for the COI gene. The species G. cuvier presents a fragment of 50 bp
(base pairs), P. glauca 105 bp, C. falciformes 145 bp, I. oxyrinchus
280 bp, R. porosus 360 bp, A. vulpinus 410 bp, S. lewini 480 bp,
A. superciliosus 530 bp, R. lalandii 610 bp. The positive control of
the reaction is observed in all the samples with around 700 bp.
M molecular weight marker 50 bp
34 Conservation Genet Resour (2010) 2:31–35
123
Conservac¸a
˜
o e Utilizac¸a
˜
o Sustenta
´
vel da Diversidade Biolo
´
gica
Brasileira (PROBIO), Ministe
´
rio do Meio Ambiente, Brası
´
lia.
154
Mendonc¸a FF, Hashimoto DT, Porto-Foresti F, Oliveira C, Gadig
OBF, Foresti F (2009) Identification of the shark species
Rhizoprionodon lalandii and R. porosus (Elasmobranchii, Car-
charhinidae) by multiplex PCR and PCR-RFLP techniques. Mol
Ecol Resour 9:771–773
Motta FS, Gadig OBF, Namora RC, Braga FMS (2005) Size and sex
compositions, length–weight relationship, and occurrence of the
Brazilian sharpnose shark, Rhizoprionodon lalandii, caught by
artisanal fishery from southeastern Brazil. Fish Res 74:116–126
Nielsen JT (2004) Molecular genetic approaches to species identifi-
cation and delineation in elasmobranchs. M.S. thesis. Nova
Southeastern University Oceanographic Center, Dania Beach,
Florida
Oxford Molecular Group (1998) MacVector 6.5 user guide. Oxford
Molecular, Oxford
Pank M, Stanhope M, Natanson L, Kohler N, Shivji M (2001) Rapid
and simultaneous identification of body parts from the morpho-
logically similar sharks Carcharhinus obscurus and Carcharhinus
plumbeus (Carcharhinidae) using multiplex PCR. Mar Biotechnol
3:231–240
Shivji M, Clarke S, Pank M (2002) Genetic identification of pelagic
shark body party for conservation and trade monitoring.
Conservation Biol 16:1036–1047
Stevens JD (2004) Taxonomy and field techniques for identification:
with listing of available regional guides. In: Musick JA, Bonfil
R. Elasmobranch Fisheries Management Techniques. Asia
Pacific Economic Cooperation, IUCN 370
Valdez-Moreno M, Ivanova NV, Elı
´
as-Gutie
´
rrez M, Contreras-
Balderas S, Hebert PDN (2009) Probing diversity in freshwater
fishes from Mexico and Guatemala with DNA barcodes. J Fish
Biol 74:377–402
Vooren CM, Klippel S, Galina AB (2005) Biologia e status de
conservac¸a
˜
o dos tubaro
˜
es-marelo, Sphyrna lewini e Sphyrna
zygaena. In: Vooren CM, Klippel. Ac¸o
˜
es para conservac¸a
˜
ode
tubaro
˜
es e raias no Sul do Brasil. Editora Igare
´
, Porto Alegre.
262
Ward RD, Zemlak TS, Innes BH, Last PR, Hebert PDN (2005) DNA
barcoding Australia’s fish species. Philos Trans Royal Soc 1–11
Conservation Genet Resour (2010) 2:31–35 35
123
