Content uploaded by Tiiu Kullisaar
Author content
All content in this area was uploaded by Tiiu Kullisaar
Content may be subject to copyright.
Available via license: CC BY-NC-ND 3.0
Content may be subject to copyright.
Central European Journal of Biology
* E-mail: tiiu.kullisaar@ut.ee
Research Article
1
Department of Biochemistry of Faculty of Medicine, Tartu University,
50411 Tartu, Estonia
2
Department of Microbiology of Faculty of Medicine, Tartu University,
50411 Tartu, Estonia
3
Bio-Competence Centre of Healthy Dairy Products,
50411 Tartu, Estonia
4
The Centre of Excellence for Translational Medicine,
50411 Tartu, Estonia
#
Present address:
Biomedicum, Department of Biochemistry,
Faculty of Medicine, Tartu University,
50411 Tartu, Estonia
Tiiu Kullisaar
1,3,4,#,
*, Jelena Shepetova
2
, Kersti Zilmer
1,4
, Epp Songisepp
3
,
Aune Rehema
1,4
, Marika Mikelsaar
2
, Mihkel Zilmer
1,4
An antioxidant probiotic reduces
postprandial lipemia and oxidative stress
1. Introduction
Lactobacillus fermentum LfME-3 has shown an
antiatherogenic potential [1,2], but this has not yet been
proven in postprandial period. The period after a meal
actuates the response of an organism to food. The
fat load of the meal can initiate postprandial lipemia
and deepen oxidative stress, both of which have a
substantial role in the progression of CVD and diabetes.
Many of the possible links between oxidative stress and
the metabolic syndrome occur during the postprandial
period. These include excessive and prolonged
elevation of blood triglyceride levels, impairment of the
endothelial function, an intestinal overproduction of
chylomicrons, a redundant load for insulin production,
the elevation of levels of atherogenic oxidized low-
density lipoprotein and possible disturbances in the
antioxidativity of high-density lipoproteins [3-6]. Thus,
a positive modulation of the postprandial situation,
including oxidative stress, is an important target
for dietary preventive actions. Foods enriched with
antioxidant probiotics may be a promising strategy.
32
Cent. Eur. J. Biol. • 6(1) • 2011 • 32–40
DOI: 10.2478/s11535-010-0103-4
Received 18 May 2010; Accepted 14 September 2010
Keywords: Postprandial period • Oxidative stress • Postprandial lipemic response • Probiotics • Lactobacillus fermentum
• Oxidized low-density lipoprotein • Paraoxonase, isoprostanes
Abstract: Reducing postprandial oxidative stress (OxS), decreasing postprandial blood triglyceride level (TG) and improving lipoprotein
status is likely to have a preventive impact on the development of cardiovascular disease (CVD). Previously we have shown that
the antioxidant probiotic Lactobacillus fermentum ME-3 (DSM14241) is characterized by antiatherogenic effects. This randomized
double-blind placebo-controlled study evaluated the inuence of ker enriched with an antioxidative probiotic L. fermentum ME-3
(LfKef) on postprandial OxS, blood TG response and lipoprotein status. 100 clinically healthy subjects were recruited into the study.
Blood parameters of postprandial OxS, TG and lipoprotein status were determined by oxidized LDL, baseline diene conjugation
in LDL (BDC-LDL), oxidized LDL complex with beta-2 glycoprotein (Beta2-GPI-oxLDL), paraoxonase (PON) activity, LDL-Chol,
HDL-Chol and TG. To evaluate general body postprandial OxS-load we measured 8-isoprostanes (8-EPI) in the urine. Consumption
of LfKef signicantly reduced the postprandial level of oxidized LDL, BDC-LDL, Beta2-GPI-oxLDL, urinary 8-isoprostanes and
postprandial TG and caused a signicant increase in HDL-Chol and PON activity. This is the rst evidence that ker enriched with
an antioxidant probiotic may have a positive effect on both postprandial OxS and TG response as well as on lipoprotein status.
© Versita Sp. z o.o.
T. Kullisaar
et al.
Probiotics are dened as live microbial food ingredients
benecial to health [7]. Their benets include improved
intestinal microbial balance, reduced gut inammation,
alleviation of lactose intolerance symptoms and
prevention of food allergy [8]. However, investigations
of their impact on postprandial responses are absent.
A few lactobacilli strains have shown physiologically
relevant antioxidative potency. One of these strains is
Lactobacillus fermentum ME-3 (LfME-3; DSM14241,
now patented in the USA, Russia, Estonia and European
Union). It is of human origin [9] and a safety-proven
probiotic exhibiting both antimicrobial and antioxidative
benets under different in vitro and in vivo conditions
[10-12] and having a history of safe use in foodstuffs,
especially in ker, in Finland and the Baltic countries.
Encouraged by the results of our previous trials with
LfME-3 [1,2,10,11,13-16] we aimed to carry out a study
to evaluate the effects of ker enriched with probiotic
L. fermentum ME-3 on postprandial oxidative stress,
postprandial lipemic response and blood lipoprotein
status when added to an ordinary diet.
2. Experimental Procedures
2.1 Subjects and study design
One hundred clinically healthy volunteers (75 females,
25 males, age 40-65 years) with mean BMI 30±5 kg/m
2
were recruited into a double-blind placebo-controlled
randomized study. Exclusion criteria were as follows: an
ongoing acute infection; diabetes; history of food allergy
or gastrointestinal disease; use of any antimicrobial
agent within the preceding month or use of any regular
concomitant medication including non-steroidal anti-
inammatory drugs, statins or hormonal contraception;
pregnancy or breastfeeding; alcohol abuse; use of
drugs; special diets; smoking. During the intervention,
and for two weeks beforehand, participants were asked
to avoid vitamin or mineral supplementation, changes in
accustomed diet habits and everyday physical activity,
and use of probiotic-based foods or other kers/yogurts.
The participants were randomly divided into two groups
(each of 50 participants). Unfortunately because of
personal reasons and an epidemic of inuenza, 25
participants of the control group and 2 participants in
the study group did not nish the trial. Of those who
completed the experiment, there were in the control
group 18 women and 7 men with mean BMI 28±2 kg/m
2
and mean age 55±2 years; in the study group 34 women
and 14 men with mean BMI 27±2 kg/m
2
, and mean age
55±3 years.
All participants signed their written informed consent
and had the option of withdrawing from the study at any
time. The Ethics Review Committee (ERC) on Human
Research of the University of Tartu approved the study
protocol. This study was carried out in accordance
with the Declaration of Helsinki of the World Medical
Association.
The LfKef (containing the probiotic) and Ckef
(the ker without a probiotic additive) were identical
nutrient composition (including fat content, 2.5%),
color, taste, and caloric value and were produced by
the Tere Dairy Ltd (Tallinn, Estonia). After two weeks’
introductory period, baseline standard fasting blood
(from the antecubital vein) and urine samples were
obtained. Postprandial blood and urine samples
were obtained 2.5 h after consuming a standard
breakfast (Table 1), which was the maximum point of
the postprandial response according to our previous
experiments). Samples were kept at -80°C until
analyzed. Participants were then randomly assigned
into two groups to receive 200 ml of either the LfKef
or Ckef daily for two weeks. After the two-week
intervention period, postprandial (2.5 h after standard
meal) blood and urine samples were obtained as well
as fecal samples of that day, again after an identical
standard breakfast.
The viability of LfME-3 in the LfKef was analyzed
before the delivery to the study participants. Decimal
dilutions of the ker were seeded on the MRS (Oxoid Ltd.
Basingstoke, UK) agar medium and incubated for 48 h
at 37
o
C in micro aerobic (CO
2
/O
2
/N
2
: 10/5/85) conditions
(incubator IG 150, Jouan, France). The probiotic strain
was identied as described previously [1,9,11]. The viable
count of LfME-3 in the LfKef was stable in all purchased
lots (viable counts 2x10
8
CFU/g ker).
Cheeseburger Ker
Per
portion
GDA*
%
Per
100 ml
GDA
%
Carbohydrates (g) 30 11 4.0 3
Sugar (g) 7 7 4.0 8.9
Total dietary ber (g) 2 8 - -
Protein (g) 27 36 2.9 11.6
Fat (g) 23 34 2,5 7.1
Saturated fat (g) 11 50 1.4 13.5
Energy content (kcal) 435 22 50 5
NaCl (g) 2.3 46 0.05 4.2
Table 1. Nutrient composition of a cheeseburger and ker
(http://www.mcdonaldsmenu.info; http://www.tere.eu ).
GDA (Guideline Daily Amount) suggested by CIAA, http://gda.ciaa.be/asp3/index.asp)
33
An antioxidant probiotic reduces postprandial lipemia and oxidative stress
2.2 Common biochemical analysis
The measurements of HDL-Chol, LDL-Chol and TG
were performed using a routine clinical laboratory
analysis (enzymatic colorimetric methods on an
automatic analyzer).
2.3 Serum level of baseline diene conjugates
of low-density lipoprotein (BDC-LDL)
The serum level of BDC-LDL was measured
by
determining the level of LDL diene conjugation using a
method that has been recently validated and reported
in detail [17]. In brief, serum LDL was isolated by
precipitation with buffered
heparin-citrate. The amount
of peroxidized lipids in samples was determined
by the
degree of conjugated diene double bonds. Lipids were
extracted
from the samples by a mixture of chloroform
and methanol (2:1),
dried under nitrogen, redissolved
in cyclohexane, and analyzed
spectrophotometrically at
234 nm. For BDC-LDL, the coefcient of variance for
within-assay and between-assay precision was 4.4%
and 4.5%, respectively.
2.4 Plasma level of oxidized low-density
lipoprotein (oxLDL)
The plasma level of oxLDL was measured using an
ELISA kit (Mercodia AB, Uppsala Sweden; Cat No
10-1143-01). Mercodia Oxidized LDL ELISA is a solid
phase two-site enzyme immunoassay, based on direct
sandwich technique in which two monoclonal antibodies
are directed against separate antigenic determinants
on the oxidized apolipoprotein B molecule. During
incubation and a simple washing step that removes non-
reactive plasma components, a peroxidase conjugated
anti-apolipoprotein B antibody recognizes the oxLDL
bound to the solid phase. After a second incubation and
simple washing step that removes unbound enzyme-
labeled antibody, the bound conjugate is detected
by reaction with 3,3´,5,5´-tetramethylbenzidine.
The reaction is stopped by adding an acid to give a
colorimetric endpoint that is read spectrophotometrically
at 450 nm by a photometer. We used the Sunrise
photometer (Tecan Austria GmbH, Salzburg, Austria).
2.5 Serum level of oxLDL-β
2
glycoprotein I
(Beta2-GPI-oxLDL)
The serum level of Beta2-GPI-oxLDL was measured
using an ELISA kit (Cayman Chemical Company, Ann
Arbor, MI, U.S.A; Cat No 10007893). Beta2-GPI-oxLDL
is an enzyme immunoassay, based on a sandwich
technique that detects the circulating oxLDL-β
2
GPI
complex in human serum. Bound Beta2-GPI-oxLDL
was detected using a horseradish peroxidase (HRP)-
labeled monoclonal antibody against human apoB100.
Colorimetric detection of bound HRP-antibody
conjugate was detected by reaction with 3, 3´, 5,
5´-tetramethylbenzidine. The reaction was stopped by
adding acid to give a colorimetric endpoint that was read
spectrophotometrically at 450 nm by a photometer . We
used the Sunrise photometer (Tecan Austria GmbH,
Salzburg, Austria).
2.6 Analysis of Paraoxonase (PON) activity
Blood serum samples frozen at –70°C were thawed
just before the beginning of each assay. PON activity
towards paraoxon was measured following the
reaction of paraoxon hydrolysis into p-nitrophenol
and diethylphosphate catalysed by the enzyme [18].
40 µL of serum was added to 400 µL Tris-HCl buffer
(100 mmol/L, pH 8,5) containing 2 mmol/L CaCl
2
and
2.2 mmol/L paraoxon. PON activity was determined
from the initial velocity of p-nitrophenol production
(subtracting the spontaneous paraoxon hydrolysis) at
37°C and recorded at 405 nm spectrophotometrically.
PON activity was expressed in U/L (1 micromol of
p-nitrophenol formed per minute per serum litre).
The molar extinction coefcient of p-nitrophenol is
18,053 M
-1
cm
-1
at pH 8,5. The interassay CV was <8%
and the intraassay CV was <6%.
2.7 8-Isoprostanes (8-EPI) in urine
Urinary 8-isoprostanes was measured using the method
previously published [1]. This assay is a competitive
enzyme-linked immunoassay for determining levels of
8-EPI in biological samples (BIOXYTECH 8-isoprostane
Assay, Cat. No.21019). Briey, 8-EPI in the samples or
standards competes for binding (to the antibody coated
on the plate) with 8-EPI conjugated to horseradish
peroxidise (HRP). The peroxidise activity results in
colour development when the substrate is added. The
intensity of the colour is proportional to the amount of
8-EPI-HRP bound and inversely proportional to the
amount of 8-EPI in the samples or standards. The
urinary concentrations of isoprostanes were corrected
by urinary creatinine concentrations to account for the
differences in renal excretory function. Creatinine was
measured colorimetrically (Jaffe kinetic method).
2.8 Microbial DNA extraction
The fecal samples were stored at -70ºC until analyzed.
Fecal samples of 20 mg were suspended in 1:10
volume of cold 1x PBS and centrifuged for 30 s at
100 x g to remove debris. Supernatants were collected
and centrifuged for 5 min at 16000 x g. Pellets were
washed once with 1 volume of 1x PBS and once with 1
volume of 10 mM Tris pH8, 10 mM EDTA. Fecal samples
were then resuspended in 10 mM Tris pH 8, 10 mM
34
T. Kullisaar
et al.
EDTA, 10 mg/ml lysozyme and 400 u/ml mutanolysin,
and incubated 15 min at 37ºC. After incubation, the
fecal suspensions were transferred to screw-cap tubes
containing 300 mg of zirconium beads (0.1 mm) and
1.4 ml of ASL buffer (Qiamp DNA Stool Mini Kit, Quiagen)
and were beaten in a Fast Prep at 6.5 ms
-1
for 3 x 45 with
cooling on ice between runs. After that, samples were
centrifuged for 1 min to pellet the stool particles, and
DNA was then extracted from supernatants using the
Qiamp DNA Stool Mini kit following the manufacturer’s
instructions. The presence of DNA was determined
visually after electrophoresis on a 1.2% agarose gel
containing ethidium bromide. To obtain DNA from the
bacterial pure culture, cells from 1 ml of the culture were
collected and the DNA was isolated with QIAmp DNA
isolation kit (Quiagen).
2.9 Real-time PCR
Real-time PCR was performed with the ABI PRISM 7500
HT Sequence Detection System (Applied Biosystems)
using optical grade 96-well plates [19,20]. The PCR
reaction was performed on a total volume of 25 μL using
the SYBR Green PCR Master mix (Applied Biosystems).
Each reaction included 5 μL of template DNA, 12.5 μL
SYBR Green (Applied Biosystems), 0.2 μM (lac-primers),
100 nM (Lferm-primers) and 0.2 μM (ferME-primers)
(Table 2). The reaction conditions were 50°C for 2 min
and 95°C for 10 min; followed by 40 cycles of 95°C for
15 s, 60°C for 1 min. Data analysis were conducted with
Sequence Detection Software version 1.6.3, supplied by
Applied Biosystem.
2.10 Calculation of lactobacilli cell numbers
Conversion of the amount of Lactobacillus DNA in fecal
samples determined by real-time PCR to theoretical
genome equivalents required the assumption that the
genome size and 16S rRNA gene copy number for all
lactobacilli was similar. From the review by Klaenhammer
et al. [21] of current and completed Lactobacillus
genomic sequencing projects, the average genome size
for human lactobacilli was 2.2 Mb, the average genome
of L. fermentum is 2.1 Mb, so that each cell contains
approximately 2.3-2.4 fg of DNA.
2.11 Statistical analysis
Calculations were performed using commercially
available statistical software packages (Statistics
for Windows, Stat Soft Inc. and Graph Pad PRISM
Version 2.0) and software R, version 1.6.0 for windows
(www.r-project.org). All values are given as mean and
standard deviation (mean±SD). Statistically signicant
differences between the groups were determined
by using Student`s t-test. In all analyses, P values
<0.05 were considered to be statistically signicant.
Correlations between the variables were examined
using linear regression analysis (software R, version
2.0.1 for Windows).
3. Results
Three different OxS-related parameters of the LDL
(BDC-LDL, oxLDL and Beta2-GPI-oxLDL) decreased
signicantly in the LfKef group (Table 3). The
concentrations of oxLDL and BDC-LDL did not change
in the Ckef (control) group.
Neither LfKef nor CKef had a signicant effect on
postprandial LDL-Chol level or on total cholesterol
level. Consumption of LfKef was associated with
a statistically signicant increase in postprandial
HDL-Chol concentrations (1.36±0.28 and
1.50±0.35 mmol/L, respectively) and in PON activity
(110.0±39.5 and 133.4±38.7 U/L, respectively). The
elevated PON activity is probably a HDL-linked PON as
a correlation model revealed statis tically signicant posi-
tive corre lation bet ween the concentration of HDL-Chol
and PON (Figure 1). Consumption of the LfKef reduced
the postprandial lipaemic response measured by the
blood triglyceride levels 2.1±1.1 to 1.9±0.7 mmol/l,
P<0.05, while there was no change in the case of CKef
(2.2±0.6 and 2.6±1.1 mmol/l). There was no statistical
difference between baseline values.
Primer/Target Nucleotide sequence (5’-3’) References
Lac-F / Lactobacillus GCAGCAGTAGGGAATCTTCCA
[19]
Lac-R / Lactobacillus GCATTYCACCGCTACACATG
[19]
Lferm-R / L. fermentum GTCCATTGTGGAAGATTCCC
[20]
Lferm-F / L. fermentum GCACCTGATTGATTTTGGTCG
[20]
FerME-F / L. fermentum ME-3 CCCAGCAAACTCCACCAGACA
[16]
FerME-R / L. fermentum ME-3 TGTGGAATTGTGAGCGGATA
[16]
Table 2. Primers and probes used in this study.
35
An antioxidant probiotic reduces postprandial lipemia and oxidative stress
The systemic OxS marker, urinary 8-EPI, was not
signicantly different in the LfKef and Ckef groups before
intervention, but after two weeks of LfKef consumption
the concentration of 8-EPI had decreased from
37.7±7.6 to 28.8±6.1 ng/mmol creatinine (P=0.0001,
Figure 2). There was no change with consumption of
the Ckef (37.0±8.0 and 38.1±6.5 ng/mmol creatinine
respectively). Consumption of LfKef was not associated
with a signicant change in the total fecal lactobacilli
count (baseline 6.7±1.0 log
10
cfu/g feces, post-intervention
7.1±1.1 log
10
cfu/g feces) (Figure 3). All subjects in the
Lfkef group harbored lactobacilli during the trial. The
concentration of L. fermentum species was quite low
at baseline (3.7±1.7 log
10
cfu/g feces) and signicantly
increased(4.7±1.4 log
10
cfu/g feces, p=0.008). Also, the
concentration of the specic strain L. fermentum ME-3
increased (1.7±1.0 vs. 3.7±1.7 log
10
cfu/g feces, P=0.018).
LfKef (n=48) CKef (n=25) Pre-prandial baseline
Postprandial Postprandial
0 week 2 weeks 0 week 2 weeks
LDL-Chol (mmol/l) 4.0 ± 0.9
*
4.0 ± 0.8 3.9 ± 0.7 4.1 ± 0.6 4.3 ± 0.4
oxLDL (U/l) 71 ± 19 63 ± 16
***,#
89 ± 20 92 ± 21 80 ± 20
BDC-LDL (µmol/l) 23.8 ± 6.2
*
22.0 ± 6.1
**
20.0 ± 7.0 21.0 ± 6.0 23.0 ± 8.0
PON (U/l) 110.0 ± 39.5
*
133.4 ± 38.7
***
115 ± 35 120 ± 37 117 ± 30
HDL-Chol (mmol/l) 1.4 ± 0.3
*
1.5± 0.3
***
1.5 ± 0.3 1.5 ± 0.3 1.5 ± 0.4
TG (mmol/l) 2.1 ±1.1
*
1.9 ±0.7
****
2.2 ± 1.1 2.6 ± 1.1 1.4 ± 0.7
Table 3. Effect of LfKef and CKef on the postprandial oxidative stress response and postprandial blood lipoprotein status.
Values are mean±SD
*
Nonsignicant difference between the values of LfKef and CKef at 0 week and pre-meal baseline,
**
P<0.03 and
***
P<0.001 for the differences before and after using
the LfKef,
#
P<0.05 vs. pre-meal baseline value,
****
P<0.05 after vs. before;
LDL-Chol - low density lipoprotein cholesterol; HDL-Chol - high density lipoprotein cholesterol; PON - paraoxonase, BDC-LDL - baseline diene conjugation in LDL;
oxLDL - oxidized LDL, Beta2-GPI-oxLDL - oxidized LDL complex with Beta-2-glycoprotein.
Figure 1. Scatterplot diagram of the relationship between
paraoxonase (PON) activity and HDL-Chol in the LfKef
group (R=0.35, P<0.05 between endpoint values, n=48).
Figure 2. Changes in postprandial concentration of urinary 8-isoprostanes in control (CKef n=25) and probiotic (LfKef n=48) groups after two weeks
of consumption).
36
T. Kullisaar
et al.
4. Discussion
Postprandial lipemic response is widely accepted as an
independent risk factor for CVD. Any aggravation of the
postprandial pro-oxidative situation may have negative
consequences as postprandial oxidative stress (OxS)
has been suggested to be the unifying mechanism in the
connection between CVD, metabolic syndrome, insulin
resistance and Type 2 diabetes [4,22]. Both postprandial
lipemic response and aggravation of postprandial OxS
have a direct impact on blood lipoprotein status and
metabolism, making postprandial abnormal events
crucial factors in the development of CVD [23]. Therefore
nutritional changes alleviating the postprandial load
of OxS, postprandial blood triglyceride (TG) response
and lipoprotein status may have a preventing impact on
the development of CVD. For example, recently it has
been shown that short-term intake of the Mediterranean
diet and an acute intake of an olive oil meal lead to
the formation of a reduced number of higher-size
triacylglycerols-rich lipoproteins compared with another
fat source [6]. Therefore, considering the principal roles
of the postprandial OxS and lipemic response, and
our previous trials with LfME-3 [1,2,11,13] we carried
out a study to evaluate the effects of the LfKef on
postprandial OxS, postprandial lipemic response and
blood lipoprotein status.
Our main ndings were that consumption on the
LfKef reduced the postprandial lipemic response,
decreased the body systemic OxS-load (lower level
of isoprostanes), decreased the level of oxidized LDL
(measured by three different methods) and elevated the
levels of HDL and HDL-related PON activity. The LfKef
did not have signicant inuence on the post prandial
LDL-Chol level or the total cholesterol level.
Postprandial hypertriglyceridemia can cause
endothelial dysfunction that is recognized as an early
process of atherosclerosis even in healthy subjects
[3]. Both OxS and blood lipoprotein status are related
to the development of CVD. Recently it was noted that
the traditional CVD risk factors, in promoting OxS and
endothelial dysfunction, are the rst steps in a cascade
of pathological events [24]. OxS leads to an excess of
oxLDL and the higher levels of the circulating oxLDL,
even more than LDL-Chol, are strongly associated
with the increased incidence of metabolic syndrome
in people who are young and otherwise healthy [25].
OxLDL is an important determinant of structural changes
of the arteries even in asymptomatic persons [13,26].
Recent data suggest that an increased production
of atherogenic and inammatory oxLDL within the
vessel wall suppresses several immunity-related cells,
including regulatory T cells [27] which normally exert
antiatherogenic and anti allergic effects. It should
be noted that previous trials have shown the positive
effect of ME-3 on blood LDL, prolonging its resistance
to oxidation, lowering the content of oxLDL and BDC-
LDL and enhancing the total antioxidative capacity of
the blood [1,11,14]. The systemic inuence of LfME-3 on
the host´s OxS-load is seen in the decline of the values
of isoprostanes, which are accepted as an informative
marker for the body’s systemic OxS-burden [28]. It
seems that the systemic effect of LfME-3 starts by
alleviating OxS- and inammation-related abnormalities
in the intestinal cells, leading to altered composition of
lipoproteins (chylomicrons, VLDL, LDL and HDL) with
lower levels of harmful oxidation products. Improvement
of the luminal environment of the gastrointestinal (GI)
tract as well as within the intestinal cells, by improving
glutathione levels and decreasing lipid peroxidation
Figure 3.
Fecal concentration of Lactobacillus sp., L. fermentum and L. fermentum ME-3 before and after consuming LfKef as determined by RT-PCR.
37
An antioxidant probiotic reduces postprandial lipemia and oxidative stress
has been conrmed by Truusalu [29,30] in a mouse
experimental S. typhimurium infection. Involvement
of the glutathione system is fundamental as reduced
glutathione (GSH) is both a crucial antioxidant and a
principal redox-controller for a number of processes in
cells. Some lipid hydroperoxides in food may escape
from reduction by glutathione peroxidase in the GI tract
and enter the circulation [31]. Consumption of antioxidant
probiotic LfME-3, which produces glutathione and
has complete glutathione redox cycle enzymes (Gp
x
and GRed), may contribute to the reduction of lipid
hydroperoxides in the GI tract and in hepatocytes and
prevent them from entering the circulation [32].
The antioxidant activity of HDL can be expressed
through multiple mechanisms [33]. PON is an
antioxidant enzyme associated with HDL in human
serum that hydrolyzes oxidized phospholipids and
inhibits the LDL oxidation that is otherwise an important
step in atherogenesis. In animals, the addition of
oxidized lipids to the circulation reduces PON activity,
and diets rich in oxidized fat accelerate the development
of atherosclerosis [34]. Removal and inactivation
of lipid peroxides which accumulate during LDL
oxidation may be the central mechanism accounting
for HDL antioxidative properties [35]. Recent studies
have shown that when HDL particles have poor bio-
quality (antioxidant properties and anti atherosclerotic
potency), they may have even inammatory effect [35].
Indeed, the antioxidant action of HDL is recognized
as one of the principal mechanisms mediating its
cardioprotective effect [36]. The increase in PON
activity by LfKef consumption shows that protection
of plasma lipo protein particles against oxidative
modication by ROS is improved. PON inhibits athe-
ro ge nesis by hydrolyzing lipid hydroperoxides and
cho lesterol ester hydroperoxides, reducing pero xides
to the hydroxides, and hydrolyzing homo cycteine
thiolactone which prevents protein homo cycteinylation
[37,38]. Thus, an elevation of PON activity should
decrease the level of oxLDL. We have established
statistically signi cant nega tive correlation bet ween the
PON activity and oxLDL.
As established in a murine model of S. typhimurium
infection (article in press), the antioxidant probiotic
LfME-3 may interfere with the postprandial status of
lipoprotein metabolism by increasing the production of
the anti-inammatory cytokine IL-10 and by decreasing
the production of the pro-inammatory cytokine TNF-α
in ileal mucosa and hepatocytes, hence lowering levels
of VLDL and TG and reducing formation of oxLDL.
Changes in VLDL production can be due to changes
in the amount of lipid per VLDL particle, the number of
particles secreted, or both.
According to our previous data, fecal recovery of
LfME-3 is detectable after consumption of probiotic
yoghurt, cheese and ker. LfME-3 fecal recovery was
particularly good when this strain was consumed with
fermented goat milk containing only 2 starter strains with
ME-3 as a probiotic adjunct [1]. The food vehicle for the
probiotic in the present study was ker and resulted in
a signicant increase in the fecal concentration of the
overall L. fermentum (that includes LfME-3). It seems
that ker may be a less ideal vehicle for ME-3 compared
with fermented goat´s milk. Though ME-3 tolerates
technological handling well, surviving the ker production
and remaining viable during the shelf-life, the interactions
of ME-3 with the microbial species in the ker grain and
their effect on ME-3 viability are not claried yet.
Thus, every study opens addi tional aspects and
has certain limitations but it is note worthy that our
pilot study is the rst to explore the possibility that a
traditional foodstuff enriched with a special probiotic
may have a signicant positive impact on postprandial
lipemic response, OxS and lipoprotein status. Thus, this
information is worth further investigation using large
scale studies.
Acknowledgments
Estonian Science Foundation (grant 6588); Targeted
nancing of The Ministry of Education and Science
of Estonia (TARBK0411) and by the European Union
through the European Regional Development Fund.
References
[1] Kullisaar T., Songisepp E., Mikelsaar M., Zilmer
K., Vihalemm T., Zilmer M., Antioxidative probiotic
fermented goats’ milk decreases oxidative stress-
mediated atherogenicity in human subjects, Br. J.
Nutr., 2003, 90, 449-456
[2] Mikelsaar M., Zilmer M., Lactobacillus fermentum
ME-3 an antimicrobial and anti oxidative probiotic,
Microb. Ecol. Health Dis., 2009, 21, 1-27
[3] Bae J.-H., Bassenge E., Kim K.-B., Kim Y.-
N., Kim K.-S., Lee H.-J., et al., Postprandial
hypertriglyceridemia impairs endothelial function
by enhanced oxidative stress, Atherosclerosis,
2001, 155, 517-523
[4] Hopps E., Noto D., Caimi G., Averna M.R., A novel
component of the metabolic syndrome: The oxidative
stress, Nutr. Metab. Cardiovasc. Dis., 2010, 20, 72-77
38
T. Kullisaar
et al.
[5] Jackson K.G., Armah C.K., Minihane A.M., Meal
fatty acids and postprandial vascular reactivity,
Biochem. Soc. Trans., 2007, 35, 451-453
[6] Perez-Martinez P., Ordovas J.M., Garcia-Rios A.,
Delgado-Lista J., Delgado-Casado N., Cruz-Teno
C., et al., Consumption of diets with different type
of fat inuences triacylglycerols-rich lipoprotein
particle number and size during the postprandial
state, Nutr. Metab. Cardiovasc. Dis., In press, DOI:
10.1016/j.numecd.2009.07.008
[7] Salminen S., Bouley C., Boutron-Ruault M.C.,
Cummings J.H., Franck A., Gibson G.R., et al.,
Functional food science and gastrointestinal
physiology and function, Br. J. Nutr., 1998, 80,
S147-S171
[8] Salminen S., Human studies on probiotics. Aspects
of scientic documentation, Scand. J. Nutr., 2001,
45, 8-12
[9] Sepp E., Julge K., Vasar M., Naaber P., Björksten B.,
Mikelsaar M., Intestinal microora of Estonian and
Swedish infants, Acta Pediatr., 1997, 86, 956-961
[10] Kullisaar T., Zilmer M., Mikelsaar M., Vihalemm
T., Annuk H., Kairane C., et al., Two antioxidative
lactobacilli strains as promising probiotics, Int. J.
Food Microbiol., 2002, 72, 215-224
[11] Songisepp E., Kals J., Kullisaar T., Mändar R., Hütt
P., Zilmer M., et al., Evaluation of the functional
efcacy of an antioxidative probiotic in healthy
volunteers, Nutr. J., 2005, 20, 4-22
[12] Järvenpää S., Tahvonen R.L., Ouwehand A.C.,
Sandell M., Järvenpää E., Salminen S., A probiotic,
Lactobacillus fermentum ME-3, has antioxidative
capacity in soft cheese with different fats, J. Dairy
Sci., 2007, 90, 3171-3177
[13] Kals J., Kampus P., Zilmer K., Impact of oxidative stress
on arterial elasticity in patients with atherosclerosis,
Am. J. Hypertens., 2006, 19, 902-908
[14] Kaur S., Kullisaar T., Mikelsaar M., Eisen M.,
Rehema A., Vihalemm T., et al., Successful
management of mild atopic dermatitis in adults with
probiotics and emollients, Cent. Eur. J. Med., 2008,
3, 215-220
[15] Kullisaar T., Mikelsaar M., Kaur S., Songisepp E.,
Zilmer K., Hütt P., et al., Probiotics, oxidative
stress inammation and diseases, In: Curic D.,
(Ed.), Proceedings of the Joint Central European
Congress (15-17 May 2008 Cavtat, Croatia),
Croatian Chamber of Economy, 2008, 1, 367-373
[16] Stsepetova J., Kullisaar T., Songisepp E., Zilmer
M., Mikelsaar M., Design of L. fermentum ME-3
strain-specic primers for detecting the cell number
in human feces by real-time PCR., Gastroenterol.
Sankt-Peterburg, 2009, 4, A26-A27, (in Russian)
[17] Ahotupa M., Marniemi J., Lehtimäki T., Talvinen K.,
Raitakari O.T., Vasankari T., et al., Baseline diene
conjugation in LDL lipids as a direct measure of in vivo
LDL oxidation, Clin. Biochem., 1998, 31, 257-261
[18] Schiavon R., Battaglia P., De Fanti E., FasolinA.,
Biasioli S., TargaL., et al., HDL3-related
decreased serum paraoxonase (PON) activity in
uremic patients: comparison with the PON allele
polymorphism, Clin Chim Acta, 2002, 324, 39-44
[19] Castillo M., Martin-Orue M.S., Manzanilla E.G.,
Badiola I., Martin M., Gasa J., Quantication
of total bacteria, enterobacteria and lactobacilli
populations in pig digesta by real-time PCR, Vet.
Microbiol., 2006, 114, 165-170
[20] Byun R., Nadkarni M.A., Chhour K.L., Martin, F.E.,
Jacques N.A., Hunter N., Quantitative analysis of
diverse lactobacillus species present in advanced
caries, J. Clin. Microbiol., 2004, 42, 3128-3136
[21] Klaenhammer T., Altermann E., Arigoni F., Bolotin
A., Breidt F., Broadbent J., et al., Discovering
lactic acid bacteria by genomics, Antonie van
Leeuwenhoek, 2002, 82, 29-58
[22] Fisher-Wellman K., Bloomer R.J., Macronutrient
specic postprandial oxidative stress: relevance
to the development of insulin resistance, Curr.
Diabetes Rev., 2009, 5, 228-238
[23] Lopez-Miranda J., Perez-Martinez P., Marin
C., Moreno J.A., Gomez P., Perez-Jimenez F.,
Postpran dial lipoprotein metabolism, genes and
risk of cardiovascular disease, Curr. Opin. Lipidol.,
2006, 17,132-138
[24] Dzau V.J., Antman E.M., Black H.R., Hayes D.L.,
Manson J.E., Plutzky J., et al., The cardiovascular
disease continuum validated: clinical evidence of
improved patient outcomes: part I: Pathophysiology
and clinical trial evidence (risk factors through
stable coronary artery disease), Circulation, 2006,
114, 2850-2870
[25] Holvoet P., Lee D.H., Steffes M., Gross M., Jacobs
D.R. Jr., Association between circulating oxi-
dized low-density lipoprotein and incidence of the
metabolic syndrome, JAMA, 2008, 299, 2287-2293
[26] Kampus P., Kals J., Ristimäe T., Muda P., Ulst K.,
Zilmer K., et al.. Augmentation index and carotenoid
intima-media thickness are differently related to
age, C-reactive protein and oxidized low-density
lipoprotein, J. Hypertens., 2007, 25, 132-138
[27] George J., Mechanisms of disease: the evolving
role of regulatory T cells in atherosclerosis, Nat.
Clin. Pract. Cardiovasc. Med., 2008, 5, 531-540
[28] Halliwell B., Gutteridge J.M.C., (Eds.), Free radicals
in biology and medicine, 3
rd
Ed., Oxford University
Press, New York, 1999
39
An antioxidant probiotic reduces postprandial lipemia and oxidative stress
[29] Truusalu K., Naaber P., Kullisaar T., Tamm H.,
Mikelsaar R.-H., Zilmer K., et al., The inuence of
antibacterial and antioxidative probiotic lactobacilli
on gut mucosa in a mouse model of Salmonella
infection, Microb. Ecol. Health Dis., 2004, 16,
180-187
[30] Truusalu K., Mikelsaar R.-H., Naaber P., Karki
T., Kullisaar T., Zilmer M., et al., Eradication of
salmonella Typhimurium infection in a murine
mudel of tophoid fever with the combination of
probiotic Lactobacillus fermentum ME-3 and
ooxacin, BMC Microbiol., 2008, 8, 132-136
[31] Chui M.H., Greenwood C.E., Antioxidant vitamins
reduce acute meal-induced memory decits in
adults with type 2 diabetes, Nutr. Res., 2008, 28,
423-429
[32] Kullisaar T., Songisepp E., Aunapuu M., Kilk K.,
Arend A, Mikelsaar M., et al., Complete glutathione
system in probiotic L. fermentum ME-3, Appl.
Biochem. Microbiol., 2010, 46, 481-486
[33] Bruckert E., Hansel B., HDL-c is a powerful lipid
predictor of cardiovascular diseases, Int. J. Clin.
Pract., 2009, 61, 1905-1913
[34] Sutherland W.H., Walker R.J., de Jong S.A.,
van Rij A.M., Phillips V., Walker H.L., Reduced
postprandial serum paraoxonase activity after a
meal rich in used cooking fat, Arterioscler. Thromb.
Vasc. Biol., 1999, 19, 1340-1347
[35] Navab M., Anantharamaiah G.M., Reddy S.T.,
Van Lenten B.J., Ansell B.J., Fogelman A.M.,
Mechanisms of disease: proatherogenic HDL -
an evolving eld, Nat. Clin. Pract. Endocrin. Met.,
2006, 2, 504-511
[36] Hansel B., Giral P, Nobecourt E., Clantepie S.,
Bruckert E., Chapman M.J., et al., Metabolic
syndrome is associated with elevated oxidative
stress and dysfunctional dense high-density
lipoprotein particles displaying impaired
antioxidative activity, J. Clin. Endocrin. Met., 2006,
89, 4963-4971
[37] Beltowski J., Wojcicka G., Jamroz A., Leptin
decreases plasma paraoxonase 1 (PON1) activity
and induces oxidative stress: the possible novel
mechanism for proatherogenic effect of chronic
hyperleptinemia, Atherosclerosis, 2003, 170, 21-29
[38] Durrington P.N., Mackness B., Mackness M.I.,
Paraoxonase and atherosclerosis, Arterioscler.
Thromb. Vasc. Biol., 2005, 21, 473-480
40
