ArticlePDF Available

Abstract and Figures

Reducing postprandial oxidative stress (OxS), decreasing postprandial blood triglyceride level (TG) and improving lipoprotein status is likely to have a preventive impact on the development of cardiovascular disease (CVD). Previously we have shown that the antioxidant probiotic Lactobacillus fermentum ME-3 (DSM14241) is characterized by antiatherogenic effects. This randomized double-blind placebo-controlled study evaluated the influence of kefir enriched with an antioxidative probiotic L. fermentum ME-3 (LfKef) on postprandial OxS, blood TG response and lipoprotein status. 100 clinically healthy subjects were recruited into the study. Blood parameters of postprandial OxS, TG and lipoprotein status were determined by oxidized LDL, baseline diene conjugation in LDL (BDC-LDL), oxidized LDL complex with beta-2 glycoprotein (Beta2-GPI-oxLDL), paraoxonase (PON) activity, LDL-Chol, HDL-Chol and TG. To evaluate general body postprandial OxS-load we measured 8-isoprostanes (8-EPI) in the urine. Consumption of LfKef significantly reduced the postprandial level of oxidized LDL, BDC-LDL, Beta2-GPI-oxLDL, urinary 8-isoprostanes and postprandial TG and caused a significant increase in HDL-Chol and PON activity. This is the first evidence that kefir enriched with an antioxidant probiotic may have a positive effect on both postprandial OxS and TG response as well as on lipoprotein status. KeywordsPostprandial period-Oxidative stress-Postprandial lipemic response-Probiotics-Lactobacillus fermentum-Oxidized low-density lipoprotein-Paraoxonase, isoprostanes
Content may be subject to copyright.
Central European Journal of Biology
* E-mail: tiiu.kullisaar@ut.ee
Research Article
1
Department of Biochemistry of Faculty of Medicine, Tartu University,
50411 Tartu, Estonia
2
Department of Microbiology of Faculty of Medicine, Tartu University,
50411 Tartu, Estonia
3
Bio-Competence Centre of Healthy Dairy Products,
50411 Tartu, Estonia
4
The Centre of Excellence for Translational Medicine,
50411 Tartu, Estonia
#
Present address:
Biomedicum, Department of Biochemistry,
Faculty of Medicine, Tartu University,
50411 Tartu, Estonia
Tiiu Kullisaar
1,3,4,#,
*, Jelena Shepetova
2
, Kersti Zilmer
1,4
, Epp Songisepp
3
,
Aune Rehema
1,4
, Marika Mikelsaar
2
, Mihkel Zilmer
1,4
An antioxidant probiotic reduces
postprandial lipemia and oxidative stress
1. Introduction
Lactobacillus fermentum LfME-3 has shown an
antiatherogenic potential [1,2], but this has not yet been
proven in postprandial period. The period after a meal
actuates the response of an organism to food. The
fat load of the meal can initiate postprandial lipemia
and deepen oxidative stress, both of which have a
substantial role in the progression of CVD and diabetes.
Many of the possible links between oxidative stress and
the metabolic syndrome occur during the postprandial
period. These include excessive and prolonged
elevation of blood triglyceride levels, impairment of the
endothelial function, an intestinal overproduction of
chylomicrons, a redundant load for insulin production,
the elevation of levels of atherogenic oxidized low-
density lipoprotein and possible disturbances in the
antioxidativity of high-density lipoproteins [3-6]. Thus,
a positive modulation of the postprandial situation,
including oxidative stress, is an important target
for dietary preventive actions. Foods enriched with
antioxidant probiotics may be a promising strategy.
32
Cent. Eur. J. Biol. • 6(1) • 2011 • 32–40
DOI: 10.2478/s11535-010-0103-4
Received 18 May 2010; Accepted 14 September 2010
Keywords: Postprandial period Oxidative stress Postprandial lipemic response Probiotics Lactobacillus fermentum
• Oxidized low-density lipoprotein • Paraoxonase, isoprostanes
Abstract: Reducing postprandial oxidative stress (OxS), decreasing postprandial blood triglyceride level (TG) and improving lipoprotein
status is likely to have a preventive impact on the development of cardiovascular disease (CVD). Previously we have shown that
the antioxidant probiotic Lactobacillus fermentum ME-3 (DSM14241) is characterized by antiatherogenic effects. This randomized
double-blind placebo-controlled study evaluated the inuence of ker enriched with an antioxidative probiotic L. fermentum ME-3
(LfKef) on postprandial OxS, blood TG response and lipoprotein status. 100 clinically healthy subjects were recruited into the study.
Blood parameters of postprandial OxS, TG and lipoprotein status were determined by oxidized LDL, baseline diene conjugation
in LDL (BDC-LDL), oxidized LDL complex with beta-2 glycoprotein (Beta2-GPI-oxLDL), paraoxonase (PON) activity, LDL-Chol,
HDL-Chol and TG. To evaluate general body postprandial OxS-load we measured 8-isoprostanes (8-EPI) in the urine. Consumption
of LfKef signicantly reduced the postprandial level of oxidized LDL, BDC-LDL, Beta2-GPI-oxLDL, urinary 8-isoprostanes and
postprandial TG and caused a signicant increase in HDL-Chol and PON activity. This is the rst evidence that ker enriched with
an antioxidant probiotic may have a positive effect on both postprandial OxS and TG response as well as on lipoprotein status.
© Versita Sp. z o.o.
T. Kullisaar
et al.
Probiotics are dened as live microbial food ingredients
benecial to health [7]. Their benets include improved
intestinal microbial balance, reduced gut inammation,
alleviation of lactose intolerance symptoms and
prevention of food allergy [8]. However, investigations
of their impact on postprandial responses are absent.
A few lactobacilli strains have shown physiologically
relevant antioxidative potency. One of these strains is
Lactobacillus fermentum ME-3 (LfME-3; DSM14241,
now patented in the USA, Russia, Estonia and European
Union). It is of human origin [9] and a safety-proven
probiotic exhibiting both antimicrobial and antioxidative
benets under different in vitro and in vivo conditions
[10-12] and having a history of safe use in foodstuffs,
especially in ker, in Finland and the Baltic countries.
Encouraged by the results of our previous trials with
LfME-3 [1,2,10,11,13-16] we aimed to carry out a study
to evaluate the effects of ker enriched with probiotic
L. fermentum ME-3 on postprandial oxidative stress,
postprandial lipemic response and blood lipoprotein
status when added to an ordinary diet.
2. Experimental Procedures
2.1 Subjects and study design
One hundred clinically healthy volunteers (75 females,
25 males, age 40-65 years) with mean BMI 30±5 kg/m
2
were recruited into a double-blind placebo-controlled
randomized study. Exclusion criteria were as follows: an
ongoing acute infection; diabetes; history of food allergy
or gastrointestinal disease; use of any antimicrobial
agent within the preceding month or use of any regular
concomitant medication including non-steroidal anti-
inammatory drugs, statins or hormonal contraception;
pregnancy or breastfeeding; alcohol abuse; use of
drugs; special diets; smoking. During the intervention,
and for two weeks beforehand, participants were asked
to avoid vitamin or mineral supplementation, changes in
accustomed diet habits and everyday physical activity,
and use of probiotic-based foods or other kers/yogurts.
The participants were randomly divided into two groups
(each of 50 participants). Unfortunately because of
personal reasons and an epidemic of inuenza, 25
participants of the control group and 2 participants in
the study group did not nish the trial. Of those who
completed the experiment, there were in the control
group 18 women and 7 men with mean BMI 28±2 kg/m
2
and mean age 55±2 years; in the study group 34 women
and 14 men with mean BMI 27±2 kg/m
2
, and mean age
55±3 years.
All participants signed their written informed consent
and had the option of withdrawing from the study at any
time. The Ethics Review Committee (ERC) on Human
Research of the University of Tartu approved the study
protocol. This study was carried out in accordance
with the Declaration of Helsinki of the World Medical
Association.
The LfKef (containing the probiotic) and Ckef
(the ker without a probiotic additive) were identical
nutrient composition (including fat content, 2.5%),
color, taste, and caloric value and were produced by
the Tere Dairy Ltd (Tallinn, Estonia). After two weeks’
introductory period, baseline standard fasting blood
(from the antecubital vein) and urine samples were
obtained. Postprandial blood and urine samples
were obtained 2.5 h after consuming a standard
breakfast (Table 1), which was the maximum point of
the postprandial response according to our previous
experiments). Samples were kept at -80°C until
analyzed. Participants were then randomly assigned
into two groups to receive 200 ml of either the LfKef
or Ckef daily for two weeks. After the two-week
intervention period, postprandial (2.5 h after standard
meal) blood and urine samples were obtained as well
as fecal samples of that day, again after an identical
standard breakfast.
The viability of LfME-3 in the LfKef was analyzed
before the delivery to the study participants. Decimal
dilutions of the ker were seeded on the MRS (Oxoid Ltd.
Basingstoke, UK) agar medium and incubated for 48 h
at 37
o
C in micro aerobic (CO
2
/O
2
/N
2
: 10/5/85) conditions
(incubator IG 150, Jouan, France). The probiotic strain
was identied as described previously [1,9,11]. The viable
count of LfME-3 in the LfKef was stable in all purchased
lots (viable counts 2x10
8
CFU/g ker).
Cheeseburger Ker
Per
portion
GDA*
%
Per
100 ml
GDA
%
Carbohydrates (g) 30 11 4.0 3
Sugar (g) 7 7 4.0 8.9
Total dietary ber (g) 2 8 - -
Protein (g) 27 36 2.9 11.6
Fat (g) 23 34 2,5 7.1
Saturated fat (g) 11 50 1.4 13.5
Energy content (kcal) 435 22 50 5
NaCl (g) 2.3 46 0.05 4.2
Table 1. Nutrient composition of a cheeseburger and ker
(http://www.mcdonaldsmenu.info; http://www.tere.eu ).
GDA (Guideline Daily Amount) suggested by CIAA, http://gda.ciaa.be/asp3/index.asp)
33
An antioxidant probiotic reduces postprandial lipemia and oxidative stress
2.2 Common biochemical analysis
The measurements of HDL-Chol, LDL-Chol and TG
were performed using a routine clinical laboratory
analysis (enzymatic colorimetric methods on an
automatic analyzer).
2.3 Serum level of baseline diene conjugates
of low-density lipoprotein (BDC-LDL)
The serum level of BDC-LDL was measured
by
determining the level of LDL diene conjugation using a
method that has been recently validated and reported
in detail [17]. In brief, serum LDL was isolated by
precipitation with buffered
heparin-citrate. The amount
of peroxidized lipids in samples was determined
by the
degree of conjugated diene double bonds. Lipids were
extracted
from the samples by a mixture of chloroform
and methanol (2:1),
dried under nitrogen, redissolved
in cyclohexane, and analyzed
spectrophotometrically at
234 nm. For BDC-LDL, the coefcient of variance for
within-assay and between-assay precision was 4.4%
and 4.5%, respectively.
2.4 Plasma level of oxidized low-density
lipoprotein (oxLDL)
The plasma level of oxLDL was measured using an
ELISA kit (Mercodia AB, Uppsala Sweden; Cat No
10-1143-01). Mercodia Oxidized LDL ELISA is a solid
phase two-site enzyme immunoassay, based on direct
sandwich technique in which two monoclonal antibodies
are directed against separate antigenic determinants
on the oxidized apolipoprotein B molecule. During
incubation and a simple washing step that removes non-
reactive plasma components, a peroxidase conjugated
anti-apolipoprotein B antibody recognizes the oxLDL
bound to the solid phase. After a second incubation and
simple washing step that removes unbound enzyme-
labeled antibody, the bound conjugate is detected
by reaction with 3,3´,5,5´-tetramethylbenzidine.
The reaction is stopped by adding an acid to give a
colorimetric endpoint that is read spectrophotometrically
at 450 nm by a photometer. We used the Sunrise
photometer (Tecan Austria GmbH, Salzburg, Austria).
2.5 Serum level of oxLDL
2
glycoprotein I
(Beta2-GPI-oxLDL)
The serum level of Beta2-GPI-oxLDL was measured
using an ELISA kit (Cayman Chemical Company, Ann
Arbor, MI, U.S.A; Cat No 10007893). Beta2-GPI-oxLDL
is an enzyme immunoassay, based on a sandwich
technique that detects the circulating oxLDL-β
2
GPI
complex in human serum. Bound Beta2-GPI-oxLDL
was detected using a horseradish peroxidase (HRP)-
labeled monoclonal antibody against human apoB100.
Colorimetric detection of bound HRP-antibody
conjugate was detected by reaction with 3, 3´, 5,
5´-tetramethylbenzidine. The reaction was stopped by
adding acid to give a colorimetric endpoint that was read
spectrophotometrically at 450 nm by a photometer . We
used the Sunrise photometer (Tecan Austria GmbH,
Salzburg, Austria).
2.6 Analysis of Paraoxonase (PON) activity
Blood serum samples frozen at –70°C were thawed
just before the beginning of each assay. PON activity
towards paraoxon was measured following the
reaction of paraoxon hydrolysis into p-nitrophenol
and diethylphosphate catalysed by the enzyme [18].
40 µL of serum was added to 400 µL Tris-HCl buffer
(100 mmol/L, pH 8,5) containing 2 mmol/L CaCl
2
and
2.2 mmol/L paraoxon. PON activity was determined
from the initial velocity of p-nitrophenol production
(subtracting the spontaneous paraoxon hydrolysis) at
37°C and recorded at 405 nm spectrophotometrically.
PON activity was expressed in U/L (1 micromol of
p-nitrophenol formed per minute per serum litre).
The molar extinction coefcient of p-nitrophenol is
18,053 M
-1
cm
-1
at pH 8,5. The interassay CV was <8%
and the intraassay CV was <6%.
2.7 8-Isoprostanes (8-EPI) in urine
Urinary 8-isoprostanes was measured using the method
previously published [1]. This assay is a competitive
enzyme-linked immunoassay for determining levels of
8-EPI in biological samples (BIOXYTECH 8-isoprostane
Assay, Cat. No.21019). Briey, 8-EPI in the samples or
standards competes for binding (to the antibody coated
on the plate) with 8-EPI conjugated to horseradish
peroxidise (HRP). The peroxidise activity results in
colour development when the substrate is added. The
intensity of the colour is proportional to the amount of
8-EPI-HRP bound and inversely proportional to the
amount of 8-EPI in the samples or standards. The
urinary concentrations of isoprostanes were corrected
by urinary creatinine concentrations to account for the
differences in renal excretory function. Creatinine was
measured colorimetrically (Jaffe kinetic method).
2.8 Microbial DNA extraction
The fecal samples were stored at -70ºC until analyzed.
Fecal samples of 20 mg were suspended in 1:10
volume of cold 1x PBS and centrifuged for 30 s at
100 x g to remove debris. Supernatants were collected
and centrifuged for 5 min at 16000 x g. Pellets were
washed once with 1 volume of 1x PBS and once with 1
volume of 10 mM Tris pH8, 10 mM EDTA. Fecal samples
were then resuspended in 10 mM Tris pH 8, 10 mM
34
T. Kullisaar
et al.
EDTA, 10 mg/ml lysozyme and 400 u/ml mutanolysin,
and incubated 15 min at 37ºC. After incubation, the
fecal suspensions were transferred to screw-cap tubes
containing 300 mg of zirconium beads (0.1 mm) and
1.4 ml of ASL buffer (Qiamp DNA Stool Mini Kit, Quiagen)
and were beaten in a Fast Prep at 6.5 ms
-1
for 3 x 45 with
cooling on ice between runs. After that, samples were
centrifuged for 1 min to pellet the stool particles, and
DNA was then extracted from supernatants using the
Qiamp DNA Stool Mini kit following the manufacturer’s
instructions. The presence of DNA was determined
visually after electrophoresis on a 1.2% agarose gel
containing ethidium bromide. To obtain DNA from the
bacterial pure culture, cells from 1 ml of the culture were
collected and the DNA was isolated with QIAmp DNA
isolation kit (Quiagen).
2.9 Real-time PCR
Real-time PCR was performed with the ABI PRISM 7500
HT Sequence Detection System (Applied Biosystems)
using optical grade 96-well plates [19,20]. The PCR
reaction was performed on a total volume of 25 μL using
the SYBR Green PCR Master mix (Applied Biosystems).
Each reaction included 5 μL of template DNA, 12.5 μL
SYBR Green (Applied Biosystems), 0.2 μM (lac-primers),
100 nM (Lferm-primers) and 0.2 μM (ferME-primers)
(Table 2). The reaction conditions were 50°C for 2 min
and 95°C for 10 min; followed by 40 cycles of 95°C for
15 s, 60°C for 1 min. Data analysis were conducted with
Sequence Detection Software version 1.6.3, supplied by
Applied Biosystem.
2.10 Calculation of lactobacilli cell numbers
Conversion of the amount of Lactobacillus DNA in fecal
samples determined by real-time PCR to theoretical
genome equivalents required the assumption that the
genome size and 16S rRNA gene copy number for all
lactobacilli was similar. From the review by Klaenhammer
et al. [21] of current and completed Lactobacillus
genomic sequencing projects, the average genome size
for human lactobacilli was 2.2 Mb, the average genome
of L. fermentum is 2.1 Mb, so that each cell contains
approximately 2.3-2.4 fg of DNA.
2.11 Statistical analysis
Calculations were performed using commercially
available statistical software packages (Statistics
for Windows, Stat Soft Inc. and Graph Pad PRISM
Version 2.0) and software R, version 1.6.0 for windows
(www.r-project.org). All values are given as mean and
standard deviation (mean±SD). Statistically signicant
differences between the groups were determined
by using Student`s t-test. In all analyses, P values
<0.05 were considered to be statistically signicant.
Correlations between the variables were examined
using linear regression analysis (software R, version
2.0.1 for Windows).
3. Results
Three different OxS-related parameters of the LDL
(BDC-LDL, oxLDL and Beta2-GPI-oxLDL) decreased
signicantly in the LfKef group (Table 3). The
concentrations of oxLDL and BDC-LDL did not change
in the Ckef (control) group.
Neither LfKef nor CKef had a signicant effect on
postprandial LDL-Chol level or on total cholesterol
level. Consumption of LfKef was associated with
a statistically signicant increase in postprandial
HDL-Chol concentrations (1.36±0.28 and
1.50±0.35 mmol/L, respectively) and in PON activity
(110.0±39.5 and 133.4±38.7 U/L, respectively). The
elevated PON activity is probably a HDL-linked PON as
a correlation model revealed statis tically signicant posi-
tive corre lation bet ween the concentration of HDL-Chol
and PON (Figure 1). Consumption of the LfKef reduced
the postprandial lipaemic response measured by the
blood triglyceride levels 2.1±1.1 to 1.9±0.7 mmol/l,
P<0.05, while there was no change in the case of CKef
(2.2±0.6 and 2.6±1.1 mmol/l). There was no statistical
difference between baseline values.
Primer/Target Nucleotide sequence (5’-3’) References
Lac-F / Lactobacillus GCAGCAGTAGGGAATCTTCCA
[19]
Lac-R / Lactobacillus GCATTYCACCGCTACACATG
[19]
Lferm-R / L. fermentum GTCCATTGTGGAAGATTCCC
[20]
Lferm-F / L. fermentum GCACCTGATTGATTTTGGTCG
[20]
FerME-F / L. fermentum ME-3 CCCAGCAAACTCCACCAGACA
[16]
FerME-R / L. fermentum ME-3 TGTGGAATTGTGAGCGGATA
[16]
Table 2. Primers and probes used in this study.
35
An antioxidant probiotic reduces postprandial lipemia and oxidative stress
The systemic OxS marker, urinary 8-EPI, was not
signicantly different in the LfKef and Ckef groups before
intervention, but after two weeks of LfKef consumption
the concentration of 8-EPI had decreased from
37.7±7.6 to 28.8±6.1 ng/mmol creatinine (P=0.0001,
Figure 2). There was no change with consumption of
the Ckef (37.0±8.0 and 38.1±6.5 ng/mmol creatinine
respectively). Consumption of LfKef was not associated
with a signicant change in the total fecal lactobacilli
count (baseline 6.7±1.0 log
10
cfu/g feces, post-intervention
7.1±1.1 log
10
cfu/g feces) (Figure 3). All subjects in the
Lfkef group harbored lactobacilli during the trial. The
concentration of L. fermentum species was quite low
at baseline (3.7±1.7 log
10
cfu/g feces) and signicantly
increased(4.7±1.4 log
10
cfu/g feces, p=0.008). Also, the
concentration of the specic strain L. fermentum ME-3
increased (1.7±1.0 vs. 3.7±1.7 log
10
cfu/g feces, P=0.018).
LfKef (n=48) CKef (n=25) Pre-prandial baseline
Postprandial Postprandial
0 week 2 weeks 0 week 2 weeks
LDL-Chol (mmol/l) 4.0 ± 0.9
*
4.0 ± 0.8 3.9 ± 0.7 4.1 ± 0.6 4.3 ± 0.4
oxLDL (U/l) 71 ± 19 63 ± 16
***,#
89 ± 20 92 ± 21 80 ± 20
BDC-LDL (µmol/l) 23.8 ± 6.2
*
22.0 ± 6.1
**
20.0 ± 7.0 21.0 ± 6.0 23.0 ± 8.0
PON (U/l) 110.0 ± 39.5
*
133.4 ± 38.7
***
115 ± 35 120 ± 37 117 ± 30
HDL-Chol (mmol/l) 1.4 ± 0.3
*
1.5± 0.3
***
1.5 ± 0.3 1.5 ± 0.3 1.5 ± 0.4
TG (mmol/l) 2.1 ±1.1
*
1.9 ±0.7
****
2.2 ± 1.1 2.6 ± 1.1 1.4 ± 0.7
Table 3. Effect of LfKef and CKef on the postprandial oxidative stress response and postprandial blood lipoprotein status.
Values are mean±SD
*
Nonsignicant difference between the values of LfKef and CKef at 0 week and pre-meal baseline,
**
P<0.03 and
***
P<0.001 for the differences before and after using
the LfKef,
#
P<0.05 vs. pre-meal baseline value,
****
P<0.05 after vs. before;
LDL-Chol - low density lipoprotein cholesterol; HDL-Chol - high density lipoprotein cholesterol; PON - paraoxonase, BDC-LDL - baseline diene conjugation in LDL;
oxLDL - oxidized LDL, Beta2-GPI-oxLDL - oxidized LDL complex with Beta-2-glycoprotein.
Figure 1. Scatterplot diagram of the relationship between
paraoxonase (PON) activity and HDL-Chol in the LfKef
group (R=0.35, P<0.05 between endpoint values, n=48).
Figure 2. Changes in postprandial concentration of urinary 8-isoprostanes in control (CKef n=25) and probiotic (LfKef n=48) groups after two weeks
of consumption).
36
T. Kullisaar
et al.
4. Discussion
Postprandial lipemic response is widely accepted as an
independent risk factor for CVD. Any aggravation of the
postprandial pro-oxidative situation may have negative
consequences as postprandial oxidative stress (OxS)
has been suggested to be the unifying mechanism in the
connection between CVD, metabolic syndrome, insulin
resistance and Type 2 diabetes [4,22]. Both postprandial
lipemic response and aggravation of postprandial OxS
have a direct impact on blood lipoprotein status and
metabolism, making postprandial abnormal events
crucial factors in the development of CVD [23]. Therefore
nutritional changes alleviating the postprandial load
of OxS, postprandial blood triglyceride (TG) response
and lipoprotein status may have a preventing impact on
the development of CVD. For example, recently it has
been shown that short-term intake of the Mediterranean
diet and an acute intake of an olive oil meal lead to
the formation of a reduced number of higher-size
triacylglycerols-rich lipoproteins compared with another
fat source [6]. Therefore, considering the principal roles
of the postprandial OxS and lipemic response, and
our previous trials with LfME-3 [1,2,11,13] we carried
out a study to evaluate the effects of the LfKef on
postprandial OxS, postprandial lipemic response and
blood lipoprotein status.
Our main ndings were that consumption on the
LfKef reduced the postprandial lipemic response,
decreased the body systemic OxS-load (lower level
of isoprostanes), decreased the level of oxidized LDL
(measured by three different methods) and elevated the
levels of HDL and HDL-related PON activity. The LfKef
did not have signicant inuence on the post prandial
LDL-Chol level or the total cholesterol level.
Postprandial hypertriglyceridemia can cause
endothelial dysfunction that is recognized as an early
process of atherosclerosis even in healthy subjects
[3]. Both OxS and blood lipoprotein status are related
to the development of CVD. Recently it was noted that
the traditional CVD risk factors, in promoting OxS and
endothelial dysfunction, are the rst steps in a cascade
of pathological events [24]. OxS leads to an excess of
oxLDL and the higher levels of the circulating oxLDL,
even more than LDL-Chol, are strongly associated
with the increased incidence of metabolic syndrome
in people who are young and otherwise healthy [25].
OxLDL is an important determinant of structural changes
of the arteries even in asymptomatic persons [13,26].
Recent data suggest that an increased production
of atherogenic and inammatory oxLDL within the
vessel wall suppresses several immunity-related cells,
including regulatory T cells [27] which normally exert
antiatherogenic and anti allergic effects. It should
be noted that previous trials have shown the positive
effect of ME-3 on blood LDL, prolonging its resistance
to oxidation, lowering the content of oxLDL and BDC-
LDL and enhancing the total antioxidative capacity of
the blood [1,11,14]. The systemic inuence of LfME-3 on
the host´s OxS-load is seen in the decline of the values
of isoprostanes, which are accepted as an informative
marker for the body’s systemic OxS-burden [28]. It
seems that the systemic effect of LfME-3 starts by
alleviating OxS- and inammation-related abnormalities
in the intestinal cells, leading to altered composition of
lipoproteins (chylomicrons, VLDL, LDL and HDL) with
lower levels of harmful oxidation products. Improvement
of the luminal environment of the gastrointestinal (GI)
tract as well as within the intestinal cells, by improving
glutathione levels and decreasing lipid peroxidation
Figure 3.
Fecal concentration of Lactobacillus sp., L. fermentum and L. fermentum ME-3 before and after consuming LfKef as determined by RT-PCR.
37
An antioxidant probiotic reduces postprandial lipemia and oxidative stress
has been conrmed by Truusalu [29,30] in a mouse
experimental S. typhimurium infection. Involvement
of the glutathione system is fundamental as reduced
glutathione (GSH) is both a crucial antioxidant and a
principal redox-controller for a number of processes in
cells. Some lipid hydroperoxides in food may escape
from reduction by glutathione peroxidase in the GI tract
and enter the circulation [31]. Consumption of antioxidant
probiotic LfME-3, which produces glutathione and
has complete glutathione redox cycle enzymes (Gp
x
and GRed), may contribute to the reduction of lipid
hydroperoxides in the GI tract and in hepatocytes and
prevent them from entering the circulation [32].
The antioxidant activity of HDL can be expressed
through multiple mechanisms [33]. PON is an
antioxidant enzyme associated with HDL in human
serum that hydrolyzes oxidized phospholipids and
inhibits the LDL oxidation that is otherwise an important
step in atherogenesis. In animals, the addition of
oxidized lipids to the circulation reduces PON activity,
and diets rich in oxidized fat accelerate the development
of atherosclerosis [34]. Removal and inactivation
of lipid peroxides which accumulate during LDL
oxidation may be the central mechanism accounting
for HDL antioxidative properties [35]. Recent studies
have shown that when HDL particles have poor bio-
quality (antioxidant properties and anti atherosclerotic
potency), they may have even inammatory effect [35].
Indeed, the antioxidant action of HDL is recognized
as one of the principal mechanisms mediating its
cardioprotective effect [36]. The increase in PON
activity by LfKef consumption shows that protection
of plasma lipo protein particles against oxidative
modication by ROS is improved. PON inhibits athe-
ro ge nesis by hydrolyzing lipid hydroperoxides and
cho lesterol ester hydroperoxides, reducing pero xides
to the hydroxides, and hydrolyzing homo cycteine
thiolactone which prevents protein homo cycteinylation
[37,38]. Thus, an elevation of PON activity should
decrease the level of oxLDL. We have established
statistically signi cant nega tive correlation bet ween the
PON activity and oxLDL.
As established in a murine model of S. typhimurium
infection (article in press), the antioxidant probiotic
LfME-3 may interfere with the postprandial status of
lipoprotein metabolism by increasing the production of
the anti-inammatory cytokine IL-10 and by decreasing
the production of the pro-inammatory cytokine TNF-α
in ileal mucosa and hepatocytes, hence lowering levels
of VLDL and TG and reducing formation of oxLDL.
Changes in VLDL production can be due to changes
in the amount of lipid per VLDL particle, the number of
particles secreted, or both.
According to our previous data, fecal recovery of
LfME-3 is detectable after consumption of probiotic
yoghurt, cheese and ker. LfME-3 fecal recovery was
particularly good when this strain was consumed with
fermented goat milk containing only 2 starter strains with
ME-3 as a probiotic adjunct [1]. The food vehicle for the
probiotic in the present study was ker and resulted in
a signicant increase in the fecal concentration of the
overall L. fermentum (that includes LfME-3). It seems
that ker may be a less ideal vehicle for ME-3 compared
with fermented goat´s milk. Though ME-3 tolerates
technological handling well, surviving the ker production
and remaining viable during the shelf-life, the interactions
of ME-3 with the microbial species in the ker grain and
their effect on ME-3 viability are not claried yet.
Thus, every study opens addi tional aspects and
has certain limitations but it is note worthy that our
pilot study is the rst to explore the possibility that a
traditional foodstuff enriched with a special probiotic
may have a signicant positive impact on postprandial
lipemic response, OxS and lipoprotein status. Thus, this
information is worth further investigation using large
scale studies.
Acknowledgments
Estonian Science Foundation (grant 6588); Targeted
nancing of The Ministry of Education and Science
of Estonia (TARBK0411) and by the European Union
through the European Regional Development Fund.
References
[1] Kullisaar T., Songisepp E., Mikelsaar M., Zilmer
K., Vihalemm T., Zilmer M., Antioxidative probiotic
fermented goats’ milk decreases oxidative stress-
mediated atherogenicity in human subjects, Br. J.
Nutr., 2003, 90, 449-456
[2] Mikelsaar M., Zilmer M., Lactobacillus fermentum
ME-3 an antimicrobial and anti oxidative probiotic,
Microb. Ecol. Health Dis., 2009, 21, 1-27
[3] Bae J.-H., Bassenge E., Kim K.-B., Kim Y.-
N., Kim K.-S., Lee H.-J., et al., Postprandial
hypertriglyceridemia impairs endothelial function
by enhanced oxidative stress, Atherosclerosis,
2001, 155, 517-523
[4] Hopps E., Noto D., Caimi G., Averna M.R., A novel
component of the metabolic syndrome: The oxidative
stress, Nutr. Metab. Cardiovasc. Dis., 2010, 20, 72-77
38
T. Kullisaar
et al.
[5] Jackson K.G., Armah C.K., Minihane A.M., Meal
fatty acids and postprandial vascular reactivity,
Biochem. Soc. Trans., 2007, 35, 451-453
[6] Perez-Martinez P., Ordovas J.M., Garcia-Rios A.,
Delgado-Lista J., Delgado-Casado N., Cruz-Teno
C., et al., Consumption of diets with different type
of fat inuences triacylglycerols-rich lipoprotein
particle number and size during the postprandial
state, Nutr. Metab. Cardiovasc. Dis., In press, DOI:
10.1016/j.numecd.2009.07.008
[7] Salminen S., Bouley C., Boutron-Ruault M.C.,
Cummings J.H., Franck A., Gibson G.R., et al.,
Functional food science and gastrointestinal
physiology and function, Br. J. Nutr., 1998, 80,
S147-S171
[8] Salminen S., Human studies on probiotics. Aspects
of scientic documentation, Scand. J. Nutr., 2001,
45, 8-12
[9] Sepp E., Julge K., Vasar M., Naaber P., Björksten B.,
Mikelsaar M., Intestinal microora of Estonian and
Swedish infants, Acta Pediatr., 1997, 86, 956-961
[10] Kullisaar T., Zilmer M., Mikelsaar M., Vihalemm
T., Annuk H., Kairane C., et al., Two antioxidative
lactobacilli strains as promising probiotics, Int. J.
Food Microbiol., 2002, 72, 215-224
[11] Songisepp E., Kals J., Kullisaar T., Mändar R., Hütt
P., Zilmer M., et al., Evaluation of the functional
efcacy of an antioxidative probiotic in healthy
volunteers, Nutr. J., 2005, 20, 4-22
[12] Järvenpää S., Tahvonen R.L., Ouwehand A.C.,
Sandell M., Järvenpää E., Salminen S., A probiotic,
Lactobacillus fermentum ME-3, has antioxidative
capacity in soft cheese with different fats, J. Dairy
Sci., 2007, 90, 3171-3177
[13] Kals J., Kampus P., Zilmer K., Impact of oxidative stress
on arterial elasticity in patients with atherosclerosis,
Am. J. Hypertens., 2006, 19, 902-908
[14] Kaur S., Kullisaar T., Mikelsaar M., Eisen M.,
Rehema A., Vihalemm T., et al., Successful
management of mild atopic dermatitis in adults with
probiotics and emollients, Cent. Eur. J. Med., 2008,
3, 215-220
[15] Kullisaar T., Mikelsaar M., Kaur S., Songisepp E.,
Zilmer K., Hütt P., et al., Probiotics, oxidative
stress inammation and diseases, In: Curic D.,
(Ed.), Proceedings of the Joint Central European
Congress (15-17 May 2008 Cavtat, Croatia),
Croatian Chamber of Economy, 2008, 1, 367-373
[16] Stsepetova J., Kullisaar T., Songisepp E., Zilmer
M., Mikelsaar M., Design of L. fermentum ME-3
strain-specic primers for detecting the cell number
in human feces by real-time PCR., Gastroenterol.
Sankt-Peterburg, 2009, 4, A26-A27, (in Russian)
[17] Ahotupa M., Marniemi J., Lehtimäki T., Talvinen K.,
Raitakari O.T., Vasankari T., et al., Baseline diene
conjugation in LDL lipids as a direct measure of in vivo
LDL oxidation, Clin. Biochem., 1998, 31, 257-261
[18] Schiavon R., Battaglia P., De Fanti E., FasolinA.,
Biasioli S., TargaL., et al., HDL3-related
decreased serum paraoxonase (PON) activity in
uremic patients: comparison with the PON allele
polymorphism, Clin Chim Acta, 2002, 324, 39-44
[19] Castillo M., Martin-Orue M.S., Manzanilla E.G.,
Badiola I., Martin M., Gasa J., Quantication
of total bacteria, enterobacteria and lactobacilli
populations in pig digesta by real-time PCR, Vet.
Microbiol., 2006, 114, 165-170
[20] Byun R., Nadkarni M.A., Chhour K.L., Martin, F.E.,
Jacques N.A., Hunter N., Quantitative analysis of
diverse lactobacillus species present in advanced
caries, J. Clin. Microbiol., 2004, 42, 3128-3136
[21] Klaenhammer T., Altermann E., Arigoni F., Bolotin
A., Breidt F., Broadbent J., et al., Discovering
lactic acid bacteria by genomics, Antonie van
Leeuwenhoek, 2002, 82, 29-58
[22] Fisher-Wellman K., Bloomer R.J., Macronutrient
specic postprandial oxidative stress: relevance
to the development of insulin resistance, Curr.
Diabetes Rev., 2009, 5, 228-238
[23] Lopez-Miranda J., Perez-Martinez P., Marin
C., Moreno J.A., Gomez P., Perez-Jimenez F.,
Postpran dial lipoprotein metabolism, genes and
risk of cardiovascular disease, Curr. Opin. Lipidol.,
2006, 17,132-138
[24] Dzau V.J., Antman E.M., Black H.R., Hayes D.L.,
Manson J.E., Plutzky J., et al., The cardiovascular
disease continuum validated: clinical evidence of
improved patient outcomes: part I: Pathophysiology
and clinical trial evidence (risk factors through
stable coronary artery disease), Circulation, 2006,
114, 2850-2870
[25] Holvoet P., Lee D.H., Steffes M., Gross M., Jacobs
D.R. Jr., Association between circulating oxi-
dized low-density lipoprotein and incidence of the
metabolic syndrome, JAMA, 2008, 299, 2287-2293
[26] Kampus P., Kals J., Ristimäe T., Muda P., Ulst K.,
Zilmer K., et al.. Augmentation index and carotenoid
intima-media thickness are differently related to
age, C-reactive protein and oxidized low-density
lipoprotein, J. Hypertens., 2007, 25, 132-138
[27] George J., Mechanisms of disease: the evolving
role of regulatory T cells in atherosclerosis, Nat.
Clin. Pract. Cardiovasc. Med., 2008, 5, 531-540
[28] Halliwell B., Gutteridge J.M.C., (Eds.), Free radicals
in biology and medicine, 3
rd
Ed., Oxford University
Press, New York, 1999
39
An antioxidant probiotic reduces postprandial lipemia and oxidative stress
[29] Truusalu K., Naaber P., Kullisaar T., Tamm H.,
Mikelsaar R.-H., Zilmer K., et al., The inuence of
antibacterial and antioxidative probiotic lactobacilli
on gut mucosa in a mouse model of Salmonella
infection, Microb. Ecol. Health Dis., 2004, 16,
180-187
[30] Truusalu K., Mikelsaar R.-H., Naaber P., Karki
T., Kullisaar T., Zilmer M., et al., Eradication of
salmonella Typhimurium infection in a murine
mudel of tophoid fever with the combination of
probiotic Lactobacillus fermentum ME-3 and
ooxacin, BMC Microbiol., 2008, 8, 132-136
[31] Chui M.H., Greenwood C.E., Antioxidant vitamins
reduce acute meal-induced memory decits in
adults with type 2 diabetes, Nutr. Res., 2008, 28,
423-429
[32] Kullisaar T., Songisepp E., Aunapuu M., Kilk K.,
Arend A, Mikelsaar M., et al., Complete glutathione
system in probiotic L. fermentum ME-3, Appl.
Biochem. Microbiol., 2010, 46, 481-486
[33] Bruckert E., Hansel B., HDL-c is a powerful lipid
predictor of cardiovascular diseases, Int. J. Clin.
Pract., 2009, 61, 1905-1913
[34] Sutherland W.H., Walker R.J., de Jong S.A.,
van Rij A.M., Phillips V., Walker H.L., Reduced
postprandial serum paraoxonase activity after a
meal rich in used cooking fat, Arterioscler. Thromb.
Vasc. Biol., 1999, 19, 1340-1347
[35] Navab M., Anantharamaiah G.M., Reddy S.T.,
Van Lenten B.J., Ansell B.J., Fogelman A.M.,
Mechanisms of disease: proatherogenic HDL -
an evolving eld, Nat. Clin. Pract. Endocrin. Met.,
2006, 2, 504-511
[36] Hansel B., Giral P, Nobecourt E., Clantepie S.,
Bruckert E., Chapman M.J., et al., Metabolic
syndrome is associated with elevated oxidative
stress and dysfunctional dense high-density
lipoprotein particles displaying impaired
antioxidative activity, J. Clin. Endocrin. Met., 2006,
89, 4963-4971
[37] Beltowski J., Wojcicka G., Jamroz A., Leptin
decreases plasma paraoxonase 1 (PON1) activity
and induces oxidative stress: the possible novel
mechanism for proatherogenic effect of chronic
hyperleptinemia, Atherosclerosis, 2003, 170, 21-29
[38] Durrington P.N., Mackness B., Mackness M.I.,
Paraoxonase and atherosclerosis, Arterioscler.
Thromb. Vasc. Biol., 2005, 21, 473-480
40
... In the same study with rats, TG, TC, and LDL-C levels were decreased while HDL-C value was increased after kefir consumption (Ali et al., 2020). Kullisaar et al. (2011) has shown that kefir enriched with probiotic Lactobacillus fermentum ME-3 reduces postprandial lipemia and oxidative stress (Kullisaar et al., 2011). Ghizi et al. (2021) demonstrated that, after kefir consumption, patients with metabolic syndrome have lower TG and LDL-C values and higher HDL-C values. ...
... In the same study with rats, TG, TC, and LDL-C levels were decreased while HDL-C value was increased after kefir consumption (Ali et al., 2020). Kullisaar et al. (2011) has shown that kefir enriched with probiotic Lactobacillus fermentum ME-3 reduces postprandial lipemia and oxidative stress (Kullisaar et al., 2011). Ghizi et al. (2021) demonstrated that, after kefir consumption, patients with metabolic syndrome have lower TG and LDL-C values and higher HDL-C values. ...
... However, in that study, only probiotic supplements were used and the duration of the study was 6 weeks, which was shorter than the duration of our intervention. Kullisaar et al. (33) reported an increase in HDL cholesterol and paraoxonase, levels which contradicts the results of our study. However, they used ke r enriched with lactobacillus fermentum; therefore other components of ke r may have in uenced the results. ...
Preprint
Full-text available
Background: Cardiovascular disease is one of the leading causes of death worldwide. Evidence suggests that alterations in the gut microbiome could play a role in cardiovascular diseases including heart failure. Objective: The purpose of this study was to evaluate the effect of synbiotics on serum paraoxonase 1(PON1), (sCD163/sTWEAK) and lipid profile, which are involved in heart failure in patients with chronic heart failure. Method: In this triple-blind randomized clinical trial, 90 eligible patients were included in the study. They were randomly assigned to receive one capsule (500 mg) of synbiotics or a placebo per day for 10 weeks. serum paraoxonase 1(PON1), (sCD163/sTWEAK), and lipid profile were measured at the beginning and end of the study. The data were analyzed by SPSS 24, and the p-value <0.05 was considered statistically significant. Result: Among 90 patients who met the inclusion criteria, 80 patients completed the study. At the end of the intervention, and after adjusting for the effect of confounders, the levels of total cholesterol (TC), LDL-c, Triglyceride and TC/HDL-C showed a significant decrease. However, we found no significant differences between the groups when considering other study indices. Conclusion: A favorable effect of synbiotics on the lipid profile of patients with heart failure was observed, but no statistically significant effect was found on paraoxinase1, sCD163, and sTWEAK factors Registration number: IRCT20091114002709N55
... It was found that thiobarbituric acid reactive substances (TBARS) increased and red blood cell reducing glutathione (GSH) and superoxide dismutase (SOD) decreased after HFM in patients with T2D with macrovascular complications, illustrating that damage to antioxidant capacity might lead to endothelial dysfunction (58). Fat load leads to aggravation of oxidative stress and augment of postprandial lipemia, both of which promote the development of CVD (59). ...
Article
Full-text available
Postprandial lipemia plays an important role in the formation, occurrence, and development of atherosclerosis, and it is closely related to coronary heart disease and other diseases involving endothelial dysfunction, oxidative stress, inflammation, and other mechanisms. Therefore, it has become a focus area for further research. The studies on postprandial lipemia mainly include TG, TRL, VLDL, CM, and remnant cholesterol. Diurnal triglyceride patterns and postprandial hyperlipidemia are very relevant and are now insufficiently covered. The possible mechanisms between postprandial lipemia and cardiovascular disease have been reviewed in this article by referring to relevant literature in recent years. The research progress on the effects of postprandial lipemia on endothelial function, oxidative stress, and inflammation is highlighted. The intervention of postprandial lipemia is discussed. Non-medicinal intervention such as diet and exercise improves postprandial lipemia. As medicinal intervention, statin, fibrate, ezetimibe, omega-3 fatty acids, and niacin have been found to improve postprandial lipid levels. Novel medications such as pemafibrate, PCSK9, and apoCIII inhibitors have been the focus of research in recent years. Gut microbiota is closely related to lipid metabolism, and some studies have indicated that intestinal microorganisms may affect lipid metabolism as environmental factors. Whether intervention of gut microbiota can reduce postprandial lipemia, and therefore against AS, may be worthy of further study.
... In this way, supplementation with prebiotics may also reduce TC and LDL levels (Zhuang et al., 2012). Furthermore, supplements with prebiotics can reduce the amount of oxidized LDL, which is one of the MDA-enhancing agents (Kullisaar et al., 2011). In our study, WMDF treatment increased the relative abundance of probiotics such as Bifidobacterium and the production of short-chain fatty acids, showing a prebiotic effect. ...
Article
Full-text available
Dietary fiber intake is associated with a low incidence of suffering from metabolic syndrome. To explore the potential health benefits of walnut meal dietary fiber (WMDF) as a prebiotic, the functional role of WMDF on metabolic syndrome in mice induced by high fructose diet (20%, HF) was investigated. The animal experiment results showed that administration of WMDF to HF-fed mice alleviated abnormal body weight gain, insulin resistance, oxidative stress, lipid metabolism disorders and inflammation. Histopathological observation confirmed the preventative effects of WMDF on hepatic steatosis and vascular endothelial dysfunction. Also, WMDF intake increased the production of acetic acid, propionic acid and butyric acid. Moreover, WMDF ingestion effectively improved the disorder of gut microbiota caused by HF, increased the diversity of gut microbiota and the relative abundance of short-chain fatty acids-producing bacteria. These findings demonstrate WMDF can be used as a prebiotic to prevent HF-induced metabolic syndrome.
... Especially valuable is information about the Lf strains that have in addition to common properties also the strainspecific beneficial effects on the host. A number of studies (in vitro, clinical randomized trials, clinical randomized double blind trials) have highlighted that human origin Lactobacillus fermentum ME-3 (DSM14241, LfME-3) has several specific properties including antiatherogenic and anti-oxidative effects, possible anti-diabetic influence, ability to manage multiple protective systems like superoxide dismutase, glutathione system, etc [2][3][4]. For example, probiotic Lf ME-3 has two special enzymes needed for the redox cycle of glutathione (glutathione peroxidase and glutathione reductase) confirmed by the immunohistochemical method [5]. ...
Chapter
Full-text available
Ağız Diş ve Çene Radyolojisi alanında yapay zeka
Article
Full-text available
Ischemic and hemorrhagic strokes are the most common known cerebrovascular disease which can be induced by modifiable and non-modifiable risk factors. Age and race are the most common non-modifiable risk factors of stroke. However, hypertension, diabetes, obesity, dyslipidemia, physical inactivity, and cardiovascular disorders are major modifiable risk factors. Understanding the molecular mechanism mediating each of these risk factors is expected to contribute significantly to reducing the risk of stroke, preventing neural damage, enhancing rehabilitation, and designing suitable treatments. Abnormalities in the structure of the blood-brain barrier and blood vessels, thrombosis, vasoconstriction, atherosclerosis, reduced cerebral blood flow, neural oxidative stress, inflammation, and apoptosis, impaired synaptic transmission, excitotoxicity, altered expression/activities of many channels and signaling proteins are the most knows mechanisms responsible for stroke induction. However, the molecular role of risk factors in each of these mechanisms is not well understood and requires a lot of search and reading. This review was designed to provide the reader with a single source of information that discusses the current update of the prevalence, pathophysiology, and all possible molecular mechanisms underlying some major risk factors of stroke namely, hypertension, diabetes mellitus, dyslipidemia, and lipid fraction, and physical inactivity. This provides a full resource for understanding the molecular effect of each of these risk factors in stroke.
Article
Context: Kefir, a traditional, fermented-milk beverage, has increasingly been promoted for various health benefits. The evidence from systematic reviews, however, is limited. Objective: Evidence from randomized controlled trials testing oral consumption of fermented-milk kefir on any outcome of human health or disease. Data sources: A systematic search of 4 electronic databases (PubMed, Scopus, Allied and Complementary Medicine Database, and Cochrane Trials) from inception to July 31, 2021, was conducted. Data extraction: Data extraction and risk-of-bias assessments were conducted by 2 reviewers independently. Data analysis: A total of 18 publications reporting the results of 16 studies were included. Per the narrative analysis, fermented-milk kefir may have potential as a complementary therapy in reducing oral Streptococcus mutans, thereby reducing dental caries risk, and in Helicobacter pylori eradication therapy. Kefir may further aid treatment of adult dyslipidemia and hypertension, although evidence was very limited. Safety was only assessed in 5 of the 18 included publications, and 12 of the studies had an overall high risk for bias. Conclusion: Kefir is a dairy product with a unique microbiological profile that appears to be a safe for generally healthy populations to consume. However, efficacy and safety data from high-quality human trials are essential before any recommendations may be made for conditions of the oral and gastric microbiota and metabolic health. Systematic review registration: PROSPERO registration no. CRD42020211494.
Article
Background Metabolic syndrome (MetS) is closely related to lipid disorders and increased oxidant stress, and is associated with cardiovascular diseases.Objective The purpose of this research was to examine thiol/disulfide homeostasis and oxidative stress in MetS patients with postprandial lipemia (PPL) during fasting by considering time-dependent changes in the postprandial period.Methods Twenty-five patients with MetS and 25 healthy controls underwent a 6-h oral fat tolerance test. Dynamic thiol/disulfide homeostasis (native thiol, disulfide, and total thiol) values and total oxidant status (TOS), total antioxidant status (TAS), and Oxidative Stress Index (OSI): (TOS/TAS) were evaluated.ResultsIncreased levels of disulfide, and higher disulfide/native thiol ratio, TOS, and OSI values were observed at fasting and in the postprandial period in MetS compared to the control group, peaking at the 4th hour in both groups (p < 0.05). ROC analysis showed that both fasting and 4th hour disulfide/native thiol ratios exhibited the highest values. Higher disulfide/native thiol ratio values were observed at the 4th hour and higher OSI in the 2nd hour in the upper tertiles for MetS (p < 0.05).Conclusions An increased disulfide/native thiol ratio and OSI level elevation in MetS may be closely associated with PPL. The disulfide/native thiol ratio in MetS subjects with PPL may play a role for evaluating oxidative stress, especially in postprandial 4th hour.
Article
Full-text available
The purpose of the present study was to test the ability of selected probiotic Lactobacillus spp. (with high antimicrobial and antioxidative potential in in vitro tests) to compete with invasive Salmonella enterica serovar Typhimurium infection and protect the gut mucosa against excessive oxidative stress during inflammatory tissue damage in a mouse model. In total 47 mice were divided into four groups. The control group was treated with either phosphate-buffered saline (PBS, group 1) or alternatively 0.5)/10 8 CFU/ml of human intestinal lactobacilli, namely Lactobacillus fermentum ME-3 (DSM 14241) and Lactobacillus acidophilus 0.5)/10 8 CFU /ml (group 4), daily for 15 days. Group 2 and 3 mice were challenged with a clinical isolate of S. Typhimurium (0.5)/10 5 CFU/ml). The group 3 mice were additionally orally inoculated with lactobacilli for 5 days before and 10 days after the challenge with S. Typhimurium. Counts of salmonellae and lactobacilli in blood, intestine, liver and spleen were recorded; the morphological indices of inflammation in the same organs and oxidative stress-indicative biochemical status (lipid peroxidation, total antioxidative activity, redox ratio of glutathione and iron content) of gut mucosa were assessed on the 10th day after oral inoculation. The administration of probiotic lactobacilli of human origin did not increase the total count of lactobacilli in the terminal ileum of mice; however, hyperplasia of lymph nodes was registered in group 4 mice compared with group 1 mice. In the gut the lactobacilli that were antagonistic against S. Typhimurium in vitro neither decreased the count of salmonellae nor prevented the spread of the infection. In contrast, the antioxidative potential of L. fermentum ME-3 influenced gut mucosa by the reduction of iron level (pro-oxidant), lipid peroxidation and increased total antioxidative activity, glutathione redox value. We conclude that properties of probiotic lactobacilli assessed in vitro could be expressed differentially during in vivo study. The possibility to influence the pro-and antioxidant balance by specific probiotic lactobacilli with antioxidative properties in the course of inflammatory tissue damage could be further explored.
Article
Full-text available
Atopic dermatitis is characterized by impaired skin and mucous membrane barrier function. Measures improving barrier integrity decrease the influence of environmental factors that might exacerbate inflammation. Ten adult patients with mild-to-moderate atopic dermatitis consumed for three months fermented with potent antioxidative probiotic, L. fermentum ME-3 (DSM 14241) goat milk 200 mg/day. A control group consisted of six patients, not supplemented by probiotic. All patients used emollients regularly. Skin iron levels, glutathione redox ratios (GSSG/GSH), diene conjugate (DC) amounts, blood glutathione status, oxidized low-density lipoprotein (oxLDL), and total antioxidativity was measured at the baseline and after three months. A significant decrease in skin iron levels, DC amounts, and glutathione redox ratio occurred in the probiotic-supplemented group compared to the control group (P < 0.05 for all indices). In the same group, blood levels of oxLDL decreased (p < 0.05), and GSH levels increased (P < 0.001) with concomitant improvement in the GSSG/GSH ratio. Blood antioxidativity markers also showed an improvement. The results of our study demonstrate that regular use of probiotics with antioxidative properties coupled with the use of lipid-containing emollients considerably decreases inflammation and concomitant oxidative stress in adult patients with mild-to-moderate atopic dermatitis. This effect was observed both in the skin and in the blood.
Article
Full-text available
There is much information about glutathione (GSH) in eukaryotic cells, but relatively little is known about GSH in prokaryotes. Without GSH and glutathione redox cycle lactic acid bacteria (LAB) cannot protect themselves against reactive oxygen species. Previously we have shown the presence of GSH in Lactobacillus fermentum ME-3 (DSM14241). Results of this study show that probiotic L. fermentum ME-3 contains both glutathione peroxidase and glutathione reductase. We also present that L. fermentum ME-3 can transport GSH from environment and synthesize GSH. This means that it is characterized by a complete glutathione system: synthesis, uptake and redox turnover ability that makes L. fermentum ME-3 a perfect protector against oxidative stress. To our best knowledge studies on existence of the complete glutathione system in probiotic LAB strains are still absent and glutathione synthesis in them has not been demonstrated.
Article
Full-text available
The metabolic syndrome (MS) represents a cluster of cardiovascular (CV) risk factors associated to CV disease and type 2 diabetes. It is still under debate whether MS is a mere aggregation of risk factors or it represents a clinical entity with visceral obesity as underlying pathophysiological trigger. The publication of several diagnostic criteria of MS by scientific associations or experts panels reflects this uncertainty in understanding the real nature of MS. Besides the metabolic disturbances of MS, as visceral obesity, hypertriglyceridemia, low HDL cholesterol, hypertension and hyperglycemia, novel mechanisms of arterial damage have been identified. This paper reviews the evidence showing that MS and MS factors are characterized by increased oxidative stress, a relevant factor contributing to the development of metabolic and cardiovascular complications. In the next future, the measure of plasma oxidative stress may contribute to identify a subset of MS patients at increased CV risk, candidates to more intensive therapies.
Article
Full-text available
The paper lays out the short scientific history and characteristics of the new probiotic Lactobacillus fermentum strain ME-3 DSM-14241, elaborated according to the regulations of WHO/FAO (2002). L. fermentum ME-3 is a unique strain of Lactobacillus species, having at the same time the antimicrobial and physiologically effective antioxidative properties and expressing health-promoting characteristics if consumed. Tartu University has patented this strain in Estonia (priority June 2001, patent in 2006), Russia (patent in 2006) and the USA (patent in 2007). The paper describes the process of the identification and molecular typing of this probiotic strain of human origin, its deposition in an international culture collection, and its safety assessment by laboratory tests and testing on experimental animals and volunteers. It has been established that L. fermentum strain ME-3 has double functional properties: antimicrobial activity against intestinal pathogens and high total antioxidative activity (TAA) and total antioxidative status (TAS) of intact cells and lysates, and it is characterized by a complete glutathione system: synthesis, uptake and redox turnover. The functional efficacy of the antimicrobial and antioxidative probiotic has been proven by the eradication of salmonellas and the reduction of liver and spleen granulomas in Salmonella Typhimurium-infected mice treated with the combination of ofloxacin and L. fermentum strain ME-3. Using capsules or foodstuffs enriched with L. fermentum ME-3, different clinical study designs (including double-blind, placebo-controlled, crossover studies) and different subjects (healthy volunteers, allergic patients and those recovering from a stroke), it has been shown that this probiotic increased the antioxidative activity of sera and improved the composition of the low-density lipid particles (LDL) and post-prandial lipids as well as oxidative stress status, thus demonstrating a remarkable anti-atherogenic effect. The elaboration of the probiotic L. fermentum strain ME-3 has drawn on wide international cooperative research and has taken more than 12 years altogether. The new ME-3 probiotic-containing products have been successfully marketed and sold in Baltic countries and Finland.
Article
1. Oxygen is a toxic gas - an introductionto oxygen toxicity and reactive species 2. The chemistry of free radicals and related 'reactive species' 3. Antioxidant defences Endogenous and Diet Derived 4. Cellular responses to oxidative stress: adaptation, damage, repair, senescence and death 5. Measurement of reactive species 6. Reactive species can pose special problems needing special solutions. Some examples. 7. Reactive species can be useful some more examples 8. Reactive species can be poisonous: their role in toxicology 9. Reactive species and disease: fact, fiction or filibuster? 10. Ageing, nutrition, disease, and therapy: A role for antioxidants?
Article
The assessment of probiotic health effects has to be based on human studies. Knowledge of the mechanisms is an important factor, complemented with target functions and biomarkers that are accepted as relevant to the state of health and well-being or reduction in risk of disease. Human studies should preferably be conducted by at least two independent research groups in different locations. In conclusion, well-designed human studies with requirements similar to those for pharmaceutical studies are required to demonstrate health benefits. Additionally, epidemiolo- gical studies or post-marketing surveillance can be recommended to assess both safety and efficacy of probiotics. Using these criteria, only a few health-promoting effects can be considered scientifically proven for specific strains. These include effects upon rotavirus diarrhoea, antibiotitic-associated diarrhoea and alleviation of lactose intolerance symptoms. The reported effects are strain-specific and product-specific. As more information is accumulating the evidence may be soon obtained for other health effects.
Article
Objectives: To additionally test validity of the recently developed method (LDL baseline diene conjugation, LDL-BDC) for determination of circulating oxidized LDL. Design and methods: A detailed comparison between the ultracentrifugation and heparin precipitation methods for LDL isolation was performed to test suitability of the fast precipitation method. Validity of LDL-BDC as an indicator of circulating oxidized LDL was tested by comparing LDL-BDC to results obtained by the immunological autoantibody method. Results: BDC values in LDL isolated by heparin precipitation did not differ from those isolated by sequential ultracentrifugation. While highest amount of diene conjugation was found in LDL (40% of that in serum), substantial amounts were also found in VLDL (31%) and HDL (25%). When analyzed in the same samples, assays for the titer of autoantibodies against oxidized LDL and LDL-BDC were found to show good correlation (r = 0.57, p = 0.001, n = 29). Conclusions: These results, together with thus far conducted studies on clinical applicability of the method, indicate that LDL-BDC is a promising candidate in search for a method for estimation of LDL oxidation in vivo.
Article
Previous evidence suggests that dietary fat could influence the composition and size of triacylglycerols-rich lipoproteins (TRL). In a controlled intervention study on healthy subjects, we evaluated the influence of 3 dietary interventions, with different types of fat on postprandial TRL particle size and number. Volunteers followed three different diets for four weeks each, according to a randomized crossover design. Western diet: 15% protein, 47% carbohydrates (CHO), 38% fat (22% saturated fatty acid (SFA)); Mediterranean diet: 15% protein, 47% CHO, 38% fat (24% monounsaturated fatty acid (MUFA)); high CHO enriched with ALNA diet: 15% protein, 55% CHO, <30% fat (8% polyunsaturated fatty acid (PUFA)). After a 12-h fast, volunteers consumed a breakfast with 1g fat and 7 mg cholesterol per kg body weight and a fat composition similar to that consumed in each of the diets: Butter meal: 35% SFA; Olive oil meal: 36% MUFA; Walnut meal: 16% PUFA, 4% α-linolenic acid. Tryglicerides (TG) in TRL (large and small TRL) were determined by ultracentrifugation and size and number of lipoprotein particles were measured with Nuclear Magnetic Resonance Spectroscopy at different time points. The olive oil meal reduced the number of total TRL postprandial particles compared with the other meals (P=0.002). Moreover, the olive oil meal also increased the TRL particle size compared with the walnut meal (P=0.001). Our data showed that short-term intake of the Mediterranean diet and the acute intake of an olive oil meal lead to the formation of a reduced number and higher-size TRL particle compared with other fat sources. These novel findings have implications for understanding the postprandial lipoprotein mechanisms, and could favour the lower cardiovascular risk in Mediterranean countries.
Article
The prevalence of obesity and its associated disorders [e.g., insulin resistance, type 2 diabetes and cardiovascular disease (CVD)] has seen a rapid increase in recent years. As such, understanding the mechanisms underlying diet-induced insulin resistance has been a topic of interest. In line with this notion, postprandial oxidative stress has received considerable attention over the past several years due to its involvement in the etiology of the above mentioned conditions. In fact, postprandial oxidative stress has been suggested to be the unifying mechanism in the connection between insulin resistance, Type 2 diabetes and CVD. In addition to this growing association, recent data are now available suggesting a causal role for such prooxidant stress in the development of insulin resistance. This review is intended to provide an overview of literature pertaining to the role of free radical production following feeding, as related to the development of insulin resistance, Type 2 diabetes and CVD.