Comparative characterization of mesenchymal bone marrow stromal cells at early and late stages of culturing

Article (PDF Available)inBiology Bulletin 35(2):132-138 · March 2008with43 Reads
DOI: 10.1134/S1062359008020064
Abstract
The mesenchymal stromal cell is a multipotent precursor of osteoblasts, adipocytes, and some other cell types. In this study, a comparative analysis of cultured mesenchymal stromal cells from the rat bone marrow at the early and late stages of subculturing has been performed using molecular genetic and cytological methods. The culture has undergone 11 passages during 140 days. Upon long-term culturing, the mesenchymal stromal cells have proved to lose their potential for adipogenic differentiation but preserve the potential for osteogenesis. Morphological characters typical of osteogenic differentiation can be observed at the earlier stages of culturing (passages 1–4) but disappear at later stages (passages 9–11), despite mineralization of the extracellular matrix and the expression of osteogenic differentiation markers. A comparative analysis of the proliferation potential of stromal cells has shown that differences in the period of cell population doubling at the early and later stages of culturing are insignificant. An almost complete arrest of cell growth has been observed in the middle of the culture period (passages 5 and 6).
ISSN 1062-3590, Biology Bulletin, 2008, Vol. 35, No. 2, pp. 132–138. © Pleiades Publishing, Inc., 2008.
Original Russian Text © M.N. Kozhevnikova, A.S. Mikaelyan, I.A. Payushina, V.I. Starostin, 2008, published in Izvestiya Akademii Nauk, Seriya Biologicheskaya, 2008,
No. 2, pp. 156–162.
132
INTRODUCTION
Mesenchymal stromal cells (MSC), first found in
the stroma of hematopoietic organs (Friedenstein and
Luria, 1980), have a status of multipotent stem cells and
can give rise to adipogenic, osteogenic chondrogenic,
and other cell lineages. In the human bone marrow,
MSC comprise an extremely small cell population
(0.01-0.001% of the total cell number) capable of
adhering to the surface of cell culture plasticware.
Adhesion to the plastic and other substrates, which is
essential for MSC proliferation, provides a criterion for
their identification (Dominici et al., 2006). Initially,
MSC were regarded only as cells of the bone marrow
stroma that organize their hematopoietic microenviron-
ment. In addition to the bone marrow, other sources of
MSC have been identified. They include fat tissue,
umbilical cord blood, and several embryonic tissues.
The International Society for Cellular Therapy
established three minimal criteria for defining multipo-
tent MSC (Dominici et al., 2006). These are (1) adhe-
sion to plasticware under standard culture conditions;
(2) expression of cell surface antigens CD90, CD105,
and CD73; and (3) the ability to differentiate into osteo-
blasts, adipocytes, and chondroblasts in vitro.
The interest of many researches in MSC is
accounted for by the wide differentiation potential of
these cells and their ability to support proliferation of
hematopoietic stem cells upon their cotransplantation,
which offer ample opportunities for using them in cell
and gene therapy. However, the use of MSC in therapy
makes in necessary to produce them in large amounts.
This is possible only by means of long-term in vitro
culturing, which, in turn, is an appropriate model for
studies on the mechanisms of MSC self-maintenance,
directional differentiation, and senescence, which have
priority in stem cell biology.
The multipotency of MSC declines in the course of
long-term culturing. It was shown, for example, that
cultured MSC after 12 passages manifested the signs of
senescence and lost the potential for adipogenic differ-
entiation (DiGirolamo et al., 1999). According to other
authors who studied cultures of human bone marrow
MSC, only two out of five cultures proved to be capable
of osteogenesis after ten passages, whereas the poten-
tial for osteogenesis was retained in four out of five cul-
tures (Bonab et al., 2006). The results of many studies
confirm that MSC retain their osteogenic properties
under conditions of long-term culturing (Bruder et al.,
1997; DiGirolamo et al., 1999; Muraglia et al., 2000).
It is necessary to note that senescent cultures are char-
acterized by spontaneous accumulation of calcium in
the extracellular matrix (DiGirolamo et al., 1999).
An MSC culture at early passages is heterogeneous
and contains at least two morphologically distinct cell
types: slowly dividing large, flattened cells and rapidly
dividing spindle-shaped cells (Mets and Verdonk,
1981). At later passages, the culture becomes more
homogeneous, with the prevalence of the first cell type
(Prockop et al., 2001). There is also experimental evi-
dence that MSC cultured for a long time (118 days)
show the symptoms of cell senescence referred to as the
Comparative Characterization of Mesenchymal Bone Marrow
Stromal Cells at Early and Late Stages of Culturing
M. N. Kozhevnikova, A. S. Mikaelyan, O. V. Payushina, and V. I. Starostin
Kol’tsov Institute of Developmental Biology, Russian Academy of Sciences,
ul. Vavilova 26, Moscow, 119991 Russia
e-mail: mn_kozhevnikova@mail.ru
Received June 7, 2007
Abstract
—The mesenchymal stromal cell is a multipotent precursor of osteoblasts, adipocytes, and some other
cell types. In this study, a comparative analysis of cultured mesenchymal stromal cells from the rat bone marrow
at the early and late stages of subculturing has been performed using molecular genetic and cytological meth-
ods. The culture has undergone 11 passages during 140 days. Upon long-term culturing, the mesenchymal stro-
mal cells have proved to lose their potential for adipogenic differentiation but preserve the potential for osteo-
genesis. Morphological characters typical of osteogenic differentiation can be observed at the earlier stages of
culturing (passages 1–4) but disappear at later stages (passages 9–11), despite mineralization of the extracellu-
lar matrix and the expression of osteogenic differentiation markers. A comparative analysis of the proliferation
potential of stromal cells has shown that differences in the period of cell population doubling at the early and
later stages of culturing are insignificant. An almost complete arrest of cell growth has been observed in the
middle of the culture period (passages 5 and 6).
DOI:
10.1134/S1062359008020064
CELL BIOLOGY
BIOLOGY BULLETIN
Vol. 35
No. 2
2008
COMPARATIVE CHARACTERIZATION 133
Hayflick phenomenon. Morphologically, this is mani-
fested as follows: the cells begin to differ in shape and
size; their cytoplasm becomes granular, with many
inclusions; and cell debris appears in the culture
medium (Bonab et al., 2006).
Replicative senescence of MSC largely depends on
the animal species used as their source. According to
available data, human MSC are tolerant of 40–50 popu-
lation doublings (Stenderup et al., 2003), compared to
more than 100 doublings in the case of mouse MSC
(Meirelles and Nardi, 2003). The proliferation potential
of MSC decreases with an increase in the age of cell
donors (D’Ippolito et al., 1999, Baxter et al., 2004) and
in the number of passages in vitro (DiGirolamo et al.,
1999; Bonab et al., 2006).
However, in order to gain a deeper understanding of
the role of multiple subculturing in MSC senescence, it
is necessary to study in detail the molecular and cyto-
logical aspects of changes in the multipotent status of
MSC in the course of long-term culturing. Therefore,
the purpose of this study was to perform a comparative
analysis of rat MSC cultures at earlier and later stages
of culturing using cytological and molecular genetic
methods.
MATERIALS AND METHODS
MSC isolation and culturing.
Randombred Wistar
rats aged 5–6 months and weighing 120–150 g were
used in the study. The animals were eutanized to excise
the femora and tibiae. Bone epiphyses were cut off, and
the contents of the diaphyses were washed out with the
α
-MEM medium (Sigma, United States) using a 10-ml
syringe. The resulting bone marrow samples were sus-
pended in the medium by pumping with the syringe and
filtered through nylon gauze. After taking cell count,
the suspension (
5
×
10
6
cells/ml) was transferred to
plastic culture flasks with a surface area of 75 cm
2
(Greiner, Germany) and cultured by a standard method
in a CO
2
incubator (5% CO
2
) at 37
°
C, using the
α
-MEM medium without deoxyribonucleotides and
ribonucleotides supplemented with 2mM L-glutamine
(Sigma, United States) 10% bovine serum (Biolot, Rus-
sia), 100 U/ml penicillin, and 100
µ
g/ml streptomycin.
One day after establishing the primary culture, nonad-
hesive cells were removed, while adhesive cells were
washed with two portions of Dulbecco’s modified PBS,
pH 7.2–7.4 (Sigma), and the medium was replaced.
Thereafter, it was replaced every 3–4 days.
When the cells were grown to 90
100% confluence
(after 14–15 days), they were detached with 0.25%
trypsin solution (Biolot, Russia) in 1 mM EDTA, trans-
ferred to new flasks (
3
×
10
4
cells/ml), and cultured in
the
α
-MEM medium with 8% fetal calf serum but with-
out antibiotics until the cell layer reached 90–100%
confluence again. The total culture period was
140 days, including 11 passages.
Induction of osteogenic and adipogenic differen-
tiation of MSC.
MSC at a concentration of
2000 cells/cm
2
were seeded into 25-cm
2
flasks
(Greiner) for isolating total RNA or into 12-well plates
with a well area of 3.83 cm
2
(Greiner) for immunohis-
tochemical and histochemical analyses. To induce
osteogenesis, the cells were cultured in the growth
medium with
10
8
M dexamethasone, 50
µ
g/ml ascorbic
acid phosphate, and 10 mM glycerophosphate for
15
18 days, replacing the medium every 3–4 days. To
visualize mineral deposits in the extracellular matrix,
the cells were washed with PBS, fixed with 70% ethyl
alcohol for 1 h, washed with distilled water, and stained
with alizarin red (Sigma) at pH 4.1 for 10 min. After
washing in two portions of PBS, the cells were post-
stained with hematoxylin to visualize the nuclei.
To induce adipogenesis, the cells were cultured in
the growth medium with
10
6
M dexamethasone,
0.5 mM 3-isobutyl-1-methylxanthine, and 0.01 mg/ml
insulin for 14 days. To detect the appearance of cells
with fat droplets, the cultures were regularly examined
under a phase-contrast microscope with an Olympus
AH-3 camera (Germany). Multilocular adipocytes
appeared of day 14 of culturing. To visualize fat drop-
lets, cells were fixed with a formol–calcium mixture for
1 h, washed with tap water for 1 h, rinsed with distilled
water and 60% isopropanol, and stained with a fat red
O solution in isopropanol (Pearse, 1962). The his-
tochemical reaction was analyzed under the phase-con-
trast microscope.
Immunocytochemistry
. Osteogenic differentiation
was studied with monoclonal antibodies to a compo-
nent of the extracellular matrix, collagen type I
(Sigma), diluted 1 : 4000. The multipotent status of
MSC was evaluated using monoclonal antibodies to
CD90 (Abcam, England) diluted 1 : 50.
MSC cultured in 12-well plates (2000 cells per well)
were washed with PBS (
37°
C) and fixed with 3.7%
formaldehyde (for incubating with antibodies to CD90)
or chilled acetone (for incubating with antibodies to
collagen type I) for 10 min. After fixation, the cells
were washed with PBS and consecutively incubated in
0.25% Triton X-100 (Fluka, Germany) solution in Tris
buffer (TBS) with 0.1% Twin-20 for 30 min and in the
blocking solution (3% bovine serum albumin solution
in TBS with 0.1% Twin-20) for 30 min at
20°ë
. The
cells were then washed with PBS and incubated with
primary antibodies in the blocking solution at
37°ë
for
40 min. After washing in four portions of PBS for
5 min, the cells were incubated with secondary anti-
bodies labeled with Alexa Fluor 488 or 568 (Invitrogen,
United States) and diluted 1 : 1000 in the blocking solu-
tion at
37°ë
for 40 min. Thereafter, the cells were
washed with PBS and embedded under a coverslip in
glycerol with 4',6-diamidino-2-phenyl indole (DAPI)
(Vector, United States). Specificity of the primary anti-
bodies was tested in control reactions performed with
the secondary antibodies alone. Cell preparations were
134
BIOLOGY BULLETIN
Vol. 35
No. 2
2008
KOZHEVNIKOVA et al.
examined under a Leica DM RXA2 fluorescent micro-
scope (Germany) equipped with an appropriate set of
light filters and a digital camera. Image analysis was
performed with the Image J program.
RNA extraction from MSC and cDNA synthesis.
Total RNA was extracted from rat bone marrow MSC
with the TRI Reagent (Sigma), and cDNA synthesis on
the total RNA preparation (5
µ
g) was performed with
I-ILV reverse transcriptase and the oligo-d
(í)
15
primer
(Sileks M, Russia).
Construction of primers and polymerase chain
reaction (PCR)
. To construct primers for PCR, we per-
formed an analysis of relevant gene sequences using the
GeneBank database of the BLAST network (National
Center for Biotechnology Information, United States)
and the DNAStar program. To prevent the synthesis of
PCR products on a chromosomal DNA template, the
primers were constructed from different exons. PCR
with specific primers was performed on a cDNA tem-
plate using colored
Taq
polymerase (Sileks M) and a
Mastercycler thermal cycler (Eppendorf, Germany).
Amplification conditions varied depending on primer
nucleotide sequences (table).
The level of gene expression was estimated from
fluorescence intensity of bands obtained after electro-
phoresis of PCR products in 1% agarose gel, using a
GelDoc system with the QuantityOne program (Bio-
Rad, United States) for gel documentation and quanti-
tation of fluorescence.
Normalization of cDNA libraries
. For a quantita-
tive analysis of gene expression, cDNA was preliminar-
ily normalized to
β
-actin (table)
Morphological characterization of MSC cultures
at earlier and later passages and estimation of MSC
proliferation potential.
The proliferation potential of
MSC was estimated from the period of cell population
doubling. To determine this period, known numbers of
MSC were seeded into flasks, grown to obtain a conflu-
ent monolayer, and detached with trypsin and EDTA to
take cell count in a standard hemocytometer chamber,
with subsequent subculturing. The number of dou-
blings
D
was calculated by the formula
where
N
0
is the initial cell number, and
N
f
is the number
of cells forming the confluent monolayer. The state of
living MSC cultures was estimated by examining them
under an Olympus IX51 inverted phase-contrast micro-
scope (Germany) with a digital camera.
RESULTS
The long-term MSC culture was obtained as a result
of repeated subculturing of adhesive cells isolated from
the bone marrow of an adult rat.
A comparative analysis of the proliferation potential
of MSC over the entire culture period showed that the
period of MSC population doubling was 2.8 days at
N
f
/N
0
()
2
,log
Primers used in the study
Gene Primer nucleotide sequence Product size, bp Annealing temperature,
°
C Number of PCR cycles
β
-
actin
5' tacaacctccttgcagctcc 3' 598 60 30
5'ggatcttcagaggtagtctgtc 3'
OC
5' agactccggcgctacctcaa 3' 273 57 35
5' cagctgtgccgtccatactttc 3'
Runx2
5' ccgcacgacaaccgcaccat 3' 289 57.5 35
5' cgctccggcctacaaatctc 3'
CD90
5' gaacccagtcatcagcatcac 3' 496 55 30
5' gggcccaaccagtcacagag 3'
10
100
1000
0
Doubling period, days
124567911
Passage number
Fig. 1.
Doubling period of the rat bone marrow MSC popu-
lation in vitro (plotted on a logarithmic scale).
BIOLOGY BULLETIN
Vol. 35
No. 2
2008
COMPARATIVE CHARACTERIZATION 135
earlier stages (passages 1–4) and 3.6 days at later stages
(passages 9–11) stages of culturing. At passages 5 and
6, the doubling index of the MSC population over
35 days was only 0.2. The cell population with such a
low proliferation potential could have doubled within
no less than 157 days (Fig. 1). Examination of living
cultures under the phase-contrast microscope showed
that the MSC population at early passages was hetero-
geneous and included at least two morphological cell
types, large flattened cells and spindle-shaped cells.
This agreed with observations of other researchers
(Prockop et al., 2001). After repeated subculturing, the
second cell type became prevalent. Morphological
symptoms of the Hayflick phenomenon, which are
characteristic of senescent cultures, did not manifest
themselves at later stages of the MSC culturing.
The expression of CD90, an MSC marker, was
revealed immunocytochemically (Figs. 2a, 2b) and by
PCR analysis (Fig. 3) at both earlier and later stages of
culturing.
Collagen type I in the form of randomly oriented
fibers was revealed immunocytochemically in MSC
cultures at passage 2 (11 days of incubation in the
osteogenic medium) and passage 11 (10 days of incu-
bation in the osteogenic medium) (Figs. 2c, 2d).
A histochemical analysis of osteogenic MSC differ-
entiation (staining with alizarin red) revealed sites of
calcium deposition in the extracellular matrix both at
earlier and later stages of culturing (Figs. 2e, 2f). Min-
eralization of the extracellular matrix in the cultures of
passages 1–4 was accounted for by cells of a polygonal
shape typical of osteoblasts. In the cultures of passages
9–11, only spindle-shaped cells were found at the sites
of calcium deposition, while typical osteoblasts were
absent. Osteogenesis in the cultures occurred focally:
calcium deposits had an irregular shape and were
unevenly distributed over the area of a culture flask.
PCR analysis revealed a sharp increase in the
expression of the osteocalcin gene (
OC
) upon induction
of osteogenesis at both earlier and later passages (by
factors of 3.3 and 4.1, respectively), compared to that in
the control MSC culture in the growth medium without
inducers of osteogenesis. Using specific primers, we
also revealed the expression of
Runx2
, the master gene
of osteogenic differentiation. The
Runx2
expression
was 1.2–1.3 times stronger in the control than in the
experimental samples (with inducers of osteogenesis),
at both earlier and later stages of culturing (on day 15
of the experiment) (Fig. 4).
A morphological analysis of adipogenic differentia-
tion in the MSC culture (with cell staining with fat red
O to detect lipid inclusions) revealed both individual
adipocytes and their clusters at passages 1–4 (Fig. 2g).
However, these cells were absent in the culture at pas-
sage 11, after 14–15 days of incubation in the adipo-
genic medium.
DISCUSSION
It is generally accepted that the hematopoietic
stroma in the bone marrow of adult mammals is
replaced with age by fat tissue. Senescence is accompa-
nied by a decrease in the number of osteoblasts partici-
pating in bone formation and an increase in the number
of unilocular adipocytes in the bone marrow. Thus,
senescence of MSC in vivo apparently leads to activa-
tion of adipogenic and suppression of osteogenic differ-
entiation programs (Stenderup et al., 2003; Moerman et
al., 2004; Sethe et al., 2006;). However, the question
concerning the retention of MSC multipotency upon
long-term in vitro culturing has remained open and
contradictory. However, Muraglia et al. (2000) consider
that changes in the multipotent status of MSC upon
repeated subculturing conform to the hierarchical
model that features the initial loss of adipogenic poten-
tial and subsequent segregation of an osteochondro-
genic MSC subpopulation.
According to our data, the long-term culturing of the
bone marrow MSC in vitro results in the loss of their
potential for adipogenic differentiation and retention of
the osteogenic potential, which is in good agreement
with the above hierarchical model. Osteogenic differ-
entiation of MSC at early stages of culturing provides a
classic example of osteoblast differentiation, with a
typical transition from fibroblast-like to polygonal cell
morphology. At later stages, the foci of calcium deposi-
tion contain spindle-shaped cells instead of typical
osteoblasts, which indicates that the mode of osteo-
genic differentiation has become different from that at
the earlier stages. There is experimental data that spon-
taneous accumulation of calcium without any visible
signs of morphogenesis in osteogenic direction is char-
acteristic of senescent MSC cultures (DiGirolamo
et al., 1999). However, a significant increase in the
expression of osteocalcin (a marker of the late stages of
osteogenesis) and in the synthesis of collagen type I on
days 15 and 11 of incubation in the osteogenic medium,
respectively, are indicative of true osteogenic differen-
tiation in the MSC culture at late passages. Transcripts
of the
OC
gene have been reveled not only in experi-
mental but also in control samples, which confirms
once again that a sufficiently heterogeneous MSC cul-
ture contains a pool of weakly differentiated osteoblasts
committed to osteogenesis.
Among known genes that regulate osteogenesis, the
master gene
Runx2
is of particular interest. Its protein
product (a transcription factor) interacts with the pro-
moters of genes expressed mainly in mature osteo-
blasts. An analysis of its expression pattern has shown
that the
Runx2
expression in the control samples is
1.2
1.3 times stronger than in the samples stimulated
toward osteogenesis at earlier or later periods of cultur-
ing. It is known that the MSC culture is fairly heteroge-
neous and consists of cells with different degrees of
commitment, including preosteoblasts actively
expressing
Runx2
. There are experimental data on the
136
BIOLOGY BULLETIN
Vol. 35
No. 2
2008
KOZHEVNIKOVA et al.
(a)
50
µ
m 50
µ
m
200
µ
m500
µ
m
(b)
(c) (d)
(e) (f)
(g)
Fig. 2.
Immunocytochemical detection of (a, b) CD90
protein and (c, d) type I collagen and histochemical detec-
tion of (e, f) mineralized bone tissue and (g) multilocular
adipocytes in the MSC culture after (a) 1, (c, e) 2, (g) 4,
(f) 9, and (b, d) 11 passages: (a, b) the nuclei poststained
with DAPI; (e, f) staining with alizarin red S, the nuclei
poststained with hematoxylin (magnification: e, 40
×
;
f, 100
×
); (g) staining with fat red O, the nuclei post-
stained with hematoxylin (magnification 200
×
).
BIOLOGY BULLETIN
Vol. 35
No. 2
2008
COMPARATIVE CHARACTERIZATION 137
lack of correlation between the amount of
Runx2
mRNA or protein product and acquisition of cell phe-
notype typical of mature osteoblasts (Ven den Bos,
1998). According to other data, the activity of the
Runx2 transcription factor is enhanced not via an
increase in the amount of its mRNA (it remains the
same throughout the differentiation period) but rather at
the posttranslational level, due to its phosphorylation
by MAPC kinase. This process takes place when the
cells acquire the phenotype of mature osteoblast and
reaches a peak on day 7 of their incubation in the osteo-
genic medium (Shui et al., 2003). In out experiments,
we observed a decrease in the amount of
Runx2
mRNA
on day 15 of MSC incubation in the osteogenic
medium. This decrease may be attributed may be to the
active synthesis of the Runx2 transcription factor (and,
therefore, active translation of its mRNA) in the course
of osteogenic differentiation, with the resulting mRNA
depletion at its terminal phase. On the other hand, it
may be related to the actual decrease in the activity of
Runx2 at later stages of cell differentiation, when the
need for this regulator of osteogenesis is relatively low.
The dynamics of the
Runx2
expression during osteo-
genesis deserves further study.
In the adipogenic medium, MSC at early passages
produced individual adipocytes and their clusters con-
sisting of a few cells. These cells contained multiple fat
droplets intensively stained with fat red O and, conse-
quently, could be classified as multilocular adipocytes.
However, in our experiments on transplanting bone
marrow fragments under the kidney capsule, fat cells
formed during transplant regeneration always had the
morphology of unilocular adipocytes, being probably
more matured (unpublished data). The MSC subcul-
tured 11 times proved to lose the capacity for differen-
tiating into adipocytes. These data indicate that the dif-
ferentiation potential of MSC weakens in the course of
culturing.
Deviation of osteogenic differentiation from its typ-
ical mode and the loss of adipogenic potential at late
passages provide evidence for MSC senescence in the
course of repeated subculturing. One of its signs is rep-
licative senescence manifested in a decreasing number
of population doublings and an increasing doubling
period.
Our culture doubled more than 20 times during
140 days of culturing, which was not the limit (we did
not aimed at determining the maximum possible num-
ber of doublings). An important parameter characteriz-
ing the proliferation potential of a cell population is its
doubling period. In our study, a comparative analysis of
MSC proliferation potential at different stages of cul-
turing revealed no significant differences in the dou-
bling period between earlier and later passages. How-
ever, passages 5 and 6 were a kind of turning point at
which cell growth ceased almost completely. Similar
observations were also made by other authors (Zhang et
al., 2005). This phenomenon is of special interest and
deserves further study. We suppose that a subpopula-
tion of the MSC that are not yet replicatively senescent
but have already lost the capacity for differentiating
into certain cell types (in our case, into adipocytes) is
segregated in the course of culturing. This hypothesis is
indirectly confirmed by our observation that the MSC
culture gradually becomes more homogeneous, with
the strong prevalence of spindle-shaped cells and the
absence of morphological signs of the Hayflick phe-
nomenon. The expression of MSC marker CD90 at the
late stages of culturing is similar to that at early stages,
indicating that MSC retain the properties of multipotent
stem cells (the CD90 expression is one of main and
obligatory criteria of stem cells). However, it remains
unclear why MSC cultured for a long time continue to
express this marker but are incapable of adipogenic dif-
ferentiation. This and other phenomena related to long-
term culturing need further study.
ACKNOWLEDGMENTS
This study was supported by the Russian Founda-
tion for Basic Research (project no. 06-04-48209) and
the program “Molecular and Cell Biology” of the Pre-
sidium of the Russian Academy of Sciences.
REFERENCES
Baxter, M.A., Wynn, R.F., Jowitt, S.N., et al., Study of
Telomere Length Reveals Rapid Aging of Human Marrow
Stromal Cells Following in Vitro Expansion,
Stem Cells
,
2004, vol. 22, pp. 675–682.
Bonab, M.M., Alimoghaddam, K., Talebian, F., et al., Aging
of Mesenchymal Stem Cell in Vitro,
BMC Cell Biol.
, 2006,
vol. 7, no. 14.
13411
496 bp
598 bp
ëD90
β
-actin
Fig. 3.
PCR analysis of the
CD90
gene expression in MSC
at different passages (1, 3, 4, 11 are passage numbers,
cDNA was normalized to
β
-actin).
1234
289 bp
273 bp
Runx2
OC
598 bp
β
-actin
Fig. 4.
PCR analysis of
IN
and
Runx2
expression in MSC at
different passages: (1) passage 2 (control), (2) passage 2
(experiment), (3) passage 9 (control), and (4) passage 9
(experiment); cDNA was normalized to
β
-actin.
138
BIOLOGY BULLETIN
Vol. 35
No. 2
2008
KOZHEVNIKOVA et al.
Bruder, S.P., Jaiswal, N., and Haynesworth, S.E., Growth
Kinetics, Self-Renewal and the Osteogenic Potential of Puri-
fied Human Mesenchymal Stem Cells during Extensive Sub-
cultivation Following Cryopreservation,
J. Cell Biochem.
,
1997, vol. 64, pp. 278–294.
DiGirolamo, C.M., Stokes, D., Colter, D.C., et al., Propaga-
tion and Senescence of Human Marrow Stromal Cells in Cul-
ture: A Simple Colony-Forming Assay Identifies Samples
with the Greatest Potential to Propagate and Differentiate,
Br. J. Haematol.
, 1999, vol. 107, pp. 275–281.
D’Ippolito, G., Schiller, P.C., Ricordi, C., et al., Age-Related
Osteogenic Potential of Mesenchymal Stromal Stem Cells
from Human Vertebral Bone Marrow,
J. Bone Mineral Res.
,
1999, vol. 14, pp. 1115–1122.
Dominici, M., Le Blanc, K., Mueller, I,. et al., Minimal Cri-
teria for Defining Multipotent Mesenchymal Stromal Cells.
The International Society for Cellular Therapy Position
Statement,
Cytotherapy
, 2006, vol. 8, pp. 315–317.
Friedenstein, A.Ya. and Luria, E.A.,
Kletochnye osnovy
krovetvornogo mikrookruzheniya
(Cellular Basis of Hemato-
poietic Microenvironment), Moscow: Meditsina, 1980.
Meirelles, L.S. and Nardi, N.B., Murine Marrow-Derived
Mesenchymal Stem Cell: Isolation, in Vitro Expansion and
Characterization,
Br. J. Haematol.
, 2003, vol. 123, pp. 702–
711.
Mets, T. and Verdonk, G.,
In Vitro
Aging of Human Bone
Marrow Derived Stromal Cells,
Mechan. Ageing Dev.,
1981,
vol. 16, pp. 81–89.
Moerman, E.J., Teng, K., Lipschitz, D.A., et al., Aging Acti-
vates Adipogenic and Suppresses Osteogenic Programs in
Mesenchymal Marrow Stroma/Stem Cells: the Role of
PPAR-
γ
2 Transcription Factor and TGF-
β
/BMP Signaling
Pathways,
Aging Cell
, 2004, vol. 3, pp. 379–389.
Muraglia, A., Cancedda, R., and Quarto, R., Clonal Mesen-
chymal Progenitors from Human Bone Marrow Differentiate
in Vitro According to a Hierarchical Model,
J. Cell Sci.
,
2000, vol. 113, pp. 1161–1166.
Pearse, A.G.E.,
Histochemistry: Theoretical and Applied
,
Edinburgh: Churchill Livingstone, 1953. Translated under
the title
Gistokhimiya
, Moscow: Izd. Inostrannoi Literatury,
1962.
Prockop, D.J., Sekiya, I., and Colter, D.C., Isolation and
Characterization of Rapidly Self-Renewing Stem Cells from
Cultures of Human Marrow Stromal Cells,
Cytotherapy
,
2001, vol. 3, pp. 393–396.
Sethe, S., Scutt, A., and Stolzing, A., Aging of Mesenchymal
Stem Cells,
Ageing Res. Rev.,
2006, vol. 5, pp. 91–116.
Shui, C., Spelsberg, T.C., Riggs, B.L., et al., Changes in
Runx2/Cbfa1 Expression and Activity during Osteoblastic
Differentiation of Human Bone Marrow Stromal Cells,
J. Bone Mineral Res.
, 2003, vol. 18, pp. 213–221.
Stenderup, S., Justesen, J., Clausen, C., et al., Aging Is Asso-
ciated with Decreased Maximal Life Span and Accelerated
Senescence of Bone Marrow Stromal Cell,
Bone
, 2003,
vol. 33, pp. 919–926.
Ven den Bos, C. Human Bone Marrow-Derived Mesenchy-
mal Stem Sells Constitutively Express CBFA1: Lack of Cor-
relation of mRNA or Protein Levels with Acquisition of
Osteoblastic Phenotype,
Bone
, 1998. vol. 23 (Suppl.), p. 15.
Zhang, F., Li, L., Fang, B., et al., Passage-Restricted Differ-
entiation Potential of Mesenchymal Stem Cells into Cardi-
omyocyte-Like Cells,
Biochem. Biophys. Res. Commun.
,
2005, vol. 336, pp. 784–792.
    • "The hMSC proliferation rate was also shown to decline with age [5]. In addition, late passage hMSCs displayed a decrease in differentiation potency [6]. Thus, to better understand the reason for such a decline in the overall quality of MSCs, there is a need to investigate hMSC aging during in vitro culture. "
    [Show abstract] [Hide abstract] ABSTRACT: Human mesenchymal stem cells (hMSCs) are multipotent and have been recognized as a source for tissue engineering or cell therapy. It is, therefore, imperative to develop methods to acquire enough hMSCs that maintain self-renewal and differentiation potential. However, aged hMSCs are prone to have a gradual decline in differentiation and proliferation potential with continual cell cycle divisions during in vitro culture. The physiochemical properties of hMSCs are highly dependent on their micro-environment, i.e. the 'stem cell niche'. In this study, the heterogeneous aging of hMSC was examined on chemically defined self-assembly monolayer surfaces. Surface energy was shown to regulate aged hMSC morphology, survival, and proteoglycan expression. High surface energy supplied a preferable environment for hMSC survival and expression of proteoglycans. These results will prove valuable to the design of scaffolds for tissue engineering or for the modulation of implantation environments.
    Article · Oct 2011
  • [Show abstract] [Hide abstract] ABSTRACT: First Page of the Article
    Conference Paper · Oct 1992 · Rejuvenation Research
  • [Show abstract] [Hide abstract] ABSTRACT: In recent years mesenchymal stem cells (MSCs) have generated a great deal of excitement as an attractive alternative to embryonic stem cells (ESCs) in cell-based regenerative medicine. In contrast to cells of embryonic origin, however, the clinical application of MSCs is heavily restricted by their finite ability of self-renewal, in which they resemble the rest of the somatic cells. Yet the mechanisms controlling MSC proliferation and senescence remain unclear. This review summarizes recent advances in our understanding of the factors affecting MSC expansion in vitro and discusses the pattern of their senescence with particular emphasis on the role of telomere shortening, activation of effectory pathways, and oxidative stress. The issues associated with MSC growth and senescence will be shown in the context of other somatic cells, and all of the parallels and disparities will be delineated precisely.
    Full-text · Article · May 2009
Show more

  • undefined · undefined
  • undefined · undefined
  • undefined · undefined