ArticlePDF Available

Biochip Technology for the Detection of Animal Species in Meat Products

Authors:

Abstract and Figures

The verification of declared components in meat products is an essential task of food control agencies worldwide. To date, the ELISA and species-specific polymerase chain reaction (PCR) are two commonly applied analytical tools employed by many authorized food control laboratories. These trusted methods however do not allow the simultaneous detection of all the animal species present in a meat sample. Additionally, detection of undeclared components resulting from inadvertent contamination or deliberate adulteration of the meat products requires additional processing of the samples, resulting in increased expenditure. The use of DNA biochip analysis that allows simultaneous processing of many meat products, while concomitantly generating results for the detection of all animal species present in the meat products is thus highly desirable. In this work, two commercially available animal chip detection systems (CarnoCheck Test Kit and MEATspecies LCD Array) are compared in terms of sensitivity, robustness, reproducibility, and ease of handling. The two animal species differentiation biochip methods compared well in efficiency and could simultaneously detect from eight to 14 animal species in the meat products. Detection limits were found to be in the range of 0.1% to 0.5% in meat admixtures, with good reproducibility of results. More than 70 commercially available meat samples were analyzed in this work, with the results validated against traditional PCR methodology. Both biochip methods performed well and could be implemented for routine use in any food control agency. KeywordsDNA biochip–PCR–Meat products–CarnoCheck–LCD Array
Content may be subject to copyright.
Biochip Technology for the Detection of Animal Species
in Meat Products
Azuka N. Iwobi &Ingrid Huber &Georg Hauner &
Andreas Miller &Ulrich Busch
Received: 19 August 2010 / Accepted: 20 October 2010 /Published online: 18 November 2010
#Springer Science+Business Media, LLC 2010
Abstract The verification of declared components in meat
products is an essential task of food control agencies
worldwide. To date, the ELISA and species-specific
polymerase chain reaction (PCR) are two commonly
applied analytical tools employed by many authorized food
control laboratories. These trusted methods however do not
allow the simultaneous detection of all the animal species
present in a meat sample. Additionally, detection of
undeclared components resulting from inadvertent contam-
ination or deliberate adulteration of the meat products
requires additional processing of the samples, resulting in
increased expenditure. The use of DNA biochip analysis
that allows simultaneous processing of many meat prod-
ucts, while concomitantly generating results for the detec-
tion of all animal species present in the meat products is
thus highly desirable. In this work, two commercially
available animal chip detection systems (CarnoCheck Test
Kit and MEAT
species
LCD Array) are compared in terms of
sensitivity, robustness, reproducibility, and ease of han-
dling. The two animal species differentiation biochip
methods compared well in efficiency and could simulta-
neously detect from eight to 14 animal species in the meat
products. Detection limits were found to be in the range of
0.1% to 0.5% in meat admixtures, with good reproducibil-
ity of results. More than 70 commercially available meat
samples were analyzed in this work, with the results
validated against traditional PCR methodology. Both
biochip methods performed well and could be implemented
for routine use in any food control agency.
Keywords DNA biochip .PCR .Meat products .
CarnoCheck .LCD Array
Introduction
The false declaration of meat components for food and feed
ingredients continues to pose a challenge for the relevant
food control agencies worldwide. In order to protect
consumer trust and confidence and to ensure the quality
of the meat produce, the verification of the animal species
in meat samples is important for various reasons: (a) the
health condition of some might exclude the consumption of
certain meat products; (b) the religious persuasions of some
reject certain meat products, and (c) substitution of
expensive meat species with cheap meat derivatives
violates consumer trust and confidence with associated
economic loss (Commission Directive 2002/86/EC, Com-
mission Recommendation 2004/787/EC, Zipfel and Zipfel
2000).
A rapid and dependable detection system is therefore
indispensable in a food control agency for protection of
consumer trust. The traditional recipe for determination of
animal species in food relied in the past, heavily, on
immunochemical and electrophoretic analysis of proteins.
A drawback of such protein-based detection methods is that
in the case of highly processed food preparations (heated to
very high temperatures), protein denaturation affects the
sensitivity of the procedure. Also, fine discrimination
between closely related animal species like chicken and
turkey, or sheep and goat is often not possible. DNA-based
detection systems have thus become increasingly popular in
recent times. The distinct advantage of DNA-based detec-
tion lies in (1) the increased specificity (generally unam-
biguous identification of target sequences) and (2) stability
A. N. Iwobi (*):I. Huber :G. Hauner :A. Miller :U. Busch
Bavarian Health and Food Safety Authority,
Veterinaerstrasse 2,
85764 Oberschleissheim, Germany
e-mail: azuka.iwobi@lgl.bayern.de
Food Anal. Methods (2011) 4:389398
DOI 10.1007/s12161-010-9178-9
of DNA allowing the investigation of highly processed
food samples. In the early stages, DNA detection methods
principally relied on Southern blot hybridization, but
polymerase chain reactions (PCR) employing species-
specific primers are more readily applied today (Chikuni
et al. 1994; Wintero et al. 1990; Mane et al. 2009; Nau et al.
2009). An improvement on the conventional PCR method-
ology is the application of Real-Time PCR combining
species specific primers and probes unique for the detect-
able animal species in a single reaction. Such Real-Time
PCR reactions have been successfully applied in the
simultaneous detection of up to seven animal species in a
meat sample (Laube et al. 2003,2007; Köppel et al. 2008,
2009).
An alternative genetic approach is the use of microarray
analysis to simultaneously detect various events occurring
in plant and animal tissues as well as in bacteria (Kemp et
al. 2005; Radkey et al. 2000; Willse et al. 2004). This
article looks at the use of DNA biochip technology in
simultaneous detection of various animal species present in
food samples. As with the Real-Time PCR for the detection
of animal species mentioned above, the use of a DNA chip
for the detection of animal constituents in food is well
suited for rapid screening of meat products in a routine
analytical laboratory. Both methods offer a simple, robust,
and fast platform for the simultaneous detection of animal
species in meat samples. The DNA Chip however offers the
additional advantage, that undeclared and unknown animal
species present in a meat sample, resulting perhaps from
inadvertent contamination or deliberate adulteration, can be
detected.
Two commercially available chip detection systems are
here described and compared in terms of sensitivity,
robustness, reproducibility, and ease of handling. The first
system is the CarnoCheck Test Kit for the detection of
animal species in food, and the second system is the
Meat
Species
1.6 LCD Array Kit, a DNA-based identification
system for meat and poultry species in food (Chipron 2005;
Greiner 2005).
Materials and Methods
Production of Reference Meats with Specific Fractions
of Different Meat Species
In order to determine the limits of detection of the animal
differentiation by DNA chips, specially constituted refer-
ence meat samples were produced in-house. In a first
analysis, turkey, chicken, sheep, horse, and cattle in minute
percentages (0.5% to 1%) were mixed with pig (95% to
97.5%). In a second analysis, cattle, pig, chicken, and
turkey, the most widely consumed meat species, were
mixed in different ratios according to the scheme outlined
in Table 3(see Results). The reference meat was artificially
constituted from 100% flesh (muscle) of the different
animal species, homogenized in a Moulinex Mixer (Mou-
linex, Spain) and heated to 75 °C for 20 min. Following
cooling, the meat homogenates were filled into sterile
containers and DNA extraction procedures carried out.
DNA Extraction
A CTAB-method was used for the isolation of DNA from
meat products. About 200 mg of the meat was weighed into
a 2-ml tube, followed by the addition of 1.5 ml CTAB-
Buffer (20 g/L 2% CTAB, 81.8 g/L 1.4 M NaCl, 12.1 g/L
0.1 M Tris, and 7.44 g/L 20 mM Na
2
EDTA)+3 μl
Proteinase K (20 mg/μl)+ 1 μl RNase A (100 mg/ml).
The sample was vortexed and incubated for 90 min at 65 °C
with constant shaking. Centrifugation at maximal gfor
15 min followed and then 500 μl of the supernatant was
mixed with 1 volume isopropanol (500 μl) in a 1.5-ml tube.
The tube was then gently inverted and incubated for 30 min
at room temperature. Following centrifugation at 15 min at
maximal g, the supernatant was discarded and the resulting
pellet was washed with 500 μl 70% ethanol. Following
centrifugation for 5 min at maximum g, the supernatant was
discarded and the pellet dried at 50 °C for 2030 min. The
DNA-pellet was taken up in 100 μl1xTEbuffer.
Test Principles
LCD Array
The LCD Array (Chipron, Germany) allows the simulta-
neous detection of up to 14 animal species in food (cattle,
buffalo, pig, sheep, goat, horse, donkey, rabbit, hare,
chicken, turkey, goose, and two duck varieties). This test
system relies on the detection of specific sites within the
16S rRNA mitochondrial locus of all the meat species
present in the tested food sample. Provided with the test
system is a consensus primer pair that amplifies the desired
region of the animal species in a PCR. The pre-labeled PCR
primer mix provided with the test kit generates biotinylated
amplicons of the animal mtDNA present in the food
sample. The labeled PCR products generated are combined
with the provided hybridization buffer and hybridized to the
individual array fields of the biochip. During hybridization,
single-stranded labeled PCR fragments bind to comple-
mentary specific capture oligonucleotide probes immobi-
lized as spots on the bottom of each field. Following a short
washing procedure, each field is incubated with a second-
ary label solution (enzyme conjugate). The detection of a
positive hybridization reaction relies on the principle of
biotinstreptavidin binding. After a second washing step,
390 Food Anal. Methods (2011) 4:389398
those spots where PCR fragments and secondary label
are bound can be visualized by a blue precipitate formed
by the enzyme substrate provided in the test kit as
BLUE STAIN. The data read out can be done either
manually by simple visual observation, using the pattern
matrix provided in the kit, or alternatively with the
scanner and software from the Analysis-Package
provided by Chipron.
CarnoCheck
The CarnoCheck detection system (Greiner Bio-One) of
animal species is based on species-specific differences in
the sequence of the cytochrome b (cyt b) gene. Eight animal
species are detected by the CarnoCheck Test kit (pig, cattle,
sheep, turkey, chicken, horse, donkey, and goat). Following
sample homogenization and DNA extraction, a 389-bp
fragment of the cyt b gene of all the animal species present
in the food sample is amplified through polymerase chain
reaction. By coupling the fluorophore Cy5 onto one of the
primers, the amplified fragments are labeled. The labeled
fragments are then hybridized to complementary oligonu-
cleotide probes fixed as targets on the bottom of the
biochip. The target probes themselves are coupled with the
Cy3 fluorophore. Due to the use of fluorophore-labeled
PCR primers (Cy5) and fluorophore-labeled target probes
for the on-chip control system (Cy3), the analysis of the
biochips is performed by microarray scanners using wave-
lengths of ~532 nm (Cy3) and ~635 nm (Cy5).
Following hybridization and washing procedures, the
biochips are briefly dried by centrifugation and scanning and
data analysis achieved with the Checkscanner and the
CheckReport software respectively, both provided by Greiner
Bio-One.
Figures 1and 2below provide a schematic representa-
tion of the two test systems, while Table 1summarizes their
most important characteristics.
Amplification of the Animal Species DNA
CarnoCheck PCR
With the CarnoCheck test kit, a PCR Master Mix is
provided which already contains much of the components
for a PCR run, namely the PCR-Buffer, MgCl
2
, dNTPs,
DNase free water, PCR control, and a dedicated primer
mix. With the addition of 1 μl of template DNA at a
recommended concentration of 515 ng/μl, and a Hot-Start
Taq Polymerase (5 U/μl) from Qiagen, the PCR reaction
mix is ready for cycling. Here, one of the PCR primers is
labeled with the Cy5 fluorophore, resulting in all success-
fully amplified PCR fragments carrying this label. After the
PCR reaction, the amplification products can be immedi-
ately hybridized or stored at 4 °C in the dark. An initial
heating for 3 min at 95 °C is required before hybridization
for the generation of single-stranded PCR products. When
the biochips are used for the first time or optimization may
be necessary, analysis of the generated amplicons by
agarose gel electrophoresis is recommended.
LCD-Array PCR
With the LCD-Array test kit, only the pre-labeled primer
mix is supplied with the kit. The buffer, including
MgCl
2,
dNTP mix, PCR grade water, and Taq Polymerase,
must be supplied by the user. In this study, the following
PCR components were utilized pro 25 μl PCR reaction
volume: PCR grade water (8 μl), Primer mix Meat 1.6,
suppliedwiththeLCD-Arraykit(1.5μl), Qiagen Hotstar
Taq mastermix (12.5 μl). Three microliters of extracted
genomic DNA was then added to the above mix. To
confirm successful generation of PCR amplicons, agarose
gel electrophoresis was applied according to standard
procedures.
Conventional PCR for the Detection of Meat Species
In parallel, the conventional PCR method was run for all
tested samples. Species specific primer pairs that have been
thoroughly validated at the Bavarian health and food safety
authority were employed (Table 2). PCR was performed in
a 25-μl final reaction volume containing 2-μl template
DNA, 5.5 μl PCR grade water, 12.5 μl Qiagen HotStar Taq
mastermix (Qiagen, Germany), and 2.5 μl each of species
specific primers (20 pmol/μl).
Results
Validation of the Biochip Test Systems for Routine
Analysis of Meat Products and Ingredients
An important aspect of an official food control agency is
the verification of the declared food constituents to protect
consumer trust. Here, we validated the two biochip test
systems for routine use by official food control agencies
against the following parameters: sensitivity, specificity,
robustness, reproducibility, and ease of handling.
To achieve this, reference meat samples with known
species composition were analyzed first, followed by
subsequent analysis of about 70 commercial meat products.
The meat products were initially homogenized and the
homogenates subjected to the described DNA extraction
procedure. The extracted DNA was subjected to analysis
with the CarnoCheck and LCD-Array test kits according to
the manufacturer's instructions. In parallel to the biochip
Food Anal. Methods (2011) 4:389398 391
analysis, a conventional PCR using animal species specific
primers was carried out to validate the results of the biochip
analysis.
Sensitivity and Specificity
Based on manufacturer's claims, the CarnoCheck test kit
publishes the following information on detection limits for
the identified animal species: 0.05% for pig, cattle, and
horse in meat ingredients and meat samples, 0.13% for
sheep, 0.16% for chicken, 0.1% for turkey, 0.35% for
donkey, and 0.1% for goat (the latter was only tested in
DNA mixtures). The LCD Array publishes a detection limit
of <0.5%, depending on grade of food processing. In order
to verify these claims in praxis, two reference meat samples
were analyzed with the following composition:
Reference meat 1 (RM1): 0.5% turkey, chicken, sheep,
horse, and cattle respectively; 97.5% pig; reference meat 2
(RM2): 1% turkey, chicken, sheep, horse, and cattle
respectively; 95% pig
For the CarnoCheck test kit with reference meat 1, only
horse, pig, and cattle were detected at 0.5%. With reference
meat 2, all the meat species could be detected. Thus, at least
1% of all animal species tested could be reliably detected
simultaneously in complex meat mixtures with this test kit
the lower detection limits declared by the manufacturer might
therefore not be reliably reached in practice.
The LCD Array could detect all the meat species present
in reference meat 1 and reference meat 2, pointing to a
detection limit of at least 0.5% of all animal species tested.
In an extended analysis with specially constituted meat
samples with at least 0.1% cattle, pig, chicken, and turkey
under different combinations (see Table 3), the LCD-Array
could also detect simultaneously all four animal species
present in the meat mixtures at a minimal percentage of
0.1% (Table 4). With the CarnoCheck test kit, the
composition of the reference meats seemed to influence
the results spectrum. With reference meats RM1-RM2.2,
characterized by predominantly cattle, and pig (9799.7%)
with trace amounts of chicken and turkey (0.1% to 0.5%),
the latter, chicken, and turkey, were not detectable.
Conversely, with reference meats RM3-RM4.2 with pre-
dominantly turkey and chicken fractions (9799.7%) and
trace amounts of pig and cattle, pig, and cattle could always
be detected. The detection limits of the CarnoCheck chip
therefore appear to be limited by the composition of the
reference meats, with the trace detection of chicken and
turkey fractions strongly limited by the presence of
Capture Probes
NoProbe Specificity NoProbe Specificity
01 Beef Bos taurus 08 Rabbit Oryctolagus cuniculus
02 Buffalo Bubalus bubalis 09 Hare Lepus europaeus
03 Pork Sus scrofa 10 Chicken Gallus gallus
04 Sheep Ovis aries 11 Turkey Meleagris gallopavo
05 Goat Capra hircus 12 Goose Ansa albifrons
06 Horse Equus caballus 1) 13 Mall. Duck Anas platyrhyncos
07 Donkey Equus asinus 1) 14 Musc. Duck Cairina moschata
C Hyb-Contr. Functional controls (Hybridization + stain)
Fig. 1 LCD Array Meat 1.6 Test System for meat species identification. The figure shows the spotting pattern of the array while the table lists the
capture probes immobilized on each array (Data Sheet Meat
Species
1.6, V-I-08, Chipron)
392 Food Anal. Methods (2011) 4:389398
Five adjacent measurement points detect
each animal species
Controls
Turke
y
Shee
p
ChickenPi
g
CattleDonke
y
GoatHorse
Controls
Green Channel(532 nm) = Cy3-labeled targets
Red Channel (635 nm) = Cy5-labeled targets
Table depicts array design
On-chip control systems allow the exact quality determination:
1. Orientation controls (Cy3-labeled probes: 10 measuring points)
2. a) Dotted area: Printing and homogeneity control of all DNA measuring points
(Cy3-labeled target; 45 measuring points).
b) Full-line area: Hybridization control (Cy3-labeled targets; 5 measuring points)
3. PCR Control (Cy5-labeled PCR products; 5 measuring points)
4. Species identification probes (Cy5-labeled PCR products, 5 measuring points for
each species)
Red Channel (635 nm) Green Channel (532 nm)
Carno Check
Red:
Yellow:
Tur
q
uoise:
Violet
Fig. 2 CarnoCheck Test kit for the detection of animal species in
food. The small table above shows the order of the measurement
points for the animal species while the figure below depicts the on-
chip control systems for exact quality determination (orientation
controls in red, printing controls in green; CarnoCheck Handbook,
Manual version: BQ-020-00, Greiner Bio-one)
Food Anal. Methods (2011) 4:389398 393
predominantly cattle and/or pig fractions. Generally how-
ever, chicken and turkey fractions accounting for 0.1% of
the reference meats could not be detected by the Carno-
Check chip.
Table 4summarizes the lowest detection limits achiev-
able with both biochips, alongside the traditional PCR
methodology, carried out with species specific primer pairs
that have been thoroughly validated in our laboratory (see
Table 2in Materials and Methods).
Analyzing the reference meats, the LCD-Array test kit is
comparable in sensitivity with the traditional PCR detection
method. The CarnoCheck test kit however failed to detect
concentrations, especially of poultry meat at levels at or
below 0.5%.
In order to assess the sensitivity of the tested biochip
methods in praxis, more than 70 commercially available
meats and meat products were thoroughly analyzed in this
study. Table 5presents some results of the analysis with
meat products, randomly selected for validation in this
study. The LCD Array could identify all the animal species
present in the meat samples, when validated against the
traditional PCR test with a fidelity and specificity of 100%.
With the CarnoCheck test system, a significant percentage
of the meat species (close to 20%) could not be reliably
detected in the samples.
Comparing the specificity of the two tested biochip
methods, the results were comparable for both methods.
Generally 100% specificity was realized for all samples
tested, with the chips finely differentiating between closely
related species like turkey and chicken. When pure animal
species (cattle, pig, chicken, and turkey) were analyzed by
the respective biochips and the results compared, the false
positive rate was 0%, for all animal samples at 100%
fidelity.
Robustness and Reproducibility
In order to assess robustness of the DNA chips, the method
was validated against different PCR cyclers: Eppendorf
Master Cycler Personal/Gradient and MWG Biotech Pri-
mus 96 plus. All applied cyclers supported the PCR
protocols with 100% fidelity, pointing to robustness of the
PCR step. In a complementary approach, the DNA isolation
procedure was varied, with DNA extraction kits from
CIBUS (Cibus DNA Extraction kit, Cibus Biotech, Ger-
many) and Qiagen (DNeasy Tissue kit, Germany) addition-
ally implemented for DNA extraction from meat samples.
All DNA extraction methods were compatible with the
biochip test kits.
When hybridization was carried out in summer and
winter (with slightly different ambient temperatures), no
significant differences in generated results was observed.
However, care must be taken to adhere to the recommended
hybridization temperatures as temperatures lower than that
recommended resulted in increased background fluores-
cence and cross hybridization between closely related
species (horse and donkey). Increasing hybridization times
by up to 5 min or more also resulted in a noticeable
increase in background fluorescence, particularly with the
LCD Array. Thus care must be taken to adhere to the
Table 2 Species specific primers for meat species differentiation
Amplicon size (bp) Reference
Cattle Bos-f CATCGAACATTTCATCATGAT 281 Wolf et al. 2001
Bos-r TACTCCGATATTTCATGTTTCTAGA
Pig SW-01 TCAGTTTACACTCACCTGATAGCATCT 100 Meyer et al. 1994
SW-02 GGGTGGTGGAGAGGGGTGAATT
Chicken Av-f CCATCCAACATCTCTGCTT 300 this work
Gal-r TAGTGTGAGGAGGAGGATTAC
Turkey Av-f CCATCCAACATCTCTGCTT 300 this work
Mel-R GAGGGTGAGAAGTAAGACTACTCC
Table 1 Comparison between the CarnoCheck and LCD Array for the detection of animal species in food
CarnoCheck LCD Array
Up to eight species detectable Up to 14 species detectable (also custom-made arrays possible)
Detection of the cyt b gene Detection of the mt 16S rRNA gene
Five test spots per animal species on chip Two test spots per animal species on chip
Hybridization at room temperature Hybridization at 35 °C
Fluorescence-based detection (Cy3 and Cy5 labeling) Classical BiotinStreptavidinAP Detection
394 Food Anal. Methods (2011) 4:389398
Species Primers Sequence 5′–3
recommended biochip procedure to ensure good fidelity
and reproducibility of results.
In order to evaluate reproducibility of the generated
results, ten meat samples were randomly selected and
analyzed four times with the respective chips under equal
conditions. The results generated were 100% identical,
pointing to good reproducibility of the results.
The CarnoCheck test kit comprises three integrated
internal controlsa hybridization control, a PCR control,
and an orientation control for the grid of the array. Failure
in one of these internal controls causes the test analysis to
trip off, with subsequent loss of report generation for the
sample under analysis. A failure in any of the internal
controls as a result of production malfunction in our tests,
denied automatically the analysis of the sample tested,
pointing to a drawback of the system.
General Handling and Running Cost
The CarnoCheck test system is generally easy to handle and
can be readily adapted for use in the routine analysis of
meat samples and meat ingredients. The test procedure
(including PCR, hybridization, and washing) can be carried
out within 3 h after DNA extraction from the food sample.
The LCD Array is also very easy to handle, with the entire
test procedure also requiring roughly 3 h after DNA
Table 4 Comparison of sensitivity between the CarnoCheck and the LCD Array with the conventional PCR detection method
Detection of Concentration of meat species in sample
0.1%
a
0.5%
b
1.0%
c
CarnoCheck Cattle + + +
LCD Array Cattle + + +
Trad. PCR Cattle + + +
CarnoCheck Pig + + +
LCD Array Pig + + +
Trad. PCR Pig + + +
CarnoCheck Chicken ++
LCD Array Chicken + + +
Trad. PCR Chicken + + +
CarnoCheck Turkey ++
LCD Array Turkey + + +
Trad. PCR Turkey + + +
a
At 0.1% of the detected meat species, is the following composition valid for the other meat components: pork (99.7%), beef, turkey, and chicken (0.1%)
b
At 0.5% of the detected meat species is the following composition valid for the other meat components: pork (98.5%), beef, turkey, and chicken (0.5%)
c
At 1% of the detected meat product, is the following composition valid for the other meat components: pork (97%), beef, turkey, and chicken (1%)
Reference meats (RM) Cattle (%) Pig (%) Turkey (%) Chicken (%)
RM1 97 1 1 1
RM1.1 98.5 0.5 0.5 0.5
RM1.2 99.7 0.1 0.1 0.1
RM2 1 97 1 1
RM2.1 0.5 98.5 0.5 0.5
RM2.2 0.1 99.7 0.1 0.1
RM3 1 1 97 1
RM3.1 0.5 0.5 98.5 0.5
RM3.2 0.1 0.1 99.7 0.1
RM4 1 1 1 97
RM4.1 0.5 0.5 0.5 98.5
RM4.2 0.1 0.1 0.1 99.7
RM5 50 46 2 2
RM6 2 2 50 46
Table 3 Composition (in
percentage) of the reference
meats to determine the range
of sensitivity of the biochip
methods tested
Food Anal. Methods (2011) 4:389398 395
extraction. A major advantage of the LCD Array lies in its
simplicitythe detection step does not require an elaborate
scanner, but a simple slide scanner which is relatively
inexpensive. Alternatively, the hybridized chips can also be
visualized without scanner. An additional advantage with
the LCD array lies in the formation of an optical precipitate,
enabling long storage of the chips post-hybridization. In
contrast, as a result of the fluorescence-based detection of
the CarnoCheck system, the hybridized biochips cannot be
stably stored. Thus the chips must be almost immediately
analyzed after hybridization
Discussion
A variety of species specific PCR reactions have been
described to date and more keep evolving (Mane et al.
2007,2009; Arslan et al. 2006; Meyer et al. 1994; Nau et
al. 2009). While these PCR methods hold out distinct
advantages over protein-based analyses, detecting multiple
animal species in complex meat admixtures is time
consuming, as only one species can be detected at a time.
As an improvement over species-specific singleplex PCR
reactions, multiplex PCR assays have been described by
some workers, where multiple primers specific for the
animal species to be identified or unique consensus primers,
are combined in a single PCR reaction (Matsunaga et al.
1999; Ling and Hwang 2008). Such traditional multiplex
reactions generally require much optimization and may not
be readily applicable as a screening tool in the routine
identification of meat species in food.
On the other hand, DNA microarrays or biochip
technology offer the distinct advantage of simultaneous
analysis of several events in tissues or food, thus saving
time and reducing concomitantly cost. In this work, we
present results on the assessment of two biochip test kits
(CarnoCheck and LCD Array) for the differentiation of
animal species in food.
Both test systems are based on the amplification of
consensus DNA regions for animal species and the differen-
tiation of the species by species-specific probes that are
covalently bound to the surface of the microarrays. The two
biochips exploit differences within the mitochondrial DNA
(mtDNA) of the respective animal species. The high copy
number of mtDNA compared to genomic or nuclear DNA
makes this locus ideally suited for analysis of highly degraded
DNAarising for example, through denaturing procedures in
highly processed food samples. With the CarnoCheck test
system, the cytochrome b gene of mtDNA is the basis of the
animal species differentiation, while the Chipron LCD array
exploits intraspecific differences within the 16S rRNA of
mtDNA. These two genetic loci have been extensively
exploited in species identification and conservation studies
(Hsing-Mei et al. 2001,Kocheretal.1989). In the classical
study of Kocher et al. (1989) for example, a standard set of
primers directed at conserved regions was successfully
employed in the amplification of homologous segments of
mtDNA from more than 100 animal species, including
mammals, birds, amphibians, fishes, and some invertebrates,
thus indicating the robustness and high fidelity of mtDNA in
species differentiation studies.
Generally, the two test systems showed good sensitivity.
With the CarnoCheck test system, at least 0.5% to 1% of all
animal species could be detected in the analyzed reference
meats. The detection, especially of turkey and chicken
fractions at lower percentages (less than 0.5%) appeared to
be strongly limited by the concomitant presence in the meat
probe of abundant pig and cattle fractions. This highlights a
common problem with multiplex PCR reactions where
sequences that are very abundant in the PCR matrix might
Table 5 Analysis of meat samples with the biochip test kits compared to the traditional PCR method
Traditional PCR test
Sample
number
Product Cattle Pig Goat Turkey Chicken Sheep LCD Array CarnoCheck
1 Garlic sausage (cattle, sheep,
cattle fat)
Pos Pos Pos Sheep, cattle, turkey Sheep, cattle
2 Turkey sausages (turkey,
mortadella, pig fat)
Pos Pos Pig, turkey Pig, turkey
3 Goat peperoni: (goat, pig) Pos Pos Pig, goat Pig, goat
4 Cervelat (declared as 100%
lamb)
Pos Pos Pos Sheep, pig, cattle Pig, sheep
5 Bavarian meat loaf (pig,
cattle)
Pos Pos Pig, cattle Pig, cattle
6 Poultry sausage (turkey
(45%), chicken (10%))
Pos Pos Chicken, turkey Turkey
The animal species marked in bold could be detected by the LCD Array kit and species specific PCR, but not by the CarnoCheck kit
396 Food Anal. Methods (2011) 4:389398
be over amplified and less abundant or trace sequences
seemingly under represented. In the work by Bai et al.
2009, the inherent complexity, low amplification efficiency,
and unequal amplification efficiency on different templates
were cited as major drawbacks of currently described
multiplex PCR reactions, thus precluding their commercial
application. Although the animal biochips here described
exploit the principle of hybridization of the amplified
fragments on specific probes bound on the arrays, thus
heightening the sensitivity and specificity of this detection
method, the procedure is nevertheless limited by the overall
proficiency of the PCR amplification. Interestingly, in the
work of Stueber (2008) where the CarnoCheck and two
other commercial test kits for animal species differentiation
were compared, beef failed to be detected at 0.1% in 25% of
the samples. We therefore suggest the manufacturer'sraising
the published detection limits of the animal species to at least
0.5%. This observation is corroborated by the data presented
in Table 5where the CarnoCheck failed to detect cattle and
poultry fractions in some of the meat samples analyzed.
The LCD Array demonstrated a higher sensitivity, with
at least 0.1% of all meat species in the analyzed meats
detectable. This confirms manufacturer's claims which put
detection limits at <0.5% depending on grade of process-
ing. Because of the smaller amplicon sizes generated by the
LCD Array (100125 bp compared to about 389 bp PCR
amplicons generated by the CarnoCheck test kit), a bias for
more amplification products with the LCD-Array test
system could result in the enhanced sensitivity and lower
detection limits observed. This suggestion has to be
however viewed with some caution as the detection of
animal species present in infinitely small concentrations
resulting for example from contamination during the
production process and not from deliberate adulteration of
the meat productmight not be advantageous in the final
analysis.
In the previously cited work by Stueber (2008), three
commercially available test kits for animal species identi-
fication in meats were compared: The CIB-A-Kit which is a
polymerase chain reaction using species specific primer
pairs, the CarnoCheck DNA Chip and an ELISA kit. The
kits were evaluated for their sensitivity and specificity, as
well as the time and financial investment required for each
method. The CIB-A-kit and the CarnoCheck had a
detection limit of 0.1% and could reliably differentiate
between closely related chicken and turkey. With the
ELISA, a detection limit of 0.5% could be achieved,
without differentiation between chicken and turkey. Re-
garding specificity, all three kits performed well, with the
CarnoCheck demonstrating 100% specificity under all the
tested parameters, what we could corroborate in this study.
In this work, the CarnoCheck chip and LCD Array were
validated against several parameters as screening tools in
animal species detection in meat samples. Additionally,
more than 70 commercially available meat samples were
analyzed in this work with both biochip differentiation kits,
with the results validated against traditional PCR Method-
ology. Both biochip systems performed well and could be
readily implemented for routine use in any food control
agency. A disadvantage of the method could lie in the
initial procurement of a scanner, particularly with the
CarnoCheck fluorescence Scanner. The overall permanent
costs are however low with the DNA Chips, what in the
end might be advantageous. Additionally, the inadvertent
presence of other sources of animal DNA during the PCR
setup could lead to ambiguous results, and post amplifica-
tion processing of the chips could introduce other sources
of error. To minimize such error sources, care must be taken
to tailor the PCR cycling parameters and chip processing to
manufacturer's instructions. Such precautions include for
example, limiting PCR cycle number to kit recommenda-
tions, working with aliquots of the STAIN solution (as with
the LCD Array) while limiting handling of the stock
solution, and changing washing solutions for each chip to
avoid carrying over of signals. When reasonable care is
exercised, our work shows that the Biochip test systems
here described will lead to a reliable and accelerated
identification of the meat species in food samples.
References
Arslan A, Irfan Ilhak O, Calicioglu M (2006) Effect of method of
cooking on identification of heat processed beef using
polymerase chain reaction (PCR) technique. Meat Sci 72:326
330
Bai W, Xu W, Huang Y, Cao S, Luo Y (2009) A novel common
primer multiplex PCR (CP-M-PCR) method for the simultaneous
detection of meat species. Food Control 20:366370
Chikuni K, Tabata T, Kosugiyama M, Monma M, Saito M (1994)
Polymerase chain reaction assay for detection of sheep and goat
meats. Meat Sci 37:337345
Chipron (2005) DNA based identification of meat and poultry species.
Data Sheet Meat
Species
1.6. Manual V-I-08
Commission Directive 2002/86/EC. L 305/19. 2002. Official Journal
of the European Communities
Commission Recommendation 2004/787/EC. L 348/18. 2004. Official
Journal of the European Union
Greiner Bio-One (2005) CarnoCheck test kit for the detection of
animal species in food. Manual, Version BQ-005-03
Hsing-Mei H, Hsiao-Ling C, Li-Chin T, Shu-Ya L, Nu-en H, Linacre
A, James Chun-I L (2001) Cytochrome b gene for species
identification of the conservation animals. Forensic Sci Int
122:718
Kemp JT, Davis RW, White RL, Wang SX, Webb CD (2005) A novel
method for STR-based DNA Profiling using microarrays. J
Forensic Sci 50:11091113
Kocher TD, Thomas WK, Meyer A, Edwards SV, Paabo S,
Villablanca FX, Wilson AC (1989) Dynamics of mitochondrial
DNA evolution in animals: Amplification and sequencing with
conserved primers. Proc Natl Acad Sci U S A 86:61966200
Food Anal. Methods (2011) 4:389398 397
Köppel R, Ruf J, Zimmerli F, Breitenmoser A (2008) Multiplex real-
time PCR for the detection and quantification of DNA from beef,
pork, chicken and turkey. Eur Food Res Technol 227:11991203
Köppel R, Zimmerli F, Breitenmoser A (2009) Heptaplex real-time
PCR for the identification and quantification of DNA from beef,
pork, chicken, turkey, horse meat, sheep (mutton) and goat. Eur
Food Res Technol 230:125133
Laube I, Spiegelberg A, Butschke A, Zagon J, Schauzu M, Kroh L,
Broll H (2003) Methods for the detection of beef and pork in
foods using real-time polymerase chain reaction. Int J Food Sci
Technol 38:111118
Laube I, Tagon J, Broll H (2007) Quantitative determination of
commercially relevant species in foods by real-time PCR. Int J
Food Sci Technol 42:336341
Ling W-F, Hwang D-F (2008) A multiplex PCR assay for species
identification of raw and cooked bonito. Food Control 19:879
885
Mane BG, Mendiratta SK, Tiwari Bhilegaokar KN, Ravindra PV,
Rautt AA (2007) Precise and rapid identification of ovine-caprine
origin of meat by specific PCR assay. J Vet Public Health 5:107
111
Mane BG, Mendiratta SK, Tiwari AK (2009) Polymerase chain
reaction assay for identification of chicken in meat and meat
products. Food Chem 116:806810
Matsunaga T, Chikuni K, Tanabe R, Muroya S, Shibata K, Yamada J,
Shinmura Y (1999) A quick and simple method for the
identification of meat species and meat products by PCR assay.
Meat Sci 51:143148
Meyer R, Candrian U, Luethy J (1994) Detection of pork in heated
meat Products by polymerase chain reaction. J AOAC Int 77
(3):617622
Nau F, Désert C, Cochet M-F, Pasco M, Jan S, Baron F, Lagarrigue S,
Guérin-Dubiard C (2009) Detection of turkey, duck, and guinea
fowl egg in hen egg products by species-specific PCR. Food
Anal Methods 2:231238
Radkey R, Feng L, Muralhider M, Duhon M, Canter D, DiPierro D,
Fallon S, Tu E, McElfresh K, Nerenberg M, Sosnowski R (2000)
Rapid, high fidelity analysis of simple sequence repeats on an
electronically active DNA microchip. Nucleic Acids Res 28(7):E17
Stueber E (2008) Comparion of three commercial test kits for species
identification in scalding sausages. Arch fuer Lebensmittelhyg
59:8491, Archives of Food Chemistry, German
Willse A, Straub TM, Wunschel SC, Small JA, Call DR, Daly DS,
Chandler DP (2004) Quantitative oligonucleotide microarray
fingerprinting of Salmonella enterica isolates. Nucleic Acids
Res 32:18481856
Wintero AK, Thomsen PD, Davies W (1990) A comparison of DNA
hybridization, countercurrent immunoelectrophoresis and isoelec-
tric focussing for detecting the admixture of pork to beef. Meat
Sci 27:7591
Wolf H, Gaede W, Wolf C, Zellerman S, Hoeber S (2001) Nachweis
von Tierischen Bestandteilen im Mischfutter. Fleischwirtschaft
81(5):197201
Zipfel W, Zipfel G (2000) Lebensmittelrecht Textsammlung, 82.
Ergänzungslieferung, C. H. München: Beck'sche-Verlagsbuchhandlung
(in German)
398 Food Anal. Methods (2011) 4:389398
... Moreover, the direct PCR method is still time-consuming, requires complex operation and gel electrophoresis, and cannot be accurately quantified (Li, Jalbani et al., 2019;Shabani et al., 2015) through spectrophotometric methods because the PCR prod-ucts easily undergo interference with single-stranded DNA, RNA, proteins, and so on (Kang & Tanaka, 2018), which restricts its application in industry and commercial settings . Therefore, an upgraded technology has been developed in recent years, that is PCR associated with biochips (Cottenet, Sonnard, Blancpain, Ho, Leong, & Chuah, 2016;Iwobi, Huber, Hauner, Miller, & Busch, 2011;. The DNA biochip technologies have the advantages of the high sensitive and simultaneous detection of multispecies compared to simplex PCR methods (Cottenet et al., 2016;Iwobi et al., 2011). ...
... Therefore, an upgraded technology has been developed in recent years, that is PCR associated with biochips (Cottenet, Sonnard, Blancpain, Ho, Leong, & Chuah, 2016;Iwobi, Huber, Hauner, Miller, & Busch, 2011;. The DNA biochip technologies have the advantages of the high sensitive and simultaneous detection of multispecies compared to simplex PCR methods (Cottenet et al., 2016;Iwobi et al., 2011). Recently, developed two independent multiplex PCR methods based on 12S rRNA, 16S rRNA, ND2, and COI. ...
Article
Meat adulteration, mainly for the purpose of economic pursuit, is widespread and leads to serious public health risks, religious violations, and moral loss. Rapid, effective, accurate, and reliable detection technologies are keys to effectively supervising meat adulteration. Considering the importance and rapid advances in meat adulteration detection technologies, a comprehensive review to summarize the recent progress in this area and to suggest directions for future progress is beneficial. In this review, destructive meat adulteration technologies based on DNA, protein, and metabolite analyses and nondestructive technologies based on spectroscopy were comparatively analyzed. The advantages and disadvantages, application situations of these technologies were discussed. In the future, determining suitable indicators or markers is particularly important for destructive methods. To improve sensitivity and save time, new interdisciplinary technologies, such as biochips and biosensors, are promising for application in the future. For nondestructive techniques, convenient and effective chemometric models are crucial, and the development of portable devices based on these technologies for onsite monitoring is a future trend. Moreover, omics technologies, especially proteomics, are important methods in laboratory detection because they enable multispecies detection and unknown target screening by using mass spectrometry databases.
... • Indirect ELISA is not reliable for unknown samples • Cross-reactivity • Not suitable for heat and pressure treated products (Alikord et al., 2018) Laser-induced breakdown spectroscopy (detect elemental emission signals from organic and inorganic molecules) (Iwobi et al., 2011) (continued on next page) cumbersome. The identification of species-specific protein and nucleic acid (DNA) for meat species differentiation has definite advantages over conventional methods (Amjadi et al., 2012;Ballin et al., 2009). ...
Article
Meat adulteration is a substantial problem in the food industry due to the increasing number of mislabeling incidents worldwide. This malpractice affects the economy, religious beliefs, and health of consumers. Thus, a variety of analytical approaches (protein-based and DNA-based) have been developed for the identification of animal species in meat products. Protein-based approaches are not suitable for distinguishing closely related species and results can be altered due to harsh processing conditions. Hence, the majority of these protein-based approaches have been superseded by more precise and sensitive DNA-based techniques. The polymerase chain reaction (PCR) is the most sensitive and specific DNA-based technique. However, the identification of a single species in a reaction is time-consuming as well as results in resources and economic loss. Multiplex techniques simultaneously detect many species in a single reaction and are advantageous over singleplex techniques. The design of multiplex primer is a complicated process and the detection is affected by many processing conditions. This review provides an overview of multiplex PCR-based detection methods for the identification of meat species. General consideration of multiplex PCR, advantages over conventional PCR, limitations, and challenges in primer designing are also reviewed.
... When designing the oligonucleotide probe sets, all available sequence information can be reviewed and assessed for correctness. Commercially available DNA chips are already being used to differentiate animal species in meat products [4]. Because of the reduced variety of animal species expected in meat products, the oligonucleotide probes on "meat chips" do not have to be able to differentiate between closely related species. ...
Article
Full-text available
This proof-of-principle study describes the development of a rapid and easy-to-use DNA microarray assay for the authentication of giant tiger prawns and whiteleg shrimp. Following DNA extraction and conventional end-point PCR of a 16S rDNA segment, the PCR products are hybridised to species-specific oligonucleotide probes on DNA microarrays located at the bottom of centrifuge tubes (ArrayTubes) and the resulting signal patterns are compared to those of reference specimens. A total of 21 species-specific probes were designed and signal patterns were recorded for 47 crustacean specimens belonging to 16 species of seven families. A hierarchical clustering of the signal patterns demonstrated the specificity of the DNA microarray for the two target species. The DNA microarray can easily be expanded to other important crustaceans. As the complete assay can be performed within half a day and does not require taxonomic expertise, it represents a rapid and simple alternative to tedious DNA barcoding and could be used by crustacean trading companies as well as food control authorities for authentication of crustacean commodities. Graphical abstract
... The microarray technique offers isolation of specific microorganisms, detection and characterization of food-borne pathogens with high sensitivity and specificity [79], furthermore it enables food control laboratories for detection of various animal species in meat products [80]. Moreover, this technology also helps diagnosis of precancerous lesions, cancer and antibiotic treatment [81]. ...
Article
The next generation microbiological analysis is progressed swiftly due to its numerous advantages such as sensitivity, reproducibility, accuracy, low cost and rapidity. Although, conventional culture and analytical methods frequently used for the microbiological examination in terms of its easily accessible, advanced methods provide improving its selectivity and sensitivity. The present paper reviews a variety of qualitative and quantitative techniques for determination of both commonly and rarely emerged microorganisms such as Escherichia coli, Staphylococcus aureus, Listeria monocytogenes, Acinetobacter, Rothia, Pantoea, Cryptococcus, Bacillus, Micrococcus etc. that isolated from different various sources. Presented analytic, nucleic acid-based, biosensor-based, bacteriophage-based and spectroscopy-based methods are detailed with respect to their fundamental principles and examples of applications in microbial ecology. Future-oriented evaluations of these methods and their applications are also discussed to indicate their significance in the field.
... Meanwhile DNA microarray approach is one of the fastest-growing technologies, based on the classical PCR followed by a LCD array hybridisation. Previous studies already reported efficient and reliable meat species identification by DNA microarray technique (Iwobi et al. 2011, Yosef et al. 2014, Beltramo et al. 2017. ...
Article
Adequate testing and adulterant detection of food products are required to assure its safety and avoid fraudulent activities. Adulteration/substitution of costlier meat with a cheaper or inferior meat is one of the most common fraudulence in meat industry. Aim of this study was to check the correct labelling of meat and ready to cook bovine meat products, combining the DNA microarray approach to identify the animal species with the histological examination, to check the composition and safety of meat. One hundred and one samples of bovine minced meat (Group 1) and ready to cook meat products (Group 2) were collected from supermarkets in Turin, Italy. DNA microarray revealed that 25.7% of samples were positive for species not declared on the label, swine being the most common. Histology showed the presence of cartilage, bone and glandular tissue. A higher presence of bacteria and inflammatory cells was detected in Group 1. Bacterial cells associated to inflammatory cells were detected with a higher score in Group 2. Sarcocystis spp. were present in 83.3% samples of Group 1 and 49.1% of Group 2. This study confirmed that the mislabelling of meat products is not uncommon. The combination of DNA microarrays and histology can increase the monitoring capacity in bovine meat industry.
... The use of a DNA microarray is an alternative genetic approach to simultaneous detection of various plant and animal species as well as bacteria present in a sample of interest. It offers several advantages, specifically the identification of unreported and unknown animal species present in the meat sample that were introduced by unintentional contamination or deliberate adulteration of meat products (Kemp et al. 2005;Azuka et al. 2011). RT-PCR can be used in the routine detection and quantification of animal species (Kesmen et al. 2009). ...
Article
The aim of the study was to compare the efficiency, sensitivity and reliability of the MEAT 5.0 LCD-Array and innuDETECT Assay detection kits in identifying selected animal species. Samples were taken from the femoral muscles of six animal species (turkey, chicken, cattle, pig, sheep and goat), and six variants of binary meat mixtures were analysed at 18 different concentration levels of addition. The MEAT 5.0 LCD-Array test was able to detect 0.1% of other meat additions in two meat mixtures and 0.5% in four meat mixtures. The innuDETECT Assays were able to detect the addition of 0.1% of other meat in three meat mixtures, 0.5% in two mixtures and 1% in one meat mixture. Subsequently, these methods were applied in practice to 136 samples of various products taken from commercial food networks. By performing extensive monitoring, we identified 60 products in which one to three species were detected besides what was present on the product label. Nine products were contaminated with pig DNA. Two products that the MEAT 5.0 LCD-Array kit identified as positive for the presence of pig DNA were not confirmed by the innuDETECT Pork Assay kit. We recommend these methods of analysis to comprehensively monitor the presence of animal species in food samples, regardless of the degree of heat treatment or mechanical processing, as a tool to detect food adulteration.
... The food labels of meat and meat products are required to mark the meat source specifically to prevent adulteration in many countries, but the mixture of lower-price meat into high-price meat is still common, for example, adulterating pork or duck meat into beef or mutton or donkey meat, therefore, a reliable identification method of meat species is critical for surveillance of the commercial adulteration (Hong et al., 2017). The existing identification methods are mainly classified into protein-based approaches, for example, radioimmunoassay (Lowenstein et al., 2006), chromatography (Lozano et al., 2017;Pebriana et al., 2017;Wu et al., 2018) and Chemometrics-Assisted Shotgun Proteomics (Yuswan et al., 2018), and DNA-based approaches (Sheikha et al., 2017), for example, polymerase chain reaction (PCR) (Karabasanavar et al., 2017;Man et al., 2012;Mane et al., 2012), multi-PCR (Abuzinadah et al., 2015;Jia et al., 2016), realtime PCR (ÅAkalar & Kaynak, 2016;Herrero et al., 2013;Pegels et al., 2015;Sudjadi et al., 2016), PCR-RFLP (Bielikova et al., 2010), Biochip technology (Iwobi et al., 2011), forensically informative nucleotide sequencing (Rajpoot et al., 2017), and real-time PCR coupled melting curve analysis (Yuru et al., 2016). The structure of meat protein are usually destroyed by the processes such as shredding, cooking and roasting, therefore, the reliability of protein-based approaches is compromised, by comparison, the DNA-based approaches are more reliable, among which PCR is the most commonest assay, PCR, forensically informative nucleotide sequencing and melting curve for analyzing the adulterated meat product is very effective, but limited by the presence of PCR inhibitors in real biological samples and food samples, and meat products are the very complex matrix, mainly composed of proteins, lipids, pigments, enzymes, and other substances, which may interfere with PCR reactions (Wilson, 1997). ...
Article
Full-text available
The objective of this study was to develop a reliable visual method for rapid detection of donkey components to protect consumers from commercial adulteration. Six specific loop-mediated isothermal amplification (LAMP) primers targeted at donkey mitochondrial cytochrome b gene were designed, the mitochondrial DNA extraction simplified, the LAMP reaction system optimized, the specificity verified with mitochondrial DNA of horse, pork, cow, sheep, chicken, duck, and rabbit as negative controls, the detection limit determined with gradient dilution of adulterated meat with donkey meat, and the visual LAMP method for detection of donkey-derived ingredient in common meat products established. The results showed that the modified mitochondrial DNA extraction method was simple and repeatable, and the visual LAMP method with 4-(2-pyridylazo)-resorcinol sodium salt as indicator can accurately and specifically detect the donkey meat in common meat products, 1% detection limit. The study provided a promising solution for facilitating the surveillance of the commercial adulteration in processed meat.
Article
Full-text available
The substitution of more appreciated animal species by animal species of lower commercial value is a common type of meat product adulteration. DNA metabarcoding, the combination of DNA barcoding with next-generation sequencing (NGS), plays an increasing role in food authentication. In the present study, we investigated the applicability of a DNA metabarcoding method for routine analysis of mammalian and poultry species in food and pet food products. We analyzed a total of 104 samples (25 reference samples, 56 food products and 23 pet food products) by DNA metabarcoding and by using a commercial DNA array and/or by real-time PCR. The qualitative and quantitative results obtained by the DNA metabarcoding method were in line with those obtained by PCR. Results from the independent analysis of a subset of seven reference samples in two laboratories demonstrate the robustness and reproducibility of the DNA metabarcoding method. DNA metabarcoding is particularly suitable for detecting unexpected species ignored by targeted methods such as real-time PCR and can also be an attractive alternative with respect to the expenses as indicated by current data from the cost accounting of the AGES laboratory. Our results for the commercial samples show that in addition to food products, DNA metabarcoding is particularly applicable to pet food products, which frequently contain multiple animal species and are also highly prone to adulteration as indicated by the high portion of analyzed pet food products containing undeclared species.
Article
Background Firm raw sausages or ham from game species like chamois, red deer, or roe deer are typical meat products from the alpine regions in Germany, Italy, Austria, and Switzerland. Increased hunting effort and limited numbers make chamois meat more expensive than comparable game meat. In routine analysis at Bavarian Health and Food Safety Authority (LGL), screening of meat relevant animal species is usually performed by LCD array. However, chamois is not included on the commercial array. A simple alternative method for chamois detection in mixed products was therefore required. Results We developed a duplex probe-based real-time PCR (duplex qPCR) that facilitates the specific detection of chamois and a universal eukaryotic gene as control, especially in processed meat products. Detection of chamois was sensitive (chamois DNA content of 1.25 pg/μL or 0.05% is detectable), robust (eight variations of PCR conditions tested), and specific (inclusivity and exclusivity). Detection of Eukarya in the duplex assay can be used both as an inhibition control, and as a rough estimation for the chamois content in the sample. We analysed 20 firm raw sausages with chamois as a declared ingredient. Eleven sausages were free of chamois meat, for three sausages, a ΔCq(Chamois-Eukarya) > 10 indicated the use of chamois meat as minor ingredient, and in six sausages, abundant amounts of chamois meat were detected. Furthermore, among three analysed chamois hams, one consisted of roe deer meat instead. Conclusions The developed duplex qPCR is an easy to use tool to verify the presence of the declared ingredient chamois meat, especially in processed meats like sausages. The considerable proportion of products lacking declared chamois meat (55% or 11/20 for firm raw sausages, 33% or 1/3 for ham), indicates the need for further controls in this non-standard food segment.
Article
Fishery products are traded worldwide, have long and branched supply chains and are among the most counterfeit foods. Food control authorities are responsible of controlling food labelling in order to ensure the safety and quality of products. This is particularly important for tropical and subtropical fish species, such as snappers (Lutjanidae), because certain species are known to be frequently contaminated with ciguatoxins that cause harmful Ciguatera Fish Poisoning outbreaks. The analytical method of choice for the identification of a sample at species level is ‘DNA barcoding’, the sequencing of specific genetic markers and the comparison of the sequences with international nucleotide databases, such as GenBank and BOLD. However, the results of these analyses can be severely impaired by an insufficient data basis and especially by database entries with incorrect species annotations. In this work, the available nucleotide sequences for common genetic markers (COI, cytb, 16S rDNA, 12S rDNA, rag1 and ITS) of snapper species in GenBank were subjected to careful examination with regard to their unambiguousness and clarity. Phylogenetic neighbour joining trees were prepared and checked for ambiguous and contradictory placement of species' sequences with special emphasis on the Malabar blood snapper (Lutjanus malabaricus), the two-spot red snapper (L. bohar) and the crimson snapper (L. erythropterus). The results indicate that ambiguous and contradictory database nucleotide sequences impede the DNA barcoding-based authentication of snapper products at species level. A species assignment for the Malabar snapper and the crimson snapper based solely on database queries seems questionable.
Article
Full-text available
With a standard set of primers directed toward conserved regions, we have used the polymerase chain reaction to amplify homologous segments of mtDNA from more than 100 animal species, including mammals, birds, amphibians, fishes, and some invertebrates. Amplification and direct sequencing were possible using unpurified mtDNA from nanogram samples of fresh specimens and microgram amounts of tissues preserved for months in alcohol or decades in the dry state. The bird and fish sequences evolve with the same strong bias toward transitions that holds for mammals. However, because the light strand of birds is deficient in thymine, thymine to cytosine transitions are less common than in other taxa. Amino acid replacement in a segment of the cytochrome b gene is faster in mammals and birds than in fishes and the pattern of replacements fits the structural hypothesis for cytochrome b. The unexpectedly wide taxonomic utility of these primers offers opportunities for phylogenetic and population research.
Article
Full-text available
Many meat products are composed of two or more meat species. To determine the proportion of these meat fractions, a quantitative multiplex PCR was developed for the quantification of beef, pork, chicken and turkey. This system proved its applicability, precision and accuracy in examining different meat products from the market. Thus it allows the efficient control of composed meat products in official food control and production control laboratories.
Article
Full-text available
Meat products are often composed of meat from several species. Due to fraud or incorrect manufacturing processes, different proportions of unexpected or undeclared meat may be incorporated. Pork, beef, chicken, turkey, horse meat, sheep (mutton) and goat are the most common types of meat in these products. To measure the fractional proportion of each of the seven meat types simultaneously, a quantitative multiplex PCR has been developed. This system has proven its applicability in the examination of meat compounds with fractional proportions between 2 and 100%. The uncertainty was 32% or better. In a single analytical step, the multiplex PCR identifies and in certain cases quantifies the most probable species of composed meat products. Additionally, this study illustrates that by using dyes with different wavelength shifts, more targets can be distinguished than channels provided for by the Rotorgene 6000® thermocycler.
Article
In order to determine their suitability for routine use, three commercial kits for the species identification of meat products were compared. The ELISA-Kit (Transia, Ober-Mörlen), the DNA-Chip CarnoCheck® (Greiner Bio-One, Frickenhausen) and the CIB-A-Kit (Cibus, Gütersloh), a polymerase chain reaction using species specific primer pairs, were used. The kits were evaluated for their sensitivity and specificity as well as the time and money required for each method. In a total of 240 samples, the identification of beef, chicken, turkey and pork in concentrations of 0.1 %, 0.5 % and 1.0 % was examined. The CIB-A-Kit and the CarnoCheck® had a detection limit of 0.1 % and the ability to differentiate between chicken and turkey. With the ELISA it was only possible to reliably identify 0.5 % without enabling a differentiation between chicken and turkey. All three kits showed a high specificity for the species tested. Because of the expensive equipment needed for the molecular biological methods, these expenses ranged clearly above those required for the ELISA. On the other hand, the CarnoCheck® had the lowest permanent costs. The fastest method for the identification of four species in 12 samples was the ELISA which yielded results within approximately 5 3/4 hours. The CarnoCheck® required nearly 8 1/2 hours, while the CIB-A-Kit needed approximately 13 hours. The ELISA method has been applied in routine use for several years, yet the CarnoCheck® could replace this technique as a screening method. On the contrary, the CIB-A-Kit is suitable for the confirmation of ambiguous test results obtained with protein based methods.
Article
Attempts are made to establish one-step multiplex PCR assay for distinguishing five species of raw and cooked bonito including Euthynnus pelamis, Euthynnus affinis, Auxis rochei, Auxis thazard, and Sarda orientalis. After constructing the 1141bp complete mitochondrial cytochrome b genes of five bonito species and other five contrastive Scombridae species, five sets of species-specific primer were designed to amplify different cytochrome b gene fragments in each species individually. The amplified lengths of fragments were respectively 143bp for A. rochei, 236bp for E. pelamis, 318bp for A. thazard, 398bp for E. affinis and 506bp for S. orientalis, which could be obviously differentiated from each other on DNA electrophoresis. The five sets of species-specific primer were mixed and applied to simultaneously detect bonito species. All species from 12 commercial raw fish and five species out of eight cooked bonito fillets were successfully identified by the multiplex PCR assay. Experiments carried out demonstrate that the multiplex PCR assay was useful for identifying species of non-overheating fish product.
Article
Defined samples were examined regarding the proportion of beef, pork, lamb, goat, chicken and turkey utilising TaqManTM PCR. A quantification was performed for determining the proportion of animal species in relation to the total proportion of meat in the food products. The adoption of published real-time PCR systems (International Journal of Food Science and Technology, 2005) permitted a quantitative statement in processed meat products and in canned foods down to a concentration of 0.1%. Different factors influencing the amount of species determined were investigated.
Article
Summary Two TaqMan™-polymerase chain reaction (PCR) systems have been developed which permit the detection of even minute amounts of beef and pork in processed foods. In these methods cattle-specific primers amplified a fragment from the phosphodiesterase gene having a length of 104 base pairs (bp), and the swine-specific primers amplified a fragment from the ryanodin gene having a length of 108 bp. Beyond this, a third TaqMan™-PCR system, developed on the basis of the detection of the myostatin gene, permits a reliable exclusion of false-negative results by detecting meat from a variety of mammals or poultry in the material to be tested.
Article
A simplex polymerase chain reaction (PCR) has been applied for the specific detection of hen, duck, turkey, and guinea fowl in egg products using species-specific primers targeting the mitochondrial cytochrome b genes. The species-specific PCR yielded excellent results for identification of duck, turkey, and guinea fowl eggs in hen egg products, since the detection of 0.1% of each species was achieved, in liquid egg products as well as in powders. The proposed method is then a potentially reliable and suitable technique in routine food analysis for the research of fraudulent species mixture practices.
Article
The aim of this study was to develop polymerase chain reaction (PCR) assay for specific detection of chicken meat using designed primer pair based on mitochondrial D-loop gene for amplification of 442 bp DNA fragments from fresh, processed and autoclaved meat and meat products. The PCR result was further verified by restriction digestion with HaeIII and Sau3AI enzymes for specific cutting site in amplified DNA fragments. The specificity of assay was cross tested with DNA of cattle, buffalo, sheep, goat, pig, duck, guinea fowl, turkey and quail, where amplification was observed only in chicken without cross reactivity with red meat species. However positive reaction was also observed in quail and turkey. In this study, no adverse effects of cooking and autoclaving were found on amplification of chicken DNA fragments. Thus, the detection limits was found to be less than 1% in admixed meat and meat products. The developed assay was found specific and sensitive for rapid identification of admixed chicken meat and meat products processed under different manufacturing conditions.