Amino acid residues in the non-structural protein 1 of porcine reproductive and respiratory syndrome virus involved in down-regulation of TNF-α expression in vitro and attenuation in vivo

Article (PDF Available)inVirology 432(2):241-9 · June 2012with26 Reads
DOI: 10.1016/j.virol.2012.05.014 · Source: PubMed
Abstract
Porcine reproductive and respiratory syndrome virus (PRRSV) suppresses tumor necrosis factor-alpha (TNF-α) production at both transcriptional and post-transcriptional levels by its non-structural proteins 1α and 1β (Nsp1α and Nsp1β). To identify the amino acid residues responsible for this activity, we generated several alanine substitution mutants of Nsp1α and Nsp1β. Examination of the mutant proteins revealed that Nsp1α residues Gly90, Asn91, Arg97, Arg100 and Arg124 were necessary for TNF-α promoter suppression, whereas several amino acids spanning the entire Nsp1β were found to be required for this activity. Two mutant viruses, with mutations at Nsp1α Gly90 or Nsp1β residues 70-74, generated from infectious cDNA clones, exhibited attenuated viral replication in vitro and TNF-α was found to be up regulated in infected macrophages. In infected pigs, the Nsp1β mutant virus was attenuated in growth. These studies provide insights into how PRRSV evades the effector mechanisms of innate immunity during infection.
Amino acid residues in the non-structural protein 1 of porcine reproductive
and respiratory syndrome virus involved in down-regulation of TNF-
a
expression in vitro and attenuation in vivo
Sakthivel Subramaniam
1
, Lalit K. Beura
2
, Byungjoon Kwon, Asit K. Pattnaik, Fernando A. Osorio
n
School of Veterinary Medicine & Biomedical Sciences and Nebraska Center for Virology, University of Nebraska-Lincoln, NE 68583, USA
article info
Article history:
Received 22 March 2012
Returned to author for revisions
3 May 2012
Accepted 14 May 2012
Available online 13 June 2012
Keywords:
PRRSV
TNF-
a
Reverse genetics
Promoter regulation
Immune evasion
Innate immunity
abstract
Porcine reproductive and respiratory syndrome virus (PRRSV) suppresses tumor necrosis factor-alpha (TNF-
a
) production at both transcriptional and post-transcriptional levels by its non-structural proteins 1
a
and 1
b
(Nsp1
a
and Nsp1
b
). To identify the amino acid residues responsible for this activity, we generated several
alanine substitution mutants of Nsp1
a
and Nsp1
b
. Examination of the mutant proteins revealed that Nsp1
a
residues Gly90, Asn91, Arg97, Arg100 and Arg124 were necessary for TNF-
a
promoter suppression, whereas
several amino acids spanning the entire Nsp1
b
were found to be require d for this activi ty. Two mutant
viruses, with mutations at Nsp1
a
Gly90 or Nsp1
b
residues 70–74, generated from infectious cDNA clones,
exhibited attenuated viral replication in vitro and TNF-
a
was found to be up regulated in infected
macrophages. In infected pigs, the Nsp1
b
mutant virus was attenuated in growth. These studies provide
insights into how PRRSV evades the effector mechanisms of innate immunity during infection.
& 2012 Else vier Inc. All rights reserved.
Introduction
Porcine reproductive and respiratory syndrome virus (PRRSV)
causes late-term abortion in sows and respiratory disease in
young pigs (Christianson et al., 1993; Christianson et al., 1992;
Rossow et al., 1995). Following infection, PRRSV replicates in
lungs and secondary lymphoid tissues in the host and establishes
a viremic period of about 3–4 weeks (Duan, Nauwynck, and
Pensaert, 1997; Rossow et al., 1994; Rossow et al., 1995). The
viremic period is followed by a persistent period of 1–6 months,
characterized by low levels of virus replication in secondary lym-
phoid tissues (Allende et al., 2000). The host immune response
usually takes several months to clear the virus from persistently
infected swine (Allende et al., 2000).
Previous studies demonstrated that the adaptive immune
responses against PRRSV develop gradually, an important factor
in less efficient clearance of the virus from the host (Allende et al.,
2000; Meier et al., 2003). The ineffective adaptive immune
responses against PRRSV are the result of various immune evasion
strategies utilized by this virus (Ansari et al., 2006; Beura et al.,
2010; Costers et al., 2009; Lopez and Osorio, 2004; Ostrowski
et al., 2002; Subramaniam et al., 2010; Vu et al., 2011). One such
strategy consists of inhibiting the key pro-inflammatory cytokine,
tumor necrosis factor-
a
(TNF-
a
) in infected cells (Lopez-Fuertes
et al., 2000; Subramaniam et al., 2010). The TNF-
a
response
against different PRRSV strains in pulmonary alveolar macro-
phages (PAMs) varies significantly depending on the strain
(Darwich et al., 2011; Gimeno et al., 2011). Since TNF-
a
can
inhibit PRRSV replication in macrophages (Lopez-Fuertes et al.,
2000), we hypothesize that PRRSV-mediated TNF-
a
suppression
would likely enhance virus production in the infected host.
Our laboratory has previously shown that PRRSV-vFL12 strain
suppresses TNF-
a
during infection, at the promoter level and also
post-transcriptionally (Subramaniam et al., 2010). Particularly,
vFL12 strain suppresses the TNF-
a
promoter only at early times
after infection. Even though TNF-
a
transcripts are abundant at
later time points after vFL12 infection, secreted TNF-
a
is not
detected in the infected culture supernatants (Subramaniam
et al., 2010). The non-structural proteins 1
a
(Nsp1
a
) and 1
b
(Nsp1
b
) of the virus down-regulate NF-
k
B and Sp1 activities at
TNF-
a
promoter, respectively (Subramaniam et al., 2010). In addi-
tion to Nsp1 proteins, PRRSV non-structural protein 2 (Nsp2) also
regulates TNF-
a
expression in infected cells (Chen et al., 2010).
The variations in Nsp2 sequences account for differences in TNF-
a
induction in response to various PRRSV field isolates (Darwich
et al., 2011).
Contents lists available at SciVerse ScienceDirect
journal homepage: www.elsevier.com/locate/yviro
Virology
0042-6822/$ - see front matter & 2012 Elsevier Inc. All rights reserved.
http://dx.doi.org/10.1016/j.virol.2012.05.014
n
Corresponding author at: 111 Morrison Center, University of Nebraska-Lincoln,
NE 68583, USA. Fax: þ 1 402 472 3323.
E-mail address: fosorio@unl.edu (F.A. Osorio).
1
Present address: Department of Biomedical Sciences & Pathobiology, Virgi-
nia-Maryland Regional College of Veterinary Medicine, Virginia Tech, Blacksburg,
VA 24060, USA.
2
Present address: Department of Microbiology, University of Minnesota,
Minneapolis, MN 55455, USA.
Virology 432 (2012) 241–249
Nsp1
a
and Nsp1
b
are non-structural proteins that participate
in various aspects of the PRRSV life cycle such as transcription,
virion biogenesis and innate immune evasion (Beura et al., 2010;
Kroese et al., 2008; Tijms et al., 2007). Nsp1
a
, the proteolytically
processed amino-terminal region of Nsp1, contains 180 amino
acid residues and forms two domains, an N-terminal zinc finger
domain (ZF domain) and a C-terminal papain-like cysteine pro-
tease (PCP
a
) domain (Sun et al., 2009). Nsp1
b
, the proteolytically
processed carboxy-terminal region of Nsp1, contains 203 amino
acid residues and forms three domains, an N-terminal nuclease
domain, a linker domain and a C-terminal papain-like cysteine
protease (PCP
b
) domain (Xue et al., 2010). The PCP
a
and PCP
b
domains auto-cleave Nsp1
a
and Nsp1
b
from the viral polypro-
tein, respectively (Kroese et al., 2008). Upon cleavage and activa-
tion, both of these proteins homo-dimerize (Sun et al., 2009; Xue
et al., 2010). PCP
a
-mediated auto-cleavage of Nsp1
a
is essential
for transcription of viral sub-genomic RNAs (Kroese et al., 2008).
Likewise, PRRSV Nsp1
a
ZF domain may also directly participate in
viral transcription (Fang and Snijder, 2010; Tijms et al., 2007). On
the other hand, PCP
b
-mediated auto-cleavage of Nsp1
b
is essen-
tial for PRRSV replication (Kroese et al., 2008). In addition, the
Nsp1
b
nuclease domain cleaves double-stranded DNA, and single-
stranded RNA in vitro (Xue et al., 2010). However, the Nsp1
a
and Nsp1
b
sequences necessary for down-regulating the TNF-
a
promoter activity are unknown.
In this study, we conducted mutagenesis studies to identify
the amino acid residues in Nsp1
a
and Nsp1
b
that are necessary
for affecting TNF-
a
promoter activity. Five Nsp1
a
amino acid
residues, Gly90, Asn91, Arg97, Arg100, and Arg124 were identi-
fied as required for suppression of TNF-
a
promoter activity.
Several Nsp1
b
amino acid residues spanning the entire protein
were found to be necessary for suppression of TNF-
a
promoter
activity. We subsequently recovered two mutant viruses from
infectious cDNA clones with alanine substitution at Nsp1
a
Gly90
residue or Nsp1
b
70–74 amino acid positions. These mutant
viruses induced TNF-
a
mRNAs efficiently but induced protein
levels minimally in infected macrophages when compared to
the infection with wild type virus. In infected swine, the Nsp1
b
mutant virus exhibited growth-attenuated phenotype as com-
pared to the wild type virus. Overall, these results suggest the
possibility of generating attenuated PRRSVs for vaccine develop-
ment through mutations in Nsp1
b
.
Results
Cysteine protease activities of Nsp1 are not necessary for TNF-
a
promoter suppression
Nsp1
a
and Nsp1
b
cysteine protease activities are mediated by
PCP
a
and PCP
b
, respectively (Kroese et al., 2008). The histidine
residue at amino acid position 146 in vFL12-Nsp1
a
is a part of
PCP
a
active site as deduced by pairwise sequence alignment with
Nsp1
a
of Lelystad strain (Kroese et al., 2008). Similarly, the
cysteine residue at amino acid position 90 and the histidine
residue at amino acid position 159 of vFL12-Nsp1
b
are part of
the PCP
b
active site, as deduced by pairwise sequence alignment
with Nsp1
b
of Lelystad strain (Kroese et al., 2008). Mutation of
these residues to alanine in the expression constructs did not
affect their respective protein levels (Fig. 1A and B, bottom
panels). Transient reporter assays were carried out with a TNF-
a
promoter-luciferase construct and lipopolysaccharide (LPS) was
used to stimulate the promoter. Both Nsp1
a
and Nsp1
b
mutated
in their respective cysteine protease active sites (PCP
a
and PCP
b
,
respectively) efficiently reduced the TNF-
a
promoter activity in
those assays when compared to their wild type counterparts
(Fig. 1A, B). The results suggest that Nsp1
a
and Nsp1
b
reduce the
TNF-
a
promoter activity independently of their cysteine protease
activities.
Identification of Nsp1
a
amino acid residues critical for TNF-
a
promoter suppression
Nsp1
a
has two distinct domains: the ZF domain (1–65 amino
acids) and the PCP
a
domain (66–166 amino acids) (Sun et al.,
2009). To identify which of these domains is necessary for
reducing TNF-
a
promoter activity, we performed alanine-scan-
ning mutagenesis in randomly selected blocks of 4–6 amino acid
length spanning the entire Nsp1
a
protein. In transient reporter
assays, none of the PCP
a
domain mutants were able to reduce
TNF-
a
promoter activity (Fig. 2A). Certain PCP
a
domain mutants
such as Nsp1
a
122-6A, Nsp1
a
139-5A, and Nsp1
a
155-5A exhibited
reduced protein levels when compared to the wild type protein
(Fig. 2A). Three out of four ZF domain mutants (Nsp1
a
20-4A,
Nsp1
a
55-5A, and Nsp1
a
63-5A) reduced the TNF-
a
promoter
activity to similar extent as the wild type protein (Fig. 2A).
The remaining ZF domain mutant (Nsp1
a
41-5A) suppressed the
TNF-
a
promoter less efficiently than did the wild type protein,
which may be due to reduced protein expression (Fig. 2A). Three
amino acid scanning mutations in PCP
a
domain but not in the ZF
domain also relieved TNF-
a
promoter suppression (data not
shown). These results suggest that the PCP
a
domain but not ZF
Fig. 1. PRRSV Nsp1
a
and Nsp1
b
suppress TNF-
a
promoter activity independently
of their cysteine protease functions. (A, B) RAW 264.7 cells were transfected with
pswTNF-luc plasmid (0.2
m
g) along with indicated vi ral protein expressing
plasmid (1
m
g) and a renilla luciferase-expressing vector (10 ng). After 2 4 h,
cells were stimulated with LPS (1
m
g) for 6 h. In cell lysates, firefly luciferase
activities were measured and normalized with renilla luciferase activities. 100%
TNF-
a
promoter activity represents the activity in control vector tran sfected
cells and 0% promoter activity represents the activity in wild type Nsp1
a
or
Nsp1
b
transfected cells. Each bar represents mean7 standard error (n ¼3).
Bottom panels depict the amount of corresponding viral proteins in transfected
cells. RAW 264.7 cells were transfected with viral protein expressing plasmid
(2
m
g). After 24 h post-transfection, the viral protein in cell lysates was detected
by western blotting using anti-Nsp1 antibodi es.
b
-actinwasusedasloading
control.
S. Subramaniam et al. / Virology 432 (2012) 241–249242
domain appears to be primarily responsible for suppression of
TNF-
a
promoter activity.
Additional studies were performed to identify individual
amino acid residues in PCP
a
domain that are necessary for
reducing TNF-
a
promoter activity. Point mutations were intro-
duced in selected amino acid stretches 89–93, 95–97, and 122–
127 of PCP
a
domain. Mutation of PCP
a
domain residues, Gly90,
Asn91, Arg97, Arg100, and Arg124 significantly up regulated TNF-
a
promoter activity when compared to the wild type protein
(Fig. 2B, C). Mutations of these amino acid residues did not affect
protein levels (Fig. 2B and C) or protease activities of Nsp1
a
(data
not shown). Examination of the Nsp1
a
tertiary structure revealed
that the amino acid residues, Gly90, Asn91, Arg97, Arg100, and
Arg124 are closely positioned on PCP
a
domain surface (Fig. 2D).
These studies suggest that the five amino acid residues in PCP
a
domain, Gly90, Asn91, Arg97, Arg100, and Arg124 are important
for suppressing the TNF-
a
promoter activity.
Mutations in several Nsp1
b
amino acid stretches relieved TNF-
a
promoter suppression
Nsp1
b
has three domains: an N-terminal nuclease domain
(1–48 amino acids), a flexible linker domain (49–84 amino acids)
and a C-terminal PCP
b
domain (85–181 amino acids) (Xue et al.,
2010). To identify the domains involved in suppressing the TNF-
a
promoter activity, alanine-scanning mutations of 4–6 amino acids
in all Nsp1
b
domains were introduced. In transient reporter
assays, most mutant proteins demonstrated relief of TNF-
a
promoter suppression relative to the wild type protein (Fig. 3).
The mutant, Nsp1
b
101-5A suppressed TNF-
a
promoter moder-
ately when compared to the wild type protein (Fig. 3). Although
the mutants, Nsp1
b
124-4A and Nsp1
b
136-5A, were expressed at
reduced protein levels when compared to the wild type protein
(Fig. 3), the relief of TNF-
a
promoter suppression activity was
significant. The results suggest that all Nsp1
b
domains may be
Fig. 2. Characterization of Nsp1
a
amino acid residues necessary for reducing TNF-
a
promoter activity. (A–C) RAW 264.7 cells were transfected with pswTNF-luc (0.2
m
g)
along with Nsp1
a
wild type or mutant protein expressing plasmid (1
m
g) and a renilla luciferase-expressing vector (10 ng). After 24 h, cells were stimulated with LPS (1
m
g/
mL) for 6 h. Firefly luciferase activities were measured in cell lysates and normalized with renilla luciferase activities. 100% TNF-
a
promoter activity represents the activity
in control vector transfected cells and 0% promoter activity represents the activity in wild type Nsp1
a
transfected cells. Each bar represents mean7standard error (n¼ 3).
The immunoblot panels depict the amount of corresponding viral proteins in transfected cells. RAW 264.7 cells were transfected with Nsp1
a
wild type or mutant protein
expressing plasmid (2
m
g). After 24 h post-transfection, the viral protein in cell lysates was detected by western blotting using anti-Nsp1 antibodies.
b
-actin was used as
loading control. (D) Tertiary structure of Nsp1
a
. Residues necessary for reducing TNF-
a
promoter activity are highlighted: Three Arginine residues (in green), the Glycine
residue (in yellow) and the Asparagine residue (in blue). The figure was adopted from NCBI structure database (PDB ID: 3IFU) using Cn3D software. (For interpretation of
the references to color in this figure legend, the reader is referred to the web version of this article.)
S. Subramaniam et al. / Virology 432 (2012) 241–249 243
involved in inhibiting TNF-
a
promoter activity. Alternatively, it is
possible that mutations in some of these domains may have
affected the overall structure of the protein, thus rendering it
nonfunctional in its ability to suppress TNF-
a
promoter activity.
Recovery, growth kinetics and plaque morphology of Nsp1
a
and Nsp1
b
mutant viruses
In the case of Nsp1
a
, attempts were made to recover viruses
harboring 3–6 amino acid block mutations from infectious cDNA
clones containing the mutations. Viruses with mutations at the
Nsp1
a
positions, 89–93, 95–97, 97–100, and 122–127 were non-
viable as judged by the absence of anti-N (PRRSV nucleocapsid)
immunofluorescence (Table 1) in cells infected with supernatants
from full-length viral RNA transfected cells. However, two viruses
(vFL12Nsp1
a
G90A and vFL12Nsp1
a
G90S) were recovered with
single point mutations at Nsp1
a
amino acid residue, Gly90
(Table 1). Viruses harboring other single point mutations at
Nsp1
a
amino acid residues, Asn91, Arg97, Arg100, and Arg124
were not viable (Table 1).
In the case of Nsp1
b
, attempts were made to generate viruses
with mutations at Nsp1
b
positions, 70–74 and 113–118. The
infectious virus was successfully recovered with mutations at
residues 70–74 (vFL12Nsp1
b
70-5A) but a viable virus could not
be recovered with mutation at residues 113–118 (Table 1). In an
attempt to recover a virus containing mutations in both Nsp1
a
G90 and Nsp1
b
positions 70–74, we generated cDNA clones with
these mutations. However, repeated attempts to recover such a
virus were unsuccessful. Overall, we recovered three mutant
PRRSVs, two presenting mutations in Nsp1
a
at G90 (G90A,
G90S) and one with a mutation in Nsp1
b
at positions, 70–74. Of
the two Nsp1
a
mutant viruses, we used the virus with G90S
substitution for further studies, as this mutant virus contains two
nucleotide substitutions in this codon and is therefore less likely
to readily revert to the wild type sequence.
Multi-step growth kinetic analysis revealed that the mutant
viruses (vFL12Nsp1
a
G90S and vFL12Nsp1
b
70-5A) exhibited
overall similar growth kinetics as the parental wild type vFL12
Fig. 3. All domains of Nsp1
b
contribute to TNF-
a
promoter suppression. RAW
264.7 cells were transfected with pswTNF-luc (0.2
m
g) along with Nsp1
b
wild type
or mutant expressing plasmid (1
m
g) and a renilla luciferase vector (10 ng). After
24 h, cells were stimulated with LPS (1
m
g/mL) for 6 h. Firefly luciferase activities
were measured in cell lysates and normalized with renilla luciferase activities.
100% TNF-
a
promoter activity represents the activity in control vector transfected
cells and 0% promoter activity represents the activity in wild type Nsp1
b
transfected cells. Each bar represents mean7standard error (n ¼ 3). Bottom panels
depict the amount of corresponding viral proteins in transfected cells. RAW 264.7
cells were transfected with Nsp1
b
wild type or mutant expressing plasmid (2
m
g).
After 24 h post-transfection, the viral protein in cell lysates was detected by
western blotting using anti-Nsp1 antibodies.
b
-actin was used as loading control.
Table 1
Recovery of PRRSV mutant viruses by reverse genetics.
Amino acid position
a
Anti-N immunofluorescence Virus recovery
Nsp1
a
(89–93) 
Nsp1
a
(95–97) 
Nsp1
a
(97–100) 
Nsp1
a
(122–127) 
Nsp1
a
Gly90Ala þþ
Nsp1
a
Gly90Ser þþ
Nsp1
a
Asn91Ala 
Nsp1
a
Arg97Ala 
Nsp1
a
Arg100Ala 
Nsp1
a
Arg124Ala 
Nsp1
b
(70–74)
þþ
Nsp1
b
(113–118)

a
Number in the parentheses indicate the position of amino acids mutated to
alanines.
Fig. 4. Nsp1 mutant viruses have reduced growth when compared to wild type
vFL12 virus. (A) Multi-step growth kinetics in MARC-145 cells after infection with
0.1 m.o.i. of indicated viruses. Supernatant of infected cells was collected at
indicated time points and viral titration was performed in MARC-145 cells. Viral
titers are expressed as tissue culture infectivity dose
50
(TCID
50
). Viral titer values
represent the mean7 standard error (n¼ 3). (B) Plaque morphology of viruses in
MARC-145 cells. Cells were infected with FL12 wild type or mutant viruses,
covered with growth medium agar and incubated for 4 day. Cells were fixed with
glutaraldehyde followed by crystal violet staining.
S. Subramaniam et al. / Virology 432 (2012) 241–249244
in MARC-145 cells. The vFL12Nsp1
b
70-5A virus grew slightly
slower than vFL12 virus exhibiting approximately a ten-fold
difference in titer (Fig. 4A). The vFL12Nsp1
a
G90S virus grew to
a titer that is approximately 5–7 fold less compared to vFL12
(Fig. 4A). Both mutant viruses also exhibited reduced plaque sizes
as compared to the wild type virus (Fig. 4B). Overall, these results
suggest that the mutant viruses, vFL12Nsp1
a
G90S and
vFL12Nsp1
b
70-5A, exhibit somewhat reduced growth in cultured
MARC-145 cells.
Expression of TNF-
a
in macrophages infected by Nsp1 mutant PRRSVs
is up regulated
Studies were performed to examine TNF-
a
responses after
infecting swine macrophages with vFL12 wild type or the mutant
viruses. Infections with Nsp1 mutant viruses induced higher levels
of TNF-
a
mRNAs only at 12 hpi when compared to the infection
with the wild type virus (Fig. 5A). Importantly, the mutant virus
vFL12Nsp1
b
70-5A induced significant levels of TNF-
a
mRNA at the
early (12 hpi) time of infection (Fig. 5A). However, there were no
differences observed in TNF-
a
mRNA levels between wild type and
mutant virus infected macrophage cultures at 24 hpi (Fig. 5A). Our
additional experiments also showed that the Nsp1
b
70-5A mutant
protein did not affect Sp1-dependent transcriptional activities in
transient transfection assays (data not shown), which are necessary
for activating the TNF-
a
promoter (Falvo et al., 2000). The mutant
vFL12Nsp1
a
G90S virus induced higher levels of TNF-
a
protein in
the supernatant of infected macrophage cultures both at 12 and
24 hpi (Fig. 5B). However, both wild type vFL12 and mutant
vFL12Nsp1
b
70-5A viruses induced negligible levels of TNF-
a
protein
in the supernatant of infected macrophage cultures (Fig. 5B).
Furthermore, the mutant viruses, replicated with low viral titers in
macrophage cultures after infection when compared to wild type
vFL12 (Fig. 5C). In particular, the mutant vFL12Nsp1
b
70-5A showed
an approximately 100-fold reduction in viral titers in macrophage
culture supernatants when compared to vFL12 (Fig. 5C).
Additionally, the macrophages infected with the mutant
viruses also induced higher mRNA levels of two pro-inflammatory
chemokines: CCL2 and CXCL10 at 24 and 36 h post-infection
when compared to macrophages infected with vFL12 (data not
shown). This is not unexpected considering that these two
chemokines are induced by TNF-
a
(Murao et al., 2000; Qi et al.,
2009). In summary, the two mutant viruses, vFL12Nsp1
a
G90S
and vFL12Nsp1
b
70-5A, stimulated the production of TNF-
a
mRNA and protein more strongly than the wild type vFL12 in
infected macrophage cultures.
Growth attenuation and TNF-
a
induction phenotypes of PRRSV
mutant viruses in infected pigs
To examine the growth of the Nsp1 mutant viruses and TNF-
a
responses in swine, pigs were infected with wild type vFL12 or the
mutant viruses. By 14 day post-infection (dpi), all infected pigs sero-
converted (data not shown). In addition, all infected pigs exhibited
their peak viremia between 3 and 7 day post-infection (Fig. 6A, B).
Sequencing of viral RNAs isolated from serum until 14 day post-
infection confirmed the presence of Nsp1
a
G90S and Nsp1
b
70-5A
mutations in respective mutant viruses. When compared to wild
type vFL12, the mutant vFL12Nsp1
b
70-5A exhibited nearly two
log
10
reduction in viral titers and viral RNA copies in serum at 3 dpi
(Fig. 6A, B). By 7 dpi, two out of three animals infected with the
mutant vFL12Nsp1
b
70-5A had no detectable infectious virus in
Fig. 5. TNF-
a
response against Nsp1 mutant viruses in infected primary macrophages in vitro. (A) Quantitative PCR analysis. PBMC-derived macrophages were mock-
infected or infected with 0.1 m.o.i. of indicated viruses. At different time points, total RNAs were prepared from infected cells and cDNAs were synthesized. Using cDNAs as
template, the amount of TNF-
a
mRNAs was quantified by qPCR. TNF-
a
copy numbers were calculated using standard curve prepared with known amount of templates and
normalized with
b
-actin copy numbers. Bars represent mean7 standard error (n ¼ 3). (B) TNF-
a
protein measurement by ELISA. PBMC-derived macrophages were infected
with vFL12 wild type or indicated mutant viruses at 0.1 m.o.i. TNF-
a
protein levels in the supernatant were measured by ELISA. Bars represent mean 7 standard error
(n¼ 3). Dotted line in y-axis represents the detection limit of assay. (C) Viral titers were measured in MARC-145 cells and expressed as TCID
50
/mL. Mean7standard error
(n¼ 3) values were shown.
S. Subramaniam et al. / Virology 432 (2012) 241–249 245
serum (Fig. 6A). However, viral RNAs were detected at lower levels
in pigs infected with the mutant vFL12Nsp1
b
70-5A when compared
to pigs infected with vFL12 for 14 dpi (Fig. 6B). In contrast, pigs
infected with the mutant vFL12Nsp1
a
G90S had similar viral titers
as well as viral RNA copies in serum when compared to the pigs
infected with vFL12 (Fig. 6A, B).
The TNF-
a
mRNA levels in PBMCs were enhanced in pigs infected
with vFL12Nsp1
b
70-5A virus at 3 dpi when compared to the wild
type vFL12 infection (Fig. 6C). Pigs infected with the mutant
vFL12Nsp1
a
G90S showed increased TNF-
a
protein levels in serum
at 7 dpi when compared to pigs infected with wild type vFL12
(Fig. 6D). However, at 10 dpi, both vFL12 and vFL12Nsp1
a
G90S
groups had similar elevated levels of TNF-
a
(Fig. 6D). In summary,
the mutant vFL12Nsp1
b
70-5A virus replicated with reduced viral
titers and the virus also up-regulated TNF-
a
mRNA levels at 3 dpi in
infected pigs.
Discussion
PRRSV decreases the production of TNF-
a
during infection
in vitro and in vivo (Calzada-Nova et al., 2011; Labarque et al.,
2003; Lopez-Fuertes et al., 2000; Subramaniam et al., 2010; van
Gucht, van Reeth, and Pensaert, 2003). Nsp1
a
and Nsp1
b
are
important viral mediators that reduce TNF-
a
promoter activity in
transient transfection assays (Subramaniam et al., 2010). In this
study, we identified critical amino acid residues in Nsp1
a
and
Nsp1
b
that are important for TNF-
a
down-regulation. Subse-
quently, through reverse genetics, we generated two mutant
PRRSV viruses that up-regulated TNF-
a
expression, particularly
at mRNA level in infected macrophage cultures. These two
mutant viruses replicated in cell culture with reduced viral titers.
In infected pigs, one mutant virus with mutation in Nsp1
b
replicated with reduced viral titers in serum.
Several laboratories demonstrated that PRRSV infection leads to
poor TNF-
a
response in serum and broncho-alveolar lavage fluid
from infected pigs (Labarque et al., 2003; Thanawong nuw ec h et al.,
2004; van Gucht, van Reeth, and Pensaert, 2003). Similarly, PRRSV
infection actively inhibits TNF-
a
expression in macrophages and
dendritic cells in vitro (Calzada-Nova et al. 2011; Lopez-Fuertes
et al., 2000). Previous results from our laboratory indicated that
PRRSV cysteine proteases, Nsp1
a
and Nsp1
b
suppress TNF-
a
promoter by modulating the activity of specific transcription factors,
NF-
k
B and Sp1, respectively (Subramaniam et al., 2010). In this
study, we sought to further characterize the down-regulatory effect
by identifying the amino acid residues in Nsp1
a
and Nsp1
b
that
reduce TNF-
a
production. Upon such identification, we pursued
recovering PRRSV strains with mutations in those positions by
reverse genetics and examining the mutants in infected animals
for their ability to relieve TNF-
a
suppression.
A previous study had shown that active site mutations in Nsp1
cysteine proteases lead to failure of virus recovery by reverse
genetics (Kroese et al., 2008). Our result showed that the Nsp1
cysteine protease activities were not necessary for suppressing
TNF-
a
promoter activity. This observation is consistent with
previous findings that the Nsp1 cysteine proteases cleave only
cis-substrates present at the end of respective proteins (Sun et al.,
2009; Xue et al., 2010). Therefore, it is less likely that Nsp1
cysteine protease activities degrade signaling molecules required
for the TNF-
a
-induction pathway.
Screening of domain-specific mutations in Nsp1
a
revealed
that the PCP
a
domain, but not the ZF domain, was primarily
Fig. 6. Comparison of viremia, TNF-
a
expression levels between pigs infected with vFL12 wild type and pigs infected with mutant viruses. Four-week old piglets (n¼ 3
each group) were infected intra-muscularly with 10
5.1
TCID
50
of vFL12 wild type or indicated mutant viruses. (A) Viral titers were evaluated in serum of infected pigs at
indicated time points after infection. Viral titration was done in MARC-145 cells. The viral titers were calculated by Reed and Muench method, and expressed as tissue
culture infectivity dose
50
(TCID
50
/mL). Data indicate mean7 standard error (n ¼ 3). (B) PRRSV-specific quantitative RT-PCR analysis. Viral RNAs were isolated from serum of
infected pigs at indicated time points after infection. They were quantified by qRT-PCR specific to vFL12 3’UTR as described in methods section. Viral RNA copies were
calculated by using a standard curve prepared with known amount of templates. Data indicate mean7 standard error (n¼ 3). (C) TNF-
a
-specific qRT-PCR. Total RNAs were
isolated from 1 10
6
PBMCs collected from pigs at indicated time points after infection. TNF-
a
mRNA levels were quantified by qRT-PCR as described in methods section.
TNF-
a
mRNA copies were normalized with
b
-actin mRNA copies. Bars represent mean7 standard error values (n ¼ 3). (D) TNF-
a
ELISA. TNF-
a
protein levels in serum of
infected pigs were measured by ELISA at indicated time points after infection. Values are expressed as mean7 standard error (n¼ 3).
S. Subramaniam et al. / Virology 432 (2012) 241–249246
important for inhibiting TNF-
a
promoter activity. Five amino acid
residues (Gly90, Asn91, Arg97, Arg100, and Arg124) on the sur-
face of the PCP
a
domain were important for inhibiting the TNF-
a
promoter. Many mutations in the ZF domain of Nsp1
a
did not
significantly relieve TNF-
a
suppression, which suggested that the
ZF domain may not directly participate in inhibiting the TNF-
a
promoter activity. We were only able to recover mutant viruses
with mutations at Nsp1
a
Gly90 residue. However, viruses with
mutations at Nsp1
a
residues Asn91, Arg97, Arg100, and Arg124,
were not viable, though they were found to be dispensable for
PCP
a
protease activity. These amino acid residues may be
important for other Nsp1
a
functions, such as viral transcription,
replication and/or virion biogenesis (Fang and Snijder, 2010).
Unlike Nsp1
a
, all three domains of Nsp1
b
seem to be impor-
tant for down regulating TNF-
a
promoter activity. One of Nsp1
b
mutant (70-5A) exhibits protein levels equivalent to wild type but
did not reduce TNF-
a
promoter activity efficiently. In agreement
with this, 70-5A mutant protein did not also reduce transcription
driven by Sp1, which bind TNF-
a
promoter to activate transcrip-
tion (Falvo et al., 2000). The 70-5A mutation is located in a small
linker domain of Nsp1
b
. The successful recovery of mutant virus
in this position suggests that the amino acids at 70–74 position
are not required for Nsp1
b
protease activity over Nsp1
b
–Nsp2
junction. It seems plausible that the Nsp1
b
linker domain may
directly participate in the inhibition of Sp1 trans-activation or
indirectly modulate the functions of the other Nsp1
b
domains to
inhibit Sp1-dependent TNF-
a
transcription.
Previous studies demonstrated that PRRSV suppresses TNF-
a
expression at the transcriptional and post-transcriptional levels
(Subramaniam et al., 2010; Thanawongnuwech et al., 2004). PRRSV
particularly inhibited the TNF-
a
transcription during early time
points after infection in macrophages (Subramaniam et al., 2010).
We confirmed such previous finding in the present study. Both Nsp1
mutant virus infections showed enhanced TNF-
a
transcriptional
activity at early times (12 h) post-infection. Particularly, the Nsp1
b
mutant virus significantly induced TNF-
a
mRNA levels at 12 h post-
infection in infected macrophage cultures. In consistent with these
in vitro observations, pigs infected with Nsp1
b
mutant virus also
up-regulated TNF-
a
mRNA levels at 3 dpi in peripheral blood
mononuclear cells.
When the growth characteristics of Nsp1 mutant viruses were
examined, both viruses were moderately attenuated in growth in
susceptible MARC-145 cells, which may be due to the effects in
other Nsp1 functions such as transcription and replication. When
we examined the growth of these mutant viruses in macrophages
in vitro and in infected pigs, the growth of vFL12Nsp1
b
70-5A was
severely compromised but the growth of vFL12Nsp1
a
G90S was
affected to a minimal level. Even though vFL12Nsp1
b
70-5A
mutant virus has ability to induce TNF-
a
mRNAs earlier than
the wild type virus, it did not induce significant TNF-
a
protein at
any time point after infection in vitro or in vivo. Hence, the
crippled growth of vFL12Nsp1
b
70-5A in macrophages in vitro
and in infected pigs is more likely due to loss of some other
critical function of the protein important for viral progression.
The vFL12Nsp1
a
G90S mutant virus infection produced detect-
able levels of TNF-
a
protein in macrophages when compared to
wild type virus infection. This suggests that in addition to its
effect at the promoter level, Nsp1
a
also inhibits TNF-
a
production
via a post-transcriptional mechanism. This is evident in animal
studies in which vFL12Nsp1
a
G90S mutant virus induced TNF-
a
in
serum of infected pigs at 7 dpi when compared to wild type vFL12
infected pigs. Additional experiments also revealed that, when
over-expressed, Nsp1
a
reduces co-expressing TNF-
a
protein
levels without affecting Internal Ribosome Entry Site (IRES)-
dependent GFP expressed from a bi-cistronic mRNA. Further, in
those experiments, Nsp1
a
G90S mutant protein did not efficiently
reduce TNF-
a
protein levels expressed from the bi-cistronic
construct when compared to the wild type protein.
In summary, the overall conclusions of this study are: (1) Nsp1
a
amino acid residue Gly90 is necessary for suppressing the TNF-
a
promoter activity and TNF-
a
protein levels during PRRSV infection;
(2) Nsp1
b
amino acid residues at 70–74 are necessary for suppres-
sing the TNF-
a
promoter activity; and (3) PRRSV-vFL12 strain with
mutation at Nsp1
b
positions 70–74 produced significantly reduced
viral titers in infected pigs, an information that may pave the way
for new candidate attenuated live vaccines.
Materials and methods
Cells and viruses
RAW 264.7 cells, a murine macrophage cell line (ATCC) was
maintained in RPMI-1640 supplemented with 10% fetal bovine
serum (FBS). MARC-145 cells, an African green monkey kidney
epithelial cell line (obtained from Dr. Will Laegreid, University of
Illinois, Urbana-Champaign) was maintained in Dulbecco’s mod-
ified eagle medium (DMEM)-low glucose supplemented with 10%
FBS. BHK-21, baby hamster kidney epithelial cell line (ATCC)
was maintained in DMEM-high glucose supplemented with 10%
FBS. Primary swine macrophages were prepared from PBMCs as
previously described (Subramaniam et al., 2010). PRRSV vFL12
strain (GenBank ID: AY545985) and its mutant viruses were
propagated and titrated in MARC-145 cells. Viral titers were
calculated using the Reed and Muench method (Reed and
Muench, 1938). Viral plaque assays were performed in MARC-
145 cells as previously described (Ansari et al., 2006).
TNF-
a
promoter-luciferase reporter assay
Swine TNF-
a
promoter-luciferase reporter assay was carried
out as previously described (Subramaniam et al., 2010). RAW
264.7 cells were co-transfected with plasmids, pswTNF-luc (0.2
m
g)
(Subramaniam et al., 2010) and pRL-TK (10 ng) (Promega), and wild
type or mutant Nsp1
a
/Nsp1
b
-expressing plasmid (1
m
g) using
DEAE-dextran (Sigma) by following a procedure described earlier
(Subramaniam et al., 2010). After 24 h of transfection, the reporter
genes were stimulated with LPS (1
m
g/mL) for 6 h. Firefly and renilla
luciferase activities were measured using dual luciferase reporter
assay system in GloMax 20/20 luminometer (Promega). Firefly
luciferase units were normalized with renilla luciferase units.
Relative luciferase units were calculated by dividing normalized
firefly lucif er ase units measured from stimul ated cells with those
measured from unstimulated cells.
Plasmids construction
pIHA-Nsp1
D
268–297 plasmid was constructed by deleting
thirty amino acids from 268 to 297 amino acid positions in the
whole Nsp1 sequence (Gene Bank Accession No. AY545985).
Plasmids expressing Nsp1
a
or Nsp1
b
(pIHA-Nsp1
a
and pIHA-
Nsp1
b
(Subramaniam et al., 2010)) were used to introduce 3–6
amino acid alanine-scanning mutations. pIHA-Nsp1
D
268–297
plasmid was used to introduce point mutations in Nsp1
a
. Muta-
tions were introduced into Nsp1 genes by PCR mutagenesis
following the mega primer method (Sarkar and Sommer, 1990).
In order to transfer Nsp1
a
and Nsp1
b
mutant sequences from
pIHA constructs into pFL12 infectious clone (Truong et al., 2004),
we constructed an intermediate transfer vector pIHA-2757. The
plasmid was constructed by cloning RsrII and SpeI restriction-
digested fragment of pFL12 infectious clone into pIHA empty
vector ( Beura et al., 2010). Nsp1
a
mutant sequences were cloned
S. Subramaniam et al. / Virology 432 (2012) 241–249 247
into pIHA-2757 using AccI and StuI restriction sites present within
Nsp1
a
. Nsp1
b
mutant sequences were cloned into pIHA-2757
using AvrII and BsrGI restriction sites present within Nsp1
b
.
Finally, the RsrII and SpeI digested fragment was transferred from
the pIHA-2757 mutant plasmid into pFL12 infectious clone. The
corresponding mutation in pFL12 plasmid was confirmed by
sequencing.
Quantitative RT-PCR and ELISA
TNF-
a
-specific quantitative PCR (qPCR) was performed as
previously described (Subramaniam et al., 2010). Briefly, total
RNA fractions were prepared from mock-infected cells or cells
infected with either vFL12 or mutant viruses using Trizol-LS
reagent (Invitrogen). Complementary DNAs (cDNAs) were synthe-
sized using oligo-dTs as primer. cDNAs were used as template in
qPCR reactions to measure TNF-
a
or
b
-actin mRNAs using
sequence-specific primers and probes (Subramaniam et al., 2010).
PRRSV 3
0
untranslated region (UTR)-specific qRT-PCR was per-
formed to detect viral RNAs in serum of infected pigs. Briefly, viral
RNAs were isolated from 140
m
L of serum using QIAamp viral
RNA mini kit (Qiagen). Viral RNAs (4
m
L) were used as template
in quantitative reverse-transcription (RT)-PCR reaction using hot
start-IT Probe one step qRT-PCR kit (USB, 75772). The following
primers and probe were used in the reaction: forward primer
ATGTGTGGTGAATGGCACTG, reverse primer GCATGGTTCTCGCCA-
ATTAAA, Taqman probe 6-FAM-TCACCTATTCAATTAGGGCGACCG-
TAMRA. The cycling conditions employed were as follows: reverse
transcription at 50
J
C for 30 min, initial enzyme activation at 95
J
C
for 2 min, denaturation at 95
J
C for 15 s followed by annealing/
extension at 60
J
C for 60 s. Denaturation and annealing/extension
steps were repeated for total of 45 cycles.
To measure the TNF-
a
protein levels in the supernatant of
mock-infected or virus-infected cells, a commercial swine TNF-
a
-
specific ELISA was used (Pierce/Invitrogen).
Western blotting
Cellular protein lysates were prepared in either radio-immuno-
precipitation assay buffer or cell-lysis buffer as described elsewhere
(Alcaraz et al., 1990; Beura et al., 2010). Equal amounts of total
protein were resolved in 12% Sodium dodecyl Sulfate (SDS)-poly-
acrylamide gel electrophoresis and transferred on Polyvinylidene
fluoride (PVDF) membrane. The membrane was blotted with rabbit
polyclonal antibodies specific for Nsp1 or mouse monoclonal anti-
bodies specific for
b
-actin (Santacruz) for overnight at 4
J
C. The
membranes were treated with Horse Radish Peroxidase (HRP)-
conjugated anti-rabbit or anti-mouse IgG antibodies (KPL) for 1 h
at RT and signals were obtained with chemiluminescence substrates
(Thermo scientific).
In vitro transcription, electroporation and recovery of mutant viruses
Capped in vitro transcripts (IVTs) were prepared from wild type
ormutantpFL12infectiousclonesaspreviouslydescribed(Kwon
et al., 2006; Truong et al., 2004). IVTs were electroporated into
MARC-145 or BHK-21 cells by following a procedure described
earlier (Ansari et al., 2006). After 1–2 day post-electroporation, the
replication of mutant virus was confirmed by immunofluorescence
using anti-N monoclonal antibodies (SDOW17, NVSL-USDA). The
success of viral recovery was assessed by spread of cytopathic effect
in electroporated MARC-145 cells. The supernatants from electro-
porated BHK-21 cells were transferred on to PBMC-derived macro-
phages to propagate recovered viruses.
Viral growth kinetics and in vitro infection studies
For multi-step growth kinetics, MARC-145 cells were cultured
in 96-well plates two days before infection. On the third day, cells
were infected with vFL12 wild type or mutant viruses at 0.1 multi-
plicity of infection (m.o.i.) in triplicates. At 6, 12, 24, 48, 72, 96 h
post-infection, supernatants were collected and viruses were
titrated in MARC-145 cells. The viral titers were calculated using
Reed and Muench method (Reed and Muench, 1938). For measur-
ing TNF-
a
mRNA and protein responses in vitro, PBMC-derived
macrophages were infected with vFL12 wild type or mutant
viruses at 0.1 m.o.i. At 12, 24, 36 and 48 h post-infection, cells
were collected in Trizol-LS (Invitrogen) for mRNA quantification.
Supernatants were collected to measure TNF-
a
protein and viral
titers.
Animal experiments
Four-week old PRRSV-negative pigs (n¼ 3 each group) were
infected with vFL12 wild type or mutant strains at 10
5.1
TCID
50
/
2 mL intra-muscularly. At 3, 7, 10, 14, 21 day post-infection (dpi),
serum was collected to determine viremia and TNF-
a
protein
levels by viral titration and ELISA, respectively. Similarly, PBMCs
(1 10
6
cells/aliquot) were collected in Trizol-LS for mRNA
quantification.
Statistical analysis
The significance in difference between means of two treatment
groups was tested using one-tailed unpaired student’s t-test. A p
value of less than 0.05 was considered significant. Analyses were
performed using Prism 5 (Graphpad).
Acknowledgment
Collection of blood from donor pigs and animal infection
studies were performed according to the protocols approved by
the Institutional Animal Care and Use Committee at the Univer-
sity of Nebraska-Lincoln. This research was supported in part by
USDA NRICGP/NIFA awards [Project no. 2008-00903 (to FAO) and
2009-01654 and 2012-67015-30191 (to AKP)].
References
Alcaraz, C., De Diego, M., Pastor, M.J., Escribano, J.M., 1990. Comparison of a
radioimmunoprecipitation assay to immunoblotting and ELISA for detection of
antibody to African swine fever virus. J. Vet. Diagn. Invest. 2 (3), 191–196.
Allende, R., Laegreid, W.W., Kutish, G.F., Galeota, J.A., Wills, R.W., Osorio, F.A., 2000.
Porcine reproductive and respiratory syndrome virus: description of persis-
tence in individual pigs upon experimental infection. J. Virol. 74 (22),
10834–10837.
Ansari, I.H., Kwon, B., Osorio, F.A., Pattnaik, A.K., 2006. Influence of N-linked
glycosylation of porcine reproductive and respiratory syndrome virus GP5 on
virus infectivity, antigenicity, and ability to induce neutralizing antibodies.
J. Virol. 80 (8), 3994–4004.
Beura, L.K., Sarkar, S.N., Kwon, B., Subramaniam, S., Jones, C., Pattnaik, A.K., Osorio,
F.A., 2010. Porcine reproductive and respiratory syndrome virus nonstructural
protein 1beta modulates host innate immune response by antagonizing IRF3
activation. J. Virol. 84 (3), 1574–1584.
Calzada-Nova, G., Schnitzlein, W.M., Husmann, R.J., Zuckermann, F.A., 2011. North
American porcine reproductive and respiratory syndrome viruses inhibit type
I interferon production by plasmacytoid dendritic cells. J. Virol. 85 (6),
2703–2713.
Chen, Z., Zhou, X., Lunney, J.K., Lawson, S., Sun, Z., Brown, E., Christopher-
Hennings, J., Knudsen, D., Nelson, E., Fang, Y., 2010. Immunodominant epitopes
in nsp2 of porcine reproductive and respiratory syndrome virus are dispen-
sable for replication, but play an important role in modulation of the host
immune response. J. Gen. Virol. 91 (Pt 4), 1047–1057.
Christianson, W.T., Choi, C.S., Collins, J.E., Molitor, T.W., Morrison, R.B., Joo, H.S.,
1993. Pathogenesis of porcine reproductive and respiratory syndrome virus
infection in mid-gestation sows and fetuses. Can. J. Vet. Res. 57 (4), 262–268.
S. Subramaniam et al. / Virology 432 (2012) 241–249248
Christianson, W.T., Collins, J.E., Benfield, D.A., Harris, L., Gorcyca, D.E., Chladek,
D.W., Morrison, R.B., Joo, H.S., 1992. Experimental reproduction of swine
infertility and respiratory syndrome in pregnant sows. Am. J. Vet. Res. 53 (4),
485–488.
Costers, S., Lefebvre, D.J., Goddeeris, B., Delputte, P.L., Nauwynck, H.J., 2009.
Functional impairment of PRRSV-specific peripheral CD3þ CD8 high cells.
Vet. Res. 40 (5), 46.
Darwich, L., Gimeno, M., Sibila, M., Diaz, I., de la Torre, E., Dotti, S., Kuzemtseva, L.,
Martin, M., Pujols, J., Mateu, E., 2011. Genetic and immunobiological diver-
sities of porcine reproductive and respiratory syndrome genotype I strains.
Vet. Microbiol. 150 (1-2), 49–62.
Duan, X., Nauwynck, H.J., Pensaert, M.B., 1997. Virus quantification and identifica-
tion of cellular targets in the lungs and lymphoid tissues of pigs at different
time intervals after inoculation with porcine reproductive and respiratory
syndrome virus (PRRSV). Vet. Microbiol. 56 (1-2), 9–19.
Falvo, J.V., Uglialoro, A.M., Brinkman, B.M., Merika, M., Parekh, B.S., Tsai, E.Y., King,
H.C., Morielli, A.D., Peralta, E.G., Maniatis, T., Thanos, D., Goldfeld, A.E., 2000.
Stimulus-specific assembly of enhancer complexes on the tumor necrosis
factor alpha gene promoter. Mol. Cell. Biol. 20 (6), 2239–2247.
Fang, Y., Snijder, E.J., 2010. The PRRSV replicase: exploring the multifunctionality
of an intriguing set of nonstructural proteins. Virus Res. 154 (1–2), 61–76.
Gimeno, M., Darwich, L., Diaz, I., de la Torre, E., Pujols, J., Martin, M., Inumaru, S.,
Cano, E., Domingo, M., Montoya, M., Mateu, E., 2011. Cytokine profiles and
phenotype regulation of antigen presenting cells by genotype-I porcine
reproductive and respiratory syndrome virus isolates. Vet. Res. 42 (1), 9.
Kroese, M.V., Zevenhoven-Dobbe, J.C., Bos-de Ruijter, J.N., Peeters, B.P., Meulen-
berg, J.J., Cornelissen, L.A., Snijder, E.J., 2008. The nsp1alpha and nsp1 papain-
like autoproteinases are essential for porcine reproductive and respiratory
syndrome virus RNA synthesis. J. Gen. Virol. 89 (Pt 2), 494–499.
Kwon, B., Ansari, I.H., Osorio, F.A., Pattnaik, A.K., 2006. Infectious clone-derived
viruses from virulent and vaccine strains of porcine reproductive and respira-
tory syndrome virus mimic biological properties of their parental viruses in a
pregnant sow model. Vaccine 24 (49–50), 7071–7080.
Labarque, G., Van Gucht, S., Nauwynck, H., Van Reeth, K., Pensaert, M., 2003.
Apoptosis in the lungs of pigs infected with porcine reproductive and
respiratory syndrome virus and associations with the production of apopto-
genic cytokines. Vet. Res. 34 (3), 249–260.
Lopez-Fuertes, L., Campos, E., Domenech, N., Ezquerra, A., Castro, J.M., Dominguez,
J., Alonso, F., 2000. Porcine reproductive and respiratory syndrome (PRRS)
virus down-modulates TNF-alpha production in infected macrophages. Virus
Res. 69 (1), 41–46.
Lopez, O.J., Osorio, F.A., 2004. Role of neutralizing antibodies in PRRSV protective
immunity. Vet. Immunol. Immunopathol. 102 (3), 155–163.
Meier, W.A., Galeota, J., Osorio, F.A., Husmann, R.J., Schnitzlein, W.M., Zuckermann,
F.A., 2003. Gradual development of the interferon-gamma response of swine
to porcine reproductive and respiratory syndrome virus infection or vaccina-
tion. Virology 309 (1), 18–31.
Murao, K., Ohyama, T., Imachi, H., Ishida, T., Cao, W.M., Namihira, H., Sato, M.,
Wong, N.C., Takahara, J., 2000. TNF-alpha stimulation of MCP-1 expression is
mediated by the Akt/PKB signal transduction pathway in vascular endothelial
cells. Biochem. Biophys. Res. Commun. 276 (2), 791–796.
Ostrowski, M., Galeota, J.A., Jar, A.M., Platt, K.B., Osorio, F.A., Lopez, O.J., 2002.
Identification of neutralizing and nonneutralizing epitopes in the porcine
reproductive and respiratory syndrome virus GP5 ectodomain. J. Virol. 76 (9),
4241–4250.
Qi, X.F., Kim, D.H., Yoon, Y.S., Jin, D., Huang, X.Z., Li, J.H., Deung, Y.K., Lee, K.J., 2009.
Essential involvement of cross-talk between IFN-gamma and TNF-alpha in
CXCL10 production in human THP-1 monocytes. J. Cell. Physiol. 220 (3),
690–697.
Reed, L.J., Muench, H., 1938. A simple method of estimating fifty percent end-
points. Am. J. Hygiene 27, 493–497.
Rossow, K.D., Collins, J.E., Goyal, S.M., Nelson, E.A., Christopher-Hennings, J.,
Benfield, D.A., 1995. Pathogenesis of porcine reproductive and respiratory
syndrome virus infection in gnotobiotic pigs. Vet. Pathol. 32 (4), 361–373.
Rossow, K.D., Bautista, E.M., Goyal, S.M., Molitor, T.W., Murtaugh, M.P., Morrison,
R.B., Benfield, D.A., Collins, J.E., 1994. Experimental porcine reproductive and
respiratory syndrome virus infection in one-, four-, and 10-week-old pigs.
J. Vet. Diagn. Invest. 6 (1), 3–12.
Sarkar, G., Sommer, S.S., 1990. The ‘‘megaprimer’’ method of site-directed
mutagenesis. Biotechniques 8 (4), 404–407.
Subramaniam, S., Kwon, B., Beura, L.K., Kuszynski, C.A., Pattnaik, A.K., Osorio, F.A.,
2010. Porcine reproductive and respiratory syndrome virus non-structural
protein 1 suppresses tumor necrosis factor-alpha promoter activation by
inhibiting NF-kappaB and Sp1. Virology 406 (2), 270–279.
Sun, Y., Xue, F., Guo, Y., Ma, M., Hao, N., Zhang, X.C., Lou, Z., Li, X., Rao, Z., 2009.
Crystal structure of porcine reproductive and respiratory syndrome virus
leader protease Nsp1alpha. J. Virol. 83 (21), 10931–10940.
Thanawongnuwech, R., Thacker, B., Halbur, P., Thacker, E.L., 2004. Increased
production of proinflammatory cytokines following infection with porcine
reproductive and respiratory syndrome virus and Mycoplasma hyopneumo-
niae. Clin. Diagn. Lab. Immunol. 11 (5), 901–908.
Tijms, M.A., Nedialkova, D.D., Zevenhoven-Dobbe, J.C., Gorbalenya, A.E., Snijder, E.J.,
2007. Arterivirus subgenomic mRNA synthesis and virion biogenesis depend on
the multifunctional nsp1 autoprotease. J. Virol. 81 (19), 10496–10505.
Truong, H.M., Lu, Z., Kutish, G.F., Galeota, J., Osorio, F.A., Pattnaik, A.K., 2004. A
highly pathogenic porcine reproductive and respiratory syndrome virus
generated from an infectious cDNA clone retains the in vivo virulence and
transmissibility properties of the parental virus. Virology 325 (2), 308–319.
van Gucht, S., van Reeth, K., Pensaert, M., 2003. Interaction between porcine
reproductive-respiratory syndrome virus and bacterial endotoxin in the lungs
of pigs: potentiation of cytokine production and respiratory disease. J. Clin.
Microbiol. 41 (3), 960–966.
Vu, H.L., Kwon, B., Yoon, K.J., Laegreid, W.W., Pattnaik, A.K., Osorio, F.A., 2011.
Immune evasion of porcine reproductive and respiratory syndrome virus
through glycan shielding involves both glycoprotein 5 as well as glycoprotein
3. J. Virol. 85 (11), 5555–5564.
Xue, F., Sun, Y., Yan, L., Zhao, C., Chen, J., Bartlam, M., Li, X., Lou, Z., Rao, Z., 2010.
The crystal structure of porcine reproductive and respiratory syndrome virus
nonstructural protein Nsp1beta reveals a novel metal-dependent nuclease.
J. Virol. 84 (13), 6461–6471.
S. Subramaniam et al. / Virology 432 (2012) 241–249 249
    • "Thus, both Nsp1 and Nsp11 of PRRSV are suggested to be the factors contributing to the pathogenesis of PRRSV. A previous study had shown that mutant viruses with mutations at Nsp1 Gly90 or Nsp1 residues 70–74, generated from infectious cDNA clones, exhibited attenuated viral replication in vitro and TNF-was found to be up regulated in infected macrophages (Subramaniam et al., 2012). However, no differences were found by aligning the amino acids of these sites between JXwn06 and HB-1/3.9. "
    [Show abstract] [Hide abstract] ABSTRACT: Porcine reproductive and respiratory syndrome virus (PRRSV) has been recognized to be one of the most important pathogens severely affecting global swine industry. An increasingly number of studies has paid much attention to the diverse roles of its nonstructural proteins (Nsps) in regulating the innate immune response of host upon PRRSV infection. In the present study, we first discovered that highly pathogenic PRRSV (HP-PRRSV) and low pathogenic PRRSV (LP-PRRSV) infection exhibited a differential TNF-α expression in pulmonary alveolar macrophages (PAMs), showing that HP-PRRSV infection induces lower TNF-α production at protein level in PAMs, compared with LP-PRRSV. Next, HP-PRRSV was confirmed to strongly suppress TNF-α production by inhibiting ERK signaling pathway. Finally, both Nsp1β and Nsp11 were demonstrated to be responsible for the inhibitory effect on TNF-α production induced by HP-PRRSV and the differential TNF-α production in PAMs. These findings contribute to the understanding of the pathogenesis of the Chinese HP-PRRSV. Copyright © 2015. Published by Elsevier B.V.
    Full-text · Article · Feb 2015
    Qing HeQing HeYan LiYan LiLei ZhouLei Zhou+1more author...[...]
    • "Nsp1a and Nsp1b moderately inhibited NF-kB activation and completely abrogated the Sp1 transactivation, respectively [34]. PRRSV elicits a defective transcriptional response to facilitate viral replication through down-regulating TNF-a production and inducing anti-apoptotic transcripts [35]. Apart from PRRSV, TNF-a has also been proved to directly inhibit replication of several DNA and RNA viruses in vitro [34]. "
    [Show abstract] [Hide abstract] ABSTRACT: Porcine reproductive and respiratory syndrome (PRRS) is one of the most serious diseases affecting the swine industry worldwide, however, there is no efficient control strategies against PRRSV at present. Therefore, development of new antiviral treatment strategies is urgently needed. As reported, LiCl can efficiently impair the replication of a variety of viruses, including infectious bronchitis coronavirus (IBV) and transmissible gastroenteritis coronavirus (TGEV). In this report, we exploited whether the LiCl had the potential to inhibit PRRSV infection. MARC-145 cells were treated with LiCl at various stages of PRRSV life cycle. Virus titration assay was performed to determine the virus infectivity. The expression of viral mRNA and protein was measured by Realtime PCR and indirect immunofluorescence assay, respectively. The transcript levels of cytokines were evaluated by Realtime PCR. LiCl significantly repressed the synthesis of viral RNA and protein. However, it did not block PRRSV binding and entry. Further studies confirmed that the LiCl inhibited PRRSV replication at an early stage, and TNF-α, one of the antiviral cytokines, was significantly increased after LiCl treatment. Thus, we suggested that LiCl inhibited PRRSV infection by up-regulating the level of antiviral cytokine TNF-α at an early infection stage. Our findings imply that the LiCl has the potential to be used for anti-PRRSV therapies.
    Article · Jan 2015
    Jin CuiJin CuiJiexiong XieJiexiong XieMing GaoMing Gao+1more author...[...]
    • "The structural and non-structural proteins (nsp) are believed to modulate host immune responses (Wang et al, 2009). It has been recently shown that nsp1 of PRRSV modulates the expression of type I interferon (Beura et al, 2010; Beura et al, 2012; Chen et al, 2010; Wang et al, 2013; Kim et al, 2010) and TNF-α (Subramaniam et al, 2012), which leads to persistent infection (Lamontagne et al, 2003). In addition, PRRSV infects and destroys porcine alveolar macrophage (PAM), which is an active producer of cytokines and leukotrienes and has important roles in inducing pro-and anti-inflammatory responses in the alveolus (Gordon and Read, 2002) and innate immune response against respiratory infections (Pribul et al, 2008). "
    [Show abstract] [Hide abstract] ABSTRACT: Although it has been generally accepted that porcine reproductive and respiratory syndrome virus (PRRSV) induces weak and delayed protective immunity after infection, it is unclear that the same immunological features can be applicable to all PRRS viruses because huge genetic variation exists even among the same genotypes of PRRSV (Type 1 and 2). In the current study, two genetically distinct type 2 PRRSV strains (VR-2332 and JA142) which showed approximately 90% nucleotide homology based on ORF5 sequences were characterized by both in vitro and in vivo assessments to determine the immunological features of the viruses. For in vitro assessment, porcine alveolar macrophages (PAM) were infected with the viruses at multiplicity of infection (MOI) and then supernatants and cells were collected separately at 36 hrs post infection to determine the relative expression levels of IL-, IL-12, TNF- and INF- by quantitative RT-PCR. In addition, five PRRSV-free pigs were inoculated with either of JA142 or VR2332 for in vivo assessment. Serum samples were collected every week until 6 weeks post challenge. The serum samples were analyzed for the levels of viremia, PRRSV nucleocapsid-specific antibody and virus neutralizing antibody. Based on those assessments, the two viruses showed different patterns of cytokine expression in PAM and immune responses in pigs after infection. These results indicate that genetically distinct PRRSV strains have different immunological features, which might be criteria for virus classification and selection of candidate virus strains for vaccine development in the future.
    Full-text · Article · Mar 2014
Show more