Unprecedented long-term genetic monomorphism in an endangered relict butterfly species

Abstract

Multi-locus monomorphism in microsatellites is practically non-existent, with one notable exception, the island fox (Urocyon littoralis dickeyi) population on San Nicolas island off the coast of southern California, having been called “the most monomorphic sexually
reproducing animal population yet reported”. Here, we present the unprecedented long-term monomorphism in relict populations
of the highly endangered Parnassius apollo butterfly, which is protected by CITES and classified as “threatened” by the IUCN. The species is disjunctly distributed
throughout the western Palaearctic and has occurred in several small remnant populations outside its main distribution area.
We screened 78 individuals from 1 such relict area (Mosel valley, Germany) at 16 allozyme and 6 microsatellite loci with the
latter known to be polymorphic in this species elsewhere. From the same area, we also genotyped 55 museum specimens sampled
from 1895 to 1989 to compare historical and present levels of genetic diversity. However, none of all these temporal populations
yielded any polymorphism. Thus, present and historical butterflies were completely monomorphic for the same fixed allele.
This is the second study to report multi-locus monomorphism for microsatellites in an animal population and the first one
to prove this monomorphism not to be the consequence of recent factors. Possible explanations for our results are a very low
long-term effective population size and/or a strong historic bottleneck or founder event. Since the studied population has
just recovered from a recent population breakdown (second half of twentieth century) and no signs of inbreeding depression
have been detected, natural selection might have purged the population of weakly deleterious alleles, thus rendering it less
susceptible to the usual negative corollaries of high levels of homozygosity and low effective population size.

Full text

RESEARCH ARTICLE
Unprecedented long-term genetic monomorphism
in an endangered relict butterfly species
Jan Christian Habel ÆFrank Emmanuel Zachos Æ
Aline Finger ÆMarc Meyer ÆDirk Louy Æ
Thorsten Assmann ÆThomas Schmitt
Received: 6 May 2008 / Accepted: 29 October 2008 / Published online: 15 November 2008
Springer Science+Business Media B.V. 2008
Abstract Multi-locus monomorphism in microsatellites
is practically non-existent, with one notable exception, the
island fox (Urocyon littoralis dickeyi) population on San
Nicolas island off the coast of southern California, having
been called ‘‘the most monomorphic sexually reproducing
animal population yet reported’’. Here, we present the
unprecedented long-term monomorphism in relict popula-
tions of the highly endangered Parnassius apollo butterfly,
which is protected by CITES and classified as ‘‘threatened’’
by the IUCN. The species is disjunctly distributed
throughout the western Palaearctic and has occurred in
several small remnant populations outside its main distri-
bution area. We screened 78 individuals from 1 such relict
area (Mosel valley, Germany) at 16 allozyme and 6
microsatellite loci with the latter known to be polymorphic
in this species elsewhere. From the same area, we also
genotyped 55 museum specimens sampled from 1895 to
1989 to compare historical and present levels of genetic
diversity. However, none of all these temporal populations
yielded any polymorphism. Thus, present and historical
butterflies were completely monomorphic for the same
fixed allele. This is the second study to report multi-locus
monomorphism for microsatellites in an animal population
and the first one to prove this monomorphism not to be the
consequence of recent factors. Possible explanations for
our results are a very low long-term effective population
size and/or a strong historic bottleneck or founder event.
Since the studied population has just recovered from a
recent population breakdown (second half of twentieth
century) and no signs of inbreeding depression have been
detected, natural selection might have purged the popula-
tion of weakly deleterious alleles, thus rendering it less
susceptible to the usual negative corollaries of high levels
of homozygosity and low effective population size.
Keywords Parnassius apollo vinningensis 
Microsatellites Allozymes Purging Collection samples 
Climate change Population genetics Genetic diversity
Introduction
Xerothermophilic elements (re)colonized Central Europe
from the Mediterranean region after the last glacial period
(Hewitt 1996). With the end of the climatic optimum during
the Atlanticum, some 6,000 years ago, a large number of
Mediterranean species with highly specific ecological
demands only survived at isolated habitat patches in some
parts of Central Europe with especially hot and dry condi-
tions (De Lattin 1967). Living in isolation enhances
processes of population dynamics [like population fluctua-
tions (Lesica and Allendorf 1995)] and population
stochasticity (Melbourne and Hastings 2008) resulting in
J. C. Habel (&)A. Finger M. Meyer
Muse
´e National d’histoire Naturelle, Section Zoologie des
Inverte
´bre
´s, 25, rue Mu
¨nster, 2160 Luxembourg, Germany
e-mail: Janchristianhabel@gmx.de
J. C. Habel A. Finger D. Louy T. Schmitt
Biogeography, University Trier, 54296 Trier, Germany
F. E. Zachos
Zoological Institute, Christian-Albrechts-University Kiel,
24118 Kiel, Germany
A. Finger
ETH Zu
¨rich, ITES-Ecosystem Management, 8092 Zu
¨rich,
Switzerland
T. Assmann
Institute of Ecology and Environmental Chemistry, Leuphana
University Lueneburg, 21335 Lu
¨neburg, Germany
123
Conserv Genet (2009) 10:1659–1665
DOI 10.1007/s10592-008-9744-5

the loss of genetic diversity in local sites through drift,
which cannot be compensated by immigration from
neighbouring populations (Hanski 1999). Such genetically
impoverished populations often suffer from decreased fit-
ness due to inbreeeding e.g., causing the accumulation of
weakly deleterious genes (Allendorf and Luikart 2006).
Many theoretical and experimental studies have analysed
these effects (cf. Frankham et al. 2002; Hansson and
Westerberg 2002; Reed and Frankham 2003).
To address the problem of genetic erosion in isolated
and small populations, we selected the strongly isolated
populations of Parnassius apollo in the Mosel valley.
These populations are several hundreds of kilometres dis-
tant from the next extant populations (Nakonieczny et al.
2007). Futhermore, the demography of the Apollo butter-
flies in the Mosel region has been well recorded and a
strong population bottleneck is known for the second half
of the twentieth century due to intensification of viticulture
and later recovery after intensive restoration efforts
(Kinkler et al. 1987;Lo
¨ser and Rehnelt 1983). To test the
influence of these known population dynamics, we ana-
lysed the population genetic structure of extant post-
bottleneck, bottleneck and pre-bottleneck populations.
Herefore, we sampled individuals in their habitats and
analysed museum specimens dating back to 1895.
For this survey, we selected two different analytical
tools: microsatellites and allozymes. Due to their high
mutation rate, microsatellite loci are powerful markers for
the detection of genetic diversity and differentiation of
isolated and fragmented populations because they more
often show polymorphisms than other molecular markers
(Selkoe and Toonen 2006) and the six loci included in this
study show considerable genetic variability in two other
populations of P. apollo (Petenian et al. 2005). Allozymes
also represent a suitable marker system especially in but-
terfly species (cf. Schmitt and Hewitt 2004a,b) to unravel
genetic diversity within and differentiation among popu-
lations (Ridgway 2005), and Descimon (1995) found
polymorphisms in populations of P. apollo from France;
however, this system only could be used for the currently
sampled individuals as enzymes degrade rapidly so that
museum specimens are not a suitable source. Based on
these data we analysed the genetic consequences of this
regional bottleneck and the resulting conservation impli-
cations for the P. apollo populations of the Mosel region.
Materials and methods
Study species
The xeromontane butterfly Parnassius apollo (Linnaeus
1758) is patchily distributed from Spain to southern
Fennoscandia and the Balkan Peninsula including the
northwestern Peleponnesos (Kudrna 2002). It has univol-
tine populations flying from June to August (Tolman and
Lewington 1997). The species is divided into many sub-
species distributed over Europe, and some of these
subspecies are restricted to isolated regions of Central
Europe (Tolman and Lewington 1997). At present, P.
apollo is classified as one of the most endangered butter-
flies in Europe (IUCN 1996), listed in the European Red
Data Book (Van Swaay and Warren 1999), the Appendix II
of the Habitat Directive (EEC 92/43/EWG) of the Euro-
pean Union and the CITES-Convention.
The subspecies Parnassius apollo vinningensis (Stichel
1899) was described as an endemic taxon of the Lower Mosel
valley due to a characteristic wing coloration constantly
deviating from the nominate form. The habitats of this but-
terfly are rocky slopes with the larval food plant Sedum
album (Kinkler et al. 1987). Habitat destruction due to plot
alignements, destruction of old stone walls with Sedum and
widespread spraying of pesticides and fallow land led to a
severe collapse during the 1970s, and this formerly wide-
spread and common butterfly of the Mosel valley between
Trier and Koblenz declined strongly to some few remnants
during this period (Lo
¨ser and Rehnelt 1983; Kinkler et al.
1987). However, strict conservation programmes of habitat
reconstruction in combination with reduced application of
pesticides resulted in a recovery of the surviving populations.
Sampling and genetic analyses
Seventy-eight individual samples of P. apollo were taken
from four sites along the Mosel valley, including the
westernmost and the easternmost occurrences (Fig. 1).
Butterflies were sampled from the beginning of June to the
end of July 2004. The individuals were netted in the field,
and one leg was dissected per individual and stored in
liquid nitrogen until analysis. To avoid resampling of
individuals, all captured butterflies were marked before
release. We used allozyme electrophoresis and microsat-
ellite markers as analytical tools. The sampled animal
tissue of one leg per individual was sufficient for both
molecular approaches as a non-lethal method. We also
sampled 55 museum specimens from 1895 to 1989 (1895,
1897, 1898, 1904, 1909, 1932, 1946, 1953, 1968, 1979,
1989, five samples per year), analysing these samples
exclusively for the six microsatellite loci.
For the allozyme analysis, the femur of each sample was
homogenised in Pgm-buffer (Harris and Hopkinson 1978)
by ultrasound and centrifuged at 17,000gfor 5 min. The
remaining tibia and tarsus were stored for DNA extraction.
We ran electrophoreses on cellulose acetate plates (Hebert
and Beaton 1993) and analysed 16 enzyme systems (run-
ning conditions see Table 1).
1660 Conserv Genet (2009) 10:1659–1665
123

For microsatellite markers, DNA was extracted from the
remaining tibia using the Qiagen DNeasy
TM
Tissue Extrac-
tion Kit (Hilden, Germany), following the manufacturers’
protocol. PCR reactions were carried out in a thermal cycler
(Corbett Research CG1-96). Microsatellite loci were
amplified from 50 to 100 ng diluted DNA in a Thermozym
Mastermix (Molzym, Bremen, Germany). The samples were
screened and genotyped for six microsatellite loci (PA35, 45,
56, 79, 82, 85). The forward primer of each pair was 50end-
labelled with the fluorescent phosphoramidite FAM. Primer
sequences and PCR conditions were taken from Megle
´cz
et al. (2004) and optimised (for details see Table 2). PCR
products were visualised by electrophoresis on a 2.4% aga-
rose gel stained with ethidium bromide as a control before
scoring the microsatellites using an automated sequencer
with the Megabace software (GE Healthware, USA).
Results
All 16 allozyme and all six microsatellite loci analysed
were monomorphic, showing one fixed allele each. This
Mosel
Rhine
Lahn
Koblenz
Cochem
5 km
Winningen (18)
Dortebachtal (20)
Calmont (18)
Valwig (22)
Germany
Germany
France
Swizerland
Austria
Scech-Republic
Poland
Belgium
Netherlands
Germany
Germany
France
Swizerland
Austria
Czech republic
Poland
Belgium
Netherlands
Winningen (18)
Dortebachtal (20)
Calmont (18)
Valwig (22)
Germany
Germany
France
Swizerland
Austria
Scech-Republic
Poland
Belgium
Netherlands
Germany
Germany
France
Switzerland
Austria
Czech Republic
Poland
Belgium
Netherlands
Fig. 1 Geographic location of
the four sample sites Calmont,
Valwig, Dortebachtal and
Winningen of Parnassius apollo
vinningensis in the Mosel
valley. The numbers in
parenthesis represent the
numbers of sampled individuals
Table 1 Conditions of
electrophoresis for different
enzymes analysed for
Parnassius apollo vinningensis
TC Tris–citrate pH 8.2, TG
Tris–glycine pH 8.5, TM Tris–
maleic acid pH 7.0 (adjusted
from TM pH 7.8). All buffers
were run at 200 V
Enzyme EC-No. Buffer Homogenate
applications
Running
time (min)
6PGDH 1.1.1.44 TC 2 50
GPDH 1.1.1.8 TM 3 45
MDH1, MDH2 1.1.1.37 TM 2 45
MPI 5.3.1.8 TC 3 30
AAT 2.6.1.1 TM 3 40
G6PDH 1.1.1.49 TM 3 45
FUM 4.2.1.2 TM 3 45
ME1, ME2 1.1.1.40 TC 3 30
PK 2.7.1.40 TM 3 40
APK 2.7.3.3 TM 3 40
PGM 5.4.2.2 TG 3 35
GPI 5.3.1.9 TG 1 35
IDH1, IDH2 1.1.1.42 TC 2 50
Conserv Genet (2009) 10:1659–1665 1661
123

was also true for the six microsatellite loci studied in the
historical samples demonstrating that the fixation of one
allele at least for the microsatellites occurred prior to 1895.
Discussion
Suitability of genetic marker systems
In accordance with our a priori expectations based on the
relict status of the Mosel valley populations of P. apollo,
no high genetic diversity was detectable. However, it was
unexpected to find a complete lack of genetic diversity at
the studied microsatellite loci in all individuals analysed
from different localities all over the Mosel distribution
range spanning a time frame of more than 100 years. The
four local sampling sites therefore do not show any dif-
ferentiation among each other, but must be considered as
belonging to one homogeneous gene pool. Therefore, we
have to question the suitability of the two genetic marker
systems applied in our study.
Microsatellites are a marker system often used for
similar studies (Selkoe and Toonen 2006), however, the
application in butterflies is often rather difficult (Megle
´cz
and Solignac 1998; Megle
´cz et al. 2004; Habel et al. 2008;
Finger et al. 2008). This most probably is due to the
occurrence of microsatellite DNA families with similar or
almost identical flanking regions implying an early stage of
evolution in Lepidopterans (Zhang 2004). Therefore, the
suitability of microsatellites in population genetic studies
of butterflies is limited due to low cloning efficiency and
lacking specificity due to the similarities in the flanking
regions important for the primer annealing (Zhang 2004).
However, Petenian et al. (2005) demonstrated the suit-
ability of the six microsatellite loci also used in our study.
They analysed a total of 40 P. apollo individuals
descending from two populations and got clearly inter-
pretable results with 3–25 alleles per locus and high
percentages of heterozygosity (H
o
: 7.5–79.6%; H
e
: 25.1–
95.4%). Therefore, the observed genetic uniformity of the
Mosel population of P. apollo in these six microsatellite
loci is real and not an artefact of unsuitability of the
system.
Allozymes are known as a powerful tool in the analysis
of population genetic and phylogeographic pattern in but-
terflies and moths. The 16 loci included in the analysis of
the Mosel valley Apollo butterflies showed high levels of
genetic diversity in several common butterfly species of
different biogeographical origins (e.g., Schmitt et al. 2003,
2005a,b,2006a,b,2007; Habel et al. 2005; Louy et al.
2007; Schmitt and Mu
¨ller 2007; Besold et al. 2008a,b;
Schmitt and Haubrich 2008), and even relict taxa showed
moderate levels of genetic diversity of their populations
(e.g., Schmitt and Seitz 2004; Schmitt et al. 2005c;
Haubrich and Schmitt 2007). Furthermore, Descimon
(1995) demonstrated genetic diversity of P. apollo popu-
lations sampled in France (Pyrenees, Alps, Massif Central),
but pointed out that the degree of diversity is less than in
the congeneric species P. mnemosyne and P. phoebus.
Therefore, the suitability of the 16 allozyme loci studied as
a second marker system is approved for the detection of
genetic diversity of populations.
Table 2 Characteristics of six microsatellite loci in Parnassius apollo vinningensis developed for Parnassius apollo by Megle
´cz et al. (2004),
modified
Locus GenBank
accession no.
Primer sequence (50–30) Repeat motif Size of
sequenced
allele (bp)
T
a
(C)
PA35 AY491887 F: CCCACGTCAATATCACTCTTTG
R: CTGGGACGGATTGCTAGTTG
(TACA)
5
TACG(TACA)(TG)
2
(CA)
4
240 54
PA45 AY491895 F: GCCTACATGTGAGGCGTCAT
R: GCATGTAGATGTAAGTGTGCGTG
(TACA)
5
…(TACA)
5
235 51
PA56 AY491906 F: ACTAGTCGGTCGACATAGTACC
R: CCAAATGGAAGTCTGTAGTCTC
(TACA)
6
158 51
PA79 AY491924 F: TGGTCCTGTAGCTCTGTATCAC
R: CTATTAAGCGGCTCGTACATC
(TGTA)
2
?(TGTA)
5
107 54
PA82 AY491926 F: TGTAGATGACGCCCCATAT
R: GTCATCTACATACGGTACGCAT
(TGCG)
3
GC(TGTA)
7
164 54
PA85 AY491928 F: AATGCAGGCACATAACTAAGAC
R: TCTATGTGGCGTTTTGTGG
(CA)
37
TA(CA)
2
212 54
Fforward primer; Rreverse primer; T
a
annealing temperature; individuals were analysed for each locus
1662 Conserv Genet (2009) 10:1659–1665
123

Parnassius apollo from the Mosel Valley—the most
monomorphic butterfly
Genetic depletion has been found in several butterfly
populations of species with highly specialised biotic and
abiotic demands (Debinski 1994; Gadeberg and Boomsma
1997; Bereczki et al. 2005; Figurny-Puchalska et al. 2000;
Schmitt and Seitz 2004) as well as in other animals and
plants (e.g., Watts et al. 2006; Kawamura et al. 2007;
Zachos et al. 2007), but all of them show at least some
genetic diversity within and among populations. For
example, the ground beetle Carabus auronitens was found
to be more or less genetically uniform at the level of
allozyme loci (17 loci monomorph, 1 locus with two
alleles) in Westphalia, while populations in glacial refugial
areas (southern France) exhibit a large amount of genetic
variability (Assmann et al. 1994; Reimann et al. 2002).
The multi-locus monomorphism detected for six
microsatellites and 16 allozyme loci of P. apollo vinning-
ensis is indeed exceptional. Although the presence of
additional rare alleles still cannot be completely excluded,
our reasonably large sample sizes add credibility to our
results making P. apollo vinningensis the most monomor-
phic butterfly taxon known to science. To our knowledge,
the only other reported case of multi-locus monomorphism
at microsatellite loci is the island fox (Urocyon littoralis)
population on San Nicolas Island off the southern coast of
California. Consequently, these foxes have been called
‘‘the most monomorphic sexually reproducing animal
population yet reported’’ (Aguilar et al. 2004).
When and how the genetic depletion of P. apollo vin-
ningensis occurred cannot be deduced with our data set.
However, the high stability of deoxyribonucleic acid and
effective DNA extraction protocols allow the comparison
of extant populations with older collection specimens
going back to the eighteenth century (cf. Mandrioli et al.
2006; Watts et al. 2007). By using such collections from
the late nineteenth and early twentieth century, we were
able to show that the genetic depletion in P. apollo vin-
ningensis is not a result of recent anthropogenic impacts
during the twentieth century, but must have occurred ear-
lier, as the historical samples were monomorphic for the
same alleles as the extant specimens.
Other butterfly species like Thymelicus acteon (Louy
et al. 2007), Coenonympha hero (Cassel and Tammaru
2003), Speyeria idalia (Williams et al. 2003)orLycaena
helle (Finger et al. 2008) are also confined to isolated local
populations, but still show unexpectedly high genetic
diversity. However, these species survived in compara-
tively large metapopulation networks and only recently
suffered isolation in the course of the changes in land use
so that their genetic diversity is probably best explained as
a remnant of a ‘better past’. Therefore, the genetic
uniformity of P. apollo vinningensis is probably due to
repeated bottlenecks and/or founder events during the
postglacial period enduring since some thousands of years
possibly going back until the first colonisation of the area
after the last glacial period or even glacial persistence in
situ (cf. Steward and Lister 2001). The geographically
restricted distribution of this butterfly is likely to have
enforced environmental and demographic stochasticity
(Frankham et al. 2002) as well as concomitant population
fluctuations, bottlenecks combined with genetic drift and
finally the complete loss of genetic diversity at the 22 loci
analysed.
How important is genetic diversity for the fitness
of populations?
Parnassius apollo vinningensis, which has probably been
isolated from conspecific populations in the Vosges, the
Black Forest or the Schwa
¨bische Alb for a long period of
time has recovered well from its recent anthropogenic
bottleneck (Kinkler et al. 1987). In contrast to general
theory in conservation genetics underlining the importance
of genetic diversity for the viability of populations
(Frankham et al. 2002; Reed and Frankham 2003; Schmitt
and Hewitt 2004a), this recovery occurred in a population
without any diversity at 22 loci of two normally poly-
morphic marker systems. Thus, high levels of genetic
diversity are seemingly not necessary for the viability of
this butterfly taxon.
Given that P. apollo vinningensis was already geneti-
cally depleted more than a hundred years ago, the
subspecies has probably undergone more than one historic
bottleneck event. If so, the successful recent recovery of
the population might be a consequence of purging effects:
recessive deleterious alleles might have become exposed to
natural selection as a consequence of an increase in
homozygosity due to inbreeding. Thus, the populations
surviving bottleneck events might have had a reduced
genetic load and therefore might be less susceptible to
inbreeding depression (caused by homozygous deleterious
alleles). While recent analyses have shown that the effects
of purging generally seem to be limited and that immunity
to second bottlenecks cannot be expected (Frankham et al.
2001; The
´venon and Couvet 2002), the case of P. apollo
vinningensis might be a rare exception to the rule. Future
analyses of possible inbreeding depression in this taxon as
compared with its genetically more diverse conspecifics
from other locations might turn out to be a fruitful con-
tribution to studying the importance of purging.
Acknowledgments We acknowledge a grant from the Ministe
`re de
la Culture, de l’Enseignement Superieur et de la Recherche, Lux-
embourg (grant number BFR05/118 Habel), the Muse
´e national
Conserv Genet (2009) 10:1659–1665 1663
123

d’histoire naturelle Luxembourg and the DFG (grant number SCHM
1659/3-1 and 3–2) making this study possible. We thank the local
authorities in Koblenz for giving us a sampling permit, H. Kinkler
(Leverkusen, D), A. Schmidt (Koblenz, D) and M. Weitzel (Trier, D)
for information about sample localities and the population dynamics
and Marco Zimmermann (Bonn, D) for field assistance. We are
grateful for samples from museum collections of the ‘‘Zentrum fu
¨r
Biodokumentation des Saarlandes’’ (Reden, Germany) and the
Alexander-Koenig–Forschungsmuseum (Bonn, Germany).
References
Aguilar A, Roemer G, Debenham S, Binns M, Garcelon D, Wayne
RK (2004) High MHC diversity maintained by balancing
selection in an otherwise genetically monomorphic mammal.
Proc Natl Acad Sci USA 3490–3494. doi:10.1073/pnas.0306
582101
Allendorf FW, Luikart G (2006) Conservation and the genetics of
populations. Blackwell, London
Assmann T, Nolte O, Reuter H (1994) Postglacial colonization of
middle Europe by Carabus auronitens as revealed by population
genetics (Coleoptera, Carabidae). In: Desender K, Dufre
ˆne M,
Loreau M, Luff M, Maelfait JP (eds) Carabid Beetles: Ecology
and Evolution. Kluwer Academic Publishers, Dordrecht
Bereczki J, Pecsenye K, Peregovits L, Varga Z (2005) Pattern of
genetic differentiation in the Maculinea alcon species group
(Lepidoptera, Lycaenidae) in Central Europe. J Zool Syst Evol
Res 43:157–165. doi:10.1111/j.1439-0469.2005.00305.x
Besold J, Schmitt T, Tammaru T, Cassel-Lundhagen A (2008) Strong
genetic impoverishment from the centre of distribution in southern
Europe to peripheral baltic and isolated Scandinavian populations
of the pearly heath butterfly. J Biogeogr 35:2090–2101
Besold J, Huck S, Schmitt T (2008b) Allozyme polymorphisms in the
small heath Coenonympha pamphilus: recent ecological selec-
tion or old biogeographical signal? Ann Zool Fenn 45:217–228
Cassel A, Tammaru T (2003) Allozyme variability in central,
peripheral and isolated populations of the scarce heath (Coen-
onympha hero: Lepidoptera, Nymphalidae); implications for
conservation. Conserv Genet 4:83–93. doi:10.1023/A:10218
84832122
De Lattin G (1967) Grundriß der Zoogeographie. Verlag Gustav
Fischer, Jena
Debinski DM (1994) Genetic diversity assessment in a metapopula-
tion of the butterfly Euphydryas gillettii. Heredity 70:25–30
Descimon H (1995) La conservation des Parnassius en France:
aspects zooge
´ographiques, e
´cologiques, de
´mographiques et
ge
´ne
´tiques. Editions OPIE 1:1–54
Figurny-Puchalska E, Gadeberg RME, Boomsma JJ (2000) Compar-
ison of genetic population structure of the large blue butterfly
Maculinea nausithous and M. teleius. Biodivers Conserv 9:419–
432. doi:10.1023/A:1008970232079
Finger A, Zachos FE, Schmitt T, Meyer M, Assmann T, Habel JC
(2008) The genetic status of the Violet Copper Lycaena helle—a
relict of the cold past in times of global warming. Ecography (in
press)
Frankham R, Gilligan DM, Morris D, Briscoe DA (2001) Inbreeding
and extinction: effects of purging. Conserv Genet 2:279–285.
doi:10.1023/A:1012299230482
Frankham R, Ballou JD, Briscoe DA (2002) Introduction to conser-
vation genetics. Cambridge University Press, Cambridge
Gadeberg RME, Boomsma JJ (1997) Genetic population structure of
the large blue butterfly Maculinea alcon in Denmark. J Insect
Conserv 1:99–111. doi:10.1023/A:1018439211244
Habel JC, Schmitt T, Mu
¨ller P (2005) The fourth paradigm pattern of
postglacial range expansion of European terrestrial species: the
phylogeography of the Marbled White butterfly (Satyrinae,
Lepidoptera). J Biogeogr 32:1489–1497
Habel JC, Meyer M, Schmitt T, Assmann T (2008) Polymorphic
microsatellite loci in the endangered butterfly Lycaena helle
(Lepidoptera: Lycaenidae). Eur J Entomol 105:361–362
Hanski I (1999) Metapopulation ecology. Oxford University Press,
Oxford
Hansson B, Westerberg L (2002) On the correlation between
heterozygosity and fitness in natural populations. Mol Ecol
11:2467–2474. doi:10.1046/j.1365-294X.2002.01644.x
Harris H, Hopkinson DA (1978) Handbook of enzyme electrophoresis
in human genetics. North-Holland, Amsterdam
Haubrich K, Schmitt T (2007) Cryptic differentiation in alpine-
endemic, high altitude butterflies reveals down-slope glacial
refugia. Mol Ecol 16:3643–3658. doi:10.1111/j.1365-294X.
2007.03424.x
Hebert PDN, Beaton MJ (1993) Methodologies for allozyme analysis
using cellulose acetat electrophoresis. Helena Laboratories,
Beaumont
Hewitt GM (1996) Some genetic consequences of ice ages, and their
role in divergence and speciation. Biol J Linn Soc 58:247–276
IUCN (1996) The 1996 IUCN red list of threatened animals. IUCN
Publications Service Unit, Cambridge
Kawamura K, Kubota M, Furukawa M, Harada Y (2007) The genetic
structure of endangered indigenous populations of the amago
salmon, Oncorhynchus masou ishikawae, in Japan. Conserv
Genet 8:1163–1176. doi:10.1007/s10592-006-9271-1
Kinkler H, Lo
¨ser S, Rehnelt K (1987) 10 Jahre Erforschung des
Moselapollofalters (Parnassius apollo vinningensis STICHEL
1899, Lepidoptera, Papilionidae) im modernen Weinbaugebiet
der Mosel—ein Beitrag zu seiner Rettung. Mitt Arbeitsgem rh-
westf Lepid V/2:53–100
Kudrna O (2002) The distribution atlas of European butterflies.
Oedippus 20:1–342
Lesica P, Allendorf FW (1995) When peripheral populations are
valuable for conservation. Conserv Biol 9:753–760. doi:10.1046/
j.1523-1739.1995.09040753.x
Lo
¨ser S, Rehnelt K (1983) Das rezente Verbreitungsareal von
Parnassius apollo vinningensis Stichel, 1899 (Lepidoptera,
Papilionidae) im modernen Weinbaugebiet der Mosel. Verh
SIEEC X, Budapest
Louy D, Habel JC, Schmitt T, Assmann T, Meyer M, Mu
¨ller P (2007)
Strongly diverging population genetic patterns of three skipper
species: the role of habitat fragmentation and dispersal ability.
Conserv Genet 8:671–681
Mandrioli M, Borsatti F, Mola L (2006) Factors affecting DNA
preservation from museum-collected lepidopteran specimens.
Entomol Exp Appl 120:239–244. doi:10.1111/j.1570-7458.2006.
00451.x
Megle
´cz E, Solignac M (1998) Microsatellite loci for Parnassius
mnemosyne (Lepidoptera). Hereditas 128:179–180. doi:10.1111/
j.1601-5223.1998.00179.x
Megle
´cz E, Petenian F, Danchin E, Coer D’Acier A, Rasplus J-Y,
Faure E (2004) High similarity between flanking regions of
different microstatellites detected within each of two species of
Lepidoptera: Parnassius apollo and Euphydrias aurinia. Mol
Ecol 13:1693–1700. doi:10.1111/j.1365-294X.2004.02163.x
Melbourne BA, Hastings A (2008) Extinction risk depends strongly
on factors contributing to stochasticity. Nature 454:100–103.
doi:10.1038/nature06922
Nakonieczny M, Kedziorski A, Michalczyk K (2007) Apollo
Butterfly (Parnassius apollo L.) in Europe—its history, decline
and perspectives of conservation. Funct Ecosyst Comm 1:56–79
1664 Conserv Genet (2009) 10:1659–1665
123

Petenian F, Megle
´cz E, Genson G, Rasplus J-Y, Faure E (2005)
Isolation and characterization of polymorphic microsatellites in
Parnassius apollo and Euphydryas aurinia (Lepidoptera). Mol
Ecol Notes 5:243–245. doi:10.1111/j.1471-8286.2005.00891.x
Reed DH, Frankham R (2003) Correlation between fitness and genetic
diversity. Conserv Biol 17:230–237. doi:10.1046/j.1523-1739.
2003.01236.x
Reimann T, Assmann T, Nolte O, Reuter H, Huber C, Weber F (2002)
The paleo-ecology of Carabus auronitens Fabricius: character-
ization and localization of glacial refugia in southern France and
reconstruction of postglacial expansion routes by means of
allozyme polymorphisms. Abh Naturwissenschaftl Ver Hamburg
NF 35:1–151
Ridgway T (2005) Allozyme electrophoresis still represents a
powerful technique in the management of coral reefs. Biodivers
Conserv 14:135–149. doi:10.1007/s10531-005-4054-4
Schmitt T, Haubrich K (2008) The genetic strucutre of the mountain
forest butterfly Erebia euryale unravels the late Pleistocene and
postglacial history of the mountain coniferous forest biome in
Europe. Mol Ecol 17:2194–2207. doi:10.1111/j.1365-294X.
2007.03687.x
Schmitt T, Hewitt GM (2004a) The genetic pattern of population
threat and loss: a case study of butterflies. Mol Ecol 13:21–31.
doi:10.1046/j.1365-294X.2004.02020.x
Schmitt T, Hewitt GM (2004b) Molecular Biogeography of the arctic-
alpine disjunct burnet moth species Zygaena exulans (Zygaeni-
dae, Lepidoptera) in the Pyrenees and Alps. J Biogeogr 31:885–
893. doi:10.1111/j.1365-2699.2004.01079.x
Schmitt T, Mu
¨ller P (2007) Limited hybridization along a large
contact zone between two genetic lineages of the butterfly
Erebia medusa (Satyrinae, Lepidoptera) in Central Europe. J
Zool Syst Evol Res 45:39–46. doi:10.1111/j.1439-0469.2006.
00404.x
Schmitt T, Seitz A (2004) Low diversity but high differentiation: the
population genetics of Aglaope infausta (Zygaenidae: Lepidop-
tera). J Biogeogr 31:137–144. doi:10.1111/j.1365-2699.2004.
01079.x
Schmitt T, Gießl A, Seitz A (2003) Did Polyommatus icarus
(Lepidoptera: Lycaenidae) have distinct glacial refugia in
southern Europe? Evidence from population genetics. Biol J
Linn Soc 80:529–538. doi:10.1046/j.1095-8312.2003.00261.x
Schmitt T, Ro
¨ber S, Seitz A (2005a) Is the last glaciation the only
relevant event for the present genetic population structure of the
Meadow Brown butterfly Maniola jurtina (Lepidoptera: Nymp-
halidae)? Biol J Linn Soc 85:419–431. doi:10.1111/j.1095-
8312.2005.00504.x
Schmitt T, Varga Z, Seitz A (2005b) Are Polyommatus hispana and
Polyommatus slovacus bivoltine Polyommatus coridon (Lepi-
doptera: Lycaenidae)? The discriminatory value of genetics in
the taxonomy. Org Divers Evol 5:297–307. doi:10.1016/j.ode.
2005.01.001
Schmitt T, Cizek O, Konvicka M (2005c) Genetics of a butterfly
relocation: large, small and introduced populations of the
mountain endemic Erebia epiphron silesiana. Biol Conserv
123:11–18. doi:10.1016/j.biocon.2004.09.018
Schmitt T, Hewitt GM, Mu
¨ller P (2006a) Disjunct distributions during
glacial and interglacial periods in mountain butterflies: Erebia
epiphron as an example. J Evol Biol 19:108–113. doi:
10.1111/j.1420-9101.2005.00980.x
Schmitt T, Habel JC, Zimmermann M, Mu
¨ller P (2006b) Genetic
differentiation of the Marbled White butterfly, Melanargia
galathea, accounts for glacial distribution patterns and postgla-
cial range expansion in southeastern Europe. Mol Ecol 15:1889–
1901. doi:10.1111/j.1365-294X.2006.02900.x
Schmitt T, Ra
´kosy L, Abadjiev S, Mu
¨ller P (2007) Multiple
differentiation centres of a non-Mediterranean butterfly species
in south-eastern Europe. J Biogeogr 34:939–950. doi:10.1111/
j.1365-2699.2006.01684.x
Selkoe KA, Toonen RJ (2006) Microsatellites for ecologists: a
practical guide to using and evaluating microsatellite markers.
Ecol Lett 9:615–629. doi:10.1111/j.1461-0248.2006.00889.x
Steward JR, Lister AM (2001) Cryptic northern refugia and the
origins of the modern biota. Trends Ecol Evol 16:608–613. doi:
10.1016/S0169-5347(01)02338-2
The
´venon S, Couvet D (2002) The impact of inbreeding depression
on population survival depending on demographic parameters.
Anim Conserv 5:53–60
Tolman T, Lewington R (1997) Field guide butterflies of Britain and
Europe. Harper Collins, London
Van Swaay CAM, Warren M (1999) Red Data Book of European
butterflies (Rhopalocera). Nature and environment 99. Council
of Europe Publishing, Strasbourg
Watts PC, Saccheri J, Kemp SJ, Thompson DJ (2006) Population
structure and the impact of regional and local habitat isolation
upon levels of genetic diversity of the endangered damselfly
Coenagrion mercuriale (Odonata: Zygoptera). Freshw Biol
51:193–205. doi:10.1111/j.1365-2427.2005.01478.x
Watts PC, Thompson DJ, Allen KA, Kemp SJ (2007) How useful is
DNA extracted from the legs of archieved insects for microsat-
ellite-based population genetic analyses? J Insect Conserv
11:195–198. doi:10.1007/s10841-006-9024-y
Williams BL, Brawn JD, Paige KN (2003) Landscape scale genetic
effects of habitat fragmentation on a high gene flow species:
Speyeria idalia (Nymphalidae). Mol Ecol 12:11–20. doi:10.1046/
j.1365-294X.2003.01700.x
Zachos FE, Althoff C, v Steynitz Y, Eckert I, Hartl GB (2007)
Genetic analysis of an isolated red deer (Cervus elaphus)
population showing signs of inbreeding depression. Eur J Wildl
Res 53:61–67. doi:10.1007/s10344-006-0065-z
Zhang D-X (2004) Lepidopteran microsatellite DNA: redundant but
promising. Trends Ecol Evol 19:507–509. doi:10.1016/j.tree.
2004.07.020
Conserv Genet (2009) 10:1659–1665 1665
123