Human Herpesvirus 8 Interferon Regulatory Factor-Mediated BH3-Only Protein Inhibition via Bid BH3-B Mimicry

Article (PDF Available)inPLoS Pathogens 8(6):e1002748 · June 2012with48 Reads
DOI: 10.1371/journal.ppat.1002748 · Source: PubMed
Abstract
Viral replication efficiency is in large part governed by the ability of viruses to counteract pro-apoptotic signals induced by infection of host cells. For HHV-8, viral interferon regulatory factor-1 (vIRF-1) contributes to this process in part via inhibitory interactions with BH3-only protein (BOP) Bim, recently identified as an interaction partner of vIRF-1. Here we recognize that the Bim-binding domain (BBD) of vIRF-1 resembles a region (BH3-B) of Bid, another BOP, which interacts intramolecularly with the functional BH3 domain of Bid to inhibit it pro-apoptotic activity. Indeed, vIRF-1 was found to target Bid in addition to Bim and to interact, via its BBD region, with the BH3 domain of each. In functional assays, BBD could substitute for BH3-B in the context of Bid, to suppress Bid-induced apoptosis in a BH3-binding-dependent manner, and vIRF-1 was able to protect transfected cells from apoptosis induced by Bid. While vIRF-1 can mediate nuclear sequestration of Bim, this was not the case for Bid, and inhibition of Bid and Bim by vIRF-1 could occur independently of nuclear localization of the viral protein. Consistent with this finding, direct BBD-dependent inactivation by vIRF-1 of Bid-induced mitochondrial permeabilization was demonstrable in vitro and isolated BBD sequences were also active in this assay. In addition to Bim and Bid BH3 domains, BH3s of BOPs Bik, Bmf, Hrk, and Noxa also were found to bind BBD, while those of both pro- and anti-apoptotic multi-BH domain Bcl-2 proteins were not. Finally, the significance of Bid to virus replication was demonstrated via Bid-depletion in HHV-8 infected cells, which enhanced virus production. Together, our data demonstrate and characterize BH3 targeting and associated inhibition of BOP pro-apoptotic activity by vIRF-1 via Bid BH3-B mimicry, identifying a novel mechanism of viral evasion from host cell defenses.
Human Herpesvirus 8 Interferon Regulatory Factor-
Mediated BH3-Only Protein Inhibition via Bid BH3-B
Mimicry
Young Bong Choi, Gordon Sandford, John Nicholas*
Sidney Kimmel Comprehensive Cancer Center, Department of Oncology, Johns Hopkins University School of Medicine, Baltimore, Maryland, United States of America
Abstract
Viral replication efficiency is in large part governed by the ability of viruses to counteract pro-apoptotic signals induced by
infection of host cells. For HHV-8, viral interferon regulatory factor-1 (vIRF-1) contributes to this process in part via inhibitory
interactions with BH3-only protein (BOP) Bim, recently identified as an interaction partner of vIRF-1. Here we recognize that
the Bim-binding domain (BBD) of vIRF-1 resembles a region (BH3-B) of Bid, another BOP, which interacts intramolecularly
with the functional BH3 domain of Bid to inhibit it pro-apoptotic activity. Indeed, vIRF-1 was found to target Bid in addition
to Bim and to interact, via its BBD region, with the BH3 domain of each. In functional assays, BBD could substitute for BH3-B
in the context of Bid, to suppress Bid-induced apoptosis in a BH3-binding-dependent manner, and vIRF-1 was able to
protect transfected cells from apoptosis induced by Bid. While vIRF-1 can mediate nuclear sequestration of Bim, this was not
the case for Bid, and inhibition of Bid and Bim by vIRF-1 could occur independently of nuclear localization of the viral
protein. Consistent with this finding, direct BBD-dependent inactivation by vIRF-1 of Bid-induced mitochondrial
permeabilization was demonstrable in vitro and isolated BBD sequences were also active in this assay. In addition to Bim
and Bid BH3 domains, BH3s of BOPs Bik, Bmf, Hrk, and Noxa also were found to bind BBD, while those of both pro- and anti-
apoptotic multi-BH domain Bcl-2 proteins were not. Finally, the significance of Bid to virus replication was demonstrated via
Bid-depletion in HHV-8 infected cells, which enhanced virus production. Together, our data demonstrate and characterize
BH3 targeting and associated inhibition of BOP pro-apoptotic activity by vIRF-1 via Bid BH3-B mimicry, identifying a novel
mechanism of viral evasion from host cell defenses.
Citation: Choi YB, Sandford G, Nicholas J (2012) Human Herpesvirus 8 Interferon Regulatory Factor-Mediated BH3-Only Protein Inhibition via Bid BH3-B
Mimicry. PLoS Pathog 8(6): e1002748. doi:10.1371/journal.ppat.1002748
Editor: Shou-Jiang Gao, University of Southern California Keck School of Medicine, United States of America
Received August 2, 2011; Accepted April 27, 2012; Published June 7, 2012
Copyright: ß 2012 Choi et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted
use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: This work was supported by NIH grants CA136356, CA113239 and AI099655. The funders had no role in study design, data collection and analysis,
decision to publish, or preparation of the manuscript.
Competing Interests: The authors have declared that no competing interests exist.
* E-mail: nichojo@jhmi.edu
Introduction
Human herpesvirus 8 (HHV-8) specifies a number of proteins
expressed during the lytic cycle that have demonstrated or
potential abilities to promote virus productive replication via
inhibition of apoptotic pathways induced by infection- or
replication-induced stress. These proteins include membrane
signaling receptors K1 and K15 [1–3], Bcl-2 and survivin
homologues encoded by open reading frames 16 and K7 [4–7],
viral chemokines vCCL-1 and vCCL-2 [8], and viral G protein-
coupled receptor (vGPCR) [9,10]. The viral interferon regulatory
factor homologues, vIRFs 1–4, also are believed to play important
roles in blocking interferon and other stress responses to virus
infection and replication. Their functions include inhibitory
interactions with cellular IRFs, IRF-activating pathways, and/or
IRF-recruited p300/CBP transcriptional co-activators to IRF-
stimulated promoters [11–15]. Additionally, the vIRFs inhibit
apoptosis via targeting of other cellular proteins; these include p53
(vIRFs 1 and 3) [16–18], p53-activating ATM kinase (vIRF-1)
[19], p53-destabilizing MDM2 (vIRF-4) [20], retinoic acid/
interferon-inducible protein GRIM19 (vIRF-1) [21], and TGFb
receptor-activated transcription factors Smad3 and Smad 4 (vIRF-
1) [22]. To date, the v-chemokines, vGPCR and vIRF-1 are the
only HHV-8 proteins that have been demonstrated both to inhibit
apoptosis in lytically infected cells and to promote HHV-8
productive replication, in the context of lytic reactivation in
endothelial cells in the case of the vCCLs and vIRF-1 and
additionally in primary effusion lymphoma (PEL) cells for vGPCR
[23,8,10].
In addition to its other cellular binding partners, vIRF-1 also
interacts with the pro-apoptotic BH3-only protein (BOP) Bim
[23], a protein also targeted for suppression by v-chemokine
signaling and demonstrated to be both induced during lytic
replication and a very powerful negative regulator of viral
replication efficiency [8]. Bim, like other BOPs, functions by
virtue of its BH3 domain to target anti-apoptotic members of the
Bcl-2 family and to disrupt their interactions with apoptotic
executioner proteins Bax and Bak, liberating them for oligomer-
ization and mitochondrial permeabilization [24,25]. However,
Bim can also interact with and activate Bax and Bak directly, via
induced conformational changes [26–28]. This property of direct
activation of Bax and/or Bak is shared by BOPs Bid and Puma,
although other BOPs appear to act indirectly via BH3-mediated
interactions with Bcl-2-family proteins [26,27,29,30]. Activities of
PLoS Pathogens | www.plospathogens.org 1 June 2012 | Volume 8 | Issue 6 | e1002748
several BOPs, such as Bim, Bmf and Bad, are regulated via
phosphorylation, to effect activation, inactivation, or alteration of
protein stability [31–33]. For example, Bim is activated by JNK-
mediated phosphorylation of residue T56, causing release of Bim
from microtubules, inactivated by Akt phosphorylation of S87,
which allows 14-3-3 association and cytosolic sequestration, and
ERK phosphorylation of S69 to effect proteasomal degradation of
Bim [34,32,35]. Bid is unique among BOPs in its activation via
protease cleavage, typically by death receptor-activated caspases
but also by other proteases, such as granzyme B [36–38]. Cleavage
removes N-terminal sequences (p7) containing a motif, termed
BH3-B, which interacts intramolecularly with the BH3 domain to
inhibit Bid pro-apoptotic activity [39,40]. Mitochondrial mem-
brane targeting of cleaved, truncated Bid (tBid) is promoted via
surface exposure of hydrophobic residues and N-terminal glycine
myristoylation [41,42]. While the nature of BH3 interactions with
Bcl-2 family proteins, involving BH3 a-helix association with Bcl-2
BH1–3-comprised hydrophobic grooves, is well characterized
[43,44], the basis of Bid BH3:BH3-B interaction is at present
poorly understood [40].
Our previous studies of vIRF-1 interaction with Bim identified a
unique mechanism of Bim regulation, via nuclear sequestration of
the BOP away from mitochondria, and documented the first
example of interaction between a Bcl-2 family member and an
IRF homologue [23]. While the Bim-binding domain (BBD) of
vIRF-1 was mapped, to residues 170–187 comprising a putative
amphipathic a-helix, the region of Bim interacting with vIRF-1
was not determined. Subsequent comparisons of the BBD primary
and predicted secondary structures with those of Bid BH3-B
revealed similarities, in terms of conserved residues, a-helical
structure and amphipathicity, indicating, by analogy, that BBD
may target for binding and direct functional inhibition the BH3
domain of Bim (in addition to enabling vIRF-1-mediated
inactivation of Bim via nuclear sequestration), and indeed may
be able to bind Bid BH3 also. The data presented here
demonstrate that this is indeed the case, that vIRF-1 can inhibit
Bid as well as Bim pro-apoptotic activity, and that BBD can also
recognize the BH3 domains of certain other BOPs, dependent on
residues that are common and particular to these domains. Thus,
vIRF-1 BBD mediates BH3-B mimicry, to our knowledge the first
example of viral usurpation of this mode of inhibition of BOP
function and pro-apoptotic signaling.
Results
Similarities between vIRF-1 BBD and Bid BH3-B
We noted previously the amphipathic a-helical structure of the
Bim-binding domain (BBD, residues 170–187) of vIRF-1 [23].
This type of structure also is apparent in the so-called BH3-B
domain of Bid, which interacts intramolecularly with the BH3
domain to effect inhibition of Bid activity [40]. Indeed, the
sequences of BBD and BH3-B are similar to each other and to
BH3 domains of other proteins (Fig. 1). Particularly noteworthy
are the BH3-conserved hydrophobic and BH3-B-conserved basic
residues of the BBD core sequence (Fig. 1). The structural
similarities of BBD and BH3-B suggested the possibility that BBD
might interact with Bim via its BH3 domain and that vIRF-1
might target Bid (and possibly other BOPs) in addition to Bim.
Bim and Bid BH3 targeting by vIRF-1
To test whether the BBD of vIRF-1 interacted with the BH3
domain of Bim, recombinant fusion proteins were made for co-
precipitation binding assays. The proteins comprised T7/DsRed-
fused wild-type and Bim-binding-refractory GK
179
AA versions of
BBD (vIRF-1 residues 170–187), and also Bid BH3-B (Bid
L
residues 34–51), and chitin-binding domain (CBD)-tagged GFP-
Bim BH3 (Bim
EL
residues 148–161) and GFP (control). Paired
T7/DsRed and GFP/CBD fusion proteins were mixed, CBD-
tagged proteins precipitated with chitin beads, and precipitated
material analyzed by SDS-PAGE and immunoblotting. This
experiment revealed binding of BBD, but not BBD(GK
179
AA) or
BH3-B, to Bim BH3, with no detectable background binding to
negative control GFP-CBD (Fig. 2A). An analogous experiment
using GFP/CBD-fused Bid BH3 (residues 86–99) as the ‘‘bait’’
identified interaction with Bid BH3-B (positive control) and also
with vIRF-1 BBD (Fig. 2B), thereby identifying Bid BH3, as well as
Bim BH3, as a target of vIRF-1 BBD interaction.
To confirm interaction of full-length vIRF-1 and Bid proteins,
as we had done previously for vIRF-1 and Bim [23], appropriate
expression plasmids were used to transfect HEK293T cells, and
cell lysates were used for co-precipitation assays. Immunoprecip-
itation of Flag epitope-tagged Bid, as well as Bim (positive control),
enabled co-precipitation of vIRF-1, demonstrating interaction
between vIRF-1 and Bid (Fig. 2C).
Functional equivalence of BBD and BH3-B
The relationship between vIRF-1 BBD and Bid BH3-B was
tested by substitution of the latter with the former in the context of
full-length, uncleaved Bid (Bid
L
) and testing the constructions
(Fig. 3A) for pro-apoptotic activities in appropriately transfected
cells. Apoptotic activity of Bid was measured by a GFP-based
assay, in which loss of GFP fluorescence in GFP vector-
cotransfected cells correlates with loss of cell viability and
corresponds to rates of apoptosis, e.g. as measured by TUNEL
assay [23]. Transfection of Bid
L
and GFP expression vectors into
HEK293T cells led to substantially reduced GFP fluorescence
(,39%) relative to empty vector plus GFP control, set at 100%
(Fig. 3B), consistent with previously reported apoptotic activity of
uncleaved Bid [45,40]. However, this activity was increased
substantially by introduction of Bid-BH3 binding-abrogating
mutations (GHE
41
VLA [40]) into BH3-B, suppressing GFP
Author Summary
Viruses possess mechanisms of subverting host cell
defenses against infection and virus replication; these
mechanisms are essential to the virus life cycle. Here, we
identify and characterize a novel mechanism of HHV-8
mediated inhibition of virus-induced programmed cell
death (apoptosis). This function is specified by viral
interferon regulator factor homologue vIRF-1, which binds
to and directly inhibits pro-death activities of so-called
BH3-only proteins (BOPs), induced and activated by stress
signals such as those occurring in infected cells. The BH3
domains of BOPs mediate their pro-apoptotic functions,
and it is these domains that are targeted by vIRF-1, via a
region resembling a BH3-interacting and -inhibitory
domain, termed BH3-B, present in one of the vIRF-1
targeted BOPs, Bid. The targeted BOP BH3 domains share
characteristic and conserved features. As shown previously
for Bim, depletion of Bid leads to enhanced HHV-8
productive replication, demonstrating that Bid, also, is a
biologically significant negative regulator of virus replica-
tion and suggesting that its control by vIRF-1 is of
functional importance. To our knowledge, this is the first
report of viral targeting and inhibition of BOP activity via
Bid BH3-B mimicry; our studies therefore expand the
known mechanisms of viral evasion from antiviral defenses
of the host.
Bid BH3-B Mimicry by Viral IRF
PLoS Pathogens | www.plospathogens.org 2 June 2012 | Volume 8 | Issue 6 | e1002748
fluorescence to ,20% [Fig. 3B, Bid(mBH3-B)]. Importantly, BBD
could substitute fully for BH3-B in this assay, inhibiting BH3-
mediated Bid apoptotic activity more effectively than native BH3-
B (75% GFP fluorescence relative to 39%). Increased inhibition by
BBD indicates that it may bind with higher affinity than BH3-B to
Bid BH3. Although it is more likely that BBD and BH3-B
mediated inhibition of Bid
L
activity occur via intramolecular
interactions with Bid BH3, it is also possible that trans-inhibition
may occur. Introduction of mutation GK
179
AA (previously shown
to abrogate Bim interaction [23]) into BBD (mBBD) abolished its
inhibition of Bid
L
activity, leading to GFP fluorescence (cell
viability) levels similar to those obtained upon mutation of BH3-B.
Similar transfections with these constructions were undertaken
to confirm apoptotic inhibitory activity of BBD in the context of
Bid
L
. Annexin V-Cy3 staining (Fig. 3C) and cytochrome c release
assays (Fig. 3D) were employed to quantify apoptosis and to
monitor induction of the apoptotic pathway, respectively. The
results derived from annexin V-Cy3 staining mirrored those
obtained from the GFP-based assay (Fig. 3B), demonstrating full
functional substitution of Bid BH3-B by vIRF-1 BBD. Apoptosis
induced by tBid, included in this experiment, was notably higher
than that of Bid
L
, Bid
L
-mBH3-B and Bid
L
-mBBD, as expected
because of the complete absence of the inhibitory N-terminal
region of Bid and efficient mitochondrial targeting of the truncated
Figure 1. vIRF-1 BBD resembles the BH3-related BH3-B domain of Bid. Alignments of the primary sequence of vIRF-1 BBD with those of Bid
BH3-B and BOP BH3 domains and comparison of the predicted secondary structure of BBD with the BH3-B a-helix. Collinear hydrophobic residues are
indicated by grey shading. For BBD and BH3-B sequences and helical wheels, collinear hydrophobic and basic residues are indicated by darkly and
lightly shaded circles, respectively. Matched shading on helical wheels indicates hydrophobic (diamonds) and hydrophilic [basic (pentagons) and
acidic (triangles)] residues, respectively. Helical wheels were drawn using web-based software created by Don Armstrong and Raphael Zidovetzki.
doi:10.1371/journal.ppat.1002748.g001
Bid BH3-B Mimicry by Viral IRF
PLoS Pathogens | www.plospathogens.org 3 June 2012 | Volume 8 | Issue 6 | e1002748
form. Congruent results were obtained from the cytochrome c
release assays, confirming the ability of BBD to substitute
functionally for BH3-B in the context of Bid
L
(Fig. 3D).
Combined, the data presented in Figure 3 demonstrate
functional equivalence of Bid BH3-B and vIRF-1 BBD and
provide further evidence, in a biologically relevant context, of
BBD interaction with Bid BH3.
vIRF-1 effects on nuclear-cytoplasmic distribution of Bid
In HHV-8 lytically reactivated endothelial cells, Bim is found
predominantly in the nucleus, and nuclear location of Bim can be
induced by vIRF-1 in transfected HEK293T cells [23]. As
nuclear-localized Bim is inactive in respect of apoptotic induction,
its nuclear sequestration represents a mechanism of BOP
inactivation. To determine the nuclear-cytoplasmic distribution
of Bid during HHV-8 lytic reactivation, dual-label immunofluo-
rescence assays (IFA) were undertaken to identify Bid induction
and distribution in reactivated cells expressing lytic antigen (vIRF-
1). Like Bim, Bid was induced during lytic reactivation in
telomerase-immortalized endothelial (TIME) cells [46], here
engineered to express HHV-8 immediate-early protein RTA in
response to doxycycline (see Materials and Methods and Fig.S1)
Figure 2. vIRF-1 BBD targets Bim and Bid BH3 domains. (A) In vitro co-precipitation assays were undertaken using bacterially-derived and
purified recombinant vIRF-1 BBD and Bim BH3 domains fused to T7 epitope-tagged DsRed and GFP-chitin-binding domain (CBD), respectively. T7/
DsRed-fused Bid BH3-B (Bid BH3-interacting) was also included, and BBD-AA (GK
179
AA, Bim BH3-refractory) and GFP-CBD were used as negative
controls. Chitin bead-precipitated material was analyzed by immunoblotting to detect co-precipitated T7-tagged protein; wild-type BBD alone could
be co-precipitated with Bim BH3-CBD. (B) Analogous experiments carried out using Bid BH3-GFP-CBD as ‘‘bait’’ identified similar interaction between
BBD and Bid BH3, as detected also between Bid BH3-B and its cognate BH3 interaction partner (positive control). (C) Immunoprecipitation (IP) assays
applied to transfected cell lysates were used to detect interactions between full-length vIRF-1 and Flag-tagged Bid
EL
and Bim
EL
[68,69]. Co-
precipitated vIRF-1 was detected by immoblotting using vIRF-1 antiserum, and a-Bim and a-Bid antibodies were used to confirm Flag antibody-
mediated immunoprecipitation of the respective proteins. Immunoblotting for Flag and vIRF-1 verified appropriate expression of proteins in cell
lysates.
doi:10.1371/journal.ppat.1002748.g002
Bid BH3-B Mimicry by Viral IRF
PLoS Pathogens | www.plospathogens.org 4 June 2012 | Volume 8 | Issue 6 | e1002748
Figure 3. Functional equivalence of vIRF-1 BBD and Bid BH3-B. (A) Bid expression constructions were generated in which the BH3-B domain
(Bid
L
residues 33–48) was mutated [GHE
41
VLA (mBH3-B), BH3 refractory] or replaced with vIRF-1 BBD (residues 170–185) or substitution variant of BBD
[GK
179
AA (mBBD)]. (B) These plasmids were individually cotransfected with GFP expression vector into HEK293T cells and after 24 h GFP fluorescence
was quantified by fluorometry, providing a readout of cell viability. Relative fluorescence unit (RFU) values indicate the percentage of fluorescence
relative to empty vector transfected cells (-Bid), with background, non-specific signal from untransfected cells (-GFP) subtracted. Error bars represent
standard deviations from the average values derived from triplicate samples. (C) The functional equivalence of BH3-B and BBD in respect of apoptotic
inhibition, specifically, was tested by using annexin V-Cy3 staining to detect HEK293T cells undergoing apoptosis at 7 h post-transfection. The
inclusion of tBid expression plasmid and untransfected cultures in this experiment provided, respectively, a positive (BH3-B-deleted) control for
Bid BH3-B Mimicry by Viral IRF
PLoS Pathogens | www.plospathogens.org 5 June 2012 | Volume 8 | Issue 6 | e1002748
(Fig. 4A). However, little or no nuclear localization of Bid was
apparent, in sharp contrast to the predominant nuclear localiza-
tion of Bim in lytically reactivated cultures [23] (Fig. 4A). In cells
transfected with Bid
L
or tBid expression vectors together with an
empty or vIRF-1 expression plasmid, the nuclear-cytoplasmic
distribution of each Bid protein was refractory to vIRF-1 influence
(Fig. 4B). It is notable that some nuclear localization of Bid
L
was
apparent, consistent with previous reports of nuclear localization
and associated activities of Bid [47–49], but no nuclear staining
was evident for tBid. In contrast to Bid, and consistent with
previous findings [23], Bim distribution was altered in the presence
of vIRF-1, with strong nuclear staining apparent exclusively with
vIRF-1 co-expression (Fig. 4B). That vIRF-1 indeed did not
influence nuclear-cytoplasmic distribution of Bid was verified by
using immunoblotting of cytoplasmic and nuclear fractions of
transfected cells. Again, while nuclear localization of a proportion
of Bid
L
was detected, this was not detectably influenced by vIRF-1
co-expression, and tBid localization was restricted to the cytoplasm
in the absence and presence of vIRF-1 (Fig. 4C). Furthermore, a
nuclear localization-defective vIRF-1 variant (see below) also did
not influence the nuclear-cytoplasmic distribution of Bid
L
,
although induction of Bim nuclear localization was abolished
(Fig. 4C).
Nuclear translocation-independent inactivation of Bid
and Bim
Targeting of BH3 domains of Bim and Bid by vIRF-1, coupled
with the inability of vIRF-1 to induce significant Bid nuclear
localization, suggested the possibility of direct inactivation of BOP
apoptotic activity by vIRF-1 binding. To address this issue, we
generated a nuclear localization-defective version of vIRF-1 for
use in functional assays. Each of four potential nuclear localization
signals (NLS) was mutated (Fig. 5A), and the respective vIRF-1
proteins were tested for nuclear localization in expression vector-
transfected cells. vIRF-1(RGRRR
163
AGAAA) was found to be
defective for nuclear localization, as determined by IFA (Fig. 5B).
This was verified using a functional assay based on p53-inhibitory
activity of vIRF-1; while wild-type vIRF-1 was able to suppress
reporter-detected transactivation by nuclear p53, NLS-mutated
vIRF-1 was completely inactive (Fig. 5C). As mentioned above, the
vIRF-1 variant was also confirmed to be unable to induce nuclear
localization of Bim (Fig. 4C). The wild-type and NLS-mutated
versions of vIRF-1 were used in GFP-based viability assays to
compare their abilities to inhibit Bim and Bid activities. Both
vIRF-1 proteins were able to protect cells from Bim- and Bid-
induced apoptosis, with very similar dose-activity profiles (Fig. 5D).
Therefore, vIRF-1 inhibition of both Bim and Bid can be
mediated independently of nuclear-localization and nuclear-
localized functions of vIRF-1.
Mitochondrial localization of vIRF-1
To address the hypothesis that vIRF-1 may act directly at the
mitochondrion to suppress BOP-induced apoptosis, we isolated
mitochondria from vIRF-1 vector-transfected HEK293T cells and
undertook SDS-PAGE and Western analysis for detection of vIRF-
1 in the mitochondrial fraction. Both wild-type and Bim-refractory
(GK
179
AA) vIRF-1 proteins were present in mitochondrial
fractions, representing approximately 2% of total vIRF-1 present
in the transfected cell lysates (Fig. 6A). To assess whether this vIRF-1
was likely to be membrane inserted/associated or mitochondrial
outer membrane (OM) protein associated, in vitro mitochondrial
binding assays were used. These assays employed purified
recombinant vIRF-1 (T7 epitope-tagged) added to isolated mito-
chondria prior to and after proteinase K treatment. Binding of
vIRF-1 to mitochondria, apparent absent treatment, was complete-
ly abrogated by proteinase K pre-treatment (Fig. 6B), indicating
mitochondrial association of vIRF-1 via interaction with a
cytoplasmic-exposed mitochondrial protein. Furthermore, endoge-
nously-expressed vIRF-1 was present in mitochondrial fractions
prepared from HHV-8
+
primary effusion lymphoma (PEL) cells,
BCBL1-TRE/RTA [50], with or without lytic induction (+Dox),
and this vIRF-1 was susceptible to proteinase K digestion,
demonstrating peripheral association of vIRF-1 with mitochondria
in HHV-8 infected cells (Fig. 6C). vIRF-1 has been reported
previously to be expressed during latency in PEL cells but to be
induced during lytic reactivation [51], consistent with our detected
patterns of vIRF-1 expression in BCBL1-TRE/RTA cells. Mito-
chondrial localization of vIRF-1 was verified by IFA in TIME-
TRE/vIRF-1 cells [23] in which vIRF-1 expression is inducible
upon addition of doxycycline to culture medium. These results
demonstrated localization of detectable levels of vIRF-1 to a subset
of loci staining positively for mitochondrial marker TOM20
(Fig. 6D). In both Dox-inducible BCBL1-TRE/RTA PEL cells
and HHV-8-infected TIME-TRE/RTA endothelial cells (see
Materials and Methods and Fig.S1), vIRF-1 was found by
immunoblotting of mitochondrial fractions to localize in part to
mitochondria during productive replication (Fig. 6E). The propor-
tion of vIRF-1 localizing to mitochondria in the BCBL-1 cells was
comparable with that measured in transfected cells (Fig. 6A); the
level in the TIME cells (+Dox) was .4 times higher at 9%. For the
PEL cells, which express vIRF-1 also during latency but at reduced
levels, the proportion of mitochondrial-localized vIRF-1 was
increased from 0.9% to 2% in Dox-treated, lytically-induced
cultures, possibly reflecting biological significance of vIRF-1 activity
at this site during productive replication. It should be noted that as
only a subset of these cells support lytic reactivation, the proportion
of vIRF-1 localized to mitochondria in lytically infected cells is likely
to be substantially greater than the 2% level observed for the culture
as a whole. Similar fractionation experiments in HHV-8
+
TIME-
TRE/RTA cells treated with Dox verified Bid, as well as vIRF-1,
localization to mitochondria during lytic reactivation (Fig. 6F).
Confocal immunofluorescence microscopy detected at least some
colocalization of vIRF-1 and Bid in these cells (Fig.S2). Combined,
our data provide evidence of mitochondrial association of vIRF-1,
in both transduced and infected cells, and indicate that vIRF-1 may
target BOPs for inhibition at this site.
induced apoptosis and a control for effects of transfection (by comparison to empty vector-transfected cultures). Cy3
+
cells were counted from three
random fields for each condition to generate the presented data; error bars show standard deviations from mean values obtained from individual
fields. (D) Apoptotic inhibitory activity of vIRF-1 BBD in the context of Bid
L
was further confirmed using a cytochrome c release assay. HEK293T cells
were transfected with the indicated plasmids and harvested after 18 h. Dounce-derived extracts were either untreated or processed by centrifugation
to derive total or S100 (soluble, sol.) samples for SDS-PAGE and immoblotting. Soluble sample blots were probed with antibodies specific for
cytochrome c (cytC) or b-actin (loading control), and total cell extracts were probed with Flag antibody to detect and confirm expression of Flag-
tagged Bid proteins.
doi:10.1371/journal.ppat.1002748.g003
Bid BH3-B Mimicry by Viral IRF
PLoS Pathogens | www.plospathogens.org 6 June 2012 | Volume 8 | Issue 6 | e1002748
Figure 4. Bid localization in lytically reactivated and vIRF-1 transfected cells. (A) TIME-TRE/RTA cells were infected with HHV-8 and latency
was allowed to establish. Cells were then reactivated by addition of 1
mg/ml doxycycline (Dox) to culture media and after 48 h cells were fixed and
dually immunostained for detection of Bid and lytic antigen (vIRF-1). HHV-8
+
TIME-TRE/RTA cells were also stained for detection of Bid or Bim in the
absence and presence of Dox. Both BOPs were induced by Dox treatment (right panels), with general coincidence of Bid and lytic antigen
immunofluorescence (left panels). Strong nuclear staining was evident only for Bim, with Bid localization remaining predominantly cytoplasmic. (B)
HEK293T cells were transfected with expression vectors for Flag-tagged Bim
L
or tBid and either empty vector (2vIRF-1) or vIRF-1 expression plasmid
(+vIRF-1). Cells were immunofluorescence-stained to detect Flag (green) and vIRF-1 (red) and counterstained with DAPI to visualize nuclei (blue).
Representative examples are shown. Nuclear localization of Bim but not Bid was induced by vIRF-1. (C) Nuclear and cytoplasmic extracts of similarly
transfected cells were prepared and immunoblotted to provide independent analysis of potential vIRF-1 influence on Bid
L
and tBid nuclear-
cytoplasmic distribution. Extracts were prepared and fractionated as described in Materials and Methods and quality-checked by probing with
cytoplasmic-localized lactate dehydrogenase (LDH) and nuclear-localized histone deacetylase 1 (HDAC1). Bim but not Bid relocalization in the
presence of vIRF-1 co-expression was detected. Included in this experiment was a nuclear localization-defective variant of vIRF-1, vIRF-1.NLS
X
(see
Bid BH3-B Mimicry by Viral IRF
PLoS Pathogens | www.plospathogens.org 7 June 2012 | Volume 8 | Issue 6 | e1002748
Direct inhibition of BOP activity by vIRF-1
Bid and Bim BH3 domain-targeting by vIRF-1, nuclear
localization-independent inhibition of BOP pro-apoptotic activity,
and partial mitochondrial localization of vIRF-1 suggested the
likelihood of direct BOP inactivation via BBD:BH3 association.
This was tested by using an in vitro mitochondrial permeabilization
assay to assess the abilities of wild-type and a DBBD (BOP-
refractory) variant of vIRF-1 to inhibit tBid-induced cytochrome c
release. The vIRF-1 proteins and tBid were expressed as T7/
intein/CBD and thioredoxin/His
6
/S-tag fusion proteins in
bacteria and were subsequently purified and cleaved to release
the respective T7- and S-tagged proteins (see Materials and
Methods). SDS-PAGE and Coomassie staining (Fig. 7A) verified
their purity prior to use. Addition of recombinant tBid (1.5
mg/ml,
100 nM) to mitochondrial preparations induced the release of
cytochrome c into the soluble fraction of the mitochondrial
suspension and led to a corresponding decrease in the level of
cytochrome c in the mitochondrial pellet, as determined by
Western analysis (Fig. 7B). Inclusion of vIRF-1 (8
mg/ml, 100 nM)
blocked all detectable cytochrome c release, but vIRF-1DBBD was
inactive in respect of tBid inhibition. These data demonstrate that
BBD:BH3 interaction alone is sufficient to inhibit tBid-induced
apoptosis.
Further experiments were undertaken to determine if BH3-B
could substitute functionally for BBD in the context of vIRF-1 to
block tBid-induced mitochondrial permeabilization and also to
confirm direct inhibitory activities of the BBD and BH3-B
domains, expressed as fusions with GST. The recombinant
proteins were isolated and purified from bacterial extracts and
their purities and concentrations checked prior to experimental
use (Fig. 7C). T7-fused wild-type vIRF-1 and its BBD-substituted
counterpart each were able to inhibit tBid-induced cytochrome c
Fig. 5 and associated legend and text), which was unable to induce Bim nuclear localization (v’1.NLS
X
lane, a-Flag). (arrowhead, vIRF-1; asterisk, non-
vIRF-1 a-Flag immunoreactive band).
doi:10.1371/journal.ppat.1002748.g004
Figure 5. Nuclear localization-independent inhibition of Bim and Bid by vIRF-1. (A) Amino acid sequence of vIRF-1, showing putative
nuclear localization signals (NLS, boxed), targeted for mutagenesis (basic-to-alanine residues). (B) Residues 159–163 (shaded box, panel A) were found
to be required for nuclear localization of vIRF-1 in transfected HEK293T cells, as determined by immunofluorescence assay. Mutation of the other
putative NLS sequences did not significantly affect vIRF-1 localization (data not shown). (C) Functional confirmation of nuclear exclusion of vIRF-
1(RGRRR
163
AGAAA) (NLS
X
) using a p53-reporter assay, showing inhibition of nuclear-localized p53 activity by wild-type vIRF-1 (and also vIRF-1DBBD)
but not by vIRF-1.NLS
X
. (D) Equivalent suppression of Bim and Bid apoptotic activity by wild-type and NLS-mutated vIRF-1, as determined by GFP-
based cell viability assay applied to appropriately transfected HEK293T cells. For panels C and D, error bars represent standard deviations from the
average values obtained from triplicate samples.
doi:10.1371/journal.ppat.1002748.g005
Bid BH3-B Mimicry by Viral IRF
PLoS Pathogens | www.plospathogens.org 8 June 2012 | Volume 8 | Issue 6 | e1002748
Figure 6. vIRF-1 localization to mitochondria. (A) Homogenates of HEK293T cells transfected with wild-type or BBD-mutated (GK
179
AA) vIRF-1
(or empty vector control, vIRF-1-negative) were subjected to differential and Optiprep gradient centrifugation to isolate enriched mitochondrial
fractions (see Materials and Methods). These were analyzed by immunoblotting with vIRF-1-specific rabbit antiserum for the presence of vIRF-1
protein, and also with antibody to mitochondrial protein VDAC1 [voltage-dependent anion-selective channel protein 1; integral mitochondrial outer
membrane (int. OM) protein] to provide a positive control. Normalization of vIRF-1 amounts in lysates versus mitochondrial fractions from these
transfected cells was achieved using a ratio of 1:50 (bottom). (B) In vitro mitochondrial binding assays using enriched mitochondria, untreated or pre-
treated with proteinase K (Prot. K), and recombinant T7-tagged vIRF-1 for assessment of the requirement for surface protein integrity for
mitochondrial binding by vIRF-1. Total protein released from mitochondria was precipitated with trichloroacetic acid (TCA) for direct quantitative
comparison with protein from mitochondrial pellets. Blots were probed with antibodies to mitochondrial outer membrane (OM)-associated Bax and
inner membrane (IM)-localized prohibitin to provide controls for appropriate fractionation, mitochondrial integrity, and proteinase K activity. (C)
Generation and Western analysis of mitochondrial preparations from HHV-8
+
BCBL-1-TRE/RTA cells [70] revealed mitochondrial association of
Bid BH3-B Mimicry by Viral IRF
PLoS Pathogens | www.plospathogens.org 9 June 2012 | Volume 8 | Issue 6 | e1002748
endogenous vIRF-1, both in resting (latent) and lytically reactivated (+Dox) cultures; the latter, as expected, expressed higher levels of vIRF-1. In both
cases, mitochondrial-associated vIRF-1 was susceptible to protease digestion, consistent with peripheral binding to mitochondria. Immunodetection
of Bim verified peripheral protein susceptibility to proteinase K digestion. (D) Mitochondrial localization of vIRF-1 as determined using
immunoflourescence assay for detection of vIRF-1 and mitochondrial marker TOM20 in TIME-TRE/vIRF-1 endothelial cells, +Dox. Arrows indicate
examples of vIRF-1/TOM20 co-localization. (E) Western analyses of total cell and mitochondrial extracts of HHV-8
+
TIME-TRE/RTA and BCBL1-TRE/RTA
cells, untreated or treated with Dox for 2 days, were undertaken to quantify the relative amounts of mitochondrial-localized vIRF-1 in these latently
and lytically infected cells. For TIME and BCBL-1 cells, 10- and 50-fold excess of mitochondrial extract over total extract, respectively, was loaded onto
the gels to achieve near normalization. Relative signal intensities of bands were obtained from digitally captured images and calculated values of
mitochondrial relative to total vIRF-1 levels are shown under the vIRF-1 blots. vIRF-1 was detected in latency (2Dox) only in the BCBL-1 (PEL) cells,
and mitochondrial:total vIRF-1 was increased upon Dox addition. Immunoblotting for VDAC1 (mitochondrial), histone deacetylase-1 (HDAC1,
nuclear), calreticulin (endoplasmic reticulum) and b-actin (cytoplasmic) provided quality controls for mitochondrial and total cell extracts.
(Arrowhead, vIRF-1; *non-specific). (F) A similar experiment in HHV-8
+
TIME-TRE/RTA cells, demonstrating mitochondrial localization of Bid, in addition
to vIRF-1, in lytically reactivated cultures.
doi:10.1371/journal.ppat.1002748.g006
Figure 7. Direct functional inhibition of Bid by vIRF-1. (A) T7-fused vIRF-1, vIRF-1DBBD and GFP (negative control) and S-tag-fused tBid
recombinant proteins (Materials and Methods) were checked for purity by SDS-PAGE and Coomassie staining. (B) Recombinant proteins were utilized
in an in vitro mitochondrial permeabilization assay to determine the ability of vIRF-1 to suppress tBid-induced cytochrome c release from sucrose
gradient-purified mitochondria (Materials and Methods). After 30 min. incubation, relative amounts of cytochrome c present in and released from
mitochondria were determined by Western analysis of pellets and supernatants. Wild-type vIRF-1 (100 nM) completely blocked activity of tBid
(applied at 100 nM) in this assay, whereas vIRF-1DBBD was inactive. (supe, supernatant; BSA, bovine serum albumin). (C) T7-vIRF-1 recombinant
protein containing BH3-B in place of the BBD region was generated (shown diagrammatically) along with recombinant GST, GST-BBD and GST-BH3-B
proteins. The purity and concentrations of these proteins were checked by SDS-PAGE and Coomassie staining. (D) As before, the proteins were
utilized in in vitro mitochondrial permeabilization assays to determine their abilities to inhibit tBid-induced cytochrome c release. T7-vIRF-1.BH3-B and
GST-fused BH3-B and BBD were all functional in this assay. Applied concentrations of tBid and vIRF-1 proteins were 100 nM (top); for tBid and GST-
fusion proteins, the concentrations were 10 nM and 500 nM, respectively (bottom).
doi:10.1371/journal.ppat.1002748.g007
Bid BH3-B Mimicry by Viral IRF
PLoS Pathogens | www.plospathogens.org 10 June 2012 | Volume 8 | Issue 6 | e1002748
release from mitochondrial preparations (Fig. 7D, top). Similarly,
both GST-BBD and GST-BH3-B were able to inhibit tBid-
induced cytochrome c release in this assay (Fig. 7D, bottom).
These data confirm the functional equivalence of BBD and BH3-
B, in the context of vIRF-1, and the direct role of these domains
and their interaction with Bid BH3 in the inhibition of Bid pro-
apoptotic activity.
Range and specificity of BH3 recognition by vIRF-1 BBD
We next investigated whether BBD could target additional BH3
domains, in particular those of other BOPs. The respective BH3
coding sequences were cloned in-frame with the GFP open
reading frame in plasmid vector pTYB4 and expressed in and
purified from bacteria; BBD was expressed and isolated similarly,
as a GST fusion protein (Materials and Methods). BH3 domains
tested comprised those of BOPs Bad, Bmf, Bnip3L, Hrk and Noxa,
along with Bim, Bid and ‘‘BH3-only’’ beclin [52], and BH3s from
multi-BH domain proteins Bcl-2 and Mcl-1 (anti-apoptotic) and
Bak, Bax and Bok (pro-apoptotic). Results from these co-
precipitation assays identified Bik, Bmf, Hrk and Noxa BH3
domains as additional targets of BBD interaction (Fig. 8A).
Interactions between the corresponding full-length proteins and
vIRF-1 were tested by co-immunoprecipitation of vIRF-1 with
Flag-tagged BOPs from transfected cell lysates; all but Bik were
able to co-precipitate vIRF-1 in this experiment (Fig. 8B). Bcl-2
was essentially negative, with barely detectable levels of vIRF-1 in
the co-precipitate, as was BOP Puma [not included in the
BBD:BH3 experiment (Fig. 8A)]. Therefore, of the Bcl-2 protein
family members tested, BOPs Bim, Bid, Bmf, Hrk and Noxa are
demonstrably targeted by vIRF-1, via BBD:BH3 association, and
Bik BH3 can also bind BBD.
Determinants of BH3 recognition by vIRF-1 BBD
Comparisons of the BH3 domains of vIRF-1/BBD-interacting
BOPs identified a single unique and conserved residue among the
BBD-binding BH3 sequences, namely an alanine at position w1+1
(Fig. 9A, left). Mutagenesis of this position within the context of
Bim BH3 was undertaken to determine its significance with
respect to BBD binding; it was changed to each of the collinear
residues of the non-binding BH3 domains. Additionally, residues
w1+1tow1+3 (SEC) of BBD-refractory Bax BH3 were changed to
the equivalents (AQE) in closely related Bim BH3 and the
reciprocal changes were made in Bim BH3 to determine if these
‘‘diverged’’ residues in combination could, respectively, confer and
abrogate BBD binding. The various changes made are shown in
Fig. 9A (right). As before, these sequences were expressed as GFP
fusions for use in GST-BBD-based coprecipitation assays. Other
than wild-type Bim BH3, glutathione bead-precipitated GST-BBD
was able to efficiently co-precipitate only cysteine- and serine-
substituted alanine w1+1, with weak binding apparent for the
Figure 8. Additional targets of vIRF-1 BBD. (A) Recombinant proteins comprising GFP-fused BH3 domains of various BOPs and multi-BH-domain
pro- and anti-apoptotic Bcl-2 family members were used together with GST-BBD (or GST, negative control) in co-precipitation assays, as illustrated.In
addition to Bid and Bim, Bik, Bmf, Hrk and Noxa were co-precipitated with glutathione bead-sedimented GST-BBD (but not by GST alone). None of the
non-BOP BH3 domains tested were co-precipitated. (B) Largely reflecting the in vitro binding data, Flag-tagged full-length BOPs containing the BBD-
binding BH3 domains were, with the exception of Bik, able to co-precipitate vIRF-1 from lysates of HEK293T cells co-transfected with the appropriate
expression vector pairs. Puma was included as an additional potential BOP target of vIRF-1. Bcl-2 served as a negative control. Arrows indicate bands
corresponding to the full-length proteins of the expected sizes.
doi:10.1371/journal.ppat.1002748.g008
Bid BH3-B Mimicry by Viral IRF
PLoS Pathogens | www.plospathogens.org 11 June 2012 | Volume 8 | Issue 6 | e1002748
leucine-substituted BH3 (Fig. 9B). The AQE substitution of Bax
SEC residues was able to confer at least some BBD-binding
capacity to Bax, demonstrating the contribution of these residues,
either directly or via structural influence, to binding; the converse
substitution in Bim abrogated binding. Interestingly, a sequence
isolated from a phage-display dodecamer-peptide library using
GST-BBD as bait had some resemblance to BH3 sequences in
respect of conserved basic residues and, importantly, possessed an
alanine residue at the equivalent of position w1+1. This sequence
also showed some binding in the in vitro coprecipitation assay.
Taken together, these data indicate the likely central importance
of alanine at position w1+1 for BBD interaction, although the
residue’s contribution is likely indirect and evidently context
dependent, as particular collinear small side-chain residues (serine
and cysteine) from non-binding BH3 domains can substitute for
alanine in Bim BH3 and the AQE motif from Bim can confer only
weak binding to the closely related BH3 domain of Bax.
Biological relevance of Bid to HHV-8 productive
replication
Previous studies from this laboratory identified Bim as a potent
inhibitor of virus productive replication and the importance of
vIRF-1 BBD-mediated interactions in countering lytic cycle-
induced apoptosis and promoting HHV-8 production in TIME
cells [23,8]. In view of the present findings that vIRF-1 inhibits Bid
activity in a BBD-dependent fashion (Fig. 7) and that Bid is
induced in lytically reactivated TIME cells (Fig. 4A), we wanted to
test the significance of Bid in HHV-8 replication. To do this, we
utilized lentiviral vector-delivered shRNAs directed to Bid mRNA
sequences to deplete Bid in HHV-8
+
(latently infected) TIME cells
and compared levels of cell-released encapsidated viral genomes
produced following TPA induction to those obtained from non-
silencing (NS) shRNA-transduced control cultures. Bim shRNA-
transduced TIME cells were also included to provide a positive
control for the experiment. The data from this experiment
Figure 9. Structural analysis of BBD-BH3 interactions. (A) Substitutions were generated in Bim BH3 at position w1+1 (boxed), containing a
conserved alanine in all identified BBD-interacting BH3 domains, to match collinear residues in BH3 domains refractory to interaction with BBD.
Mutual substitution of w1+1tow1+3 residues in the BH3 domains of Bim and closely related Bax were also generated. The altered and native Bim and
Bax BH3 sequences were cloned into a bacterial expression vector for generation of recombinant GFP-BH3 fusion proteins. Grey-shaded bars in the
sequence alignment correspond to coaligned hydrophobic residues; black shading indicates conserved colinear amino acids. (B) In vitro co-
precipitation assays utilizing recombinant GFP-BH3 and GST-BBD fusion proteins were utilized to analyze BH3:BBD interactions. Lane labels
correspond to wild-type (wt) and mutated Bim (1–7) and Bax (mt) BH3 sequences indicated in panel A; GFP alone (v, vector) was used as a negative
control. A BH3-related peptide sequence isolated from a phage-display library using GST-BBD as bait (see Materials and Methods) was also included in
the binding assay (w-seq*).
doi:10.1371/journal.ppat.1002748.g009
Bid BH3-B Mimicry by Viral IRF
PLoS Pathogens | www.plospathogens.org 12 June 2012 | Volume 8 | Issue 6 | e1002748
(Fig. 10A) revealed that each of the two Bid shRNAs led to small
but significant increases in virus production from TPA-treated
TIME cells; as before, Bim depletion led to substantial amplifi-
cation of virus titers. Similar experiments were undertaken in
TIME-TRE/RTA cells to confirm the effect on replication of Bid
depletion; here, lytic replication was induced by addition of
doxycycline to the cultures. Again, Bid depletion led to increased
virus production (Fig. 10B), measured in this experiment by
titration of released infectious virus in culture media via
inoculation of naı
¨
ve TIME cells and detection of virus infection
by immunofluorescence assay for latency-associated nuclear
antigen (LANA). These data demonstrate that Bid, in addition
to Bim, is a contributor to negative regulation of HHV-8 infection
and suggest that its control by vIRF-1 is likely to be important for
optimal virus productive replication. It is important to note,
however, that the positive effects on virus replication of Bid and
Bim depletion by shRNA transduction demonstrate also that
vIRF-1 is not completely effective at suppressing the activities of
these BOPs. This situation is not unexpected and is probably
universal amongst such viral regulators of cellular activities.
Discussion
Viruses have numerous and diverse mechanisms of apoptotic
inhibition, necessitated by the pro-apoptotic signals induced upon
de novo infection of a cell and by the processes associated with virus
replication (reviewed in [53–55]). These mechanisms include
inhibition by various means of interferon induction and signaling
and inactivation and suppression of p53, pro-apoptotic proteins
such as BOPs, and caspase mediators of apoptotic signaling.
Examples are p53-inhibitory activities of simian virus 40 T-antigen
and adenovirus E1B-55K [56,57], caspase inhibition by HHV-8
specified K7/vIAP and gammaherpesvirus viral FLICE inhibitory
(vFLIP) proteins [6,7,58,59], and the Bcl-2 homologues specified
by herpesviruses (gammaherpesvirus vBcl-2s and human cyto-
megalovirus UL37x1/vMIA), poxviruses (e.g., fowlpox virus 039),
African swine fever virus (A179L), adenovirus (E1B-19K), and
others [60,61]. These viral Bcl-2 homologues, while not necessarily
readily identifiable at the amino acid sequence level, have been
demonstrated or are believed to preserve the essential BH-like
helical domains and overall three-dimensional hydrophobic
groove structure of cellular Bcl-2 proteins to allow their
interactions with and inhibition of pro-apoptotic BH3-only
proteins and/or apoptotic executioners Bax and Bak. Thus, Bcl-
2 ‘‘mimicry’’ is a commonly used mechanism of viral evasion from
innate host cell defenses via apoptotic induction. However,
alternative mechanisms of direct BOP inhibition by viral proteins
have not previously been reported, to our knowledge.
HHV-8 specifies a number of proteins that have predicted
abilities to inhibit apoptosis induced by virus de novo infection and
lytic replication and therefore have the potential to promote virus
infection and establishment of latency and/or productive replica-
tion [62]. However, demonstration of such activities in the context
of virus infection is largely lacking, although vIRF-1, in part via
BBD-dependent interactions, has been found to promote cell
survival under lytic-induced stress and to enhance HHV-8
productive replication in culture [23]. Our previous studies
identified Bim as a potent negative regulator of HHV-8 productive
replication, mapped the binding domain (BBD, residues 170–187)
involved in its inhibition, and noted induced nuclear localization
of Bim as a means of its inactivation by vIRF-1 to promote HHV-
8 replication and cell survival [23,8]. However, the region of Bim
interacting with vIRF-1 was not mapped and the possibility of
direct inhibition of Bim activity, in addition to inhibition via vIRF-
1-induced nuclear sequestration, was not considered.
The present identification of BH3 as the target of BBD binding
to Bim, as well as Bid and other BOPs, and finding of direct
inactivation by vIRF-1 of Bid-induced mitochondrial permeabi-
lization in vitro, Bim and Bid inhibition by nuclear localization-
defective vIRF-1, and inability of vIRF-1 to induce significant Bid
(Bid
L
, tBid) nuclear localization, demonstrate that vIRF-1 can
inhibit BOPs independently of nuclear translocation. Indeed, in
contrast to Bim, [23], nuclear localization of Bid was not apparent
in lytically infected cells (Fig. 4). The mechanism of induced
nuclear translocation of Bim could comprise cytoplasmic-to-
nuclear chaperoning by vIRF-1 and/or nuclear capture of Bim
translocating independently or by other means. The latter would
be analogous to HHV-8 latency-associated nuclear antigen
(LANA)-induced nuclear localization of predominantly cytoplas-
mic GSK3b [63], for example. The fact that Bid has been
reported to localize in part to the nucleus, and indeed to function
here as a component of the DNA repair machinery and as an
apoptotic mediator in response to DNA damage [47–49], indicates
that simple ‘‘nuclear capture’’ by vIRF-1 is unlikely to be a
mechanism of vIRF-1-induced nuclear sequestration of Bim, as
this would be expected to operate for Bid also. Specificity of Bim
nuclear chaperoning by vIRF-1 is, similarly, difficult to explain, as
Bim and Bid interactions with vIRF-1 occur by the same means
(BH3:BBD binding) and these BOPs, able to move between
cellular compartments, appear to be equally susceptible to
translocation. It is possible that while both BOPs can enter the
nucleus, independently or promoted by vIRF-1, only Bim can, via
its association with vIRF-1, form stable interactions with other
nuclear proteins to effect its sequestration in this compartment. In
trying to resolve this issue, it would be informative to determine
whether vIRF-1 can induce nuclear translocation of any of the
other BBD-targeted BOPs or if this activity is restricted to Bim.
Regardless of mechanism, however, it is apparent that vIRF-1-
induced nuclear sequestration of Bim represents a mechanism of
inactivation of its pro-apoptotic activity, in addition to its direct
inactivation via BH3 binding. It is possible that this is necessary for
biologically sufficient inhibition of this powerful negative regulator
of HHV-8 productive replication. It is also conceivable that there
are as-yet unrecognized nuclear functions of Bim that contribute
to HHV-8 lytic replication.
An important finding of the present study is that vIRF-1 can
interact, via its Bid BH3-B-like BBD region, with the BH3
domains of BOPs Bid, Bik, Bmf, Hrk and Noxa in addition to Bim
BH3, while refractory to interaction with other tested Bcl-2 family
members (other BOPs and multi-BH-domain proteins). Thus, the
‘‘Bim-binding domain’’ of vIRF-1 should more appropriately be
referred to as the ‘‘BOP-binding domain’’. These additional
interactions of BBD not only identify multiple new BOP
interaction partners of vIRF-1 that could be targeted for
inhibition, of likely relevance in the context of HHV-8 biology,
but also provide the tools to better understand the molecular basis
and specificity of BBD and BH3-B interactions with BH3 domains.
Previous studies of the latter identified, via mutagenesis of murine
Bid BH3-B sequences and analysis of BH3-B:BH3 interaction and
Bid activity, residues L
35
(first hydrophobic, BH3/BBD-conserved)
and G
39
,R
40
and/or E
41
(GHE in human Bid) as important for
BH3-B:BH3 binding in vitro and for both physical and functional
interactions, respectively [40]. Our own in silico, mutagenesis, and
binding studies indicate that for BBD:BH3 interactions, an alanine
residue corresponding to BH3 position ‘‘w1+1’’ (Fig. 9A) is both
conserved and specific to all BBD-interacting BOP BH3 domains
and important for BBD:BH3 interaction. An alanine at this
Bid BH3-B Mimicry by Viral IRF
PLoS Pathogens | www.plospathogens.org 13 June 2012 | Volume 8 | Issue 6 | e1002748
Figure 10. Biological significance of Bid in HHV-8 replication. (A) TIME cells latently infected with BCBL-1 PEL culture-derived virus were
transduced with non-silencing (NS), Bid-specific (sh1, sh2), or Bim-specific shRNAs using lentiviral vectors (see Materials and Methods). After 48h,
these TIME cultures were treated with TPA to induce lytic reactivation, and media and cells were harvested at 0, 3 and 6 days post-induction for
determinations of encapsidated genome copy numbers and Bid and Bim expression, respectively. Quantitative PCR was used to determine genome
copies following pre-treatment with DNase I to remove any unencapsidated, contaminating viral DNA released from disrupted cells (see Materials
and Methods). Immunoblotting confirmed both induction of Bid and Bim in induced cultures (detected even though a minority of cells support lytic
replication [23,8]) and their specific suppression by the respective transduced shRNAs. (B) Similar experiments were undertaken in control (NS shRNA-
transduced) and Bid-depleted (Bid sh1-transduced) TIME-TRE/RTA cells using Dox (1
mg/ml) to induce lytic reactivation. Higher reactivation
frequencies possible in these cells enabled relative virus titers from these cultures to be measured reliably by using an infectious assay, in which
LANA
+
cells were detected by immunofluorescence assay. Naı
¨
ve TIME cultures were inoculated with ultracentrifuge-concentrated virus from Dox-
treated HHV-8
+
TIME-TRE/RTA cell culture media, cumulatively collected over 5 days following Dox addition. Numbers of infected, LANA
+
TIME cells
Bid BH3-B Mimicry by Viral IRF
PLoS Pathogens | www.plospathogens.org 14 June 2012 | Volume 8 | Issue 6 | e1002748
position was also identified in BH3-like sequences [RVAD-
SLATLMMN (Fig. 9B), SI
ANTIASVQFM, and IFAAL-
DYNLGRH; w1+1 underlined, collinear hydrophobic residues
italicized) isolated from a phage-display screen using BBD as bait.
However, because of its simple methyl side chain, it is likely that
this alanine residue permits adoption of the required local
structure and ‘‘space’’ for binding via other BBD/BH3-residue
interactions rather than being involved directly in binding. Thus,
while binding was abrogated by mutation of this alanine to most
other collinear residues of non-binding BH3s, mutation to cysteine
or serine (present in BH3s of Bok and Bax, respectively) was
compatible with binding to BBD. Also, introduction of this alanine
along with adjacent glutamine and glutamate residues (as present
in Bim) into BBD-refractory Bax BH3 was sufficient to confer
BBD interaction, although the binding was weaker than that of
Bid BH3. Taken together, our data indicate that the w1+1 alanine
appears to be preferred and important for BH3 interaction, but
that it is unlikely to contribute directly to binding and that other
residues, in appropriate context, are directly involved in BH3
association and specificity. In regard to specificity of BH3 binding,
we have established definitively that while BBD can recognize Bim
and Bid BH3 domains, the former is not targeted by Bid BH3-B.
Alignments of BBD and BH3-B, although revealing significant
similarities, with three identical and three highly-related residues
within the BH3-binding core regions, also show considerable
divergence within and outside these central sequences (Fig. 1). It is
noteworthy that previous di-alanine scanning mutagenesis of the
174–183 region of BBD identified residues within 174–181 as
essential for interaction with Bim-BH3 [23]. Interestingly,
however, combined mutation of the first two conserved hydro-
phobic residues, L
174
(qe)I
177
, did not abrogate binding (unpub-
lished data), although identical or related hydrophobic residues are
conserved in BH3 domains and are key contributors to the
amphipathicity of the predicted a-helix. Single-residue mutagen-
esis across BBD, to alanine or to collinear BH3-B residues would
be warranted to further delineate those amino acids and associated
properties contributing to interaction with BH3 domains and to
Bim- and Bid-BH3 selectivity.
In summary, data presented here identify similarity between
vIRF-1 BBD and Bid BH3-B, corresponding inhibitory interac-
tions of vIRF-1 BBD with the BH3-domains of Bim and Bid (both
induced during and inhibitory to HHV-8 productive replication),
and additional BBD binding of the BH3 domains of BOPs Bik,
Bmf, Hrk and Noxa. To our knowledge, this is the first example of
BOP targeting and inhibition via Bid BH3-B domain mimicry and
thereby our data reveal a novel mechanism of viral evasion from
host cell, apoptosis-mediated defense against viral infection and
replication.
Materials and Methods
Cell culture, transfections and viral infection
Telomerase-immortalized endothelial (TIME) cells [46] and
genetically engineered derivatives were cultured in EGM-2 MV
medium (Lonza; Walkersville, MD) containing 5% fetal bovine
serum (FBS) and cytokine supplements. TIME cell lines expressing
vIRF-1 or RTA in doxycycline (Dox)-inducible fashion were
generated using the Retro-X Tet-On Advanced system (Clontech
Laboratories; Mountainview, CA). Briefly, the pRetroX-Tet-On
Advanced plasmid was transfected into Phoenix cells and the
supernatant was used to transduce TIME cells which were selected
in G418 (400
mg/ml) to obtain TIME/Tet-On cells. The RTA
coding region was derived from an existing eukaryotic expression
vector as an EcoR1 restriction fragment and ligated into the EcoR1
site in the pRetroX-Tight-Pur plasmid. This was transfected into
Phoenix cells, virus-containing supernatant used to infect TIME/
Tet-On cultures, and transduced cells (TIME-TRE/RTA) select-
ed in puromycin (1
mg/ml). Cloning discs were used to isolate
individual colonies, and derived cells were screened by immuno-
fluorescence assay for RTA expression following Dox induction.
HeLa, HEK293, and HEK293T cells were maintained in
Dulbecco’s modified Eagle’s medium supplemented with 10%
FBS and gentamicin. BCBL-1/TRE-RTA [50] cells were
maintained in RPMI 1640 medium containing 15% FBS and
gentamicin. HHV-8 virus stocks were derived from doxycycline
induced BCBL-1/TRE-RTA cultures and used to infect TIME
cells as described previously [23]. For cell viability or immuno-
fluorescence assays, cells were transfected using Fugene 6 (Roche
Applied Science; Indianapolis, IN). For immunoprecipitation, cells
were transfected using standard calcium-phosphate method or
Lipofectamine 2000 (Invitrogen; Carlesbad, CA). For reporter
assays, HEK293 cells were transiently transfected with plasmids
expressing vIRF-1 and p53 along with the PG13-luc reporter
vector (Addgene; Cambridge, MA) for 24 h and then lysed with
passive lysis buffer (Promega; Madison, WI). Luciferase activity
was measured by standard methods using D-luciferin and
luminometry. For lentivirus production, HEK293T cells were
transfected with virus vector and gag/pol-encoding plasmids using
standard calcium-phosphate precipitation and virus was harvested
after 48 h by centrifugation at 49,0006g. Cells were transduced
with lentivirus in the presence of 5
mg/ml polybrene for 12 h and
then cultured in complete media.
Plasmids
For bacterial expression of T7-tagged proteins, coding sequenc-
es of T7 were first cloned between the NcoI and SalI sites of pTYB4
(New England Biolabs; Ipswich, MA); coding sequences of vIRF-1
or enhanced green fluorescent protein (EGFP) were then inserted
between the SalI and SmaI sites of pTYB4-T7. The EGFP cDNA
was amplified from vector pEGFP N1 (Clontech Laboratories).
For bacterial expression of EGFP-fused BH3 peptides, EGFP
coding sequences were inserted between the SalI and EcoRI sites of
pTYB4 and BH3 sequences (ds-oligonucleotides) were then
inserted between the NheI and SalI sites of pTYB4-EGFP. For
the bacterial expression of Discosoma red fluorescent protein
(DsRed)-fused peptides, coding sequences for DsRed were
amplified from vector pDsRed2 (Clontech Laboratories) and
inserted between the SalI and EcoRI sites of pTYB4-T7. Coding
sequences of vIRF-1 Bim-binding domain (BBD) or Bid BH3-B
domain were inserted between the EcoRI and SmaI sites of pTYB4-
T7-DsRed. The BBD sequence was also inserted between the
BamHI and EcoRI sites of pGEX4T-1 (GE Healthcare Life
Sciences; Piscataway, NJ) for expression of GST-BBD. For
generation of recombinant S-tagged tBid (see below), the coding
sequence of tBid (comprising codons 61–195 of Bid
L
[64]) was
inserted between the BamHI and EcoRI sites of pET-32a(+)
(Novagen; Madison, WI). BOP and Bcl-2 cDNA sequences linked
to Flag were cloned between the BamHI and EcoRI site of
were counted from multiple random fields to derive average values. Results from two independent experiments are shown, with titers expressed
relative to those obtained from NS shRNA-transduced cells (set at 1); the error bar represents deviation from the average NS/Bid titer ratios. Cells were
harvested at day 5 for mRNA preparation and RT-PCR confirmation of Bid depletion (right).
doi:10.1371/journal.ppat.1002748.g010
Bid BH3-B Mimicry by Viral IRF
PLoS Pathogens | www.plospathogens.org 15 June 2012 | Volume 8 | Issue 6 | e1002748
pcDNA3.1 (Invitrogen) for expression in transfected cells. Plasmids
expressing vIRF-1 and Bim were described previously [23].
Mutagenesis was performed by a PCR-mediated method using
Pfx DNA polymerase (Invitrogen) with oligonucleotide primers
containing deletion or substitution mutations. Two short hairpin
RNAs (shRNA) for Bid were cloned into pYNC352/puro (a
derivative of pTYB6 [65,66]) using BamHI and MluI enzyme sites.
The target sequences of the shRNAs correspond to 59-
GGGATGAGTGCATCACAAACC -39 (sh1) and 59-CTTTCA-
CACAACAGTGAATTT-39 (sh2).
Antibodies
Commercially obtained antibodies used in this study were as
follow: T7, Novagen (Madison, WI), catalog number 65922; GFP,
Bcl-2 and cytochrome c, Epitomics (Burlingame, CA), catalog
numbers 1533-1, 1017-1 and 1896-1; Flag M2 and b-actin, Sigma
(St. Louis, MI), catalog numbers F3165 and A5441; polyclonal
Flag and Bim antibodies, Cell Signaling Technology (Beverly,
MA), catalog numbers 2368 and 2819; Bax (N-20, catalog number
sc-493), Bid (5C9, sc-56025), GST (B-14, sc-138), prohibitin (H-
80, sc-28259), TOM20 (F-10, sc-17764), VDAC1 (20B12, sc-
58649), lactate dehydrogenase (H-160, sc-33781), and histone
deacetylase 1 (H-11, sc-8410) antibodies were purchased from
Santa Cruz Biotechnologies (Santa Cruz, CA); LANA (LN53),
Advanced Biotechnologies Inc. (Columbia, MD), catalog number
13-21-100. vIRF-1 rabbit antiserum was provided by Dr. Gary
Hayward.
Immunoblotting and immunofluorescence
For immunoblotting, cells were lysed in lysis buffer (50 mM
Tris-HCl [pH 8.0], 150 mM NaCl, 1 mM EDTA, 1% IGEPAL
CA-630, and 0.25% sodium deoxycholate) freshly supplemented
with protease inhibitor cocktail (Sigma) for 1 h on ice. After
centrifugation at 12,0006g for 20 min, the supernatant was used
as a whole cell extract. For immunoblotting, proteins were size
fractionated by sodium dodecyl sulfate-polyacrylamide gel elec-
trophoresis (SDS-PAGE) and transferred to a nitrocellulose or
polyvinylidene fluoride membranes. Immunoreactive bands were
detected with enhanced chemiluminescence solution (GE Health-
care Life Sciences) and visualized on X-ray film or digitally using a
chemiluminescence imager. For immunofluorescence assays, cells
were grown on a 0.1% gelatin-coated coverglass or a chamber
slide and were fixed and permeabilized in chilled methanol.
Following incubation with Superblock blocking buffer in phos-
phate-buffered saline (PBS) (Thermo Scientific Inc.; Rockford, IL),
coverslips were incubated with primary antibody, washed with
PBS, and then incubated with appropriate fluorescent dye-
conjugated secondary antibody. The coverslips were mounted in
90% glycerol in PBS containing 10 mg/ml p-phenylenediamine,
an antifade reagent.
Co-precipitation assays
For immunoprecipitation, HEK293T cells transfected with
plasmids encoding vIRF-1 or Flag epitope-tagged BH3-only
proteins (BOPs) were lysed in lysis buffer, and cell extracts were
incubated with anti-Flag M2 affinity gel (Sigma) for 3 h at 4uC.
After washing with lysis buffer, immune-complexes were eluted
with 30
mlof36 Flag peptide (150 ng/ml), subjected to SDS-
PAGE, and analyzed by immunoblotting using vIRF-1 antiserum
or polyclonal Flag antibody. For in vitro binding assays, fluorescent
protein-fused peptides or T7-tagged proteins expressed in E. coli
from vector pTYB4 (New England Biolabs) were purified
according to the manufacturer’s protocol. Bacterially expressed
glutathione-S-transferase (GST)-fused proteins were purified by
standard methods. 0.5
mg of EGFP or EGFP-BH3, fused to intein-
chitin binding domain (CBD) and immobilized on chitin beads,
was mixed with 1
mg of purified T7-DsRed-fused BBD or BH3-B
peptides and incubated for 1 h at room temperature. After
washing four times with Tris-buffered saline (TBS) supplemented
with 0.1% Tween 20, bead-associated proteins were size-
fractionated by SDS-PAGE and analyzed by immunoblotting
using T7- or GFP-specific antibodies. To screen for BBD
interaction with a variety of BOP BH3 domains, 1
mg of GST
or GST-BBD protein immobilized on glutathione sepharose 4B
beads was mixed with 2
mg of EGFP-BH3 fusion proteins. GST-
BBD and its associated proteins were eluted with 10 mM reduced
glutathione in TBS, size-fractionated by SDS-PAGE, and
analyzed by immunoblotting using GFP- or GST-specific
antibodies.
Subcellular fractionation and associated assays
For nucleo-cytoplasmic fractionation, cells were homogenized
in buffer A (20 mM Tricine-KOH [pH 7.8], 5 mM MgCl
2
,
25 mM KCl, 0.25 M sucrose, and protease inhibitor cocktail)
using a Dounce homogenizer. After centrifugation at 1,0006g for
10 min, the supernatant was used as the cytoplasmic fraction, and
the pellet was subjected to 25–35% iodixanol discontinuous
gradient centrifugation. Nuclei were collected from the interface
between 30 and 35% iodixanol and resuspended in buffer C
(20 mM HEPES [pH 8.0], 1.5 mM MgCl
2
, 420 mM NaCl,
0.2 mM EDTA, and protease inhibitor cocktail). For in vitro
cytochrome c release assays, mitochondria were isolated by
sucrose density gradient centrifugation. Briefly, HEK293T cells
grown to subconfluence in a 10 cm dish were washed in ice-cold
PBS and resuspended in mitochondrial isolation buffer (MIB:
210 mM mannitol, 70 mM sucrose, 1 mM EDTA, and 10 mM
HEPES [pH 7.5]) supplemented with protease inhibitor cocktail.
Next, cells were homogenized with 40 strokes of Dounce
homogenizer and centrifuged at 2,0006g for 10 min. The
supernatant was further centrifuged at 13,0006gat4uC for
10 min. After resuspending in MIB, the resulting pellet was
layered on top of a discontinuous sucrose gradient consisting of
1.2 M sucrose in buffer H (10 mM HEPES [pH 7.5], 1 mM
EDTA, and 0.1% BSA) on top of 1.6 M sucrose in buffer H.
Following centrifugation at 131,0006g for 2 h at 4uC, mitochon-
dria were recovered at the 1.6–1.2 M sucrose interface, washed in
MIB, centrifuged at 13,0006gat4uC for 10 min, and resuspended
in 100
ml of MIB. For other studies, mitochondria were purified
using Axis-Shield OptiPrep (Sigma) according to the manufactur-
er’s protocol. For proteinase K treatment, mitochondria in MIB
(0.5 mg/ml) were incubated on ice for 30 min with 20
mg/ml
proteinase K; the reaction was stopped by the addition of 2 mM
PMSF, and mitochondria were then washed twice in 1 ml of MIB
and resuspended in MIB or MRM buffer (250 mM sucrose,
10 mM HEPES [pH 7.5], 1 mM ATP, 5 mM sodium succinate,
80
mM ADP, 2 mM K
2
HPO
4
). For mitochondrial binding assays,
1
mg of recombinant T7-EGFP or T7-vIRF-1 protein was added
to the proteinase K-pretreated or untreated mitochondria in
MRM buffer (50
mg protein/50 ml) supplemented with PMSF and
0.1 mg/ml BSA. The mixtures were incubated for 1 h at 30uC
and then centrifuged at 12,0006g for 5 min. The mitochondrial
pellets were washed twice in MRM buffer, and the final washed
pellets were resuspended in SDS sample buffer. Trichloroacetic
acid (TCA, 10% final concentration) was added to the superna-
tants to precipitate proteins prior to SDS-PAGE and immunoblot
analysis. For in vivo cytochrome c release assay, transfected
HEK293T cells were subjected to Dounce homogenization (30
strokes) in MIB buffer. The homogenate, an aliquot of which was
Bid BH3-B Mimicry by Viral IRF
PLoS Pathogens | www.plospathogens.org 16 June 2012 | Volume 8 | Issue 6 | e1002748
used as a total cell extract, was centrifuged at 10006g for 10 min
at 4uC to remove nuclei and unbroken cells. The resulting
supernatant was centrifuged at 100,0006g for 1 h at 4uC to yield
the final soluble cytosolic fraction (S100).
In vitro cytochrome c release assay
In vitro mitochondrial permeabilization assays based on
cytochrome c release were undertaken essentially as described by
Arnoult [67] and outlined below. Thioredoxin/His
6
/S-tagged
tBid protein encoded from pET-32a(+) was purified using Ni-NTA
His-tag affinity chromatography, and S-tBid (100
mg/ml) was
eluted following thrombin (0.5 unit/ml) treatment for 2 h at room
temperature. Thioredoxin and His sequences were retained on the
Ni-NTA resin. S-tBid was purified away from thrombin using
protein S agarose, eluted with 3 M MgCl
2
, and dialyzed against
dilution buffer (25 mM HEPES-KOH [pH 7.4], 0.1 M KCl).
Following preincubation of 10 nM or 100 nM of S-tBid with or
without 500 nM of GST-fusion peptides or 100 nM of T7-vIRF-1
proteins (wild-type or mutated) in dilution buffer supplemented
with 1 mg/ml of fatty acid-free bovine serum albumin (FA-BSA),
purified mitochondria were added (50
mg protein/50 mlof
mitochondrial buffer: 125 mM KCl, 0.5 mM MgCl
2
,3mM
succinic acid, 3 mM glutamic acid, 10 mM HEPES-KOH
[pH 7.4], 1 mg/ml FA-BSA, and protease inhibitor cocktail).
The reaction mixtures were incubated at 30uC for 30 min and
then centrifuged at 12,0006g for 5 min at 4uC to pellet the
mitochondria. The supernatants were quickly removed, and the
pellet was resuspended in 70
ml of mitochondria lysis buffer
(50 mM Tris-HCl [pH 7.4], 150 mM NaCl, 2 mM EDTA, 2 mM
EGTA, 0.2% Triton X-100, and 0.3% IGEPAL CA-630). The
amounts of cytochrome c in the supernatant and pellet fractions
were determined by immunoblotting.
Annexin V apoptosis assay
After plasmid transfection of 293T cells on a coverslip, the cells
were stained with Cy3-conjugated annexin V (Biovision Inc.;
Mountain View, CA) in AV binding buffer (10 mM HEPES
[pH 7.4], 140 mM NaCl, and 2.5 mM CaCl
2
), fixed with 2%
formaldehyde in AV binding buffer for 10 min, and mounted in
glycerol medium containing DAPI. Annexin V-positive cells,
fluorescent under UV, were counted from three randomly selected
low-magnification microscopic fields.
Screening of phage display library
The Ph.D.-12 library, comprising a complexity in excess of one
billion independent clones, was purchased from New England
Biolabs (Beverly, MA). Screening was performed by a solution-
phase panning method with affinity bead capture as described by
the manufacturer’s protocol. In brief, a mixture of purified GST-
BBD (500 nM) and the library (2610
11
pfu) was incubated for
20 min at room temperature and added to glutathione 4B beads
pre-blocked with BSA. After incubating for 15 min and washing
the mixture with Tris-buffered saline (TBS) containing 0.1%
Tween 20, phage were eluted and amplified. Negative selection
using purified GST was performed prior to the second round of
panning. After the third round of panning, the mixture was
washed with TBS containing 0.5% Tween 20, and phage were
eluted and plaque-purified prior to DNA preparation and
sequencing.
HHV-8 replication
For HHV-8 infection, TIME cells were centrifuged at 1,0006g
for 1 h in the presence of HHV-8 virions and then cultured in
fresh complete medium for 7 days to allow establishment of
latency in the absence of ongoing lytic replication. After lentiviral
transduction of control (NS), Bid, or Bim shRNAs for 2 days into
HHV-8
+
TIME cells, lytic replication of HHV-8 was induced by
treatment with TPA (20 ng/ml) or 1
mg/ml doxycycline (TIME-
TRE/RTA cells). For determination of encapsidated HHV-8
genome copy number, viral DNA was isolated using standard
phenol extraction and glycogen/ethanol precipitation methods
following pre-treatment of virus suspensions with DNaseI for
20 min at 37uC to remove any unencapsidated DNA. For the
determination of the viral genome copy number, all qPCRs were
performed in a 96-well microplate using an ABI Prism 7500
detection system (Applied Biosystems; Foster City, CA) with SYBR
green/ROX master mix (SuperArray Bioscience Corp.; Frederick,
MD). For induced TIME-TRE/RTA cells, infectious virus titers
were measured by application of induced culture media-derived
virus to naı
¨
ve TIME cells and immunofluorescence staining for
HHV-8 latency-associated nuclear antigen (LANA).
Supporting Information
Figure S1 Characterization of TIME-TRE/RTA cells
line. (A) TIME cells transduced with tetracycline-responsive
repressor/transactivator (rtTA) expression cassette and rtTA-
responsive RTA expression cassette (see Materials and Methods)
were isolated as clonal cell lines and tested by immunofluorescence
assay for RTA expression following treatment with doxycycline
(Dox, 1
mg/ml) for 24 h. An example of analysis of one cell line,
which was used in subsequent studies, is shown. (B) RTA
expression in response to different concentrations of Dox (applied
for 15 h) was analyzed by immunoblotting of SDS-PAGE
fractionated cell extracts using RTA-specific antiserum. Antibody
to b-actin was used for immunoblotting to confirm equivalent
protein loading. (C) TIME-TRE/RTA cells were infected with
HHV-8 r219 (Vieira & O’Hearn; Virology 325:225–240), which
expresses GFP constitutively and RFP under the control of a lytic
cycle promoter, the latter providing a marker of lytic induction.
The cells were allowed to rest for 5 days to ensure establishment of
latency and absence of residual lytic replication. These cells
expressed GFP in ,100% of cells, and very few (,1%) expressed
RFP. Parallel cultures of these latently infected TIME-TRE/RTA
cells were either left untreated or were treated with Dox (1
mg/ml)
for the indicated times and then visualized under UV microscopy
for detection of RFP
+
cells. (D) An analogous experiment was
undertaken using BCBL-1 culture-derived HHV-8, but here
immunofluorescence staining for K8.1-encoded late lytic antigen
was used to detect cells supporting productive replication. In this
experiment, application of Dox was either sustained for 1 or 5 days
prior to fixation and immunofluorescence staining or applied for 2
days and then removed prior to IFA analysis 5 days post-
induction. For comparison, a parallel culture was treated with
TPA (20 ng/ml) for five days prior to K8.1 immunostaining.
(TIF)
Figure S2 Confocal immunofluorescence analysis of
vIRF-1 and Bid colocalization to mitochondria. HHV-8
+
TIME-TRE/RTA cells were induced with doxycycline (1 mg/ml)
for 48 hours, treated with mitochondrial-specific fluorescent
marker [MitoTracker (Cy3, red); Invitrogen], and then fixed and
immuno-stained (essentially as outlined in Materials and Methods)
for vIRF-1 (Cy5, purple) and Bid (FITC, green) and counter-
stained with DAPI (nuclear, blue). Staining patterns for vIRF-1
and Bid colocalization varied from large structures (most likely
representing fused or aggregated mitochondria) to very fine
punctate staining corresponding with MitoTracker dye. Examples
Bid BH3-B Mimicry by Viral IRF
PLoS Pathogens | www.plospathogens.org 17 June 2012 | Volume 8 | Issue 6 | e1002748
of triple vIRF-1, Bid and mitochondrial fluorescence are indicated
by white arrows, spots of Bid and mitochondrial signals by yellow
arrows, and vIRF-1 and mitochondria staining by mauve arrows.
The 406 fields are derived from a single section; the 1006 fields
represent two successive sections (z1, z2).
(TIFF)
Acknowledgments
We thank Daming Chen and Emily Cousins for helpful discussions, general
support and proofreading the manuscript.
Author Contributions
Conceived and designed the experiments: YBC JN. Performed the
experiments: YBC GS. Analyzed the data: YBC GS JN. Contributed
reagents/materials/analysis tools: YBC GS. Wrote the paper: JN.
References
1. Tomlinson CC, Damania B (2004) The K1 protein of Kaposi’s sarcoma-
associated herpesvirus activates the Akt signaling pathway. J Virol 78:
1918–1927.
2. Wang S, Wang S, Maeng H, Young DP, Prakash O, et al. (2007) K1 protein of
human herpesvirus 8 suppresses lymphoma cell Fas-mediated apoptosis. Blood
109: 2174–2182.
3. Brinkmann MM, Schulz TF (2006) Regulation of intracellular signalling by the
terminal membrane proteins of members of the Gammaherpesvirinae. J Gen
Virol 87: 1047–1074.
4. Cheng EH, Nicholas J, Bellows DS, Hayward GS, Guo HG, et al. (1997) A Bcl-2
homolog encoded by Kaposi sarcoma-associated virus, human herpesvirus 8,
inhibits apoptosis but does not heterodimerize with Bax or Bak. Proc Natl Acad
Sci U S A 94: 690–694.
5. Sarid R, Sato T, Bohenzky RA, Russo JJ, Chang Y (1997) Kaposi’s sarcoma-
associated herpesvirus encodes a functional bcl-2 homologue. Nat Med 3:
293–298.
6. Wang HW, Sharp TV, Koumi A, Koentges G, Boshoff C (2002) Character-
ization of an anti-apoptotic glycoprotein encoded by Kaposi’s sarcoma-
associated herpesvirus which resembles a spliced variant of human survivin.
EMBO J 21: 2602–2615.
7. Feng P, Park J, Lee BS, Lee SH, Bram RJ, et al. (2002) Kaposi’s sarcoma-
associated herpesvirus mitochondrial K7 protein targets a cellular calcium-
modulating cyclophilin ligand to modulate intracellular calcium concentration
and inhibit apoptosis. J Virol 76: 11491–11504.
8. Choi YB, Nicholas J (2008) Autocrine and paracrine promotion of cell survival
and virus replication by human herpesvirus 8 chemokines. J Virol 82:
6501–6513.
9. Montaner S, Sodhi A, Pece S, Mesri EA, Gutkind JS (2001) The Kaposi’s
sarcoma-associated herpesvirus G protein-coupled receptor promotes endothe-
lial cell survival through the activation of Akt/protein kinase B. Cancer Res 61:
2641–2648.
10. Sandford G, Choi YB, Nicholas J (2009) Role of ORF74-encoded viral G
protein-coupled receptor in human herpesvirus 8 lytic replication. J Virol 83:
13009–13014.
11. Offermann MK (2007) Kaposi sarcoma herpesvirus-encoded interferon
regulator factors. Curr Top Microbiol Immunol 312: 185–209.
12. Burysek L, Yeow WS, Pitha PM (1999) Unique properties of a second human
herpesvirus 8-encoded interferon regulatory factor (vIRF-2). J Hum Virol 2:
19–32.
13. Lee HR, Kim MH, Lee JS, Liang C, Jung JU (2009) Viral interferon regulatory
factors. J Interferon Cytokine Res 29: 621–627.
14. Burysek L, Yeow WS, Lubyova B, Kellum M, Schafer SL, et al. (1999)
Functional analysis of human herpesvirus 8-encoded viral interferon regulatory
factor 1 and its association with cellular interferon regulatory factors and p300.
J Virol 73: 7334–7342.
15. Wies E, Hahn AS, Schmidt K, Viebahn C, Rohland N, et al. (2009) The
Kaposi’s Sarcoma-associated Herpesvirus-encoded vIRF-3 Inhibits Cellular
IRF-5. J Biol Chem 284: 8525–8538.
16. Rivas C, Thlick AE, Parravicini C, Moore PS, Chang Y (2001) Kaposi’s
sarcoma-associated herpesvirus LANA2 is a B-cell-specific latent viral protein
that inhibits p53. J Virol 75: 429–438.
17. Seo T, Park J, Lee D, Hwang SG, Choe J (2001) Viral interferon regulatory
factor 1 of Kaposi’s sarcoma-associated herpesvirus binds to p53 and represses
p53-dependent transcription and apoptosis. J Virol 75: 6193–6198.
18. Nakamura H, Li M, Zarycki J, Jung JU (2001) Inhibition of p53 tumor
suppressor by viral interferon regulatory factor. J Virol 75: 7572–7582.
19. Shin YC, Nakamura H, Liang X, Feng P, Chang H, et al. (2006) Inhibition of
the ATM/p53 signal transduction pathway by Kaposi’s sarcoma-associated
herpesvirus interferon regulatory factor 1. J Virol 80: 2257–2266.
20. Lee HR, Toth Z, Shin YC, Lee JS, Chang H, et al. (2009) Kaposi’s sarcoma-
associated herpesvirus viral interferon regulatory factor 4 targets MDM2 to
deregulate the p53 tumor suppressor pathway. J Virol 83: 6739–6747.
21. Seo T, Lee D, Shim YS, Angell JE, Chidambaram NV, et al. (2002) Viral
interferon regulatory factor 1 of Kaposi’s sarcoma-associated herpesvirus
interacts with a cell death regulator, GRIM19, and inhibits interferon/retinoic
acid-induced cell death. J Virol 76: 8797–8807.
22. Seo T, Park J, Choe J (2005) Kaposi’s sarcoma-associated herpesvirus viral IFN
regulatory factor 1 inhibits transforming growth factor-beta signaling. Cancer
Res 65: 1738–1747.
23. Choi YB, Nicholas J (2010) Bim nuclear translocation and inactivation by viral
interferon regulatory factor. PLoS Pathog 6: e1001031.
24. Adams JM, Cory S (2007) The Bcl-2 apoptotic switch in cancer development
and therapy. Oncogene 26: 1324–1337.
25. Ewings KE, Wiggins CM, Cook SJ (2007) Bim and the Pro-Survival Bcl-2
Proteins: Opposites Attract, ERK Repels. Cell Cycle 6.
26. Kim H, Tu HC, Ren D, Takeuchi O, Jeffers JR, et al. (2009) Stepwise activation
of BAX and BAK by tBID, BIM, and PUMA initiates mitochondrial apoptosis.
Mol Cell 36: 487–499.
27. Kuwana T, Bouchier-Hayes L, Chipuk JE, Bonzon C, Sullivan BA, et al. (2005)
BH3 domains of BH3-only proteins differentially regulate Bax-mediated
mitochondrial membrane permeabilization both directly and indirectly. Mol
Cell 17: 525–535.
28. Harada H, Quearry B, Ruiz-Vela A, Korsmeyer SJ (2004) Survival factor-
induced extracellular signal-regulated kinase phosphorylates BIM, inhibiting its
association with BAX and proapoptotic activity. Proc Natl Acad Sci U S A 101:
15313–15317.
29. Cartron PF, Gallenne T, Bougras G, Gautier F, Manero F, et al. (2004) The first
alpha helix of Bax plays a necessary role in its ligand-induced activation by the
BH3-only proteins Bid and PUMA. Mol Cell 16: 807–818.
30. Willis SN, Adams JM (2005) Life in the balance: how BH3-only proteins induce
apoptosis. Curr Opin Cell Biol 17: 617–625.
31. Puthalakath H, Strasser A (2002) Keeping killers on a tight leash: transcriptional
and post-translational control of the pro-apoptotic activity of BH3-only proteins.
Cell Death Differ 9: 505–512.
32. Lei K, Davis RJ (2003) JNK phosphorylation of Bim-related members of the
Bcl2 family induces Bax-dependent apoptosis. Proc Natl Acad Sci U S A 100:
2432–2437.
33. Shibue T, Taniguchi T (2006) BH3-only proteins: integrated control point of
apoptosis. Int J Cancer 119: 2036–2043.
34. Qi XJ, Wildey GM, Howe PH (2006) Evidence that Ser87 of BimEL is
phosphorylated by Akt and regulates BimEL apoptotic function. J Biol Chem
281: 813–823.
35. Luciano F, Jacquel A, Colosetti P, Herrant M, Cagnol S, et al. (2003)
Phosphorylation of Bim-EL by Erk1/2 on serine 69 promotes its degradation via
the proteasome pathway and regulates its proapoptotic function. Oncogene 22:
6785–6793.
36. Billen LP, Shamas-Din A, Andrews DW (2008) Bid: a Bax-like BH3 protein.
Oncogene 27 Suppl 1: S93–104.
37. Li H, Zhu H, Xu CJ, Yuan J (1998) Cleavage of BID by caspase 8 mediates the
mitochondrial damage in the Fas pathway of apoptosis. Cell 94: 491–501.
38. Luo X, Budihardjo I, Zou H, Slaughter C, Wang X (1998) Bid, a Bcl2
interacting protein, mediates cytochrome c release from mitochondria in
response to activation of cell surface death receptors. Cell 94: 481–490.
39. Tait SW, de Vries E, Maas C, Keller AM, D’Santos CS, et al. (2007) Apoptosis
induction by Bid requires unconventional ubiquitination and degradation of its
N-terminal fragment. J Cell Biol 179: 1453–1466.
40. Tan KO, Tan KM, Yu VC (1999) A novel BH3-like domain in BID is required
for intramolecular interaction and autoinhibition of pro-apoptotic activity. J Biol
Chem 274: 23687–23690.
41. McDonnell JM, Fushman D, Milliman CL, Korsmeyer SJ, Cowburn D (1999)
Solution structure of the proapoptotic molecule BID: a structural basis for
apoptotic agonists and antagonists. Cell 96: 625–634.
42. Zha J, Weiler S, Oh KJ, Wei MC, Korsmeyer SJ (2000) Posttranslational N-
myristoylation of BID as a molecular switch for targeting mitochondria and
apoptosis. Science 290: 1761–1765.
43. Petros AM, Olejniczak ET, Fesik SW (2004) Structural biology of the Bcl-2
family of proteins. Biochim Biophys Acta 1644: 83–94.
44. Hinds MG, Day CL (2005) Regulation of apoptosis: uncovering the binding
determinants. Curr Opin Struct Biol 15: 690–699.
45. Wang K, Yin XM, Chao DT, Milliman CL, Korsmeyer SJ (1996) BID: a novel
BH3 domain-only death agonist. Genes Dev 10: 2859–2869.
46. Venetsanakos E, Mirza A, Fanton C, Romanov SR, Tlsty T, et al. (2002)
Induction of tubulogenesis in telomerase-immortalized human microvascular
endothelial cells by glioblastoma cells. Exp Cell Res 273: 21–33.
47. Zinkel SS, Hurov KE, Ong C, Abtahi FM, Gross A, et al. (2005) A role for
proapoptotic BID in the DNA-damage response. Cell 122: 579–591.
Bid BH3-B Mimicry by Viral IRF
PLoS Pathogens | www.plospathogens.org 18 June 2012 | Volume 8 | Issue 6 | e1002748
48. Song G, Chen GG, Yun JP, Lai PB (2009) Association of p53 with Bid induces
cell death in response to etoposide treatment in hepatocellular carcinoma. Curr
Cancer Drug Targets 9: 871–880.
49. Oberkovitz G, Regev L, Gross A (2007) Nucleocytoplasmic shuttling of BID is
involved in regulating its activities in the DNA-damage response. Cell Death
Differ 14: 1628–1634.
50. Nakamura H, Lu M, Gwack Y, Souvlis J, Zeichner SL, et al. (2003) Global
changes in Kaposi’s sarcoma-associated virus gene expression patterns following
expression of a tetracycline-inducible Rta transactivator. J Virol 77: 4205–4220.
51. Pozharskaya VP, Weakland LL, Zimring JC, Krug LT, Unger ER, et al. (2004)
Short duration of elevated vIRF-1 expression during lytic replication of human
herpesvirus 8 limits its ability to block antiviral responses induced by alpha
interferon in BCBL-1 cells. J Virol 78: 6621–6635.
52. Sinha S, Levine B (2008) The autophagy effector Beclin 1: a novel BH3-only
protein. Oncogene 27 Suppl 1: S137–148.
53. Barry M, McFadden G (1998) Apoptosis regulators from DNA viruses. Curr
Opin Immunol 10: 422–430.
54. Galluzzi L, Brenner C, Morselli E, Touat Z, Kroemer G (2008) Viral control of
mitochondrial apoptosis. PLoS Pathog 4: e1000018.
55. Postigo A, Ferrer PE (2009) Viral inhibitors reveal overlapping themes in
regulation of cell death and innate immunity. Microbes Infect 11: 1071–1078.
56. Burgert HG, Ruzsics Z, Obermeier S, Hilgendorf A, Windheim M, et al. (2002)
Subversion of host defense mechanisms by adenoviruses. Curr Top Microbiol
Immunol 269: 273–318.
57. Pipas JM, Levine AJ (2001) Role of T antigen interactions with p53 in
tumorigenesis. Semin Cancer Biol 11: 23–30.
58. Matta H, Chaudhary PM (2004) Activation of alternative NF-kappa B pathway
by human herpes virus 8-encoded Fas-associated death domain-like IL-1 beta-
converting enzyme inhibitory protein (vFLIP). Proc Natl Acad Sci U S A 101:
9399–9404.
59. Thome M, Schneider P, Hofmann K, Fickenscher H, Meinl E, et al. (1997)
Viral FLICE-inhibitory proteins (FLIPs) prevent apoptosis induced by death
receptors. Nature 386: 517–521.
60. Polster BM, Pevsner J, Hardwick JM (2004) Viral Bcl-2 homologs and their role
in virus replication and associated diseases. Biochim Biophys Acta 1644:
211–227.
61. Cuconati A, White E (2002) Viral homologs of BCL-2: role of apoptosis in the
regulation of virus infection. Genes Dev 16: 2465–2478.
62. Liang C, Lee JS, Jung JU (2008) Immune evasion in Kaposi’s sarcoma-
associated herpes virus associated oncogenesis. Semin Cancer Biol 18: 423–436.
63. Fujimuro M, Hayward SD (2004) Manipulation of glycogen-synthase kinase-3
activity in KSHV-associated cancers. J Mol Med 82: 223–231.
64. Wei MC, Lindsten T, Mootha VK, Weiler S, Gross A, et al. (2000) tBID, a
membrane-targeted death ligand, oligomerizes BAK to release cytochrome c.
Genes Dev 14: 2060–2071.
65. Chang LJ, Zaiss AK (2003) Self-inactivating lentiviral vectors and a sensitive
Cre-loxP reporter system. Methods Mol Med 76: 367–382.
66. Chen D, Sandford G, Nicholas J (2009) Intracellular signaling mechanisms and
activities of human herpesvirus 8 interleukin-6. J Virol 83: 722–733.
67. Arnoult D (2008) Apoptosis-associated mitochondrial outer membrane permea-
bilization assays. Methods 44: 229–234.
68. Bouillet P, Zhang LC, Huang DC, Webb GC, Bottema CD, et al. (2001) Gene
structure alternative splicing, and chromosomal localization of pro-apoptotic
Bcl-2 relative Bim. Mamm Genome 12: 163–168.
69. Renshaw SA, Dempsey CE, Barnes FA, Bagstaff SM, Dower SK, et al. (2004)
Three novel Bid proteins generated by alternative splicing of the human Bid
gene. J Biol Chem 279: 2846–2855.
70. Chang H, Gwack Y, Kingston D, Souvlis J, Liang X, et al. (2005) Activation of
CD21 and CD23 gene expression by Kaposi’s sarcoma-associated herpesvirus
RTA. J Virol 79: 4651–4663.
Bid BH3-B Mimicry by Viral IRF
PLoS Pathogens | www.plospathogens.org 19 June 2012 | Volume 8 | Issue 6 | e1002748
    • "For instance, a Bim mimetic, such as ABT-737, might be a good candidate for anti-ATL thera- peutics [46]. In addition to Tax, several viral oncoproteins including LMP2A of Epstein–Barr virus and viral interferon regulatory factor 1 of human herpesvirus 8 inhibit Bim function [47, 48]. Specifically, LMP2A inhibits Bim-induced anoikis by promoting Erk-dependent Bim degradation in epithelial cells [47]. "
    [Show abstract] [Hide abstract] ABSTRACT: Human T-cell leukemia virus type 1 (HTLV-1), an etiological agent of adult T-cell leukemia, immortalizes and transforms primary human T cells in vitro in both an interleukin (IL)-2-dependent and IL-2-independent manner. Expression of the HTLV-1 oncoprotein Tax transforms the growth of the mouse T-cell line CTLL-2 from being IL-2-dependent to IL-2-independent. Withdrawal of IL-2 from normal activated T cells induces apoptosis, which is mediated through the inducible expression of several proapoptotic proteins, including Bim. In this study, we found that Tax protects IL-2-depleted T cells against Bim-induced apoptosis. Withdrawal of IL-2 from CTLL-2 cells induced a prominent increase in the level of Bim protein in CTLL-2 cells, but not in Tax-transformed CTLL-2 cells. This inhibition of Bim in Tax-transformed CTLL-2 cells was mediated by two mechanisms: downregulation of Bim mRNA and posttranscriptional reduction of Bim protein. Transient expression of Tax in CTLL-2 cells also inhibited IL-2 depletion–induced expression of Bim, however, this decrease in Bim protein expression was not due to downregulation of Bim mRNA, thus indicating that Bim mRNA downregulation in Tax-transformed CTLL-2 occurs only after long-term expression of Tax. Transient expression of Tax in CTLL-2 cells also induced Erk activation, however, this was not involved in the reduction of Bim protein. Knockdown of Bim expression in CTLL-2 cells augmented Tax-induced IL-2-independent transformation. HTLV-1 infection of human T cells also reduced their levels of Bim protein, and restoring Bim expression in HTLV-1-infected cells reduced their proliferation by inducing apoptosis. Taken together, these results indicate that Tax-induced downregulation of Bim in HTLV-1-infected T cells promotes their IL-2-independent growth, thereby supporting the persistence of HTLV-1 infection in vivo.
    Full-text · Article · Dec 2014
    • "HA-bTRCP [63] was a gift from Dr. Shao-Cong Sun (M.D. Anderson Cancer Center). Tax, IKKa, and IKKb shRNAs were cloned into lentiviral pYNC352/puro or GFP-puro vector using BamHI and MluI enzyme sites as described previously [64]. The oligonucleotide sequences for shRNAs are listed inTable S2. "
    [Show abstract] [Hide abstract] ABSTRACT: The human T-cell leukemia virus type 1 (HTLV-1) Tax protein hijacks the host ubiquitin machinery to activate IκB kinases (IKKs) and NF-κB and promote cell survival; however, the key ubiquitinated factors downstream of Tax involved in cell transformation are unknown. Using mass spectrometry, we undertook an unbiased proteome-wide quantitative survey of cellular proteins modified by ubiquitin in the presence of Tax or a Tax mutant impaired in IKK activation. Tax induced the ubiquitination of 22 cellular proteins, including the anti-apoptotic BCL-2 family member MCL-1, in an IKK-dependent manner. Tax was found to promote the nondegradative lysine 63 (K63)-linked polyubiquitination of MCL-1 that was dependent on the E3 ubiquitin ligase TRAF6 and the IKK complex. Tax interacted with and activated TRAF6, and triggered its mitochondrial localization, where it conjugated four carboxyl-terminal lysine residues of MCL-1 with K63-linked polyubiquitin chains, which stabilized and protected MCL-1 from genotoxic stress-induced degradation. TRAF6 and MCL-1 played essential roles in the survival of HTLV-1 transformed cells and the immortalization of primary T cells by HTLV-1. Therefore, K63-linked polyubiquitination represents a novel regulatory mechanism controlling MCL-1 stability that has been usurped by a viral oncogene to precipitate cell survival and transformation.
    Full-text · Article · Oct 2014
    • "Bik steady-state concentrations in parental cells was assumed to be equal to 50 nM which is in the physiological range of BH3-only protein intracellular levels3334353637. This allowed us to deduce k fBik ~0:18 nM:min {1 . "
    [Show abstract] [Hide abstract] ABSTRACT: Src tyrosine kinases are deregulated in numerous cancers and may favor tumorigenesis and tumor progression. We previously described that Src activation in NIH-3T3 mouse fibroblasts promoted cell resistance to apoptosis. Indeed, Src was found to accelerate the degradation of the pro-apoptotic BH3-only protein Bik and compromised Bax activation as well as subsequent mitochondrial outer membrane permeabilization. The present study undertook a systems biomedicine approach to design optimal anticancer therapeutic strategies using Src-transformed and parental fibroblasts as a biological model. First, a mathematical model of Bik kinetics was designed and fitted to biological data. It guided further experimental investigation that showed that Bik total amount remained constant during staurosporine exposure, and suggested that Bik protein might undergo activation to induce apoptosis. Then, a mathematical model of the mitochondrial pathway of apoptosis was designed and fitted to experimental results. It showed that Src inhibitors could circumvent resistance to apoptosis in Src-transformed cells but gave no specific advantage to parental cells. In addition, it predicted that inhibitors of Bcl-2 antiapoptotic proteins such as ABT-737 should not be used in this biological system in which apoptosis resistance relied on the deficiency of an apoptosis accelerator but not on the overexpression of an apoptosis inhibitor, which was experimentally verified. Finally, we designed theoretically optimal therapeutic strategies using the data-calibrated model. All of them relied on the observed Bax overexpression in Src-transformed cells compared to parental fibroblasts. Indeed, they all involved Bax downregulation such that Bax levels would still be high enough to induce apoptosis in Src-transformed cells but not in parental ones. Efficacy of this counterintuitive therapeutic strategy was further experimentally validated. Thus, the use of Bax inhibitors might be an unexpected way to specifically target cancer cells with deregulated Src tyrosine kinase activity.
    Full-text · Article · Apr 2013
Show more