Article

Cozzarelli Prize Winner: Robust cardiomyocyte differentiation from human pluripotent stem cells via temporal modulation of canonical Wnt signaling

Department of Chemical and Biological Engineering, University of Wisconsin, Madison, WI 53706, USA.
Proceedings of the National Academy of Sciences (Impact Factor: 9.67). 05/2012; 109(27):E1848-57. DOI: 10.1073/pnas.1200250109
Source: PubMed

ABSTRACT

Human pluripotent stem cells (hPSCs) offer the potential to generate large numbers of functional cardiomyocytes from clonal and patient-specific cell sources. Here we show that temporal modulation of Wnt signaling is both essential and sufficient for efficient cardiac induction in hPSCs under defined, growth factor-free conditions. shRNA knockdown of β-catenin during the initial stage of hPSC differentiation fully blocked cardiomyocyte specification, whereas glycogen synthase kinase 3 inhibition at this point enhanced cardiomyocyte generation. Furthermore, sequential treatment of hPSCs with glycogen synthase kinase 3 inhibitors followed by inducible expression of β-catenin shRNA or chemical inhibitors of Wnt signaling produced a high yield of virtually (up to 98%) pure functional human cardiomyocytes from multiple hPSC lines. The robust ability to generate functional cardiomyocytes under defined, growth factor-free conditions solely by genetic or chemically mediated manipulation of a single developmental pathway should facilitate scalable production of cardiac cells suitable for research and regenerative applications.

Full-text

Available from: Kexian Zhu, Oct 30, 2014
Robust cardiomyocyte differentiation from human
pluripotent stem cells via temporal modulation of
canonical Wnt signaling
Xiaojun Lian
a,b
, Cheston Hsiao
a
, Gisela Wilson
c
, Kexian Zhu
a
, Laurie B. Hazeltine
a,b
, Samira M. Azarin
a,b
, Kunil K. Raval
b,c
,
Jianhua Zhang
b,c
, Timothy J. Kamp
b,c
, and Sean P. Palecek
a,b,1
Departments of
a
Chemical and Biological Engineering and
c
Medicine, University of Wisconsin, Madison, WI 53706; and
b
WiCell Research Institute, Madison,
WI 53719
Edited by Rudolf Jaenisch, Whitehead Institute for Biomedical Research, Cambr idge, MA, and approved April 25, 2012 (received for review January 18, 2012)
Human pluripotent stem cells (hPSCs) offer the potential to generate
large numbers of functional cardiomyoc ytes from clona l and
patient-specic cell sources. Here we show that temporal modu-
lation of Wnt signaling is both essential and sufcient for efcient
cardiac induction in hPSCs under dened, growth factor-free con-
ditions. shRNA knockdown of β-catenin during the initial stage of
hPSC differentiation fully blocked cardiomyocyte specication,
whereas glycogen synthase kinase 3 inhibition at this point en-
hanced cardiomyocyte generation. Furthermore, sequential treat-
ment of hPSCs with glycogen synthase kinase 3 inhibitors followed
by inducible expression of β-catenin shRNA or chemical inhibitors
of Wnt signaling produced a high yield of virtually (up to 98%)
pure functional human cardiomyocytes from multiple hPSC lines.
The robust abi lit y to generate func tion al cardiomyocytes u nde r
dened, growth facto r-free con dit ions sol ely by genetic or chem-
ically mediated manipu lati on of a sin gle de velopmen tal pat hway
should facilitate scalable production of cardiac cells suitable for
research and regenerative applications.
directed differentiation
|
chemically dened medium
B
ecause human pluripotent stem cells (hPSCs), including
human embryonic stem cells (hESCs) (1) and human in-
duced pluripotent stem cells (iPSCs) (2, 3), can be propagated
indenitely while still retaining the capacity to differentiate into
all somatic cell types, they are a potentially inexhaustible supply
of hu man cells, includi ng cardiomyocytes. Over the past de-
cade, substan tial advances have been made in genera ting car-
diomyocytes from hPSCs by providing developmental cues during
differentiation. Mouse visceral endoderm-like cell-conditioned
medium has been shown to enhance cardiac differentiation in
embryoid bodies (EBs) ( 4). The addition of dened growth
factors, including activin A, bone morphogenic facto r (BMP4),
FGF2, VEGF, and Dickkopf-1 (DKK-1), can further enhance
cardiomyocyte differentiation in EBs (5). However, this protocol
requires monitoring of kinase domain receptor/c-kit (5) or Flk1/
PDGF receptor α (6) expression to present growth factors tem-
porally at optimal concentrations to induce efcient cardiac
development and thus must be optimized individually for each
cell line. This directed differentiation protocol also requires a
difcult-to-scale enrichment step, such as cell sorting with an an-
tibody against signal-regulatory protein α (SIRPA) (7), to generate
a relatively (up to 98%) pure population of cardiomyocytes.
Identication of dened factors that promote cardiomyocyte
differentiation also has enabled development of monolayer-
based directed differentiation protocols. Sequential addition of
activin A and BMP4 to dened RPMI/B27 medium has been
reported to be more efcient than EB-based methods, generat-
ing more than 30% cardiomyocytes in the H7 hESC line (8).
However, the efciency of the activin A and BMP4 monolayer-
directed differentiation protocol can be highly variable between
cell lines and experimental repeats (9).
The Wnt signaling pathway has emerged as one of the key reg-
ulators of cardiogenesis in vivo and in vitro. Canonical Wnt ligands
direct cell proliferation and cell fate determination during em-
bryonic development through inhibition of glycogen synthase ki-
nase 3 (Gsk3), leading to nuclear accumulation of β-catenin,
which associates with T-cell factor/lymphoid enhancer-binding
factor (Tcf/Lef) and activates gene transcription. In chick and
frog embryos canonical Wnt signaling was shown to repress early
cardiac specication (10). Wnt signaling also has been shown
to have a biphasic effect on cardiac development in zebrash,
mouse embryos, and mouse ES cells (11, 12), with early Wnt
signaling enhancing and later signaling repressing heart de-
velopment. Endogenous Wnt signaling also is required for hESC
differentiation to cardiomyocytes in the monolayer-based directed
differentiation protocol (9). However, because of the complex
nature of Wnt signaling on cardiac differentiation, previous reports
have not identied the temporal requirements or sufciency of
canonical Wnt signaling in hPSC differentiation to cardiomyocytes.
Here, we systematically optimize Wnt signaling activity during
hPSC differentiation to cardiomyocytes and then illustrate that
appropriate temporal modulation of regulatory elements of Wnt
signaling alone via genetic approaches or small molecule inhib-
itors is sufcient to drive multiple hPSC lines to differentiate to
cardiomyocytes efciently, in part by regulating signaling through
other pathways critical for cardiomyocyte differentiation. We
demonstrated that it is possible to generate populations con-
sisting of up to 98% cardiomyocytes with an extremely high yield
(15 cardiomyocytes per hPSC input) from hPSC without any
enrichment and/or purication step solely via temporal modu-
lation of regulatory elements of Wnt signaling. We then used this
method to develop a robust, inexpensive, completely dened,
growth factor-free, scalable method of producing cardiomyocytes
from hPSCs.
Results
Differentiation Induced by Gsk3 Inhibitors in hPSCs is β-Catenin
Dependent.
To probe the activation of canonical Wnt/β-catenin
signaling during hPSC specication to cardiomyocytes, we gen-
erated a series of promoterreporter cell lines in H9 hESC and
19-9-11 human iPSC lines. These reporter lines, integrated with
a lentiviral 7TGP vector, express GFP under control of a con-
Author contributions: X.L., G.W., T.J.K., and S.P.P. designed research; X.L., C.H., G.W., K.Z.,
L.B.H., S.M.A., K.K.R., and J.Z. performed research; X.L., G.W., T.J.K., and S.P.P. analyzed
data; and X.L., T.J.K., and S.P.P. wrote the paper.
Conict of interest statement: T.J.K. is a founder and consultant for Cellular Dynamics
International, a company that uses human stem cells for drug testing.
This article is a PNAS Direct Submission.
1
To whom correspondence should be addressed. E-mail: palecek@engr.wisc.edu.
See Author Summary on page 10759 (volume 109, number 27).
This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10.
1073/pnas.1200250109/-/DCSupplemental.
E1848E1857
|
PNAS
|
Published online May 29, 2012 www.pnas.org/cgi/doi/10.1073/pnas.1200250109
Page 1
sensus TCF/LEF binding sequence promoter that reports canon-
ical Wnt/β-catenin signaling activation (Fig. S1A) (13). Although
Wnt/β-catenin activation has been reported in undifferentiated
mouse embryonic stem cells and hESCs (1416), we and others
(17) failed to observe signicant TCF/LEF-mediated transcrip-
tional activity in self-renewing undifferentiated H9-7TGP hESCs
in several different culture conditions, including mouse embry-
onic broblast (MEF) coculture, in MEF-conditioned medium
on Matrigel, and in mTeSR1 medium on Matrigel (Fig. S1B).
However, treatment of the H9-7TGP reporter line with the Gsk3
inhibitor CHIR99021 (CH) activated TCF/LEF promoter ac-
tivity in mTeSR1 on Matrigel. Immunouorescent analysis
revealed that the CH-induced H9-7TGP GFP
+
cells did not ex-
press Oct4 but did express Isl1 and Nkx2.5 (Fig. 1A). Heart Isl1
+
cells have been shown to be capable of self-renewal and expan-
sion before differentiation into the three major cell types: car-
diomyocytes, endothelial cells, and smooth muscle cells (18, 19),
and Nkx2.5 (20) is expressed in committed cardiomyocytes and
cardiac progenitor cells. Similar results were obtained in the
19-9-11 7TGP iPSC line (Fig. S1C). These results indicate that
CH induces differentiation of hPSCs cultured in mTeSR1. In-
terestingly, we observed heterogeneous activation of Wnt/β-cat-
enin signaling in 7TGP-hPSCs upon CH treatment in mTeSR1;
this heterogeneous activation may result from conicting self-
renewal signals in the mTeSR1 medium and differentiation sig-
nals from the Gsk3 inhibitor.
To evaluate the role of β-catenin in Gsk3 inhibitor-induced
hPSC differentiation, we generated H9 hESC and 19-9-11
iPSC lines carrying lentiviral integrated β-catenin shRNA. This
shRNA efciently down-regulated β-catenin expression com-
pared with control scrambled sequences (Fig. S2 AC). The
β-catenin knockdown cells still maintained high Oct4 and SSEA4
expression (Fig. S2 D and E).
We then treated the β-catenin knockdown (shcat-2) and scram-
ble 19-9-11 lines with CH in mTeSR1 medium to test whether
differentiation induced by Gsk3 inhibitors requires β-catenin.
Although the shcat-2 line maintained an undifferentiated mor-
phology, the scramble line appeared to undergo differentiation
(Fig. S2F), similar to unmodied cell lines treated with CH.
Induction of d ifferent iation following CH treatment in the
scramble control was indicated further by the disappearance of
SOX2 and NANOG and decreased OCT4 expression at day 4
(Fig. 1B). Flow cytometry analysis revealed that the percentage
of cells expressing Oct4 decreased to 61% in the scramble line,
B
d0 d2 d3 d4 d0 d2 d3 d4
scramble shcat-2
CTNNB
POU5F1
SOX2
NANOG
GSC
MIXL1
T
WNT3A
MSX1
ISL1
GAPDH
ACTB
pluripotency
mesendoderm
and mesoderm
Oct4 GFP
Isl1 GFP
Nkx2-5 GFP
Hoechst
Hoechst
Hoechst
A
D
0 6 12 15
CHIR99021 (μM)
1
10
100
1000
Fold of T Expression
of scramble over shcat-2
C
scramble
shcat-2
Oct4
% of Max
100
80
60
40
20
0
100
80
60
40
20
0
10 10 10 10
10
01234
10 10 10 10
10
01234
60.9
98.3
shcat2
scramble
10
0
20
30
40
50
60
70
80
0
6
12 15
9
3
CHIR99021 (μM)
% Brachyury+
E
F
scramble shcat-2
Isl1
Nanog
Fig. 1. Differentiation induced by treatment with the Gsk3 inhibitor in hPSCs is β-catenin dependent. (A) H9-7TGP cells were treated with 12 μMCHin
mTeSR1 for 4 d. Immunouorescent staining for Oct4, Isl1, and Nkx2.5 was compared with GFP expression. (Scale bars, 50 μm.) (B and C) 19-9-11 shcat-2 and
scramble cells were cultured on Matrigel with mTeSR1 medium containing 12 μ MCHfor4d.(B) RT-PCR analysis of pluripotent, mesendoderm, early me-
soderm, and early cardiac gene expression was performed. (C) Oct4 expression on day 4 was analyzed by ow cytometry. Each colored line represents an
independent replicate. n =3.(D) 19-9-11 shcat-2 and scramble lines were cultured on Matrigel in mTeSR1 containing CH. After 2 d, the expression of T in the
scramble relative to its expression in the shcat-2 line was quantied by quantitative PCR. (E) Flow cytometry analysis of brachyury expression in 19-9-11 shcat-2
and scramble cells exposed to CH for 4 d. Error bars represent SEM of three independent replicates. (F) 19-9-11 shcat-2 and scramble lines were cultured on
Matrigel in mTeSR1 containing 12 μM CH. After 4 d, cells were immunostained for Nanog and Isl1. (Scale bar, 50 μm.)
Lian et al. PNAS
|
Published online May 29, 2012
|
E1849
CELL BIOLOGY PNAS PLUS
Page 2
whereas 98% of the shcat-2 cells expressed Oct4 (Fig. 1C). In
addition, expression of genes found in mesendoderm and early
mesoderm tissues (MIXL1, GSC, T, WNT3A, and MSX1)
emerged in CH-treated scramble cells, but less expression of
these genes was observed in CH-treated shcat-2 cells. To un-
derstand better the quantitative nature of early mesoderm in-
duction via Gsk3 inhibition, we analyzed expression of the early
mesoderm gene T in scramble and shcat-2 19-9-11 lines. As CH
concentration increased, the ratio of T expression in scramble to
the shcat-2 line increased (Fig. 1D). Flow cytometry analysis
revealed that less than 2% of shcat-2 cells expressed brachyury
upon exposure to different concentrations of CH for 4 d. In
contrast, the scramble line exhibited a CH concentration-de-
pendent increase in the fraction of cells expressing brachyury,
containing 76% brachyury-positive cells following treatment with
15 μM CH for 4 d (Fig. 1E). In addition, immunostaining of the
scramble cell line after treatment with 12 μM CH in mTeSR1 for
4 d showed substantial numbers of Nanog
/Isl1
+
cells, whereas
the shcat-2 cells treated with CH contained only Nanog
+
/Isl1
cells (Fig. 1F). Together these results demonstrate that treat-
ment of undifferentiated hPSCs in mTeSR1 with Gsk3 inhibitors
induces differentiation in a β-catenindependent manner.
Temporal Key Roles of β-Catenin for Efcient Cardiac Differentiation.
Because Gsk3 inhibition induced differentiation toward early
mesoderm cells expressing Isl1 and Nkx2.5, we quantitatively
assessed the effect of incorporating Gsk3 inhibitors during
previously reported EB- and monol ayer-directed differentia-
tion protocols (8). For EB differentiation, undifferentiated H9
hESCs were cultured in the presence of 08 μM CH for 3 d be-
fore EB formation. Visual analysis of spontaneously contracting
outgrowths indicated that the efciency of cardiomyocyte dif-
ferentiation peaked at 24 μM CH (Fig. 2A). During monolayer-
based directed differentiation, sequential addition of activin A
and BMP4 generated very few contracting cardiomyocytes from
H9 hESCs. However, application of the Gsk3 inhibitors CH
or 6-bromoindirubin-3-oxime (BIO) 3 d before the addition
of growth factors greatly enhanced cardiomyocyte generation,
producing an average of 50% spontaneously contracting cardiac
troponin T (cTnT)-labeled cells (Fig. 2B and Movie S1). BIO
pretreatment for 3 d before addition of activin A and BMP4 also
enhanced generation of cTnT-expressing cells in the IMR90C4
iPSC line in a dose-dependent manner (Fig. S3A). Together these
results demonstrate that treatment of hPSCs with Gsk3 inhibitors
before differentiation, using either an EB- or monolayer-directed
strategy, dramatically enhanced cardiomyocyte differentiation.
To assess the temporal requirement of β-catenin for car-
diomyocyte generation, we then created 19-9-11 iPSC lines
(ishcat-1 and ishcat-2) expressing two different β-catenin
shRNA sequences under con trol of a Tet-regulated inducible
promoter (Fig. 2C). Integration of the lentiviral construct was
visualized by mCherry expression, and clones were selected
based on resistance to puromycin (Fig. 2D). Upon the addition
of doxycycline (dox), both shRNAs efciently down-regulated
β-catenin expression (Fig. 2E). We used these cell lines to examine
the stage-specic roles of β-catenin during monolayer-directed
differentiation induced by activin A and BMP4. Canonical Wnt
signaling is essential for cardiac induction, because β-catenin
knockdown upon the addition of activin A did not generate
cTnT-expressing cells in the 19-9-11 ishcat-1 line (Fig. 2F). Im-
portantly, knockdown of β-catenin expression at later stages of
differentiation enhanced cardiogenesis (Fig. 2F). Similar results
were observed in the 19-9-11 ishcat-2 line (Fig. S3B).
Highly Efcient Generation of Human Cardiomyocytes Solely by
Modulating Regulatory Elements of Wnt Signaling.
Our results and
prior studies (2124) indicate that early induction of canonical
Wnt signaling and suppression of canonical Wnt signaling at
later s tages of differentiation syne rgistically enhance yiel d of
cardiomyocytes with other growth factors and/or serum. We next
sought to determine whether modulating regulatory elements of
Wnt sig naling alone, in the absence of serum and exogenous
growth factors, was sufcient to induce cardiogenesis. Un-
differentiated inducible β -catenin knockdown hPSCs lines were
treated with CH for 24 h followed by the addition of dox at
various time points between day 0 and day 4 (Fig. 3A). Car-
diomyocyte differentiation was assessed at day 15 by the percent-
age and yield of cTnT-expressing cells. In the 19-9-11 ishcat-1
line, 12 μM CH produced the most cTnT
+
cells at day 15 without
additional dox-induced β-catenin knockdown (Fig. S4A). Addi-
tion of dox 36 h after the addition of 12 μM C H generated
98% cTnT
+
cells with yields of 15 cTnT
+
cells per input iPSC
without substantial effects on the total cell number (Fig. 3 B and
C and Fig. S4B). A high purity of cTnT
+
cells also was obtained
using 19-9-11 ishcat-2 (Fig. 3D) and three additional (IMR90C4,
6-9-9, and H9) hPSC lines transduced with inducible β-catenin
shRNA ishcat-1 (Fig. S4C).
Molecular analysis of this differentiation process revealed
dynamic changes in gene expression with the induction of the
primitive streak-like genes T (25) and MIXL1 (26) shortly after
CH addition and down-regulation of pluripotency markers OCT4
and NANOG within 4 d (Fig. 3E). Expression of the cardiac
transcription factor NKX2.5 (27) began at day 3 and persisted
throughout the 60-d experiment. ISL1, a gene that marks pro-
genitors of the secondary heart eld in the early embryo (18),
also was detected at day 3, but ISL1 expression ceased by day 30.
TBX5 (28), GATA4 (29), and MEF2C (30) are important regu-
lators of cardiomyocyte development, and their expression has
been used to convert broblasts directly into cardiomyocytes (31).
These three genes were expressed at different time points
following β-catenin knockdown, and expression of these genes
persisted for the full 60 d of the experiment (Fig. 3E). In addi-
tion to ISL1, TBX5, and NKX2.5, the cardiac progenitor marker
WT1 (32) also was expressed during cardiac differentiation.
Immunostaining showed the presence of substantial numbers of
Isl1
+
and/or Nkx2-5
+
cells during differentiation (Fig. 3F).
The optimal differentiation conditions illustrated in Fig. 3B,
12 μM CH followed by dox treatment at 36 h, produced relatively
pure (up to 98%) cardiomyocytes that contracted spontaneously
as coordinated sheets (Movie S2) in multiple (>50) independent
experiments in the 19-9-11 ishcat-1 line, demonstrating con-
sistency and reproducibility. These cardiomyocytes were main-
tained as spontaneously contracting cells in culture for more than
6mo(Movie S3). The cardiomyocytes exhibited normal cardiac
sarcomere organization, demonstrated by immunouorescent
staining of α-actinin,MLC2a,andcTnT(Fig.4A and Fig. S4 DG).
Scanning electron microscopy also identied cells with myo-
brillar bundles and transverse Z-bands (Fig. 4B and Fig. S4H)
and cells enriched in mitochondria (Fig. 4B). Intercalated disks
with desmo somes (Fig. S4I), typical of cardiomyocytes, were
observed also.
The expression pattern of the two major myosin light-chain
2 isoforms, MLC2a and MLC2v, can provide information re-
garding the diversity and maturity of the c ardiomyocytes. To
monitor quantitatively the differential expression of myolament
proteins involved in cardiomyocyte specication, we proled
MLC2a and MLC2v expression 20, 40, and 60 d after the in-
duction of differentiation. At day 20, very few cTnT
+
cells
contained detectable levels of MLC2v, a marker of mature
ventricular cardiomyocytes (3335), but virtually all cTnT
+
cells
contained MLC2a, which is expressed in atrial and immature
ventricular cardiomyocytes (Fig. 4C) (33). By day 60, greater
than 50% of the cTnT
+
cells expressed MLC2v, whereas the
percentage of cTnT
+
cells expressing MLC2a decreased to
less than 80%, sug gesting maturation of a population of
ventricular cardiomyocytes.
E1850
|
www.pnas.org/cgi/doi/10.1073/pnas.1200250109 Lian et al.
Page 3
To provide an initial assessment of the functional compe-
tence of cardiomyocytes generated by m anipulation of canon-
ical Wnt signaling in the absence of growth factors, we per-
formed sharp microelectrode electrophysiological recordings
at 29 d after the addition of CH. Representative recordings
of ventricular-like acti on potentials are shown (Fig. 4D). C ar-
diomyocytes also exhibited rate adaptation, as evidenced by
decreases in the duration of action potentials in response to
stimulation at increasing frequen cies (Fi g. 4 E). The observed
decreases in duration were comparable in magnitude to those
previously observed for hESC- and iPSC-derived cardiomyocytes
(36, 37). These results suggest that the ion channels and regula-
tory proteins involved in action potential generation and regula-
tion are expressed normally in cardiomyocytes generated by Wnt
pathway manipulation alone.
Together, these results indicate that spontaneously contracting
cardiomyocytes can be generated efciently from hPSCs solely
by manipulating regulatory elements of Wnt signaling in the
absence of exogenous growth factors.
Induction of TGF-β Superfamily Signaling by Gsk3 Inhibitors. To
determine whether canonical Wnt signaling requires TGF-β
superfamily signaling to induce cardiogenesis, we quantied
cTnT
+
cell generation in 19-9-11 ishcat-2 cells whe n activ in A
MCH
MCH
MCH
MCH
MCH
MCH
AB
Days after EB formation
5 10 15 20 25 30
0
5
10
15
20
25
30
35
% Beating EBs
DMSO CH
BIO
10
0
20
30
40
50
60
% cTnT+
#
#
C
P
H1TetO
shRNA
P
EF1α
TetR
IRES
RFP
-
Puro
R
iscramble
ishcat-1
GCTACACTATCGAGCAATTTTGGATCCAAAATTGCTCGATAGTGTAGC
ishcat-2
GCATAACCTTTCCCATCATTTGGATCCAAATGATGGGAAAGGTTATGC
GCTGGTGGAATGCAAGCTTTTGGATCCAAAAGCTTGCATTCCACCAGC
D
RFP
E
F
Purity
Yield
Purity (% cTnT+)
10
0
20
30
40
50
60
70
80
90
Day 1 Day 2 Day 3 Day 4Day 0
no dox
1
0
2
3
4
5
6
7
8
Yield (# CMs/hPSC)
iscramble ishcat-1 ishcat-2
0
0.2
0.4
0.6
0.8
1.0
1.2
Relative Expression of
β-catenin
#
#
#
#
#
#
#
#
Fig. 2. Temporal regulation of Wnt/β-catenin signaling promotes cardiac differentiation induced by serum or growth factors. (A) H9 cells on MEFs were
treated with CH in hESC medium for 3 d before forming EBs. EBs were cultured in suspension using serum containing medium for 4 d before being transferred
to 0.1% (wt/vol) gelatin-coated plates. The percentage of contracting EBs was determined visually. (B) H9 cells were cultured on Matrigel and treated with
DMSO, 1 μM CH, or 1 μM BIO for 3 d before exposure to 100 ng/mL activin A at day 0 and 5 ng/mL BMP4 at day 1 in RPMI/B27-insulin medium using monolayer-
directed differentiation. At day 15, the percentage of cTnT
+
cells in culture was assessed by ow cytometry.
#
P < 0.005, CH versus DMSO or BIO versus DMSO;
Students t test. (C) Schematic of the inducible shRNA construct for β-catenin knockdown and shRNA sequences targeting β-catenin. P
H1TetO
represents the
human H1 promoter with Tet operator sequences. Red and green sequences are forward and reverse shRNA sequences of β-catenin, respectively; the loop
sequence is shown in blue. (D) Representative phase-contrast and mCherry epiuorescence images of 19-9-11 cells transduced with lentiviral vectors con-
taining the constructs described in C and selected by puromycin treatment. (E) 19-9-11 ishcat-1 and ishcat-2 cells were cultured in m TeSR1 containing 2 μg/mL
dox. After 3 d, mRNA was collected, and β-catenin expression was evaluated by quantitative PCR. Error bars represent SEM of three samples.
#
P < 0.005, ishcat-1
versusiscrambleorishcat-2versusiscramble;Students t test. (F) 19-9-11 ishcat-1 cells were cultured in mTeSR1 medium and were treated with BIO before ex-
posure to 100 ng/mL activin A at day 0 and 5 ng/mL BMP4 at day 1, with 2 μg/mL dox added at the indicated times. Cells were analyzed for cTnT expression by ow
cytometry 15 d after initiation of differentiation. Error bars represent SEM. of three independent experiments.
#
P < 0.005, for each time point versus no dox;
Students t test.
Lian et al. PNAS
|
Published online May 29, 2012
|
E1851
CELL BIOLOGY PNAS PLUS
Page 4
and BMP4 sig naling antagonists were presented during the rst
24 h of cardiomyocyte induction with 12 μM CH. All samples
were treated with dox at 4 8 h. SB431542 (SB), an inhibitor of
activin A receptor-like kinase ALK5 and its relatives ALK4 and
ALK7 (38) completely blocked cardiomyocyte specication at
concentrations greater than 2 μM(Fig.5A). Addition of DMH1,
a dorsomorphin analogue that inhibits the BMP ALK2 receptor
(39), also decreased the percentage of cTnT
+
cells in a concen-
tration-dependent manner (Fig. 5A). To investigate further the
role of TGF-β superfamily signaling in modulating regulatory
elements in Wnt pathway-mediated cardiogenesis, we assessed
Smad1/5 and Smad2 phosphorylation downstream of BMP4
and activin A signaling, respectively. As expected, substantial
Smad1/5 and Smad2 phosphorylation was detected in cells that
had been treated with activin A and BMP4. CH treatment
resulted in Smad1/5 and Smad2 activation at levels comparable
to those induced by activin A and BMP4. Smad1/5 phosphor-
ylation was strongly attenuated by DMH1, whereas SB reduced
Smad2 phosphorylati on. Interestingly, endogeno us BMP2/ 4
was detected in undifferentiated hPSCs and cells following
CH treatment (Fig. 5B and Fig. S5). Gene-expression analysis
revealed that BMP2 and BMP4 were up-regulated gradually upon
CH treatment and persisted throughout the differentiation pro-
cess, whereas a transient up-regulation upon CH treatment was
observed for NODAL expression (Fig. 5C). These results indicate
that activin/Nodal and BMP signaling are necessary for cardio-
A
0
20
40
60
80
100
no
0
24
36
48 72
96
% cTnT+
Time of dox addition (hours)
dox
d-5
Single cell
seeding
RPMI with B27 minus insulin RPMI with B27mTeSR1
d0
CH
d1
Basal
medium
d5
Basal
medium
d30
Functional
analysis
d7
Contracting cells
Dox addition
*
*
#
#
D
C
B
E
d0 d1 d2 d3 d4 d5
d8 d15 d30
d60
ACTB
POU5F1
NANOG
MIXL1
T
ISL1
NKX2-5
GATA4
MEF2C
TBX5
TBX2
TNNI2
TNNI3
PLN
MYL7
MYL2
cTnT
WT1
F
Fig. 3. Modulating regulatory elements of Wnt signaling is sufcient for efcient and reproducible generation of human cardiomyocytes in the absence of
growth factors. (A) Schematic of protocol for dened, growth factor-free differentiation of hPSCs expressing dox-inducible β-catenin shRNA to car-
diomyocytes via treatment with small molecules. (B and C) 19-9-11 ishcat-1 cells were cultured as indicated in A with dox added 36 h after treatment with
12 μM CH. At day 15, cells were analyzed for cTnT expression by ow cytometry (B) or immunouorescence (C). In B, the green histogram represents cTnT
expression, and the red histogram is an isotype control. (Scale bar in C,50μm.) (D) 19-9-11 ishcat-2 cells were cultured as indicated in A, with dox added at
different time points after treatment with 12 μM CH. At day 15, cells were analyzed for cTnT expression by ow cytometry. Error bars represent SEM of three
independent experiments. *P < 0.05 and
#
P < 0.005, each time point versus no dox; Students t test. (E and F) 19-9-11 ishcat-1 cells were differentiated as
described in A, with dox added 36 h after treatment with 12 μM CH. (E) At different time points, mRNA was collected, and RT-PCR analysis of pluripotent,
mesendoderm, mesoderm, and cardiac gene expression was performed. (F) Day 7 cells were analyzed for Isl1 and Nkx2.5 expression by immunouorescence.
(Scale bar, 100 μm.)
E1852
|
www.pnas.org/cgi/doi/10.1073/pnas.1200250109 Lian et al.
Page 5
genesis induced via modulating re gulator y elements of the Wnt
pathway and suggest that this si gnaling may result from en-
dogenous Nodal and BMPs produ ced during di fferentiation.
Differentiation of hPSCs to Cardiomyocytes in Fully Dened, Growth
Factor-Free Conditions via Small Molecule Modulation of Regulatory
Elements of Wnt Signaling.
Although shRNA inhibition of β-catenin
provides specic and facile temporal regulation of canonical Wnt
signaling, this method requires genetic modication of the hPSC
line, reducing its utility for potential clinical applications. We
next used the mechanistic insight these modied lines provided
regarding the sufciency of modulating regulatory elements in
canonical Wnt signaling in cardiomyogenesis to develop a com-
pletely dened, growth factor-free method of generating car-
diomyocytes from unmodied hPSC lines efciently, using only
small molecule inhibitors of mediators of canonical Wnt signaling.
First, 19-9-11 iPSCs were maintained in mTeSR1 on Matrigel for
5 d; then the medium was switched to RPMI/B27-insulin con-
taining 12 μM CH. Inhibitor of Wnt production-4 (IWP4) and
Inhibitor of Wnt production-2 (IWP2), which prevent palmity-
lation of Wnt proteins by Porcupine, thereby blocking Wnt
protein secretion and activity (40), were used to inhibit Wnt
signaling. Addition of 5 μM IWP4 at day 3 resulted in optimal
generation of cardiomyocytes (Fig. 6A and Fig. S6A). Similar to
results obtained with the 19-9-11 ishcat-1 cell line, CH treat-
ment of 19-9-11 cell s alo ne ge nerated onl y 1 6% cTnT
+
or
MF20
+
cells after 15 d, whereas adding 5 μM IWP4 or IWP2 at
day 3 increased this purity to 87% cTnT
+
or MF20
+
cells. Similar
results were obtained when CH was replaced by other Gsk3
inhibitors, including CHIR98014 and BIO-acetoxime (Fig. S6B).
To achieve fully dened cardiomyocyte differentiation con -
ditions, Matrigel was replaced with a dened peptide acrylate
surface (Synthemax) during both hPSC expansion and differ-
entiation (Fig. 6B).19-9-11andIMR90C4iPSCsplatedon
Synthemax plates and treated with CH and IWP4 also gener-
ated 85% cTnT
+
or MF20
+
cells, comparable to the efcie ncy
of differentiati on observed after CH treatme nt followed by
expression of β-catenin shRNA (Fig. 6C). Sim ilar results were
obtained in iPSC line 6-9-9 and hESC line H9 (Fig. S6C). These
differentiated popul ations formed spontaneousl y co ntracting
sheets of cardiomyocytes (Movies S4 and S5). The cardiomyocytes
exhibited normal cardiac sarcomere organization (Fig. 6 D).
Representative recordings of ventricular-like action potentials
are shown (Fig. 6E). The small molecule cardiac differentiation
protocol predominantly generated cardiomyocytes with a ven-
tricular-like action potential morphology (32/35, 91.5%). Atrial-
like action potentials were observed less commonly (3/35, 8.5%),
and nodal-like action potentials were not observed (0/35, 0%).
Cardiomyocytes generated by treatment of hPSCs with small mol-
ecules also exhibited rate adaptation, as evidenced by decreases in
the duration of action potentials in response to stimulation at in-
creasing frequencies (Fig. 6F).
Discussion
This study demonstrates efcient and robust generation of car-
diomyocytes from multiple hPSC lines solely via small molecule
modulation of regulatory elements of Wnt/β-catenin signaling.
Using the 7TGP lines, we showed that activation of Wnt/β-catenin
signaling promotes differentiation, not self-renewal, of hPSCs, a
result that is consistent with a recent publication from Davidson
et al. (41). Furthermore, our data demonstrate that β-catenin is
α
-actinin
MLC2a
α-actinin/MLC2a/DAPI
MLC2v
+
cTNT
+
/cTNT
+
MLC2a
+
cTNT
+
/cTNT
+
10
0
20
30
40
50
60
70
80
90
100
d20
d40 d60
Percentage (%)
25 mV
500 ms
1 s
2 Hz
1 Hz
3 Hz
25 mV
250 ms
Normalized APD
1.0
0.5
0.0
2
Hz
13
1.0
0.5
0.0
2
Hz
13
APD90 APD50
A
B
C
D
E
Fig. 4. Structural and functional charact erization of cardiomyocytes generated from hPSCs via modulation of Wnt signaling. (A) Cardiomyocy tes were
generated from 19-9-11 ishcat-1 cells using the protocol described in Fig. 3A, with treatment with 12 μM CH at day 0 and 2 μg/mL dox 36 h later. At day 30,
cells were individualized and replated on 0.1% (wt/vol) gelatin-coated coverslips. Immunostaining for α-actinin and MLC2a shows sarcomere organization.
(Scale bar, 50 μm.) (B) Transmission electron microscopic images of beating clusters derived from the 19-9-11 ishcat-1 line as described in A shows myobrils
(red arrow) with Z-bands (green arrow) and mitochondria (blue arrows). (Scale bar, 2 μm.) (C) 19-9-11 ishcat-1 cells were differentiated as described in Fig. 3A,
with 12 μM CH added at day 0 and 2 μg/mL dox added 36 h later. Cells were assayed for cTNT, MLC2v, and MLC2a by ow cytometry at the indicated time
points. Error bars represent the SEM of three independent experiments. Day 20, day 40, and day 60 are signicantly different from each other (P < 0.05) when
compared using one-way ANOVA and Tukey post hoc tests. (D) Microelectrode recordings of action potential activity were collected at day 29 in car-
diomyocytes derived from the 19-9-11 ishcat-1 cells differentiated as described in A. Dashed lines indicate 0 mV. (E)(Upper) Representative recordings of
action potentials collected during eld stimulation at 1, 2, and 3 Hz as indicated.
(Lower) Bar graphs showing average (± SEM) fractional changes in action
potential duration at 90% (APD90) and 50% (APD50) repolarization obtained by normalizing to the values observed in response to 1-Hz stimulation. Data
represent SEM of four independent experiments.
Lian et al. PNAS
|
Published online May 29, 2012
|
E1853
CELL BIOLOGY PNAS PLUS
Page 6
essential for cardiogenesis upon hPSC treatment with activin A
and BMP4. Knockdown studies conclusively demonstrated that
β-catenin is required in hPSC differentiation to mesoderm and
cardiac progenitors induced by Gsk3 inhibitors. In addition,
β-catenin knockdown at the appropriate differentiation stage
enhanced generation of cardiomyocytes during monolayer-based
directed differentiation induced by ligands of the TGF-β super-
family. Recently, car diomyocytes were isolated by cell sorting
with an antibody against SIRPA, p roducing up to 98% puried
cardiomyocytes from hPSC differentiation cultures (7). However,
this technique also has disadvantages with regard to its cost, ef-
ciency, response speed, separate resolution, and scalability.
Furthermore, if cells are to be cultivated after subsequent sorting,
the damage to cells caused by to the sorting process should be
minimized. Instead, we demonstrated that it is possible to gen-
erate up to 98% cardiomyocytes by temporally modulating regu-
latory elements of Wnt signaling without subsequent enrichment
or purication. Greater than 82% cardiomyocytes were obtained
in six hESC and iPSC lines, including the 19-9-11 and 6-9-9 lines
which exhibited low rates of cardiogenesis in EB differentiation
(Table S1). Most importantly, we showed that small molecules
modulating regulatory elements of a single developmental
pathway, Wnt/β-catenin signaling, is sufcient for highly efcient
and reproducible cardiac differentiation in multiple hPSC lines
under fully dened, growth factor-free conditions. This nding
suggests that canonical Wnt signaling can act as a master regulator
of cardiomyocyte specication from pluri potent cells, with tem-
poral changes in Wnt signaling regulating autocrine and para-
crine signals that also are involved in cardiac development,
including TGF-β superfamily pathways.
Cardiomyocyte differentiation was sensitive to the timing and
dose of Wnt pathway modulation. During growth factor-free
directed differentiation, optimization of timing of Wnt pathway
regulators generated 98% cTnT
+
cardiomyocytes. To achieve
a high purity of cardiomyocytes by β-catenin knockdown, the
addition of dox must be initiated within several hours of the 36-h
postdifferentiation optimum. This result is consistent with a
previous study that reported cardiac potential is restricted to a
narrow window of mesoderm development (42) and an EB-based
study which found that kinetics of differentiation of each cell line
need to be evaluated for optimal germ-layer induction (6).
Although exogenous TGF-β superfamily growth factors are
not necessary for cardiomyocyte differentiation, activin/Nodal
and BMP pathway inhibitors resulted in a dramatic decrease in
cTnT
+
cells. Expression of Nodal and BMPs early in differentia-
tion, when 90% of the cells are either Oct4- or brachyury-positive,
suggests that endogenous Nodal/BMPs may be produced by
undifferentiated cells or mesendoderm cells. Modulation of reg-
ulatory elements in Wnt pathway signaling triggers expression of
a variety of developmental cues [e.g., Nodal (6), BMP2/4 (6, 8),
Noggin (43), WNT3a (24), and WNT8a (9)] and transcription
factors involved in cardiomyocyte differentiation [e.g., T (25),
MIXL1 (26), ISL1 (18) and NKX2-5 (27), TBX5 (28), and
MEF2C (30)]. The paradigm of modulating regulatory elements
from a single critical developmental pathway that then results in
a more complex developmental program also may simplify hPSC
differentiation to other therapeutically relevant lineages.
The use of small molecules to regulate developmental programs
has been described in reprogrammin g somatic cells t o human
iPSCs and directed differentiation of hPSCs to clinically relevant
lineages. For example, ALK4/5/7 inhibitors have been shown to
enhance reprogramming (44, 45) via overexpression of reprog-
ramming transcription factors. LY294002 (46), a PI3K inhibitor,
and IDE1 (47), an activator of the Nodal pathway, promote
endodermal differentiation of hPSCs treated with serum and/or
activin A. Inhibitors of Wnt production enhance serum and
BMP4-based cardiac differentiation of hPSCs in EBs (23).
However, these protocols require the expression of transcription
factors or application of serum and/or growth factors for cell fate
conversion. Here we show that small molecules alone are suf-
cient to convert hPSCs to cardiomyocytes efciently when applied
at the appropriate developmental stages. The use of small mole-
cules instead of growth factors ultimately could allow inexpensive
and reproducible generation of human cardiomyocytes or mul-
tipotent tissue-specic stem cells in compl etely chemi cally de-
ned conditions, facilitating translation of these cells to high-
throughput screening applications or regenerative therapies (48).
B
d0 d1 d2 d1 d2 d1 d2 d1 d2
Activin/
BMP
CH
CH/
DMH1
CH/
SB
pSmad1/5
Smad1
BMP2/4
pSmad2
Smad2
β-Actin
d0 d1 d2 d3 d4 d5 d8 d15 d30 d60
ACTB
WNT8A
WNT3A
NODAL
BMP2
BMP4
NOGGIN
C
10
0
20
30
40
50
60
70
80
90
A
0.5 1 2 4 0.5 0.2 1
control
CH CH+SB431542 (μM) CH+DMH1 (μM)
% cTnT+
#
#
#
*
*
Fig. 5. Induction of TGF-β superfamily signaling by treatment with a Gsk3
inhibitor. (A) 19-9-11 ishcat-2 cells were treated with 12 μM CH, 12 μMCH
plus 0.54 μM SB, or 12 μM CH plus 0.21 μM DMH1 for 24 h. All samples
were treated with 2 μg/mL dox 48 h later. At day 15, the percentage of cTnT
+
cells was assessed by ow cytometry. Error bars represent SEM of three in-
dependent experiments. *P < 0.05;
#
P < 0.005, each point versus control;
Students t test. (B) Expression of BMP2/4 and expression and phosphoryla-
tion of Smad proteins were analyzed via Western blot in 19-9-11 ishcat-2
cells undergoing differentiation by 100 ng/mL activin A at day 0 and 5 ng/mL
BMP4 at day 1 or treatment with 12 μM CH, 12 μMCHplus1μM DMH1, or
12 μMCHplus1μM SB for 24 h followed by the addition of 2 μg/mL dox at
36 h. (C) 19-9-11 ishcat-2 cells were differentiated to cardiomyocytes, as
showninFig.3A,with12μM CH treatment at day 0 and the addition of
2 μg/mL dox at 36 h. At different time points, Wnt and TGF-β pathway
gene expression was assessed by RT-PCR.
E1854
|
www.pnas.org/cgi/doi/10.1073/pnas.1200250109 Lian et al.
Page 7
Methods
Maintenance of hPSCs. Transgene-free human iPSCs (6-9-9 and 19-9-11)
(49 ) , lentiviral integr ated human iPSC (IMR90C4) (2), and hESCs (H9, H13,
H14) (1) were maintained on MEF feeders in hESC medium: DMEM/F12
culture medium supplemented with 20% (vol/vol) KnockOut serum re-
placer, 0.1 mM nonessential amino acids, 1 mM
L-glutamine (all from Invi-
trogen), 0.1 mM β-mercaptoethanol (Sigma), and 10 ng/mL human bFGF
(Invitrogen). Conditioned medium is hES C medium conditioned by MEFs
MF20+
cTNT+
10
0
20
30
40
50
60
70
80
90
100
0 1 2 5 7 5
A
IWP2
(μM)
IWP4
(μM)
Percentage (%)
C
MF20+
cTNT+
Activin/BMP CH+dox CH+IWP4CH+IWP4
IMR90C4
ishcat-1
19-9-11
10
0
20
30
40
50
60
70
80
90
100
Percentage (%)
IMR90C4 IMR90C4
#
#
#
#
#
D
B d-5
Single cell
seeding
RPMI with B27 minus insulin RPMI with B27mTeSR1/Synthemax
d0
CH
d1
Basal
medium
d5
Basal
medium
d30
Functional
analysis
d7
Contracting cells
d3
IWP
α
-actinin
MLC2a
α-actinin/MLC2a/DAPI


E
F
25 mV
25 m
V
500 ms
1 s
250 ms
1 Hz
2 Hz
3 Hz
APD90 APD50
0.0
0.5
1.0
0.0
0.5
1.0
1
2
3
1
2
3
Hz
Hz
***
***
Normalized APD
Normalized APD
Fig. 6. Development of a protocol for differentiation of hPSCs to cardiomyocytes in fully dened conditions via small molecule modulation of regulatory
elements of Wnt signaling. (A) 19-9-11 cells were cultured on Matrigel in mTeSR1 for 5 d before exposure to 12 μM CH at day 0 and 07 μM IWP4 or 5 μMIWP2
at day 3 in RPMI/B27-insulin. At day 15, cTnT expression and MF20 staining were assessed by ow cytometry. Error bars represent SEM of three independent
experiments.
#
P < 0.005, each point versus no drug; Students t test. (B) Schematic of protocol for fully dened, growth factor-free differentiation of hPSCs to
cardiomyocytes via treatment with small molecules. (C) IMR90C4 and 19-9-11 cells were cultured on Synthemax plates in mTeSR1 for 5 d before exposure to
12 μM CH at day 0 and 5 μM IWP4 at day 3 in RPMI/B27-insulin. IMR90C4 cells were differentiated with 100 ng/mL activin A at day 0 and 5 ng/mL BMP4 at day1
as a control. At day 15, cTNT and MF20 expression were assessed by ow cytometry. Error bars represent SEM of three independent experiments. (D) Car-
diomyocytes were generated from 19-9-11 cells using the protocol described in C, with 12 μM CH treatment at day 0 and 5 μM IWP4 treatment 3 d later on
Synthemax plates. At day 30, cells were individualized and replated on 0.1% (wt/vol) gelatin-coated coverslips. Immunostaining for α-actinin and MLC2a
shows sarcomere organization. (Scale bar, 50 μm.) (E)(Left) Microelectrode recordings of action potential activity were collected at day 29 in cardiomyocytes
derived from the 19-9-11 cells differentiated as described in C.(Right) Single action potential taken from the start of the recording shown at an expanded
timescale. Dashed lines indicate 0 mV. (F)(Upper) Representative recording of action potentials from a cardiomyocyte derived from the 19-9-11 line during
eld stimulation at 1, 2, and 3 Hz as indicated. Dashed lines indicate 0 mV. (Lower) Bar graphs showing average (± SEM) fractional changes in action potential
duration at 90% and 50% repolarization obtained by normalizing to the values observed in response to 1 Hz stimulation (n = 6) for cardiomyocytes exhibiting
a ventricular-like a ction potential phenotype. A nonparametric KruskalWallis test and Dunns posttest were used for statistical comparisons of rate adap-
tation. ***P < 0.001.
Lian et al. PNAS
|
Published online May 29, 2012
|
E1855
CELL BIOLOGY PNAS PLUS
Page 8
for 24 h (50). For feeder-free culture, hPSCs were maintained on Matrigel
(BD Biosciences) or Synthemax plates (Corning) in mTeSR1 medium
(STEMCELL Technologies).
Cardiac Differentiation via EBs. hPSCs were passaged onto MEFs (13,000 cells/
cm
2
) and cultured in hESC medium for 2 d followed by another 3 d in hESC
medium supplemented with BIO (Sigma) or CHIR99021 (Selleck). To form
EBs, hPSC cell aggregates generated by dispase treatment were cultured in
low-attachment plates overnight in RPMI plus 20% (vol/vol) KnockOut serum
replacer. The next day, the EBs were cultured in RPMI20 (RPMI plus 20% FBS)
for 4 d in suspension. EBs then were plated onto 0.1% (wt/vol) gelatin-coated
six-well culture plates at 50100 EBs per well and were cultured in RPMI20
medium. After 10 d of differentiation, the FBS concentration was reduced to
2% (vol/vol) RPMI2 (RPMI plus 2% FBS). The number of contracting EBs was
assessed visually using a microscope with a 37 °C-heated stage.
Cardiac-Directed Differentiation Using Activin A and BMP4. hPSCs maintained
on Matrigel in mTeSR1 were dissociated into single cells with Accutase
(Invitrogen) at 37 °C for 5 min and then were seeded onto a Matrigel-coated
cell-culture dish at 100,000200,000 cell/cm
2
in mTeSR1 supplemented with
5 μM ROCK inhibitor (Y-27632; Stemgent) (day 5) for 24 h. Cells then were
cultured in mTeSR1, which was changed daily. At day 0, cells were treated
with 100 ng/mL activin A (R&D) in RPMI/B27-insulin. After 24 h, the medium
was changed to RPMI/B27-insulin supplemented with 5 ng/mL BMP4 (R&D)
for another 4 d. At day 5, the medium was changed to RPMI/B27-insulin. At
day 7 the cells were transferred to RPMI/B27, and medium was changed
every 3 d. When Gsk3 inhibitors were used to stimulate cardiomyocyte dif-
ferentiation, cells were cultured in mTeSR1 containing BIO or CHIR99021
from day 3 to day 0.
Cardiac-Directed Differentiation via Small Molecules. Cells were dissociated
and plated as described in the activin/BMP4 protocol. When hPSCs main-
tained on Matrigel or Synthemax plates achieved conuence, cells were
treated with CH in RPMI/B27-insulin for 24 h (day 0 to day 1). The medium was
changed to RPMI/B27-insulin, followed by treatment with 2 μg/mL dox at
different times between day 1 and day 5 for transgenic cell lines. For ge-
netically unmodied lines, 5 μM IWP2 (Tocris) or IWP4 (Stemgent) was added
at day 3 and removed during the medium change on day 5. Cells were
maintained in the RPMI/B27 starting from day 7, with the medium changed
every 3 d. Other small molecules, including SB431542 (Stemgent) and DMH1
(Sigma), were used in this study.
Lentiviral Production and Infection of Human Pluripotent Stem Cells. The
pLKO.1-based β -catenin constitutive knockdown vectors shcat-1 and shcat-2
(plasmids 19761 and 19762; Addgene) and the β-catenininducible knock-
down vectors ishcat-1 and ishcat-2 (Biosettia) were used for lentivirus par-
ticle production. These vectors were cotransfected with the helper plasmids
psPAX2 and pMD2.G (plasmids 12260 and 12259; Addgene) into HEK-
293TN cells (System Biosciences) for virus p roduction. Virus-containing
media were collected at 48 and 72 h after transfection and used for human
pluripotent stem cells (hPSC) infection in the presence of 6 μg/mL Polybrene
(Sigma). Transduced cells were selected and clonally isolated based on re-
sistance to 1 μg/mL puromycin.
RT-PCR and Quant itative RT-PCR. Total RNA was prepared with the RNeasy
mini kit (QIAGEN) and treated with DNase (QIAGEN). RNA (0.1 μg) was re-
verse transcribed into cDNA via Oligo (dT) with SuperScript III Reverse Tran-
scriptase (Invitrogen). Real-time quantitative PCR was done in triplicate with iQ
SYBR Green SuperMix (Bio-Rad). RT-PCR was performed with Gotaq Master
Mix (Promega) and then subjected to 2% (wt/vol) agarose gel electro-
phoresis. ACTB was used as an endogenous control. The primer sequences
are listed in Table S2.
Flow Cytometry. Cells were dissociated into single cells and then xed with
1% (vol/vol) paraformaldehyde f or 20 min at room temperature and
stained with primary and secondary antibodies in PBS plus 0.1% (vol/vol)
Triton X-100 and 0.5% (w t/vol) BSA. Data wer e collected o n a FACSCalib er
ow cytomet er (Beckton Dickinson) and analyzed using FlowJo . An tibodies
are listed in Table S3.
Immunostaining. Cells were xed with 4% (vol/vol) paraformaldehyde for 15
min at room temperature and then stained with primary and secondary
antibodies in PBS plus 0.4% (vol/vol) Triton X-100 and 5% (wt/vol) nonfat dry
milk (Bio-Rad). Nuclei were stained with Gold Antifade Reagent with DAPI
(Invitrogen). An epiuorescence microscope (DM IRB; Leica) with a QImaging
Retiga 4000R camera was used for imaging analysis. Antibodies are listed in
Table S3.
Electron Microscopy. Contracting areas were microdissected and replated
onto gelatin-coated glass coverslips. The clusters were xed overnight at 4 °C
in a 2.5% (vol/vol) gluteraldehyde, 2% (vol/vol) paraformaldehyde, 0.1 M
cacodylate buffer solution and then were postxed with 1% (wt/vol) os-
mium tetroxide. Samples were dehydrated via an ethanol gradient and
embedded in Durcapan (Fluka). The glass coverslip was dissolved with
hydrouoric acid treatment. Ultrathin 60-nm sections were stained with
uranyl acetate and lead citrate. Samples were visualized on a Phillips CM120
scanning transmission electron microscope.
Western Blot Analysis. Cells were lysed in M-PER Mammalian Protein Ex-
traction Reagent (Pierce) in the presence of Halt Protease and Phosphatase
Inhibitor Mixture (Pierce). Proteins were separated by 10% (wt/vol) Tris ·
Glycine SDS/PAGE (Invitrogen) under denaturing conditions and transferred
to a nitrocellulose membrane. After blocking with 5% (wt/vol) milk in Tris-
buffered saline with Tween, the membrane was incubated with primary
antibody overnight at 4 °C. The membrane then was washed, incubated
with an anti-mouse/rabbit peroxid ase-conjug at ed secondary antibody
(1:1,000, Cell Signaling) at room temperature for 1 h, and d eveloped by
SuperSignal chemiluminescence (Pierce). Antibodies are listed in Table S 3.
Electrophysiology.
Beating cardiomyocyte clusters were microdissected and
replated onto glass coverslips and were maintained in RPMI2 medium before
recording. Action potential activity was assessed using glass microelectrodes
(50100 MΩ; 3 M KCl) in a 37 °C bath cont inuously perfused with Tyrodes
solution (in mmol/L): 140 NaCl, 5.4 KCl, 1.8 CaCl
2
, 1 MgCl
2
, 10 Hepes, 10
glucose (pH 7.4), NaOH. Junction potentials and capacitance were nulled,
and data were acquired at 10 kHz with an AxoClamp2A amplier and
pClamp 9.2 software (Molec ular Dev ices). Electrical eld stimulation was
performed using two platinum electrodes coupled to a Grass SD9 stimulator
(Grass Technologies). For analysis, data were ltered ofine using a low-
pass Gaussian lter with a cutoff frequency of 2 kHz.
Statistics. Data are presented as mean ± SEM. The statistical signicance
of differences b etween two groups was determined by two-tailed Stu-
dents t test. A KruskalWallis t est and Dunns posttest were used for
statistical compari sons of electrophysiology data. P < 0.05 wa s considered
statistically signicant.
ACKNOWLEDGMENTS. We thank Yue Wu, David Johnson, and Matt Tomai
for additional exp erime ntal ass istance. This work was supported by National
Institutes of Health Grants R01 EB007534 and U01 HL099773 and National Science
Foundation Emerging Frontiers in Research and Innovation Grant 0735903.
1. Thomson JA, et al. (1998) Embryonic stem cell lines derived from human blastocysts.
Science 282:11451147.
2. Yu J, et al. (2007) Induced pluripotent stem cell lines derived from human somatic
cells. Science 318:19171920.
3. Takahashi K, et al. (2007) Induction of pluripotent stem cells from adult human
broblasts by dened factors. Cell 131:861872.
4. Graichen R, et al. (2008) Enhanced cardiomyogenesis of human embryonic stem cells
by a small molecular inhibitor of p38 MAPK. Differentiation 76:357370.
5. Yang L, et al. (2008) Human cardiovascular progenitor cells develop from a KDR+
embryonic-stem-cell-derived population. Nature 453:524528.
6. Kattman SJ, et al. (2011) Stage-specic optimization of activin/nodal and BMP
signaling promotes cardiac differentiation of mouse and human pluripotent stem cell
lines. Cell Stem Cell 8:228240.
7. Dubois NC, et al. (2011) SIRPA is a specic cell-surface marker for isolating
cardiomyocytes derived from human pluripotent stem cells. Nat Biotechnol 29:
10111018.
8. Laamme MA, et al. (2007) Cardiomyocytes derived from human embryonic stem cells
in pro-survival factors enhance function of infarcted rat hearts. Nat Biotechnol 25:
10151024.
9. Paige SL, et al. (2010) Endogenous Wnt/beta-catenin signaling is required for cardiac
differentiation in human embryonic stem cells. PLoS ONE 5:e11134.
10. Marvin MJ, Di Rocco G, Gardiner A, Bush SM, Lassar AB (2001) Inhibition of Wnt
activity induces heart formation from posterior mesoderm. Genes Dev 15:316327.
11. Ueno S, et al. (2007) Biphasic role for Wnt/beta-catenin signalin g in cardiac
specication in zebrash and embryonic stem cells. Proc Natl Acad Sci USA 104:
96859690.
E1856
|
www.pnas.org/cgi/doi/10.1073/pnas.1200250109 Lian et al.
Page 9
12. Naito AT, et al. (2006) Developmental stage-specic biphasic roles of Wnt/beta-
catenin signaling in cardiomyogenesis and hematopoiesis. Proc Natl Acad Sci USA 103:
1981219817.
13. Fuerer C, Nusse R (2010) Lentiviral vectors to probe and manipulate the Wnt signaling
pathway. PLoS ONE 5:e9370.
14. Anton R, Kestler HA, Kühl M (2007) Beta-catenin signaling contributes to stemness
and regulates early differentiation in murine embryonic stem cells. FEBS Lett 581:
52475254.
15. Takao Y, Yokota T, Koide H (2007) Beta-catenin up-regulates Nanog expression
through interaction with Oct-3/4 in embryonic stem cells. Biochem Biophys Res
Commun 353:699705.
16. Sato N, Meijer L, Skaltsounis L, Greengard P, Brivanlou AH (2004) Maintenance of
pluripotency in human and mouse embryonic stem cells through activation of Wnt
signaling by a pharmacological GSK-3-specic inhibitor. Nat Med 10:5563.
17. Dravid G, et al. (2005) Dening the role of Wnt/beta-catenin signaling in the survival,
proliferation, and self-renewal of human embryonic stem cells. Stem C ells 23:
14891501.
18. Bu L, et al. (2009) Human ISL1 heart progenitors generate diverse multipotent
cardiovascular cell lineages. Nature 460:113117.
19. Qyang Y, et al. (2007) The renewal and differentiation of Isl1+ cardiovascular
progenitors are controlled by a Wnt/beta-catenin pathway. Cell Stem Cell 1:165179.
20. Elliott DA, et al. (2011) NKX2-5(eGFP/w) hESCs for isolation of human cardiac
progenitors and cardiomyocytes. Nat Methods 8:10371040.
21. Willems E, et al. (2011) Small-molecule inhibitors of the Wnt pathway potently
promote cardiomyocytes from human embryonic stem cell-derived mesoderm. Circ
Res 109:360364.
22. Wang H, Hao J, Hong CC (2011) Cardiac induction of embryonic stem cells by a small
molecule inhibitor of Wnt/β-catenin signaling. ACS Chem Biol 6:192197.
23. Ren Y, et al. (2011) Small molecule Wnt inhibitors enhance the efciency of BMP-4-
directed cardiac differentiation of human pluripotent stem cells. J Mol Cell Cardiol 51:
280287.
24. Tran TH, et al. (2009) Wnt3a-induced mesoderm formation and cardiomyogenesis in
human embryonic stem cells. Stem Cells 27:18691878.
25. Nakanishi M, et al. (2009) Directed induction of anterior and posterior primitive
streak by Wnt from embryonic stem cells cultured in a chemically dened serum-free
medium. FASEB J 23:114
122.
26. Davis RP, et al. (2008) Targeting a GFP reporter gene to the MIXL1 locus of human
embryonic stem cells identies human primitive streak-like cells and enables isolation
of primitive hematopoietic precursors. Blood 111:18761884.
27. Lints TJ, Parsons LM, Hartley L, Lyons I, Harvey RP (1993) Nkx-2.5: A novel murine
homeobox gene expressed in early heart progenitor cells and their myogenic
descendants. Development 119:969.
28. Bruneau BG, et al. (1999) Chamber-specic cardiac expression of Tbx5 and heart
defects in Holt-Oram syndrome. Dev Biol 211:100108.
29. Kuo CT, et al. (1997) GATA4 transcription factor is required for ventral morphogenesis
and heart tube formation. Genes Dev 11:10481060.
30. Edmondson DG, Lyons GE, Martin JF, Olson EN (1994) Mef2 gene expression marks
the cardiac and skeletal muscle lineages during mouse embryogenesis. Development
120:12511263.
31. Ieda M, et al. (2010) Direct reprogramming of broblasts into functional cardiomyocytes
by dened factors. Cell 142:375386.
32. Smart N, et al. (2011) De novo cardiomyocytes from within the activated adult heart
after injury. Nature 474:640644.
33. Kubalak SW, Miller-Hance WC, OBrien TX, Dyson E, Chien KR (1994) Chamber
specication of atrial myosin light chain-2 expression precedes septation during
murine cardiogenesis. J Biol Chem 269:1696116970.
34. Segev H, et al. (2005) Molecular analysis of cardiomyocytes derived from human
embryonic stem cells. Dev Growth Differ 47:295306.
35. Franco D, et al. (1999) Myosin light chain 2a and 2v identies the embryonic outow
tract myocardium in the developing rodent heart. Anat Rec 254:135146.
36. He JQ, Ma Y, Lee Y, Thomson JA, Kamp TJ (2003) Human embryonic stem cells
develop into multiple types of cardiac myocytes: Action potential characterization.
Circ Res 93:3239.
37. Zhang J, et al. (2009) Functional cardiomyocytes derived from human induced
pluripotent stem cells. Circ Res 104:e30e41.
38. Inman GJ, et al. (2002) SB-431542 is a potent and specic inhibitor of transforming
growth factor-beta superfamily type I activin receptor-like kinase (ALK) receptors
ALK4, ALK5, and ALK7. Mol Pharmacol 62:6574.
39. Hao J, et al. (2010) In vivo structure-activity relationship study of dorsomorphin
analogues identi
es selective VEGF and BMP inhibitors. ACS Chem Biol 5:245253.
40. Chen B, et al. (2009) Small molecule-mediated disruption of Wnt-dependent signaling
in tissue regeneration and cancer. Nat Chem Biol 5:100107.
41. Davidson KC, et al. (2012) Wnt/β-catenin signaling promotes differentiation, not self-
renewal, of human embryonic stem cells and is repressed by Oct4. Proc Natl Acad Sci
USA 109:44854490.
42. Kouskoff V, Lacaud G, Schwantz S, Fehling HJ, Keller G (2005) Sequential development
of hematopoietic and cardiac mesoderm during embryonic stem cell differentiation.
Proc Natl Acad Sci USA 102:1317013175.
43. Zhang Q, et al. (2011) Direct differentiation of atrial and ventricular myocytes from
human embryonic stem cells by alternating retinoid signals. Cell Res 21:579587.
44. Lin T, et al. (2009) A chemical platform for improved induction of human iPSCs. Nat
Methods 6:805808.
45. Ichida JK, et al. (2009) A small-molecule inhibitor of tgf-Beta signaling replaces sox2 in
reprogramming by inducing nanog. Cell Stem Cell 5:491503.
46. McLean AB, et al. (2007) Activin a efciently species denitive endoderm from
human embryonic stem cells only when phosphatidylinositol 3-kinase signaling is
suppressed. Stem Cells 25:2938.
47. Borowiak M, et al. (2009) Small molecules efciently direct endodermal differentiation
of mouse and human embryonic stem cells. Cell Stem Cell 4:348358.
48. Murry CE, Keller G (2008) Differentiation of embryonic stem cells to clinically relevant
populations: Lessons from embryonic development. Cell 132:661680.
49. Yu J, et al. (2009) Human induced pluripotent stem cells free of vector and transgene
sequences. Science 324:797801.
50. Xu C, et al. (2001) Feeder-free growth of undifferentiated human embryonic stem
cells. Nat Biotechnol 19:971974.
Lian et al. PNAS
|
Published online May 29, 2012
|
E1857
CELL BIOLOGY PNAS PLUS
Page 10
  • Source
    • "iPSCs were differentiated into iPS-CM using the WNT modulation-differentiation method (Lian et al., 2012) (Figure S5A). Briefly, iPSCs were seeded at 1.25– 2.5x10 4 cells/cm 2 onto cell-culture plates coated with 80 µg/µl growth factorreduced Matrigel (BD Biosciences) in mTeSR supplemented with 10 µM Y-27632 (Selleckchem) for 24 h (day –3). "
    Full-text · Dataset · Apr 2016
  • Source
    • "To determine this, we prepared primary cell cultures of the sinus node cells from right atrium. Initially, the isolated right atria cells had both Tbx3 (sinus node marker) [24] and MLC2A (atrial cardiomyocyte marker) (Fig. 2A) [25, 26]. Following FBS incubation for 3 days, only Tbx3 expressed cells were occupied and incubated with Ang II or phosphate buffered saline (PBS) for 5 more days. "
    [Show abstract] [Hide abstract] ABSTRACT: Kaempferol exerts cardioprotective actions through incompletely understood mechanisms. This study investigated the molecular mechanisms underlying the cardioprotective effects of kaempferol in sinus node dysfunction (SND) heart. Here, we demonstrate that angiotensin II (Ang II) infusion causes SND through oxidized calmodulin kinase II (CaMKII). In contrast to this, kaempferol protects sinus node against Ang II-induced SND. Ang II evoked apoptosis with caspase-3 activation in sinus nodal cells. However, kaempferol lowered the CaMKII oxidization and the sinus nodal cell death. To block the CaMKII oxidization, gene of p47phox, a cytosolic subunit of NADPH oxidase, was deleted using Cas9 KO plasmid. In the absence of p47phox, sinus nodal cells were highly resistance to Ang II-induced apoptosis, suggesting that oxidized-CaMKII contributed to sinus nodal cell death. In Langendorff heart from Ang II infused mice, kaempferol preserved normal impulse formation at right atrium. These data suggested that kaempferol protects sinus node via inhibition of CaMKII oxidization and may be useful for preventing SND in high risk patients.
    Full-text · Article · Jan 2016 · Anatomy & cell biology
  • Source
    • "Furthermore, our data highlight the impact of the combined BMP/WNT signaling input on cell lineage induction in general (Figure 2F). Notably, this pronounced cooperativity is not at odds with alternative cardiac differentiation protocols that rely either on BMP or WNT activation (Burridge et al., 2012; Lian et al., 2012 ). Rather, we propose that single-factor-based protocols present extreme cases of the more general corridor model introduced here. "
    [Show abstract] [Hide abstract] ABSTRACT: Cardiac induction requires stepwise integration of BMP and WNT pathway activity. Human embryonic stem cells (hESCs) are developmentally and clinically relevant for studying the poorly understood molecular mechanisms downstream of these cascades. We show that BMP and WNT signaling drive cardiac specification by removing sequential roadblocks that otherwise redirect hESC differentiation toward competing fates, rather than activating a cardiac program per se. First, BMP and WNT signals pattern mesendoderm through cooperative repression of SOX2, a potent mesoderm antagonist. BMP signaling promotes miRNA-877 maturation to induce SOX2 mRNA degradation, while WNT-driven EOMES induction transcriptionally represses SOX2. Following mesoderm formation, cardiac differentiation requires inhibition of WNT activity. We found that WNT inhibition serves to restrict expression of anti-cardiac regulators MSX1 and CDX2/1. Conversely, their simultaneous disruption partially abrogates the requirement for WNT inactivation. These results suggest that human cardiac induction depends on multi-stage repression of alternate lineages, with implications for deriving expandable cardiac stem cells.
    Full-text · Article · Dec 2015 · Cell stem cell
Show more