Article

Acquisition Order of Ras and p53 Gene Alterations Defines Distinct Adrenocortical Tumor Phenotypes

Institut National de la Santé et de la Recherche, Unité 1036, Grenoble, France.
PLoS Genetics (Impact Factor: 7.53). 05/2012; 8(5):e1002700. DOI: 10.1371/journal.pgen.1002700
Source: PubMed

ABSTRACT

Sporadic adrenocortical carcinomas (ACC) are rare endocrine neoplasms with a dismal prognosis. By contrast, benign tumors of the adrenal cortex are common in the general population. Whether benign tumors represent a separate entity or are in fact part of a process of tumor progression ultimately leading to an ACC is still an unresolved issue. To this end, we have developed a mouse model of tumor progression by successively transducing genes altered in adrenocortical tumors into normal adrenocortical cells. The introduction in different orders of the oncogenic allele of Ras (H-Ras(G12V)) and the mutant p53(DD) that disrupts the p53 pathway yielded tumors displaying major differences in histological features, tumorigenicity, and metastatic behavior. Whereas the successive expression of Ras(G12V) and p53(DD) led to highly malignant tumors with metastatic behavior, reminiscent of those formed after the simultaneous introduction of p53(DD) and Ras(G12V), the reverse sequence gave rise only to benign tumors. Microarray profiling revealed that 157 genes related to cancer development and progression were differentially expressed. Of these genes, 40 were up-regulated and 117 were down-regulated in malignant cell populations as compared with benign cell populations. This is the first evidence-based observation that ACC development follows a multistage progression and that the tumor phenotype is directly influenced by the order of acquisition of genetic alterations.

Full-text

Available from: Jean-Jacques Feige
Acquisition Order of Ras and p53 Gene Alterations
Defines Distinct Adrenocortical Tumor Phenotypes
Maryline Herbet
1,2,3
, Aude Salomon
1,2,3
, Jean-Jacques Feige
1,2,3
, Michae
¨
l Thomas
1,2,3
*
1 Institut National de la Sante
´
et de la Recherche, Unite
´
1036, Grenoble, France, 2 Commissariat a
`
l’E
´
nergie Atomique, Institut de Recherches en Technologies et Sciences
pour le Vivant, Biologie du Cancer et de l’Infection, Grenoble, France, 3 Universite
´
Joseph Fourier-Grenoble I, Grenoble, France
Abstract
Sporadic adrenocortical carcinomas (ACC) are rare endocrine neoplasms with a dismal prognosis. By contrast, benign
tumors of the adrenal cortex are common in the general population. Whether benign tumors represent a separate entity or
are in fact part of a process of tumor progression ultimately leading to an ACC is still an unresolved issue. To this end, we
have developed a mouse model of tumor progression by successively transducing genes altered in adrenocortical tumors
into normal adrenocortical cells. The introduction in different orders of the oncogenic allele of Ras (H-Ras
G12V
) and the
mutant p53
DD
that disrupts the p53 pathway yielded tumors displaying major differences in histological features,
tumorigenicity, and metastatic behavior. Whereas the successive expression of Ras
G12V
and p53
DD
led to highly malignant
tumors with metastatic behavior, reminiscent of those formed after the simultaneous introduction of p53
DD
and Ras
G12V
, the
reverse sequence gave rise only to benign tumors. Microarray profiling revealed that 157 genes related to cancer
development and progression were differentially expressed. Of these genes, 40 were up-regulated and 117 were down-
regulated in malignant cell populations as compared with benign cell populations. This is the first evidence-based
observation that ACC development follows a multistage progression and that the tumor phenotype is directly influenced by
the order of acquisition of genetic alterations.
Citation: Herbet M, Salomon A, Feige J-J, Thomas M (2012) Acquisition Order of Ras and p53 Gene Alterations Defines Distinct Adrenocortical Tumor
Phenotypes. PLoS Genet 8(5): e1002700. doi:10.1371/journal.pgen.1002700
Editor: H. Leighton Grimes, Cincinnati Children’s Hospital Medical Center, United States o f America
Received September 23, 2011; Accepted March 26, 2012; Published May 10, 2012
Copyright: ß 2012 Herbet et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits
unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: This work was supported by INSERM (U1036), CEA (DSV/iRTSV/LAPV), Fondation de France (research grant 2004012837 to MT), Association pour la
Recherche sur le Cancer (research grant 5106 to MT), and Programme Hospitalier de Recherche Clinique (Grant AOM 06179) to the COMETE Network. MH was
supported by a doctoral grant from the Mini ste
`
re De
´
le
´
gue
´
a
`
la Recherche et aux Nouvelles Technologies. The funders had no role in study design, data collection
and analysis, decision to publish, or preparation of the manuscript.
Competing Interests: The authors have declared that no competing interests exist.
* E-mail: michael.thomas@cea.fr
Introduction
Cancer is an heterogeneous disease. Thus, tumors in different
organs display markedly different clinical behaviors and tumors
that arise in a single tissue can even exhibit an array of pathologies,
ranging from benign adenomas to highly invasive malignancies
[1,2]. The phenotypic diversity observed in neoplastic tumors has
been generally ascribed to the deregulation of multiple signal
transduction pathways. However, it remains unclear for most
cancers which genetic alterations in a cell or group of cells play a
causative role in tumor initiation and progression, and which ones
represent bystanders with no selective advantage. Cellular
transformation is a process where a normal cell accumulates
mutations, as well as epigenetic changes, that activate oncogenes
or down-regulate tumor suppressor genes to give rise to a clonal
expansion of a subset of transformed cells, independently of both
external and internal signals that normally control cell growth [3].
This general concept of multistage tumorigenesis has been
demonstrated in the case of the colon cancer where distinct
histological stages are directly correlated with genetic alterations in
key tumor suppressors and oncogenes. Most adenomatous polyps
of the colon, even though they are the precursors of invasive
cancer, never actually progress to that stage [4,5]. Thus, clinically
the occurrence of benign tumors is much more frequent than
carcinomas.
Sporadic adrenocortical carcinomas (ACCs) are rare endocrine
neoplasms in humans, notorious for their aggressive behavior,
metastatic potential and poor outcome [6] with an estimated
worldwide annual incidence of 2 per million in adults [7]. By
contrast, benign adrenocortical adenomas (ACAs) are rather
common in the general population (present in 2.3% of persons
at autopsy [8]). Moreover, the availability of high-resolution
imaging modalities has resulted in an increase of the detection of
adrenal masses of which cortical adenomas represent 52% of the
surgically resected incidental tumors [9]. Whether ACAs represent
a separate entity or are in fact part of a process of tumor
progression leading to the emergence of ACC is still an open
question, however these numbers are consistent with the
hypothesis that only a very small fraction of ACAs may progress
to cancer upon the accumulation of additional changes. Although
the direct progression of benign adrenocortical tumors to
malignant carcinomas has not been clearly demonstrated, the
best evidence for a multistage adrenal tumorigenesis comes from
two clinical cases where a localized tumor was found to be
composed of a benign part surrounded by a malignant area
[10,11]. Progress into the elucidation of the genes and pathways
involved in the pathogenesis of sporadic ACC has been slower
than that for most other cancers, largely because of the rarity of
this tumor [12]. Nevertheless it has been shown that TP53 somatic
mutations are present in about 30% of sporadic adult ACCs and
PLoS Genetics | www.plosgenetics.org 1 May 2012 | Volume 8 | Issue 5 | e1002700
Page 1
almost never in ACAs [12] whereas, activating mutations of N-Ras
gene have been observed in both benign and malignant adrenal
cortical neoplasms with an incidence of 12.5% [13]. In addition, a
suitable animal model for unraveling the role of a given genetic
alteration and its possible cooperation with other gene defects in
the pathogenesis of the disease has also been lacking.
We have previously determined that the sequential introduc-
tions of the catalytic subunit of the human telomerase, the simian
virus 40 large T (LT) and an oncogenic allele of Ras (H-Ras
G12V
)
suffice to transform normal bovine adrenocortical (BAC) cells into
tumorigenic cells, when transplanted beneath the kidney capsule of
SCID mice [14]. Our data suggested that a limited number of
genetic alterations cooperate to transform long-lived mammalian
adrenocortical cells. We sought now to develop an in vivo system
for the neoplastic transformation of primary BAC cells in order to
reveal a minimal set of genes that had been recognized to be
altered in human adrenocortical tumors (ACT) and to study the
influence of each of these genetic alterations taken separately on
the pathogenesis of the disease.
Here, we report that the simultaneous disruption of the p53
pathway by using a truncated form of the protein, p53
DD
, which
acts as a dominant-negative [15] and the Ras pathway through the
stable expression of an active Ras protein (H-Ras
G12V
) [16] is
sufficient to transform normal BAC cells into a tumorigenic state.
Strikingly, we show, using our in vivo tissue reconstruction model,
that the order of acquisition of genetic mutations is a critical
determinant in the outcome of tumor development and aggres-
siveness.
Results
Expression of Ras
G12V
and p53
DD
in BAC cells alters their
growth properties in culture
The primary BAC cells were infected simultaneously with two
replication-defective amphotropic retroviruses based on Moloney
murine leukemia virus (MoMLV) expressing either p53
DD
[17] or
H-Ras
G12V
[18], each encoding a drug selection marker, hygro-
mycin and neomycin, respectively. Following infection, the cells
were selected for 7 days by supplementing the culture medium
with both antibiotics. At the end of the selection process, we
established a polyclonal population termed p53
DD
/Ras
G12V
(PR)
cells (Figure 1A). Two parallel cultures of primary BAC cells were
infected simultaneously either with a retrovirus expressing p53
DD
(P) and a control pLNCX2 (pL) retrovirus, or with a retrovirus
expressing H-Ras
G12V
(R) and a control pBabe-Hygro (pB)
retrovirus. Thus, we generated two control populations termed P
and R, respectively (Figure 1A).
We first confirmed that the three polyclonal BAC cell
populations transduced with p53
DD
(P), Ras
G12V
(R) or both
p53
DD
and Ras
G12V
(PR) expressed the desired transgenes
(Figure 1B). Then the cells were assayed for the expression of
the desired transgenes by immunoblot analysis. We found that the
resulting polyclonal cell populations expressed similar amounts of
Ras
G12V
and p53
DD
proteins (Figure 1C) The replication of pL, R
and P cells ceased at high density suggesting that these cells were
still sensitive to contact inhibition (Figure 1D), a regulatory
mechanism through which cells enter a stage of reversible G1
arrest [19]. On the contrary, PR cells did not demonstrate any
decrease in cell proliferation at high cell density (Figure 1D) and
formed multilayered foci in culture (data not shown), a phenom-
enon commonly associated with malignant transformation [19].
Thus, infection of adrenocortical cells with the combination of
p53
DD
and Ras
G12V
dramatically increased the proliferation rate
in comparison to infection with either p53
DD
or Ras
G12V
alone
(Figure 1D). We also studied the proliferation by determining the
percentage of Ki-67 positive cells in each cell population. In
serum-supplemented medium, each of these populations displayed
a similar percentage of cells engaged in the cell cycle (Figure 1E).
However, in the absence of serum, only cells transduced with
Ras
G12V
and p53
DD
proliferated independently from extrinsic
mitogens. Conversely, pL and P cells required mitogens for their
proliferation, whereas R cells exhibited a reduced dependence to
growth factors (Figure 1E). Therefore, in cells with defective p53
signaling, oncogenic Ras is able to partially substitute for a
mitogenic signal. Finally, the PR cell population and the two
control cell populations P and R were seeded in soft agar to assay
for anchorage-independent growth. Whereas expression of p53
DD
was unable to support anchorage-independent growth of adreno-
cortical cells, cells expressing Ras
G12V
formed small abortive
colonies characteristic of transit-amplifying cells (Table 1). Only
the expression of both p53
DD
and Ras
G12V
led to robust cell
growth in soft agar (Table 1).
We thus concluded from these experiments that PR cells were
transformed since they displayed all the in vitro characteristics
ascribed to tumor cells, i.e. loss of contact inhibition in culture,
proliferation in the absence of extrinsic mitogens and in the
absence of anchorage.
Rapid tumor induction by BAC cells expressing Ras
G12V
and p53
DD
Although mutation or overexpression of genes such as TP53 and
Ras are detected in human adrenocortical tumors [20], it is not
known whether these genetic changes must occur in combination
to induce tumor growth. We then wondered whether these two
genetic changes are sufficient to endow BAC cells with the ability
to form adrenocortical carcinoma in vivo.
When the PR cells were transplanted beneath the subrenal
capsule (SRC) of adrenalectomized SCID mice, the rate of tumor
formation was 100% and no latency period was observable
suggesting that the microenvironment provided by the SRC was
favorable to tumor development. This was obvious on sections of
the grafts taken on day 8, 14 and 21 (Figure S1). The transplanted
PR cells produced continuously expanding tumor masses, which
first protruded from the site of transplantation and finally
destroyed the kidney (Figure S1A, S1B). Eight days after cell
transplantation, the xenografts formed a solid tissue structure on
the kidney surface (Figure S1B). Invasive characteristics of the
Author Summary
A sequential acquisition of genetic events is critical in
tumorigenesis, and a dysregulation of a limited set of
pathways has been demonstrated as sufficient to progres-
sively transform normal cells into tumor cells in several
human tissues. However, in the case of adrenocortical
tumorigenesis, whether benign tumors represent a sepa-
rate entity or are in fact part of a process of tumor
progression leading ultimately to an adrenal carcinoma is
still an unresolved issue. Moreover, the importance of the
order in which these genetic events must occur to
transform a cell has not been established. Here, we
developed a tissue reconstruction model in mice that
allows direct comparison of cells modified with sequential
introduction of two genetic events. This revealed that
adrenocortical tumor development follows a multistage
progression and that the tumor phenotype, including
histopathology and metastatic behavior, is directly influ-
enced by the order of acquisition of genetic alterations.
Mutational Event Order Affects Tumor Phenotype
PLoS Genetics | www.plosgenetics.org 2 May 2012 | Volume 8 | Issue 5 | e1002700
Page 2
Mutational Event Order Affects Tumor Phenotype
PLoS Genetics | www.plosgenetics.org 3 May 2012 | Volume 8 | Issue 5 | e1002700
Page 3
tumors were evidenced by day 14, as they infiltrated the adjacent
kidney parenchyma (Figure S1B, S1C) and by day 21, the
neighboring tissues, skeletal muscle and adipose tissue (Figure
S1D, S1E). Ultimately, by day 35, the kidney was destroyed
(Figure 2A, 2B) and the adjacent tissues and organs (fat, muscle
and pancreas) were invaded (Figure 2H–2J). The tumors were
poorly differentiated carcinomas composed of eosinophilic cells
with high nuclear grade, high mitotic activity and prominent
nucleoli. Necrosis, a typical histopathological marker of malig-
nancy was commonly observed in tumors at day 35 (Figure 2C).
Rare apoptotic cells were detected in these tumors (Figure 2G).
Examination of Ki-67 expression showed that the cells had a very
high proliferation rate which was sustained over time (Figure S1C;
Figure 2F and Table 2). Ras and p53 antibodies showed strong
staining throughout the tumor, confirming the long term
expression of the transgenes (Figure S1D, S1E; Figure 2D, 2E).
Metastases are responsible for 90% of deaths from solid tumors
and arise following the spread of cancer cells from the primary site
and the formation of new tumors in distant organs. The metastatic
process comprises a series of steps including angiogenesis and
lymphangiogenesis, which allow the tumor cells to escape the
confines of the primary tumor [21]. Moreover, the formation of
new blood vessels is an almost absolute requirement in the early
development of tumors by providing oxygen and nutrients to the
cells. We consistently observed a dense vascular network on the
surface of the PR masses that was confirmed on tissue sections by
immunofluorescence with an antibody against CD31 (Figure 2K).
At day 35, it was clear from gross appearance that the primary
tumor had spread to intraperitoneal organs. Metastatic sites
included spleen, diaphragm, abdominal muscle and mesentery
(Figure 2M). Most of the metastases grew on the surface of the
organs (Figure 2M) and the cells forming the metastases were
issued from the PR primary tumors as demonstrated by Ras and
p53 expression (Figure 2N, 2O). As recent experimental studies
and clinicopathological reports suggest that tumor lymphangio-
genesis can promote tumor spread through the secretion of
lymphangiogenic growth factors [21,22], we investigated the
presence of lymphatic vessels in primary tumors by immunoflu-
orescence staining for LYVE-1 (lymphatic vessel endothelial
hyaluronan receptor-1), a specific marker of lymphatic endothelial
cells [23]. At the time when metastases were detected, numerous
lymphatics were present in the tumor (Figure 2K), suggesting that
the spread of tumor cells might occur through de novo development
of a lymphatic network.
Adrenalectomized animals bearing transplanted cells lived well
until they are sacrificed, demonstrating that the cells were
functional and produced cortisol (data not shown). The mouse
glucocorticoid, corticosterone, was replaced in plasma by the
bovine glucocorticoid, cortisol. Cortisol levels gave an unambig-
uous measure of the function of the transplanted cells because
mice lack expression of the steroid-17a-hydroxylase in the adrenal
cortex, thus resulting in the biosynthesis of corticosterone rather
than cortisol. In addition to cortisol production, we wanted to
ascertain that the tumors and metastases were formed from BAC
cells transformed by the transduction of p53
DD
and Ras
G12V
and
not from cells such as fibroblasts or other stromal cells possibly
contaminating the primary culture. Immunohistochemical analysis
of the tumors for the expression of the steroid-converting enzyme
3-b-hydroxy-D5-steroid dehydrogenase/isomerase-1 type II
(3bHSD) involved in cortisol biosynthesis showed that most if
not all tumor cells were positively stained (Figure 2L), consistent
with the steroidogenic origin of the initial cells.
The formation of malignant tumors by cells expressing only
Ras
G12V
and p53
DD
was unexpected since it has been previously
shown that adrenocortical cells require at least the ablation of two
tumor suppressor genes (p53 and Rb through the expression of LT
antigen) and the mutation of one oncogene (expression of
Ras
G12V
) to undergo transformation [24]. To rule out the
possibility that mutations other than the introduction of Ras
G12V
and p53
DD
occurred during the process of engineering the PR cells,
we ensured to keep our population polyclonal, to reduce the
period in culture for its generation as short as possible and to
produce three independent other PR polyclonal populations from
primary BAC cells. Following transplantation, tumors formed in
100% of the injected mice and all tumors were highly neoplastic,
poorly differentiated and invaded the adjacent kidney and organs
(data not shown). Since it is unlikely that all three polyclonal cell
populations have acquired the same mutation that was essential for
tumorigenesis, we can conclude that the malignant potential of the
cell population is a property of transduced PR cells in general
rather than the result of an overgrowth of a minor subpopulation.
So, the simultaneous alteration of both p53 and Ras pathways is
sufficient to fully transform primary BAC cells and form metastatic
ACC when transplanted beneath the SRC of mice.
p53
DD
or Ras
G12V
alone are not sufficient to transform
BAC cells into a tumorigenic state
Next, we analyzed the phenotype of tissues resulting from
implantation of cells that had been singly transduced with p53
DD
or Ras
G12V
retroviruses. Following transplantation, P cells formed a
small tissue spread between the kidney parenchyma and the
capsule (Figure 3A). P tissue presented a uniform structure of
regular eosinophilic adrenocortical cells without invasion in the
renal parenchyma (Figure 3B). Examination of Ki-67 expression in
tissue sections showed that the transplanted cells had a low
proliferation rate (4.6%, Figure 3D; Table 2). In contrast, R cells
Figure 1.
In vitro
characterization of BAC cells transduced simultaneously with p53
DD
and Ras
G12V
. A, summary of the experimental
design for the generation of stably infected cell populations. B, detection of Ras
G12V
and p53
DD
by RT-PCR in adrenocortical PR, P, R and pL cells. Total
RP-L27 acts as loading control. C, Confirmation of protein expression by immunoblotting of PR, R, P and pL cells. Actin served as a loading control. D,
growth curves of PR, R, P and pL cells. The in vitro cell proliferation rates were obtained by counting cells from triplicate cell culture dishes every day.
Points, mean; bars, SD. E, asynchronous populations of BAC cells were cultured in normal culture medium or in defined medium containing 0.1% FCS.
The percentage of cells engaged into the cell cycle was determined by measuring the Ki-67 labeling index. Bars, SD.
doi:10.1371/journal.pgen.1002700.g001
Table 1. Anchorage-independent growth of the
adrenocortical cells expressing the indicated transgenes.
Soft Agar assay
PR 19165
P0
R4763
R+P10662
P+R3662
The number of soft agar colonies was determined 3 weeks after 5610
3
cells
were seeded. Results are expressed as the mean 6 SD of three determinations
in three distinct experiments.
doi:10.1371/journal.pgen.1002700.t001
Mutational Event Order Affects Tumor Phenotype
PLoS Genetics | www.plosgenetics.org 4 May 2012 | Volume 8 | Issue 5 | e1002700
Page 4
Mutational Event Order Affects Tumor Phenotype
PLoS Genetics | www.plosgenetics.org 5 May 2012 | Volume 8 | Issue 5 | e1002700
Page 5
gave rise to a voluminous tissue with no sign of invasion
(Figure 3A). The R cells had formed an heterogeneous benign
expanding tumor with an irregular architecture, cellular pleomor-
phism and some nuclear atypia (Figure 3B). We confirmed by p53
and Ras expression that these phenotypes were due to the
expression of the transgenes (Figure 3C). The proliferation rate of
the R cells in the transplants was intermediate between that
measured in P tissues and in PR tissues (18.7%, Figure 4D;
Table 2). Both P and R tissues were vascularized and interestingly,
no lymphatics were detected consistent with the absence of the
occurrence of metastases in the recipient mice (Figure 3E). Finally,
the P and R tissues were functional as probed by cortisol
production (data not shown) and by the detection of 3bHSD
(Figure 3F), consistent as described above with the adrenal origin
of the initial cells.
The order of acquisition of genetic alterations is a critical
determinant of the tumor phenotype
Simultaneous activation of the Ras oncogene and inactivation of
the p53 tumor suppressor deregulate the transcriptional programs
and confer PR adrenocortical cells a tumorigenic potential when
transplanted into mice. However, the exact importance of the
order of acquisition of these genetic events on the tumor
phenotype has not yet been clearly established. It was proposed
that multiple alternative genetic pathways may lead to the
formation of a primary tumor and that the characteristics of a
tumor may vary as a function of the activated pathway [25]. To
address this important issue, primary cells were successively
transduced with two retroviruses, allowing between 5 to 7 days of
selection after each infection. Thus, singly transduced R cells were
infected with p53
DD
retroviruses (R+P) and conversely, singly
transduced P cells were infected with Ras
G12V
retroviral particles
(P+R) (Figure 4A). The controls for each doubly transduced cell
were prepared by using the empty vector used to clone the second
transgene (pL or pB), establishing two populations termed P+pL
and R+pB (Figure 4A). We also generated from primary
adrenocortical cells a control cell population transduced with
both empty vectors (pL+pB). Following appropriate antibiotic
selection, the five resultant polyclonal cell populations were
confirmed to express the desired transgenes with the exception
of the pL+pB cells which did not express either one (Figure 4B).
Importantly, the expression levels of the products of the
introduced genes were comparable (Figure 4C).
The P+pL and R+pB control cell populations were indistin-
guishable from their singly infected P and R counterparts in terms
of proliferative capacity and in their ability to form steroidogenic
tissues once transplanted (Figure 4D; data not shown). Interest-
ingly, the longer time in culture required for efficient selection did
not alter the phenotype expressed by these cells, suggesting that no
additional genetic changes had appeared during the process of
generating these cells. The expression of constitutively active Ras
followed by inactivation of wild-type p53 conferred to the cells a
proliferation capacity similar to the PR cells (Figure 4D). On the
contrary, the reverse order of gene transduction resulted in a
marked reduction in the cell proliferation capacity (Figure 4D). To
further characterize these cells, cell proliferation was determined
by the percentage of Ki-67
+
cells in each cell population. The R+P
cell population maintained in 0.1% FCS-medium displayed a
percentage of cells engaged in the cell cycle close to the percentage
measured in PR cells, suggesting an almost complete indepen-
dence from extrinsic mitogens for proliferation (Figure 4E).
Conversely, the P+R cells exhibited a reduced proliferation index
in the absence of mitogens and thus, a stronger dependence to
growth factors (Figure 4E). Therefore, in cells with defective p53
signaling, oncogenic Ras, as a second genetic hit, is not able to
totally substitute for a mitogenic signal. When the respective
abilities of the R+P and P+R cells to form colonies in soft agar
were compared, R+P cells were as efficient as the PR cells whereas
the P+R cells were unable to grow, just like the R cells (Table 1).
We then concluded from these in vitro experiments that R+P cells
were transformed similarly to the PR cells.
The transplantation of R+P cells resulted in highly neoplastic
(Figure 5A, 5B), proliferative (Figure 5C) and poorly differentiated
tumors that invaded the kidney parenchyma and adjacent organs
such as muscle, pancreas and adipose tissue (data not shown). At
the time of necropsy, the primary tumors spread from the kidney
to the spleen, abdominal muscle, intestinal mesentery and
diaphragm (Figure 5G–5J). Therefore, R+P cells were as potent
as PR cells to induce the formation of a metastatic adrenocortical
carcinoma. In contrast, the tissues formed following the trans-
plantation of P+R cells were benign tumors with no signs of kidney
parenchyma invasion (Figure 5A, 5B) or metastases. The number
of Ki-67
+
cells was lower than in the R+P tumors (Figure 5C). This
milder phenotype in P+R tissues could not be due to a difference
in the level of expression of both transgenes as the levels of
expression of p53
DD
and Ras
G12V
detected by immunohistochem-
istry were very similar in PR, R+P and P+R (Figure 5D, 5E).
When the respective ability of R+P and P+R tissues to develop
Figure 2. Malignant behavior of PR cells in the subrenal capsule assay. A, appearance of a representative entire tumor mass resulting from
growth of transplanted PR cells at day 35. B, the tumors were cut transversally and photographed, together with the host animal kidney. C–G, H&E
staining (bar, 100
mm) (C); Ras staining (bar, 50 mm) (D); p53 staining (bar, 50 mm) (E); Ki-67 staining (bar, 100 mm) (F); and TUNEL staining (arrows; bar,
100 mm) (G) of PR tumors. H–J, H&E coloration of tumor sections reveals invasion into adjacent tissues including adipose tissue (bar, 100 mm) (H);
muscle (bar, 100
mm) (I); and pancreas (bar, 100 mm) (J). K, Double CD31 (red) and LYVE-1 (green) immunofluorescent staining of the tumors to detect
vascular and lymphatic vessels, respectively (bar, 50
mm). L, 3bHSD immunostaining of the tumors to detect adrenocortical steroidogenic cells (bar,
50
mm). M–N, adrenocortical tumor spread to retroperitoneal organs. Arrows indicate PR cells metastases to the spleen, diaphragm and mesentery
(M); Ras staining of metastases (bar, 400
mm) (N); p53 staining of metastases (bar, 100 mm) (O).
doi:10.1371/journal.pgen.1002700.g002
Table 2. Proliferation in tissues formed following
transplantations of 2610
6
cells expressing the indicated
transgenes either beneath the kidney capsule.
Site of
implantation
Implanted
cells
Days post-
implantation
Ki-67 labeling
index (%)
pL 35 3.5161.04
P 35 4.5761.21
R 35 18.7263.25
Subrenal capsule PR 8 56.7569.30
PR 14 46.3167.20
PR 21 42.2767.40
PR 35 48.4366.66
The labeling index which corresponds to the number of Ki-67
+
cells per 100
adrenocortical cells was determined at various times after cell transplantation.
Results are expressed as the mean of the counts of two non-consecutive tissue
sections per condition +/2 SD.
doi:10.1371/journal.pgen.1002700.t002
Mutational Event Order Affects Tumor Phenotype
PLoS Genetics | www.plosgenetics.org 6 May 2012 | Volume 8 | Issue 5 | e1002700
Page 6
lymphatics was compared, a close correlation with the metastatic
potential was found (Figure 5F) since P+R tumors were devoid of
lymphatic vessels. We next sought to confirm the immunostaining
and performed Western analyses of the levels of expression of
p53
DD
and Ras
G12V
proteins in three R+P and P+R transplants.
We noticed that the Ras
G12V
and p53
DD
protein levels appeared
Figure 3. Characterization of tissues formed from P or R cell transplantation at day 35. 2610
6
P and R cells were transplanted beneath the
kidney capsule of mice. The tissues found to have resulted from growth of the transplanted cells (arrows) were cut transversally and photographed,
together with the host kidney (A). H&E stained sections (bar, 100
mm) (B); immunostained for p53 expression in P transplant or Ras expression in R
transplant (bar, 100
mm) (C); assayed for Ki-67
+
cells (arrows, bar, 100 mm) (D); double immunofluorescent stained for CD31 (red) and LYVE-1 (no green
fluorescence detected) (bar, 50
mm) (E); and immunostained for 3bHSD (bar, 50 mm) (F).
doi:10.1371/journal.pgen.1002700.g003
Mutational Event Order Affects Tumor Phenotype
PLoS Genetics | www.plosgenetics.org 7 May 2012 | Volume 8 | Issue 5 | e1002700
Page 7
Mutational Event Order Affects Tumor Phenotype
PLoS Genetics | www.plosgenetics.org 8 May 2012 | Volume 8 | Issue 5 | e1002700
Page 8
slightly lower in the R+P transplants than in the P+R transplants
(Figure 5K). The malignant tumors generated by the transplan-
tation of R+P cells is always more heterogenous than is benign
counterparts, this is partly due to the invasion of the mouse
adjacent tissues (kidney, pancreas and muscle) and also by the
recruitment of other mouse cells such as stromal cells and
fibroblasts. To confirm this, we examined the Ras
G12V
to p53
DD
ratio and found that the results between both groups yielded
similar values (Figure 5L). These results further support the notion
that, in this model system, the phenotype difference is mainly due
to the acquisition order of the genetic alterations rather than the
absolute expression level of the transgenes.
The tumor suppression function of p53 relies on its ability to act
as a potent sequence-specific transcriptional activator, regulating a
program of gene expression. In particular, p53 transactivates
expression of the CDK inhibitor p21
WAF1/Cip1
. Therefore the lack
or decrease of p21 expression will be a marker of the p53 function
loss. As shown on Figure S2, pL and R cells expressing p53
demonstrated a strong p21 expression in almost all nuclei. In
contrast, inactivation of p53 resulted in an absence or a marked
decrease of p21 expression in P, P+R, R+P tissues and in an
intestinal metastasis (Figure S2).
Establishing a set of genes differentially expressed in
benign versus malignant adrenocortical cells
To identify patterns of gene expression associated with fully
malignant behavior, we performed a transcriptomic microarray
analysis on two P+R and three R+P cell populations. The gene list
obtained from a class comparison between benign and malignant
populations was filtered to ensure a 1.3 fold or higher change in
expression level between the two groups. A total of 468 genes (499
probe sets) met this criterion. Among them, 157 were involved in
cancer development and progression, 40 were over-expressed and
117 were under-expressed in the R+P cell populations compared
to the P+R cell populations (Table S1). The other genes are
involved in diverse cellular functions, including cell-to-cell
signaling and interaction, transcription, cell death and metabo-
lism. These results indicated that the distinct orders of genetic hits
acquisition leads to distinct transcriptome signatures associated
with a very distinctive in vivo phenotype. We further did real-time
RT-PCR analysis of 5 genes known to be involved in tumor
development and progression: secreted protein, acidic, cysteine-rich
(osteonectin, Sparc), leucine-rich repeats and immunoglobulin-like domains 1
(LRIG1), tumor protein D52 (TPD52), egl nine homolog 2 (EglN2) and
cyclin D1 (CCND1) using RNA from cells used in the microarray
analysis. The expected differential expression was confirmed in all
genes tested. Sparc and LRIG1 were under-expressed in R+P cells
compared with P+R cells (Figure 6A). EglN2, TPD52 and CCND1
were over-expressed (Figure 6A).
To validate these malignant to benign tumor transcriptome
changes we performed immunohistochemical analysis on tissues
formed after cell transplantation on the 5 genes already validated
by QRT-PCR. For the 5 genes tested we confirmed the mRNA
differential expression at the protein level: Sparc, LRIG1 proteins
were under-expressed while TPD52, EglN2 and cyclin D1 proteins
were over-expressed in the R+P tumors compared to P+R tumors
(Figure 6B–6F).
Discussion
Our present study establishes a new experimental in vivo system
for understanding the pathogenesis of ACT. Starting with primary
BAC cells, we have successfully transformed such cells into either
benign or highly malignant and metastatic tumor-forming cells
through the perturbation of one or two signaling pathways,
respectively. Evidence has revealed that expression of both H-
Ras
G12V
and LT antigen was sufficient to convert primary BAC
cells into fully malignant tumor cells [22]. However, the
requirement of LT for transformation renders the analysis of
these results complicated since LT viral oncoprotein is known to
have several functions and to target a wide range of cellular
proteins [26]. Moreover, the SV40 proteins are rarely involved in
the etiology of human cancers [27]. However, ablation of both
mammalian pRB and p53 tumor suppressor pathways has been
recently shown to be sufficient to replace the function of LT
oncoprotein in the combination of genes to transform normal
human cells [28].
The significant progress made in identifying genetic alterations
involved in ACT has been used as a platform to discriminate those
that we believe might reasonably be involved in multistage
tumorigenesis [11,12]. The proto-oncogene N-Ras has been found
to be mutated in 12.5% of ACA and ACC [13]. The involvement
of this alteration in ACT development might appear relatively
weak; however, it is noteworthy that overexpression of the
epidermal growth factor receptor (EGFR/c-erbB1) is present in
3 to 43% of ACA and 76 to 100% of ACC [29–31], and is
frequently associated with an overexpression of TGF-a, a natural
ligand of EGFR in ACC [30]. As the signal transduced by EGFR
tyrosine kinase activity involves Ras proteins among others, it is
conceivable that Ras is activated in a larger proportion of ACT.
Chronically active wild type Ras might promote tumorigenesis
through activation of multiple Ras effectors that contribute to
deregulated cell growth, dedifferentiation, and increased survival,
migration and invasion. Somatic mutations in the TP53 tumor
suppressor gene occur in 25% to 33% of ACC but not in benign
tumors [32,33], suggesting that mutations in TP53 participate in
tumor progression rather than in initiation. Moreover, TP53
inactivating mutations have been shown to identify a sub-group of
ACC patients developing an aggressive tumor associated with a
poor outcome [34]. Patients with TP53 mutation also showed a
trend towards a shorter survival duration [32,33].
Several models of human or swine cell transformation using
distinct combinations of mammalian genetic elements have been
published in recent years [35–38]. Each model addressed the
tumorigenic conversion of mammalian cells using various
sequences of transgene introduction into target cells. Among these
studies, the number of genetic events necessary for full cell
transformation appeared to vary from 4 to 6. It is worth reminding
that implantation of transformed cells in the subcutaneous space,
Figure 4.
In vitro
characterization of BAC cells transduced with p53
DD
and Ras
G12V
in succession and in distinct orders. A, summary of
the experimental design for the generation of stably infected cell populations. B, detection of Ras
G12V
and p53
DD
by RT-PCR in BAC cells transduced
with the indicated transgenes. Total RP-L27 acts as loading control. C, Confirmation of protein expression by immunoblotting of R+P, P+R, R+pB, P+pL
and pB+pL cells. Actin served as a loading control D, growth curves of R+P, P+R, R+pB and P+pL cells. The in vitro cell proliferation rates were
obtained by counting cells from triplicates cell culture dishes every day. For comparison, PR growth curve has been plotted on the same graph.
Points, mean; bars, SD. E, asynchronous populations of P+pL, P+R, R+pB, and R+P cells were cultured in complete culture medium or in medium
containing 0.1% FCS. The percentage of cells engaged into the cell cycle was determined by measuring the Ki-67 labeling index. For comparison, P, R
and PR Ki-67 labeling index have been plotted on the same graph. Bars, SD.
doi:10.1371/journal.pgen.1002700.g004
Mutational Event Order Affects Tumor Phenotype
PLoS Genetics | www.plosgenetics.org 9 May 2012 | Volume 8 | Issue 5 | e1002700
Page 9
Figure 5.
In vivo
characterization of tissues formed at day 35 following the transplantation of R
+
PorP
+
R cells. A–F, 2610
6
R+PorP+R
cells were transplanted under the kidney capsule of Scid mice. Xenografted tissue masses were removed from the animals at day 35 after cell
transplantation and cut transversally showing internal tissue above the kidney (arrows) (A). Paraffin-embedded tissues were sectioned and H&E
Mutational Event Order Affects Tumor Phenotype
PLoS Genetics | www.plosgenetics.org 10 May 2012 | Volume 8 | Issue 5 | e1002700
Page 10
as used in these studies, does not allow the survival of cells unless
they are fully tumorigenic and, as a consequence, is not adapted
for the study of the premalignant stages. In contrast, the SRC site
is an advantageous niche for survival and growth of cells, due
probably to the immediate access to oxygen and nutrients and to
the rapid angiogenic response developed from the dense developed
renal vasculature. Indeed, our previous studies on adrenocortical
cells showed that injection of normal primary BAC cells under the
kidney capsule was an important feature for the successful
reconstruction of a functional and vascularized tissue, whereas
stained (bar, 100 mm) (B); assayed for Ki-67
+
cells (bar, 100 mm) (C); immunostained for Ras (bar, 50 mm) (D); immunostained for p53 (bar, 50 mm) (E);
and double CD31 (red) and LYVE-1 (green) immunofluorescence stained (no green fluorescence detected for the P+R transplant) (bar, 50
mm) (F). G–J,
macroscopic intraperitoneal tumor spread on the spleen of mice after implantation of adrenocortical R+P cells (arrow) (G); and microscopic tumor
spread in the abdominal muscle (H&E staining, bar, 400
mm) (H); in the intestines, immunostained for Ras (bar, 100 mm) (I); and in the diaphragm,
immunostained for p53 (bar, 100
mm) (J); Western blot analysis of introduced genes. Expression of Ras
G12V
and p53
DD
was confirmed in three separate
R+P and P+R tranplants. Actin served as a loading control (K). Ratio of Ras
G12V
to p53
DD
of R+P and P+R transplants (L).
doi:10.1371/journal.pgen.1002700.g005
Figure 6. mRNA levels of
Sparc
,
LRIG1
,
TPD52
,
EGLN2
, and
CCND1
as measured by QRT–PCR in the P
+
R and R
+
P cells and proteins
levels of these differentially expressed genes as measured by immunohistochemistry in tissues formed from transplanted P
+
R and
R
+
P cells. Between parentheses, is indicated the fold change of expression levels of these genes as determined by microarray analysis between P+R
and R+P cell populations (see Table S1). Relative expression levels normalized to RP-L27 were determined using specific gene-specific primers in the
indicated cell population (A). Immunohistochemical protein staining for Sparc (B); LRIG1 (C); TPD52 (D); EglN2 (E); and Cyclin D1 (F) in P+R transplant
and in R+P transplant (bars, 100
mm).
doi:10.1371/journal.pgen.1002700.g006
Mutational Event Order Affects Tumor Phenotype
PLoS Genetics | www.plosgenetics.org 11 May 2012 | Volume 8 | Issue 5 | e1002700
Page 11
these same cells did not survive when placed subcutaneously [39].
Moreover, although the kidney represents an ectopic site for
adrenocortical cells, the tissues formed beneath the SRC
recapitulate histological features characteristic of normal or
pathological adrenal cortex [39–41].
The ability to form functional tissues from three independent R
polyclonal populations contrasted with the report showing that
high levels of ectopically activated Ras protein may result in
premature senescence [42]. Therefore, there may exist a selection
against cells overexpressing Ras
G12V
, leaving a population with
moderate expression of the activated oncogene. The level of Ras
expression would be then sufficient to activate one or more
downstream signaling pathways controlled by Ras, such as the
MAP kinase or the PI3 kinase pathways to a level that is essential
to disrupt the fine balance between differentiation and prolifer-
ation, and to trigger some irreversible changes towards a benign
phenotype.
To our knowledge, no other study has derived cell cultures from
the same batch of initial cells and, after transduction with defined
genetic elements in different orders, evaluated their effects on the
expressed phenotype in an in vivo experimental model. In this tissue
reconstruction model, each singly infected cell population
produced a distinctive phenotype which might be thoroughly
examined. Significantly, these findings show that malignant
progression in ACT might be controlled not only by the
acquisition of specific genetic changes but also, and more
importantly, with their order of acquisition as we found that only
BAC cells expressing Ras and p53
DD
-in that order- could form
carcinomas. This supports the prediction that overexpression or
mutation in Ras signaling pathway mediate important early events
underlying later tumorigenesis. Sun et al. noted that the order of
introduction of Ras
G12V
and LT did not affect the outcome of the
transplantation; both cell populations formed very aggressive
tumors [24]. One possible explanation is that, LT being such a
powerful viral oncoprotein, the requirement for cooperation with
Ras
G12V
might be minimal whatever the order of acquisition is.
Currently, we do not know how the order of acquisition of genetic
alterations impacts the underlying mechanism of cooperation
leading to different tumor phenotypes but this is the focus of our in
progress investigations. Mouse models have been developed to
dissect the interplay between mutant p53 and oncogenic Ras in
human cancer and have demonstrated that the presence of both
genetic alterations give rise to highly invasive and metastatic
tumors associated with a decrease in survival [43–45]. According
to our results, a model of pancreatic tumor progression involving
initiation through K-Ras oncogenic mutation and progression
through acquisition of p53 point mutation has been suggested,
however the reverse combination was not studied [43]. Two p53
target genes, BTG2 and ATF3, have been identified as mediators of
the ability of wild-type p53 to resist Ras oncogenic transformation
through reduced growth rate, anchorage independent growth and
tumor formation in mice [46,47]. The establishment of malignant
phenotype for a transformed cell resides in the acquisition of new
biological properties such as cellular motility, which makes
possible invasion and metastasis. RhoA, a small GTPase involved
in the cell motility process has been found to be negatively
regulated by functional p53 and positively regulated by H-Ras
V12
;
both signals resulting in a basal level of activated RhoA Upon loss
of p53 function, RhoA activation increases, which in turn induces
cell motility and disease progression [48]. Recently, microarray
analysis of immortalized human fibroblasts transformed by the
expression of H-Ras
G12V
and inactivation of p53 identified a
NFkB-dependent pro-inflammatory gene signature endowing
these cells with an increased tumorigenicity [49,50].
In our experimental model of adrenocortical tumorigenesis,
BAC cells from the same genetic background acquire two
alterations that in turn deregulate major cellular signaling
pathways. If the order of the introduced transforming genes
was irrelevant to the phenotype, then the tumor formed following
transplantation should be identical. This was not the case,
however. A transcriptomic analysis using cDNA microarrays has
been used to identify the molecular signature that might explain
the distinctive in vivo phenotypes. The analysis of P+RandR+P
cell populations identified 468 differential genes and among those
157 genes directly involved in cancer development and progres-
sion that were differentially expressed between partially and fully
transformed cells. Moreover, histochemical validation done on a
subset of 5 gene products further confirmed their differential
expression in malignant versus benign tumors formed after
transplantation of these cells. The 5 genes were chosen on their
apparent importance in tumor development and cancer progres-
sion. Sparc is an extracellular matrix-associated glycoprotein and
a lower Sparc expression is correlated with increased growth,
metastatic behavior and reduced apoptosis in multiple cancers
[51]. LRIG1 is a transmembrane protein acting as a negative
feedback regulator of EGF signaling [52]. Its expression is
downregulated in a variety of human cancer supporting the
hypothesis that decreased expression of LRIG1 unleashes EGFR
signaling, which might contribute to tumorigenesis. To date no
data are available on LRIG1 status in ACC where EGFR
expression is markedly elevated [29–31]. However, LRIG1
expression has also been shown to be up-regulated in prostate
cancer and leukemia which highlighted that LRIG1 might act as
an oncogene depending on the cellular contexts [53]. Increased
TPD52 expression and gene copy number have been reported in
breast, prostate and ovarian cancer increasing cell proliferation in
vitro and tumorigenicity in mice [54–57]. Cyclin D1 overexpres-
sion driven by genomic alterations, post-transcriptional regula-
tion, or post-translational protein stabilization is implicated as
driving feature in various human tumors [58]. Finally, level of
EglN2, a prolyl hydroxylase, has been shown to be significantly
higher in human renal clear cell carcinoma than in normal
kidneys [59]. Moreover, inactivation of EglN2 down-regulated
Cyclin D1 and cell proliferation in several cancer cell lines [60].
Increased EglN2 expression in R+P cells compared to P+R cells
might participate to higher cell proliferation through Cyclin D1
regulation.
Thus far, we have employed a rational modeling approach to
improve our understanding of the genetic changes leading to the
initiation and progression of adrenocortical cancer and to shed
some light on the critical importance of the order of genetic
alterations for the tumor development. We have focused on Ras
and p53 genes because modifications in their expression and/or in
their genomic sequence are commonly observed in human ACT.
Other genes such as IGF-2, b-catenin, H19, p57, EGFR have also
been shown to play a role in adrenal pathogenesis and need to be
tested in future studies. Hence, the system that we established will
enable us to test the oncogenic potential of these genes singly or in
combination, in order to identify those that might truly contribute
to adrenocortical tumor development and those that might only be
bystanders. We are confident that other gene combinations will
lead to ACT development with some specific clinical and
histopathological features and it will be then possible to link the
genotypes with the tumor phenotype. Finally, the first identifica-
tion of the minimal combination of two master pathways sufficient
to trigger ACC development will help to design new therapeutic
options targeting these specific gene products or the downstream
targets of their signaling pathways.
Mutational Event Order Affects Tumor Phenotype
PLoS Genetics | www.plosgenetics.org 12 May 2012 | Volume 8 | Issue 5 | e1002700
Page 12
Materials and Methods
Ethics statement
Animal use was conducted according to the institutional
guidelines and those formulated by the European Community
for the Use of Experimental Animals. The animal protocol was
approved by the Institutional Animal Care and Use Committee at
the Commisariat a` l’Energie Atomique.
Plasmid construction and production of retroviral
particles
The H-Ras
G12V
cDNA previously inserted into pBabe-Hygro (a
gift from Pr. J.W. Shay; [61]), was subcloned into MoMLV
derived vector pL (Clontech), downstream of the immediate early
cytomegalovirus promoter. A dominant negative p53 fragment,
p53
DD
cloned into pBabe-Hygro was purchased from Addgene
(plasmid 9058) [14]. pL-Ras
G12V
(resistant to neomycin) and
pBabe-Hygro-p53
DD
(resistant to hygromycin) constructs and the
corresponding empty retroviral vectors were used to transfect the
amphotropic packaging cell line PT67 (Clontech) using the
Effecten Transfection Reagent (Life Technologies Invitrogen).
The cells underwent selection with 400
mg/ml neomycin for 10
days or 50
mg/ml hygromycin for 6 days. Then, the viral
supernatant was collected and filtered through a 0.45
mm syringe
filter to obtain cell-free viruses for adrenocortical cell infection.
Culture of BAC cells and retroviral transduction
Primary adrenocortical cells were prepared by dissection and
enzymatic digestion of adrenal glands from 2-yr-old steers [62].
They were grown at 37uC under a 5% CO
2
-95% air atmosphere
in DMEM/Ham’s F-12 1:1 supplemented with 10% FCS, 10%
horse serum and 1% (v/v) UltroSer G (BioSepra) (complete
medium). When reaching 40–50% confluence, BAC cells were
infected by a mix of two retroviral suspensions for 24 hours
(pBabe-Hygro-p53
DD
/pL-Ras
G12V
or pBabe-Hygro-p53
DD
/pL or
pBabe-Hygro/pL-Ras
G12V
). Infected cells were selected with
400
mg/ml G418 for 7 days and 50 mg/ml hygromycin for 5 days
to obtain stable cell lines.
In different experiments, primary cells were transduced with a
single retrovirus, pL-Ras
G12V
or pBabe-Hygro-p53
DD
and selected
with G418 for 7 days or hygromycin for 5 days, respectively.
Stably infected cultures were then infected with either pBabe-
Hygro or pBabe-Hygro-p53
DD
, or pL or pL-Ras
G12V
, respectively,
and selected with G418 for 7 days and hygromycin for 5 days to
obtain stable cell lines. Cells were not grown extensively between
the two infections. Primary BAC cells transduced only with the
empty vectors pL were used as control cells for the effect of the
genes of interest. Three separate adrenocortical primary cell
preparations have been used to generate the stably infected cells
described above.
In vitro analysis
Gene expression analysis was assessed by RT-PCR. One
microgram of total RNA of cultured cells, prepared using the
RNAgents Total RNA Isolation System (Promega), were reverse
transcribed using the ImProm-II Reverse Transcriptase (Promega)
with random primers PdN6 (Life Technologies Invitrogen); after
which 2
mL of each reaction were PCR amplified using following
primers: 5-ATGACGGAATATAAGCTGGTGGT and 5-TCAG-
GAGAGCACACACTTGC (Ras
G12V
), 5-AAAGGATGCCCA-
TGCTACAG and 5- TTGCCGGGAAGCTAGAGTAA (p53
DD
),
and 5-GCGGCTATCGTGAAGAACATTG and 5-CCTTGC-
GTTTGAGAGCAGGG (RP-L27; Ribosomal Protein-L27).
Proliferation was determined by assessing cell number after
growth in complete medium, for 7 days (5610
3
cells of each cell
line were initially plated). Each day, cells were counted in triplicate
using a Coulter Z1 (Coultronics). Proliferation was also assessed by
the percentage of Ki-67 positive cells in each cell population. For
each cell line, 10
4
cells were plated in complete medium for
24 hours in 4 well LabTek chamber slide (Fisher Scientific). After
deprivation in DMEM/0.1% FCS for 48 hours, cells from two
wells were transferred in complete medium whereas cells from the
two other wells were maintained in 0.1% FCS-medium for
24 hours. Cells were then fixed in 4% paraformaldehyde and
immunostained with the anti Ki-67 monoclonal antibody (clone
MIB-1; Dako). An average of 300 nuclei were counted on each
well, n = 4 for each experimental condition.
5610
3
cells of individual cell lines were seeded in triplicate in
soft agar and the resulting colonies were scored three weeks later.
Each experiment was repeated at least once.
Cell transplantation and animal expe rimentation
Both male and female SCID mice, originally purchased from
Taconic, were used at an age greater than 6 weeks (,25 g body
weight) in these experiments. Under tribromoethanol anesthesia,
mice were adrenalectomized and 2610
6
genetically modified
adrenocortical cells were transplanted under the kidney capsule
[39,63]. Six mice were used per polyclonal cell population
generated. Post-operative care for the animals consisted of the
administration of analgesics and antibiotics in drinking water for 4
days [39]. Animals were killed at various times, from 8 to 35 days
after transplantation and subjected to necropsy.
Histological and immunohistochemical analysis
All tissues (adrenocortical transplants and metastases) were fixed
in 4% paraformaldehyde and embedded in paraffin. Microtome
sections (5
mm thick) were stained with H&E for histological
analysis. Expression of the transduced genes was analyzed by
standard immunohistochemistry using the anti-Ras mouse mono-
clonal antibody (clone 18; BD Transduction Laboratories), the
anti-p53 mouse monoclonal antibody (clone pAb421; Calbio-
chem), and the anti-p21 mouse monoclonal antibody (clone EA10;
Calbiochem) detected with a biotin-conjugated anti-mouse IgG
antibody and an avidin-biotin-peroxidase complex (Vector Lab-
oratories). Sections were counterstained with hematoxylin. The
differentiation status and proliferation index of tissues were
determined using a rabbit polyclonal anti-3bHSD antibody
(produced in our laboratory) and the MIB-1 antibody that
recognizes the proliferation-associated Ki-67 antigen, respectively.
The number of Ki-67 positive cells per 100 BAC cells was
designated as the proliferation index. Counting was performed
using two non-consecutive tissue sections per tissue sample,
selected at random in each group. DNA fragmentation associated
with apoptosis was detected by nick end labeling of sections using
the TdT-FragEL kit (TUNEL) (Calbiochem). Vascular endothelial
cells were labeled with a rat monoclonal anti-CD31 antibody
(PECAM-1; BD Biosciences) and lymphatic endothelial cells were
labeled with a goat polyclonal anti-LYVE 1 antibody (R&D
Systems), on paraffin-embedded sections (5
mm thick) of tissues
fixed in Accustain formalin free fixative (Sigma-Aldrich). Second-
ary antibodies were Cy3- or FITC-labeled donkey anti-rat IgG or
anti-goat IgG respectively. Sections were counterstained with
DAPI.
Western blot analysis
Cells were rinsed in PBS and lysed in RIPA buffer (10 mM Tris-
HCl, pH 7.4, 150 mM NaCl, 1% TritonX-100, 0.5% Na
Mutational Event Order Affects Tumor Phenotype
PLoS Genetics | www.plosgenetics.org 13 May 2012 | Volume 8 | Issue 5 | e1002700
Page 13
deoxycholate, 0.1% SDS) supplemented with protease inhibitor
cocktail (#P8340; Sigma) for 10 minutes on ice, scrapped from the
culture dish, and cleared with centrifugation in a microfuge tube for
20 min at 4uC. Extracts were analyzed for protein concentration by
Bradford assay. Equal amount (25
mg) of total cell protein was
separated by 15% SDS-PAGE gel and transferred to nitrocellulose
membrane (Bio-Rad Laboratories). Filters were blocked for 1 hr at
room temperature in 5% dry milk in Tris Buffered Saline, and
incubated with primary antibodies in 5% dry milk in TBS at 4uC
overnight. The following primary antibodies were used: anti-Ras
mouse monoclonal antibody (clone 18; BD Transduction Labora-
tories), anti-p53 mouse monoclonal antibody (clone pAb421;
Calbiochem), anti-actin mouse monoclonal antibody (clone AC-
15; Sigma-Aldrich). After several washes, secondary peroxidase
conjugated antibodies (Thermo Scientific) were used at a 1:10000
dilution. The membrane was washed in TBS-5% Tween 20 and the
proteins were detected using an enhanced chemiluminescence
(ECL) detection system (Amersham).
For protein isolation from tissues, the xenograft is carefully
dissected out from the kidney and the adjacent tissues when
possible and finely cut with a razor blade into a mortar with
approximately 500
ml of RIPA lysis buffer containing a protease
inhibitor cocktail. The tissue was ground well with a pestle,
transferred into a microfuge tube and centrifuged for 20 min at
4uC. Protein extracts were then submitted to the same protocol as
described above. Quantification was done with Image J image
software (National Institute of Health).
Microarray analysis
RNA isolation and target labeling. Total RNA was
extracted from two P+R, two pBabe+pL (control for P+R cells),
three R+P and two pL+pBabe (control for R+P cells) cell
populations using RNeasy kit (Qiagen).
Microarray analysis was performed by the ProfileXpert
platform (Lyon, France) using a high-density oligonucleotide array
(GeneChip Bovine Genome array, Affymetrix). One microgram of
total RNA from each sample was amplified and biotin-labeled
using GeneChip Expression 39 Amplification One-Cycle Target
Labeling and Control Reagents Kit. Before amplification, spikes of
synthetic mRNA at different concentrations were added to all
samples; these positive controls were used to ascertain the quality
of the process. Biotinylated antisense cRNA for microarray
hybridization was prepared. After final cleanup, cRNA quantifi-
cation was performed with a NanoDrop and quality checked with
Agilent 2100 Bioanalyzer (Agilent Technologies, Inc).
Arrays hybridization and scanning. Hybridization was
performed following Affymetrix protocol (http://www.affymetrix.
com). Briefly, 10
mg of labeled cRNA was fragmented and
denaturated in hybridization buffer, then hybridized on chip
during 16 hours at 45uC with constant mixing by rotation at
60 rpm in an Genechip hybridization oven 640 (Affymetrix). After
hybridization, arrays were washed and stained with streptavidin-
phycoerythrin (Invitrogen) in a fluidic 450 (Affymetrix) according
to the manufacturer’s instruction. The arrays were read with a
confocal laser (Genechip scanner 3000, Affymetrix). Then CEL
files were generated using the Affymetrix GeneChip Command
Console (AGCC) software 3.0.
Data filtering and analysis. The obtained data were
normalized with Affymetrix Expression Console software using
MAS5 statistical algorithm. Normalized data were compared and
filtered using Partek Genomic Suite software 6.5 (Partek Inc.).
Pair-wise comparisons were performed between carcinoma
samples and control samples. Each sample from one group was
compared with each sample from the other group and only genes
showing a variation of 1.3-fold in all pairwise comparisons were
retained. Then, a gene was considered as differentially expressed
between groups only if the detected signal was above the
background for at least one of the compared groups. The same
comparison was performed between adenomas and control
samples. Finally, genes differentially expressed in carcinomas
and adenomas were compared to each other and only genes
showing a variation of 1.3-fold in all pairwise comparisons were
retained. The genes of interest were then listed and classified
according to their biological functions using Ingenuity Pathways
Analysis (Ingenuity Systems Inc.).
All data is available at the GEO public data base under
accession GSE32305.
Quantitative real-time PCR
One microgram of total RNA prepared for the microarray
hybridisation was used to generate cDNAs by reverse transcription
using the iScript system (Bio-Rad) as recommended by the
manufacturer. Real-time PCR was performed using Bio-rad
CFX96 apparatus and qPCR Master Mix (Promega). The values
for the specific genes were normalized to the RP-L27. Specific
primers sequences are provided in Table S2.
Supporting Information
Figure S1 Tumor growth analysis at day 8, 14 and 21 after
transplantation of PR cells. After growth in culture, PR cells were
transplanted beneath the kidney capsule of Scid mice. A,
macroscopic appearance of kidney and xenografted tissue mass
removed from the animals at day 8, 14, 21 after transplantation of
2610
6
PR cells. Adrenocortical tissue and kidney were cut
transversally showing tissue expansion over time (arrows). B–E,
paraffin-embedded tissues were sectioned and stained with H&E
(bar, 400
mm) (B); assayed for Ki-67
+
cells (bar, 100 mm) (C); or
immunostained for Ras revealing invasion into adjacent muscle
tissue at day 21 (bar, 50
mm) (D); or immunostained for p53 revealing
invasion into adjacent adipose tissue at day 21 (bar, 50
mm) (E).
(PPT)
Figure S2 Qualitative changes of p21 expression in tissues
formed after transplantation of pL, R, P, P+R, R+P cells and in
intestinal metastasis issued from a R+P primary tumor. Paraffin-
embedded tissues were sectioned and immunostained for p21 (bar,
50
mm). The junction with the mouse kidney is visible at the
bottom of the tissue pictures. Intestinal villi are visible on the left of
the metastasis picture. Arrows indicate stained nuclei.
(PPT)
Table S1 Differential expression of 157 genes related to cancer
development and progression resulting from microarray analysis of
R+P and P+R cell populations
(DOC)
Table S2 Primers for QRT–PCR.
(DOC)
Acknowledgments
We thank Dr J. Lachuer, S. Croze, and N. Nazaret from ProfilExpert for
their help with microarray analysis.
Author Contributions
Conceived and designed the experiments: MH J-JF MT. Performed the
experiments: MH AS MT. Analyzed the data: MH MT. Contributed
reagents/materials/analysis tools: MH MT. Wrote the paper: MH J-JF
MT.
Mutational Event Order Affects Tumor Phenotype
PLoS Genetics | www.plosgenetics.org 14 May 2012 | Volume 8 | Issue 5 | e1002700
Page 14
References
1. Bardeesy N, DePinho RA (2002) Pancreatic cancer biology and genetics. Nat
Rev Cancer 2: 897–909.
2. Troyer DA, Mubiru J, Leach RJ, Naylor SL (2004) Promise and challenge:
Markers of prostate cancer detection, diagnosis and prognosis. Dis Markers 20:
117–128.
3. Hanahan D, Weinberg RA (2011) The hallmarks of cancer: the next generation.
Cell 144: 646–674.
4. Fearon ER, Vogelstein B (1990) A genetic model for colorectal tumorigenesis.
Cell 61: 759–767.
5. Vogelstein B, Kinzler KW (1993) The multistep nature of cancer. Trends Genet
9: 138–141.
6. Allolio B, Fassnacht M (2006) Adrenocortical Carcinoma: Clinical Update. J Clin
Endocrinol Metab 91: 2027–2037.
7. Schteingart DE, Doherty GM, Gauger PG, Giordano TJ, Hammer GD, et al.
(2005) Management of patients with adrenal cancer: recommendations of an
international consensus conference. Endocr Relat Cancer 12: 667–680.
8. Barzon L, Sonino N, Fallo F, Palu` G, Boscaro M (2003) Prevalence and natural
history of adrenal incidentalomas. Eur J Endocrinol 149: 273–285.
9. Mantero F, Terzolo M, Arnaldi G, Osella G, Masini AM, et al. (2000) A survey
on adrenal incidentaloma in Italy. Study Group on Adrenal Tumors of the
Italian Society of Endocrinology. J Clin Endocrinol Metab 85: 637–644.
10. Bernard MH, Sidhu S, Berger N, Peix JL, Marsh DJ, et al. (2003) A case report
in favor of a multistep adrenocortical tumorigenesis. J Clin Endocrinol Metab
88: 998–1001.
11. Gaujoux S, Tissier F, Groussin L, Libe´ R, Ragazzon B, et al. (2008) Wnt/b-
catenin and cAMP/PKA signaling pathways alterations and somatic b-catenin
gene mutations in the progression of adrenocortical tumors. J Clin Endocrinol
Metab 93: 4135–4140.
12. Soon PS, McDonald KL, Robinson BG, Sidhu SB (2008) Molecular markers
and the pathogenesis of adrenocortical cancer. The Oncologist 13: 548–561.
13. Yashiro T, Hara H, Fulton NC, Obara T, Kaplan EL (1994) Point mutations of
ras genes in human adrenal cortical tumors: absence in adrenocortical
hyperplasia. World J Surg 18: 455–460.
14. Thomas M, Suwa T, Yang L, Zhao L, Hawks CL, et al. (2002) Cooperation of
hTERT, SV40 T antigen and oncogenic Ras in tumorigenesis: a cell
transplantation model using bovine adrenocortical cells. Neoplasia 4: 493–500.
15. Shaulian E, Zauberman A, Ginsberg D, Oren M (1992) Identification of a
minimal transforming domain of p53: negative dominance through abrogation
of sequence-specific DNA binding. Mol Cell Biol 12: 5581–5592.
16. Shields JM, Pruitt K, McFall A, Shaub A, Der CJ (2000) Understanding Ras: ‘it
ain’t over ‘til it’s over’. Trends Cell Biol 10: 147–154.
17. Hahn WC, Dessain SK, Brooks MW, King JE, Elenbaas B, et al. (2002)
Enumeration of the simian virus 40 early region elements necessary for human
cell transformation. Mol Cell Biol 22: 2111–2123.
18. Hahn WC, Counter CM, Lundberg AS, Beijersbergen RL, Brooks MW, et al.
(1999) Creation of human tumour cells with defined genetic elements. Nature
400: 464–468.
19. Fagotto F, Gumbiner BM (1996) Cell contact-dependent signaling. Dev Biol
180: 445–454.
20. Koch CA, Pacak K, Chrousos GP (2002) The molecular pathogenesis of
hereditary and sporadic adrenocortical and adrenomedullary tumors. J Clin
Endocrinol Metab 87: 5367–5384.
21. Gupta GP, Massague J (2006) Cancer metastasis: building a framework. Cell
127: 679–695.
22. Achen MG, Stacker SA (2006) Tumor lymphangiogenesis and metastatic
spread-new players begin to emerge. Int J Cancer 119: 1755–1760.
23. Prevo R, Banerji S, Ferguson DJ, Clasper S, Jackson DG (2001) Mouse LYVE-1
is an endocytic receptor for hyaluronan in lymphatic endothelium. J Biol Chem
276: 19420–19430.
24. Sun B, Huang Q, Liu S, Chen M, Hawks CL, et al. (2004) Progressive loss of
malignant behavior in telomerase-negative tumorigenic adrenocortical cells and
restoration of tumorigenicity by human telomerase reverse transcriptase. Cancer
Res 64: 6144–6151.
25. Bernards R, Weinberg RA (2002) A progression puzzle. Nature 418: 823.
26. Ali SH, DeCaprio JA (2001) Cellular transformation by SV40 large T antigen:
interaction with host proteins. Semin Cancer Biol 11: 15–23.
27. Gazdar AF, Butel JS, Carbone M (2002) SV40 and human tumours: myth,
association or causality? Nat Rev Cancer 2: 957–964.
28. Boehm JS, Hession MT, Bulmer SE, Hahn WC (2005) Transformation of
human and murine fibroblasts without viral oncoproteins. Mol Cell Biol 25:
6464–6474.
29. Kamio T, Shigematsu K, Sou H, Kawai K, Tsuchiyama H (1990)
Immunohistochemical expression of epidermal growth factor receptors in
human adrenocortical carcinoma. Hum Pathol 21: 277–282.
30. Sasano H, Suzuki T, Shizawa S, Kato K, Nagura H (1994) Transforming
growth factor alpha, epidermal growth factor, and epidermal growth factor
receptor expression in normal and diseased human adrenal cortex by
immunohistochemistry and in situ hybridization. Mod Pathol 7: 741–746.
31. Adam P, Hahner S, Hartmann M, Heinrich B, Quinkler M, et al. (2010)
Epidermal growth factor receptor in adrenocortical tumors: analysis of gene
sequence, protein expression and correlation with clinical outcome. Mod Pathol
23: 1596–1604.
32. Sidhu S, Martin E, Gicquel C, Melki J, Clark SJ, et al. (2005) Mutation and
methylation analysis of TP53 in adrenal carcinogenesis. Eur J Surg Oncol 31:
549–554.
33. Libe´ R, Groussin L, Tissier F, Elie C, Rene-Corail F, et al. (2007) Somatic TP53
mutations are relatively rare among adrenocortical cancers with the frequent
17p13 loss of heterozygosity. Clin Cancer Res 13: 844–850.
34. Ragazzon B, Libe´ R, Gaujoux S, Assie´ G, Fraticci A, et al. (2010) Transcriptome
analysis reveals that p53 and b–catenin alterations occur in a group of aggressive
adrenocortical cancers. Cancer Res 70: 8276–8281.
35. Drayton S, Rowe J, Jones R, Vatcheva R, Cuthbert-Heavens D, et al. (2003)
Tumor suppressor p16INK4a determines sensitivity of human cells to
transformation by cooperating cellular oncogenes. Cancer Cell 4: 301–310.
36. Goessel G, Quante M, Hahn WC, Harada H, Heeg S, et al. (2005) Creating oral
squamous cancer cells: a cellular model of oral-esophageal carcinogenesis. Proc
Natl Acad Sci USA 102: 15599–15604.
37. Kendall SD, Linardic CM, Adam SJ, Counter CM (2005) A network of genetic
events sufficient to convert normal human cells to a tumorigenic state. Cancer
Res 65: 9824–9828.
38. Adam SJ, Rund LA, Kuzmuk KN, Zachary JF, Schook LB, et al. (2007) Genetic
induction of tumorigenesis in swine. Oncogene 26: 1038–1045.
39. Thomas M, Northrup SR, Hornsby PJ (1997) Adrenocortical tissue formed by
transplantation of normal clones of bovine adrenocortical cells in SCID mice
replaces the essential functions of the animals’ adrenal glands. Nat Med 3:
978–983.
40. Mazzuco TL, Chabre O, Feige JJ, Thomas M (2006) Aberrant expression of
human luteinizing hormone receptor by adrenocortical cells is sufficient to
provoke both hyperplasia and Cushing’s syndrome features. J Clin Endocrinol
Metab 91: 196–203.
41. Mazzuco TL, Chabre O, Sturm N, Feige JJ, Thomas M (2006) Ectopic
expression of the gastric inhibitory polypeptide receptor gene is a sufficient
genetic event to induce benign adrenocortical tumor in a xenotransplantation
model. Endocrinology 147: 782–790.
42. Serrano M, Lin AW, McCurrach ME, Beach D, Lowe SW (1997) Oncogenic ras
provokes premature cell senescence associated with accumulation of p53 and
p16INK4a. Cell 88: 593–602.
43. Hingorani SR, Wang L, Multani AS, Combs C, Deramaudt TB, et al. (2005)
Trp53
R172H
and Kras
G12D
cooperate to promote chromosomal instability and
widely metastatic pancreatic ductal adenocarcinoma in mice. Cancer Cell 7:
469–483.
44. Tsumura H, Yoshida T, Saito H, Imanaka-Yoshida K, Suzuki N (2006)
Cooperation of oncogenic K-ras and p53 deficiency in pleomorphic rhabdo-
myosarcoma development in adult mice. Oncogene 25: 7673–7679.
45. Zheng S, El-Naggar AK, Kim ES Kurie JM, Lozano G (2007) A genetic mouse
model for metastatic lung cancer with gender differences in survival. Oncogene
26: 6896–6904.
46. Boiko AD, Porteous S, Razorenova OV, Krivokrysenko VI, Williams BR, et al.
(2006) A systematic search for downstream mediators of tumor suppressor
function of p53 reveals a major role of BTG2 in suppression of Ras-induced
transformation. Genes Dev 20: 236–252.
47. Lu D, Wolfgang CD, Hai T (2006) Activating transcription factor 3, a stress-
inducible gene, suppresses Ras-stimulated tumorigenesis. J Biol Chem 281:
10473–10481.
48. Xia M, Land H (2007) Tumor suppressor p53 restricts Ras stimulation of RhoA
and cancer motility. Nature Struct Mol Biol 14: 215–223.
49. Buganim Y, Solomon H, Rais Y, Kistner D, Nachmany I, et al. (2010) p53
regulates the ras circuit to inhibit the expression of a cancer-related gene
signature by various molecular pathways. Cancer Res 70: 2274–2283.
50. Milyavsky M, Tabach Y, Shats I, Erez N, Cohen Y, et al. (2005) Transcriptional
programs following genetic alterations in p53, INK4A, and H-Ras genes along
defined stages of malignant transformation. Cancer Res 65: 4530–4543.
51. Nagaraju GPC, Sharma D (2011) Anti-cancer role of SPARC, an inhibitor of
adipogenesis. Cancer Treat Rev 37: 559–566.
52. Hedman H, Henriksson R (2007) LRIG inhibitors of growth factor signaling-
double-edged swords in human cancer? Eur J Cancer 43: 676–682.
53. Lapointe J, Li C, Higgins JP, van de Rjin M, Bair E, et al. (2004) Gene
expression profiling identifies clinically relevant subtypes of prostate cancer. Proc
Natl Acad Sci USA 101: 811–816.
54. Rubin MA, Varambelly S, Beroukhim R, Tomlins SA, Rhodes DR, et al. (2004)
Overexpression, amplification, and androgen regulation of TPD52 in prostate
cancer. Cancer Res 64: 3814–3822.
55. Byrne JA, Balleine RL, Schoenberg FM, Mercieca J, Chiew YE, et al. (2005)
Tumor protein D52 (TPD52) is overexpressed and a gene amplification target in
ovarian cancer. Int J Cancer 117: 1049–1054.
56. Ade´laı
¨
de J, Finetti P, Bekhouche I, Repellini L, Geneix J, et al. (2007) Integrated
profiling of basal and luminal breast cancers. Cancer Res 67: 11565–11575.
57. Wang R, Xu J, Mabjeesh N, Zhu G, Zhou J, et al. (2007) PrLZ is expressed in
normal prostate development and in human prostate cancer progression. Clin
Cancer Res 13: 6040–6048.
58. Kim JK, Diehl JA (2009) Nuclear cyclin D1: an oncogenic driver in human
cancer. J Cell Physiol 220: 292–296.
Mutational Event Order Affects Tumor Phenotype
PLoS Genetics | www.plosgenetics.org 15 May 2012 | Volume 8 | Issue 5 | e1002700
Page 15
59. Yi Y, Mikhaylova O, Mamadova A, Pastola P, Biesiada J, et al. (2010) von
Hippel-Lindau-dependent patterns of RNA polymerase II hydroxylation in
human renal clear cell carcinoma. Clin Cancer Res 16: 5142–5152.
60. Zhang Q, Gu J, Li L, Liu J, Luo B, et al. (2009) Control of Cyclin D1 and breast
tumorigenesis by the EglN2 prolyl hydroxylase. Cancer Cell 16: 413–424.
61. Morales CP, Holt SE, Ouellette M, Kaur KJ, Yan Y, et al. (1999) Absence of
cancer-associated changes in human fibroblasts immortalized with telomerase.
Nat Genet 21: 115–118.
62. Duperray A, Chambaz EM (1980) Effect of prostaglandin E1 and ACTH on
proliferation and steroidogenic activity of bovine adrenocortical cells in primary
culture. J Steroid Biochem 13: 1359–1364.
63. Thomas M, Hornsby PJ (1999) Transplantation of primary bovine adrenocor-
tical cells into scid mice. Mol Cell Endocrinol 153: 125–136.
Mutational Event Order Affects Tumor Phenotype
PLoS Genetics | www.plosgenetics.org 16 May 2012 | Volume 8 | Issue 5 | e1002700
Page 16