Content uploaded by Eduardo Mateos
Author content
All content in this area was uploaded by Eduardo Mateos on May 01, 2018
Content may be subject to copyright.
This article appeared in a journal published by Elsevier. The attached
copy is furnished to the author for internal non-commercial research
and education use, including for instruction at the authors institution
and sharing with colleagues.
Other uses, including reproduction and distribution, or selling or
licensing copies, or posting to personal, institutional or third party
websites are prohibited.
In most cases authors are permitted to post their version of the
article (e.g. in Word or Tex form) to their personal website or
institutional repository. Authors requiring further information
regarding Elsevier’s archiving and manuscript policies are
encouraged to visit:
http://www.elsevier.com/copyright
Author's personal copy
Evidence for the persistence of the land planarian species Microplana terrestris
(Müller, 1774) (Platyhelminthes, Tricladida) in microrefugia during the Last
Glacial Maximum in the northern section of the Iberian Peninsula
Marta Álvarez-Presas
a
, Eduardo Mateos
b
, Miquel Vila-Farré
c
, Ronald Sluys
d,e
, Marta Riutort
a,
⇑
a
Departament de Genètica, Facultat de Biologia i Institut de Recerca de la Biodiversitat (IRBio), Universitat de Barcelona, Avinguda Diagonal 643, E-08028 Barcelona, Spain
b
Departament de Biologia Animal, Facultat de Biologia, Universitat de Barcelona, Avinguda Diagonal 643, E-08028 Barcelona, Spain
c
Departament de Genètica, Facultat de Biologia, Universitat de Barcelona, Avinguda Diagonal 643, E-08028 Barcelona, Spain
d
Institute for Biodiversity and Ecosystem Dynamics, University of Amsterdam, The Netherlands
e
Netherlands Centre for Biodiversity Naturalis (Section ZMA), P.O. Box 9514, 2300 RA Leiden, The Netherlands
article info
Article history:
Received 23 November 2011
Revised 26 April 2012
Accepted 2 May 2012
Available online 12 May 2012
Keywords:
Beech
COI
ITS-1
Oak
Phylogeography
Wet forest
abstract
The land planarian species Microplana terrestris (Müller, 1774), shows a wide distribution in the north of
the Iberian Peninsula, where mature humid forests can be found. Since most terrestrial planarians require
the presence and good condition of wet forests to survive, a parallel evolution of the taxon and its habitat
might be expected. Performing molecular analyses (mitochondrial cytochrome oxidase I and nuclear ITS-
1 genes) we estimated the demography and biogeographic history of the species in that region. Our
results show the species to present levels of genetic diversity likely originating before the Pleistocene.
However, it presents a genetic structure that presumably resulted from its survival in various refuges
during the Pleistocene glacial cycles. The two main genetic groups, present on the Iberian Peninsula, seem
to have different origins: the western one being of Iberian origin, while the eastern group may have been
the result of a re-colonization from the north. In both cases, their biogeographical history mirrors their
habitat range movements, reinforcing the phylogeographical hypothesis put forward for its preferred
habitat, i.e. humid forests.
Ó2012 Elsevier Inc. All rights reserved.
1. Introduction
The terrestrial flatworms (Tricladida, Geoplanidae) constitute a
little known group of free-living Platyhelminthes including about
eight hundred known species, although this number is presumably
a small fraction of the total diversity of the group (Carbayo and
Froehlich, 2008; Fick et al., 2006; Leal-Zanchet et al., 2011; Mateos
et al., 2009; Vila-Farré et al., 2011; Winsor, 1998). In recent years,
extensive samplings, morphological studies and the application of
molecular tools have revealed that the diversity of land planarians
is higher than presumed, not only in areas as the Atlantic Forest in
Brazil, where many species were already known (Carbayo and
Froehlich, 2008), but also in the Iberian Peninsula (Mateos et al.,
2009; Vila-Farré et al., 2008, 2011). Terrestrial planarians are part
of the cryptic soil fauna, making them hard to find with the usual
sampling techniques, which is why there is a lack of knowledge
about their distribution, origin of their populations and levels of
genetic diversity. Nonetheless, their study may unveil the factors
and processes generating and maintaining diversity due to their
special characteristics: soil in humid forests as preferred habitat,
low dispersal capability since they depend on the wet soil and have
no resistant life stages, top predators that rely on the availability of
suitable prey. Hence, the distribution of most terrestrial planarians
requires the presence and good condition of wet forests, suggesting
that they may be good indicators of forests health (Carbayo et al.,
2002; Fonseca et al., 2009; Sluys, 1999) and also an excellent
model for phylogeographic studies (Álvarez-Presas et al., 2011;
Sunnucks et al., 2006).
Microplana terrestris (Müller, 1774) is the most common terres-
trial planarian in Europe. It has a wide European distribution: from
Norway to Spain and from Portugal to Romania, including the British
Isles, and the islands of Crete, Madeira and Menorca (Fauna
Europaea Web Service, 2004; Kawakatsu et al., 2003; Minelli,
1977; Ogren et al., 1997; Vila-Farré et al., 2011). It has been recorded
also from Iceland (Lindroth et al., 1973), and from the USA and Can-
ada (see references in Ogren and Kawakatsu (1989)). Semper (1881)
cited M. terrestris (as Planaria terrestris) from Menorca (Balearic
Islands, Spain), and its presence in mainland Spain has been
documented both by molecular (Mateos et al., 2009) and morpho-
logical evidences (Vila-Farré et al., 2011). In those studies it was
shown that the species has a wide distribution in the northern part
1055-7903/$ - see front matter Ó2012 Elsevier Inc. All rights reserved.
http://dx.doi.org/10.1016/j.ympev.2012.05.001
⇑
Corresponding author.
E-mail addresses: onaalvarez@ub.edu (M. Álvarez-Presas), emateos@ub.edu (E.
Mateos), mvilafarre@gmail.com (M. Vila-Farré), Ronald.sluys@ncbnaturalis.nl (R.
Sluys), mriutort@ub.edu (M. Riutort).
Molecular Phylogenetics and Evolution 64 (2012) 491–499
Contents lists available at SciVerse ScienceDirect
Molecular Phylogenetics and Evolution
journal homepage: www.elsevier.com/locate/ympev
Author's personal copy
of the Iberian Peninsula, where it was found with a high frequency,
although several other species were also present. The external mor-
phology of live Microplana terrestris specimens is rather characteris-
tic (Johns, 1998; Jones, 2005; Jones et al., 2008): up to 2 cm long,
1–2 mm wide, grey or black body color, white ventral creeping sole,
plump and round in cross-section when extended, anterior end
blunt, with two little lateral eyes at the apical end. Also, its internal
anatomy is well known (Bendl, 1908; Jones et al., 2008; Minelli,
1977; Von Kennel, 1882). Vila-Farré et al. (2011) mentioned the pos-
sible presence of interpopulation variability or cryptic species in Ibe-
rian specimens of M. terrestris. This variability consists of the
presence or absence of two small structures under the intestine
and above the penis papilla, lined with an epithelium that is histo-
logically very similar to that of the copulatory bursa and the geni-
to-intestinal duct (here called ‘‘intestinal structure’’ or ‘‘is‘‘).
Microplana terrestris feeds mainly on molluscs, but also on
earthworms and arthropods (McDonald and Jones, 2007; Winsor
et al., 2004) and it is very sensitive to changes in climate conditions
and highly dependent on very specific habitats: shaded soils with
moderate temperatures and with a high humidity during part of
the year (McDonald and Jones, 2007). In the Iberian Peninsula
these conditions are found in forests composed of various oak
(Quercus) species, riverbank forests, and beech (Fagus sylvatica) for-
ests, most of these being situated in the northern third of the Pen-
insula (Blanco-Castro et al., 2005). Beech and oak forests have been
extensively studied in Europe. Thus, pollen registers and genetic
variability provide a good account of their history through glacial
periods (Magri et al., 2006; Magri, 2008; Petit et al., 2002a,b). These
studies show a complex genetic structure with several refugia
being present in southern and central Europe. A general trend
can be recognized among both groups of trees in the Iberian Pen-
insula. There were small scattered refugia, only in the north for
Fagus, and during the Holocene the re-colonization resulted in a
differentiation among the eastern and western regions in the Pen-
insula. Although the story for the two types of trees is slightly dif-
ferent, Fagus practically did not cross the Pyrenees to the north,
whereas Quercus crossed in different directions in the west and
the east. All of this suggests the presence of two biogeographic re-
gions in the northern Iberian Peninsula (Blanco-Castro et al., 2005).
As Petit et al. (2002b) pointed out, it would be very interesting to
find out whether this biogeographic break is paralleled in species
having ranges encompassing both regions. In the case of terrestrial
planarians, given their dependence on the presence of humid for-
ests, we expect their distributional history to be correlated with
the refugial history of the wet forests.
For the present study, we have performed an intense sampling
of terrestrial planarians in the northern part of the Iberian Penin-
sula, particularly in order to document the prevalence of M. terres-
tris in that region. Further, we have performed a morphological
analysis of adult specimens, and have analyzed the genetic vari-
ability of two molecular markers (ITS-1 and COI) in order to exam-
ine whether there is any correlation between anatomical and
molecular variability. These two genes were used because they
have been previously demonstrated to present levels of variation
adequate for studies in planarian populations (Álvarez-Presas et
al., 2011; Lázaro et al., 2009; Mateos et al., 2009). Moreover, we
have estimated the population structure of M. terrestris at the
genetic level and its correlation to its habitat history.
2. Material and methods
2.1. Specimen collection
From 1996 to 2010, 68 sites located along an east–west transect
in the northern Iberian Peninsula were sampled in search of
terrestrial planarians, in particular M. terrestris (Fig. 1). Samples
were collected beneath rocks and fallen logs in moist forest floor
habitats (beech and oak gallery forests). In addition to the Spanish
samples, specimens of Microplana terrestris from England had been
collected beneath boards in a domestic garden near Thirsk, York-
shire (Ordenance Survey grid reference: SE378848, UK; McDonald
and Jones, 2007). Following collection, planarians were placed in
cool plastic containers (5 5 cm) that had been previously filled
with wet soil from the sampling sites. Each flatworm was photo-
graphed and its external morphological characters recorded. Spec-
imens were classified into morphospecies, according to Mateos
et al. (2009). Subsequently, animals were fixed in 100% alcohol
for molecular analyses or, when the size was enough to be sexually
mature, were cut into two fragments. A small anterior portion was
preserved for DNA analysis and the rest of the animal was fixed in
Steinmann’s fluid and then preserved in alcohol 70% for anatomical
studies.
2.2. Morphological analysis
Fragments fixed in Steinmann’s fluid and preserved in 70% alco-
hol were cleared in clove oil, dehydrated in an ascending series of
alcohol concentrations, and then embedded in synthetic paraffin
wax, cut at intervals of 5–7
l
m, and mounted on albumen-coated
slides. The sections were stained in Mallory–Heidenhain (cf. Sluys,
1989) or Harris hematoxylin (cf. Humason, 1967) and mounted in
DePeX. Reconstructions of the copulatory apparatus were obtained
using a camera lucida attached to a compound microscope. Vouch-
ers are deposited in the Netherlands Centre for Biodiversity Natu-
ralis (section ZMA), Leiden, the Netherlands.
2.3. DNA extraction, gene amplification and sequencing
Specimens preserved in 100% ethanol, were digested overnight
in lysis buffer and Proteinase K and DNA was extracted with the
Wizard
Ò
Genomic DNA Purification Kit (Promega, Madison, WI,
USA), following manufacturer’s instructions. DNA from specimens
used by Mateos et al. (2009) was re-extracted from the remaining
tissue kept in the Animal Biology Department (Universitat de Bar-
celona). An approximately 1 kb fragment of the cytochrome c oxi-
dase I (COI) gene was amplified by polymerase chain reaction
(PCR), extending the length of the sequence already amplified for
the Mateos et al. (2009)’ specimens (about 400 bp). We used the
following primers: BarS: GTTATGCCTGTAATGATTG (Álvarez-Presas
et al., 2011) and COIR: CCWGTYARMCCHCCWAYAGTAAA (Lázaro
et al., 2009). In addition to the PCR primers, internal primers, COIF:
CCNGGDTTTGGDATDRTWTCWCA, and BBC: CCAAAAGAAAAATCCT
TNCC (Álvarez-Presas et al., 2011) were used for sequencing. The
nuclear ribosomal internal transcribed spacer (ITS-1) fragment
was amplified using the primers ITS9F: GTAGGTGAACCTGCGG
AAGG and ITSR: TGCGTTCAAATTGTCAATGATC (Baguñà et al.,
1999). ITS-1 sequences had a final length of 500 bp. PCRs were
carried out in 25
l
l volumes, mixing approximately 1–10 ng/
l
lof
genomic DNA containing 0.75 units of Go Taq
Ò
DNA Polymerase
(Promega), 0.5X Green Go Taq
Ò
Flexi Buffer, with final concentra-
tions of 2 mM MgCl
2
, 0.1 mM each dNTP, 1
l
M each primer. For
COI, PCR conditions were as follows: an initial denaturation step
of 2 min at 95 °C followed by 30 cycles of 50 s at 94 °C, 45 s at
43 °C, and 50 s at 68 °C, and a final extension of 4 min at 68 °C.
In the case of ITS-1 the PCR conditions were an initial denaturation
step of 5 min at 94 °C followed by 30 cycles of 45 s at 94 °C, 30 s at
54 °C, and 50 s at 72 °C, and a final extension of 4 min at 72 °C.
Amplification products were purified with a vacuum manifold
(Multiscreen
Ò
HTS Vacuum Manifold, Millipore Corporation, Bille-
rica, MA 01821, USA). DNA sequences were determined from both
strands using Big-Dye Terminator (3.1, Applied Biosystems, Foster
492 M. Álvarez-Presas et al. / Molecular Phylogenetics and Evolution 64 (2012) 491–499
Author's personal copy
City, CA, USA) and the reaction products were separated on the ABI
Prism 3730 automated sequencer (Unitat de Genòmica dels Serveis
Científico-Tècnics de la UB).
2.4. Molecular species identification
Specimens were classified into morphospecies by their external
appearance. Only a small proportion of the specimens turned out
to be big enough and sexually mature to be morphologically ana-
lyzed. Therefore, we used COI barcodes to determine the taxo-
nomic status of the specimens. These sequences were analyzed
using Maximum Likelihood (see below), together with the follow-
ing: Microplana nana Mateos et al., 1998 (GenBank FJ969947, 48),
Microplana kwiskea Jones et al., 2008 (GenBank EU334574, 76),
Microplana scharffi (Von Graff, 1896) (GenBank DQ666044) and
Rhynchodemus species (GenBank FJ969946); and seven specimens
morphologically identified as Microplana terrestris (Hugh Jones,
personal communication) from England, including a sequence pre-
viously used in a study by Jones et al. (2008; GenBank EU334581).
2.5. Data analysis
Mitochondrial coding DNA sequences were translated into ami-
no acids to guide the nucleotide alignment using Clustal W, as
implemented in Bioedit v.7.0.9.0. program (Hall, 1999). All se-
quences were unambiguously aligned. For ITS-1 sequences, the
alignment was obtained using MAFFT version 6 (Katoh et al.,
2009) using maxiterate 1000 and globalpair in > out. We estimated
the DNA sequence evolution model that best fits the data using
jModelTest 0.1.1. (Posada, 2008), applying the Akaike information
criterion (AIC). Phylogenetic relationships were estimated by Max-
imum Likelihood (ML) (using RAxML 7.0.0 software; Stamatakis,
2006) and Bayesian inference (BI) (using MrBayes v. 3.1.2.;
Ronquist and Huelsenbeck, 2003). The best-fit model of sequence
evolution for COI was TPM2uf + U. Neither RaxML nor MrBayes
implement that model, hence we used in both analyses the GTR + U
model as this is the most general model within which the
TPM2uf + Uis nested. Bootstrap support (BS) values (Felsenstein,
1985) were obtained for ML trees from 10,000 replicates. In the
bayesian analyses we used four chains to allow heating and default
priors. Three million generations were run using the Markov Chain
Monte Carlo (MCMC) analysis in two independent runs for the BI.
Sampling was every 1000 generations. The stationarity and conver-
gence of the runs were checked by plotting Log likelihood values vs
number of generations and inspecting when the standard deviation
of split frequencies had reached < 0.01, respectively. For both
markers we produced Median Joining Networks (Bandelt et al.,
1999), using NETWORK 4.5.1.6.
Kimura-2-parameters (K2P) genetic distances were calculated
with MEGA5 (Tamura et al., 2011) to estimate whether the levels of
genetic differentiation among populations adjusted to the expected
for a within species analysis, as well as a measure to apply a rough
estimation of clade age. For population genetic analyses the program
DnaSP v5.10 (Librado and Rozas, 2009) was used. We estimated hap-
lotype (Hd) and nucleotide diversity (
p
;Nei, 1987); through the D
XY
parameter (Nei, 1987) levels of DNA divergence among populations
were examined. We also applied three neutrality tests to check
whether the DNA polymorphism levels conform to that expected un-
der the neutral hypothesis (Tajima’s D,Tajima, 1989;Fu’sFs, Fu, 1997
and R
2
,Ramos-Onsins and Rozas, 2002). Their statistical significance
was estimated by coalescence computer simulations. In some cases
we joined in the same group sequences from geographically close
localities. We excluded from those analyses sampling points repre-
sented by only one individual and that are geographically distant
from any other locality: Les Planes (sampling point B002, Barcelona),
Rabòs d’Empordà (G006, Girona), and Cellers (E023, Lleida).
A Mantel test was conducted to examine whether populations
showed the isolation-by-distance pattern. We used the F
ST
genetic
distances between all pairs of populations using Weir’s (1990) esti-
mator and the log of the geographic distances in km, and con-
ducted the Mantel test using the Isolation by Distance Web
Service 3.16 (Jensen et al., 2005).
3. Results
3.1. Species identification and distribution
M. terrestris was detected at 24 of the 68 sampling sites, belong-
ing to 15 Spanish localities situated in Coruña, Asturias, Logroño,
Navarra, Huesca, Barcelona, Lleida and Girona (Table 1,Fig. 1)
and represented 64.5% of the total number of terrestrial planarians
found at these localities. Twenty-nine M. terrestris were fixed for
morphological and molecular analyses; 21 of those were juveniles.
Also, some of the 60 available Iberian individuals for molecular
analyses could not be sequenced, so that finally 57 COI and 51
ITS-1 sequences and morphological data from eight sexually ma-
ture individuals were used in this study.
The ML phylogenetic analysis resulted in 11 mitochondrial
clades (Supplementary data Fig. 1), with M. terrestris showing the
higher frequency and abundance (Table 1). In the tree obtained,
the 57 individuals identified as M. terrestris by their external appear-
ance constituted a monophyletic group with the 7 M. terrestris
Fig. 1. Area sampled in this study. Numbers indicate the localities where Microplana terrestris has been found (see Table 1 for the exact location of the different sampling sites
within each location). Circles group eastern and western clade populations, lines connect populations geographically situated far from their genetic clade. M## codes indicate
other morphotypes present along with M. terrestris in the localities (see Table 1).
M. Álvarez-Presas et al. / Molecular Phylogenetics and Evolution 64 (2012) 491–499 493
Author's personal copy
specimens from the United Kingdom. Moreover, the morphological
analysis of the 8 individuals for which it was possible to obtain
sections of their copulatory apparatus showed all of them to have
the diagnostic features of the species M. terrestris. We also found
that morphotype M3 sensu Mateos et al. (2009) (corresponding to
Microplana robusta; c.f. Vila-Farré et al., 2011) was very close to
M. terrestris, hence we decided to use it as outgroup in the following
analyses.
3.2. Molecular datasets and phylogenetic relationships
Alignments of mitochondrial COI (822 bp; 64 M. terrestris,Table
2) and nuclear ITS-1 (543 bp; 54 M. terrestris, Table 2) sequences
were used for phylogenetic analyses (GenBank accession numbers
are shown in Supplementary Table 1).
The ML tree inferred from the COI gene data is shown in Fig. 2;
the phylogenetic tree inferred by BI displays the same topology
but with different statistical support in some branches (values
shown in Fig. 2). In BI, to avoid including all sampling points saved
prior to reaching stationarity and convergence of runs, the tree was
generated excluding the first 750 sampled trees as burn-in, corre-
sponding to the 25% of the samples (as recommended in MrBayes
manual) far over the values observed. Sequences group into two
main clades, corresponding to their geographic origin, either west
or east. The western animals belong to populations from Coruña,
Asturias, Logroño, Navarra, and Barcelona (localities 1–8 and 15
in Fig. 1). The eastern clade is composed of animals from Huesca,
Lleida, Girona (localities 9–14 in Fig. 1), and England. The phyloge-
netic trees are congruent with the reconstructed haplotype
network (Fig. 3). In both types of analyses the western populations
are differentiated into two groups: one including populations from
Navarra and from Barcelona and the other consisting of populations
from Coruña, Asturias, and Logroño. One of the sequences from
Navarra (086N034) is highly differentiated from the rest, but it
nonetheless clearly groups with the western group. In contrast,
eastern populations are grouped in only one cluster in the trees,
although one individual (316G215) has a basal position, and show
a close relationship among haplotypes in the network (Fig. 3).
Due to the high similarity between sequences, the topology
obtained for ITS-1 was unresolved (not shown). The median joining
network based on ITS-1 sequences (Fig. 3) shows that the majority of
populations share the same haplotype, with only a few sequences
differing in one or two positions. No structuring based on the nuclear
marker exists.
3.3. DNA sequence variation and neutrality tests
Table 2 shows a summary of nucleotide and haplotype diversity
in both genes. Mitochondrial gene values of
p
(nucleotide diversity)
are in general low (below
p
= 0.0057), with the exception of Navarra,
with a value of 0.0108 due to the presence of a very divergent
individual (086N034, locality 8, Table 1). The number of haplotypes
is the same in both regions (12) but the eastern ones are more similar
among each other. Haplotype diversity per population is usually
quite low. There are no shared haplotypes between east and west.
Within the regions, only Logroño shares haplotypes with Coruña
and Asturias (one with each) in the west, and Girona with Huesca
in the east. For ITS-1, the
p
value is low (0.0025 maximum) as well
as the number of polymorphic sites (S) and of haplotypes (h). In fact,
a single majority haplotype is shared by most individuals.
Given the reduced levels of variability in ITS-1 sequences, the
rest of the analyses were exclusively performed with COI data.
Within localities mean pairwise genetic distances estimated with
the K2P correction are in the range of 0–1%. Values between the
Table 1
Collection localities for Microplana terrestris and Microplana robusta (outgroup).
Species Province Nearest
town
Forest
type
Coordinates
(Lat./Long.)
Altitude
(m)
Sampling
point code
Loc
Map
#
Specimens
(M02)
Sp Code
sp
M. terrestris
A Coruña Pontedeume O N 43.417/W 8.063 60 C015 1 26 (13) 3 Mt, M03, M22
Asturias Cangas de Narcea B N 42.910/W 6.594 750 A223 2 1 (1) 1 Mt
Pola de Somiedo B N 43.077/W 6.231 939 A218 3 3 (2) 2 Mt, M22
Pola de Somiedo O + B N 43.135/W 6.335 640 A220 3 4 (1) 2 Mt, M22
Pola de Somiedo B + C N 43.125/W 6.326 699 A221 3 1 (1) 1 Mt
Pola de Somiedo O + B N 43.154/W 6.252 600 A222 3 1 (1) 1 Mt
Logroño Sierra de Cameros B N 42.046/W 2.685 1240 L048 4 4 (4) 1 Mt
Navarra Lesaka B N 43.273/W 1.775 250 N060 5 2 (2) 1 Mt
Etxalar B N 43.240/W 1.662 80 N021 6 7 (2) 3 Mt, M13, M14
Etxalar B N 43.242/W 1.629 80 N061 6 1 (1) 1 Mt
Irurita B N 43.113/W 1.539 270 N062 7 1 (1) 1 Mt
Isaba B N 42.878/W 0.863 1070 N034 8 1 (1) 1 Mt
Huesca Torla B N 42.648/W 0.066 1320 H201 9 1 (1) 1 Mt
Bielsa B N 42.666/E 0.094 1270 H200 10 3 (2) 2 Mt, M07
Lleida Cellers HO N 42.066/E 0.902 490 E023 11 4 (1) 2 Mt, M07
Girona Ribes de Freser B N 42.311/E 2.199 1060 G166 12 5 (4) 2 Mt, M01
Pardines B N 42.310/E 2.231 1263 G167 12 2 (2) 1 Mt
Planoles P N 42.312/E 2.108 1083 G212 12 10 (10) 1 Mt
Toses P N 42.323/E 2.049 1283 G213 12 1 (1) 1 Mt
Vallfogona de Ripollès P + O + HA N 42.192/E 2.259 831 G214 13 1 (1) 1 Mt
Vallfogona de Ripollès B + HA N 42.186/E 2.259 880 G215 13 2 (2) 1 Mt
Vallfogona de Ripollès B N 42.193/E 2.291 864 G217 13 1 (1) 1 Mt
Rabòs d’Empordà HO N 42.464/E 3.057 380 G006 14 10 (1) 4 Mt, M05, M07, M10
Barcelona Les Planes HO N 41.438/E 2.057 135 B002 15 1 (1) 1 Mt
M. robusta
A Coruña Pontedeume O N 43.417/W 8.063 60
Gerês P.N. Peneda Gerês (Portugal) O N41.791/W 8.138 696
# Specimens indicates the total number of specimens found in the locality and, in parentheses, how many belonged to M. terrestris;Sp indicates the number of genetic clades
detected in the molecular phylogenetic analysis; Code sp shows the morphotypes of the individuals not belonging to Microplana terrestris (Mt), codes M01 to M07 sensu
Mateos et al. (2009), codes M10 to M22 are new morphotypes not previously described; Forest type HO: holm-oak; O: oak; B: beech; P: pine; HA: hazel; C: chestnut; Loc Map
corresponds to the number of the locality indicated on the map of Fig. 1.
494 M. Álvarez-Presas et al. / Molecular Phylogenetics and Evolution 64 (2012) 491–499
Author's personal copy
western localities range from 0% to 3%, while the eastern values
vary between 0% and 1.6%. West and east present a difference of
2.4% to 4% and finally, the between-species difference is about
19% (M. terrestris vs M. robusta). F
ST
values are high between the
eastern and the western groups (0.73) as well as within the
western Peninsula (four groups: Coruña, Asturias, Logroño and
Navarra, 0.81). In contrast, F
ST
is low within the eastern group
(two groups: Girona and Huesca, 0.13).
Table 2
Summary of molecular diversity estimates.
Province (Locality)nNo. of haplotypes (h) Haplotype diversity (Hd) No. of polymorphic/variable sites (S) Nucleotide diversity (
p
)
COI
West Coruña (1) 13 3 0.513 8 0.0027
Asturias (2,3) 6 3 0.600 7 0.0033
Logroño (4) 4 2 0.500 1 0.0006
Navarra (5,6,7,8) 7 6 0.952 29 0.0108
East Huesca (9,10) 3 3 1.000 7 0.0057
Girona (12,13,14) 22 7 0.541 16 0.0023
England 7 3 0.667 5 0.0030
Western IP 30 12 0.800 43 0.0141
Eastern IP 26 12 0.674 18 0.0031
All localities 64 24 0.883 60 0.0210
ITS-1
West Coruña (1) 10 5 0.844 3 0.0025
Asturias (2,3) 6 1 0.000 0 0.0000
Logroño (4) 4 2 0.667 2 0.0025
Navarra (5,6,7,8) 5 2 0.600 1 0.0011
East Huesca (9,10) 3 1 0.000 0 0.0000
Girona (12,13) 21 2 0.095 1 0.0002
England 3 2 0.667 1 0.0012
Western IP 26 4 0.403 3 0.0009
Eastern IP 24 2 0.083 1 0.0002
All localities 54 5 0.242 4 0.0006
Fig. 2. Maximum Likelihood tree inferred from the COI dataset. Values at nodes are bootstrap values (10,000 replicates) (above) and Posterior Probabilities (below). Scale bar
represents number of substitutions per site. The (+) and () indicate presence or absence of the ‘‘intestinal structure’’ on those individuals that could be studied
morphologically. The legend indicates the locality color code. Taxon labels are the same as in supplementary Table 1.
M. Álvarez-Presas et al. / Molecular Phylogenetics and Evolution 64 (2012) 491–499 495
Author's personal copy
Neutrality tests were performed for those populations for which
more than 3 individuals were available. In the east of the Peninsula
this was only possible for Girona. Therefore, and in view of the geo-
graphical proximity of the eastern localities as well as their genetic
closeness, we also performed a neutrality test including all eastern
sampling points. The values of Tajima’s Dare negative for all the
regions studied, except for the United Kingdom. For the popula-
tions of Girona alone and for the eastern region the test is signifi-
cant (Table 3). Fu’s Fs is statistically significant only for the eastern
localities when grouped together but not for Girona alone. Lastly,
R
2
(a test best suited for low numbers of individuals) was signifi-
cant both for Girona and the eastern group. When we tested the
correlation between genetic distance (F
ST
) and log-linear
geographic distance, comparing all populations pairs, a p-value of
Mantel test lower than 0.05 (0.011) showed that the levels
of genetic differentiation have the characteristic pattern of
isolation-by-distance. Analyzing the western and eastern popula-
tions separately (establishing the comparison only between pairs
of western or eastern populations), no statistically significant p-
values were found (0.084 and 0.085 respectively).
There are two unexpected results. First, the single individual
from Barcelona (in the east) shares its haplotype with one individ-
ual from Navarra (western clade). Second, there is a great similarity
between the UK individuals and those from the eastern clade in
northern Spain, some of them sharing a haplotype with individuals
from Girona (Fig. 1 and 2).
3.4. Morphology
Eight mature specimens were examined for the presence of the
characteristic intestinal structure (‘‘is’’) described by Vila-Farré
et al. (2011). We found animals with this structure in the western
clade (two individuals from sampling point C015, and one in N061,
Fig. 2). For the specimens from Navarra (N021, N061, N062) only
one presents this feature (215N061), albeit with only one of the
two intestinal structures being present. None of the eastern speci-
mens analyzed (sampling points G213, G215) showed it, albeit that
the sample size is very small (Fig. 2;Supplementary Table 1).
4. Discussion
4.1. Morphological variation vs genetic structure
The morphological variation of the ‘‘is’’ feature is clearly not
uniform through the species range, not being exclusive of any of
the molecular clades detected. Consequently, we here interpret
this structure as a morphological polymorphism not related to
any recent speciation event, therefore rejecting the possibility of
a split of M. terrestris into two cryptic species in the north of the
Peninsula, proposed by Vila-Farré et al. (2011). Moreover, the ge-
netic distances found between populations, either within the east-
ern and western clades or among them, overlap and fall within the
ranges found for freshwater planarian species (Lázaro et al., 2009).
4.2. Genetic variation in Microplana terrestris
Values of COI nucleotide diversity (
p
) are relatively low when
compared with Brazilian populations of other terrestrial flatworm
species (Álvarez-Presas et al., 2011), but are in the same range as
values reported for land planarians from Australia (Sunnucks et al.,
2006). Most localities show non-significant values for Tajima’s D
and R
2
so that these populations may be considered close to the neu-
tral model, reflecting a certain stabilitiy. The locality of Girona and
the entire eastern clade, on the contrary, present significant negative
values for Dand in the left tail for R
2
, which can be interpreted to
Fig. 3. Median joining networks of the mitochondrial haplotypes and ITS-1 alleles. COI gene haplotypes are situated approximately at their geographical location.
Table 3
Summary of COI neutrality tests.
Study region nNeutrality test
Tajima’s DFu’s F
s
Ramos-Onsins and Rozas R
2
D95% CI F
s
95% CI R
2
95% CI
Coruña 13 0.483 (1.775, 1.773) 2.812 (2.884, 4.149) 0.141 (0.106, 0.256)
Asturias 6 0.631 (1.408, 1.753) 1.624 (2.518, 3.696) 0.222 (0.141, 0.373)
Logroño 4 0.612 (0.754, 1.893) 0.172 (0.887, 1.716) 0.222 (0.000, 0.833)
Navarra 7 1.435 (1.567, 1.662) 0.062 (2.814, 4.581) 0.232 (0.113, 0.288)
Girona 22 2.088
*
(1.729, 1.907) 1.223 (3.190, 4.442) 0.086
*
(0.082, 0.224)
Eastern IP (9, 10, 11, 12, 13, 14) 26 1.733
*
(1.707, 1.853) 3.519
*
(3.808, 4.983) 0.065
**
(0.072, 0.206)
England 7 1.057 (1.553, 1.811) 1.77 (2.476, 3.968) 0.230 (0.137, 0.350)
*
P< 0.05.
**
P< 0.01.
496 M. Álvarez-Presas et al. / Molecular Phylogenetics and Evolution 64 (2012) 491–499
Author's personal copy
signal a relatively recent population expansion, although it could
also be a consequence of purifying selection acting on the mitochon-
drial genome. The results of nuclear and mitochondrial genes are not
fully coincident. The median joining network shows that variation in
the nuclear marker is much lower than in the mitochondrial gene,
rendering this DNA fragment nearly uninformative at this level.
The COI data (variability, phylogenetic clades, haplotypes network)
reveal a considerable genetic structure of M. terrestris populations
along an east–west transect in the northern part of the Iberian Pen-
insula. The structure may be a consequence of the mtDNA variation
being affected by some sort of selection, perhaps ecological. How-
ever the habitat variables recorded in the present study (altitude
and type of forest) do not present any correlation with the genetic
clades. The distances found among and within groups for COI, reach-
ing values of 3% and 4%, suggest that this differentiation cannot be
due to events as recent as the last glacial period (ending 18 Kya, He-
witt, 1996, 1999). Although we cannot calibrate a molecular clock
with the present data, these levels of differentiation should have
needed a time in the order of a few million years to accumulate, with
the rates usually found in most animals (from 0.5 to 2% divergence
per million year, Borer et al., 2010; Brown et al., 1979; Lázaro
et al., 2011). The genetic structure observed in the COI sequences,
therefore, may have resulted from the coincidence of different pro-
cesses. On the one hand, before the Pleistocene the species popula-
tions differentiated along its distribution, either in an isolation-by-
distance pattern or as a consequence of a selective pressure. On
the other hand, the isolation of some of these populations during
the glaciations may have resulted from the disappearance of parts
of their forest habitat.
4.3. Phylogeographic patterns and refuges
In view of the fact that these animals are dependent on the pres-
ence of wet forest soils, the existence of their putative refuges may
be reconstructed from information on the presence of humid for-
ests in the north of the Iberian Peninsula before, during and after
the glacial periods. Extensive studies based on fossil wood, pollen
registers and genetic variation have been published mainly for
beech and oak forests in Europe (Magri et al., 2006; Magri, 2008;
Petit et al., 2002a,b; Petit et al., 2003; Ramil-Rego et al., 2000).
According to these studies, beech forests were reduced during
the last glacial periods to a few refugia of extremely small size. Iso-
zymes data show the presence of three groups in the present day
beech forests in the north of the Iberian Peninsula. One group is re-
stricted to the Cantabrian Mountains, one to the western Pyrenees,
and the third group occurs in the eastern part and is connected
with the populations in southern France (Magri et al., 2006; Magri,
2008); these three groups originated from different refugia. During
the late Holocene, after the Last Glacial Maximum (LGM), there
would have been a slow expansion of these forests. However, they
would not have crossed the Pyrenees northward, and therefore Ibe-
rian Peninsula beech did not contribute to the re-colonization of
this type of forest in northern Europe. Studies of chloroplast se-
quences from oaks in the Iberian Peninsula show that the haplo-
types present in the Cantabrian and Basque regions most
probably persisted in a refuge on the west coast, whereas the hap-
lotypes found on the south-east slopes of the Pyrenees and in Cata-
lonia may have arrived from Italy, or even from the Balkans
through France, during the late-glacial interstadial (similarly to
what has been found for Chorthippus parallellus,Alnus glutinosa
and Triturus cristatus (cf. Hewitt, 1999; Petit et al., 2002b). Thus,
Fagus and Quercus coincide in showing a clear differentiation
among eastern and western populations in the north of the Iberian
Peninsula, and in the fact that the populations in the east probably
have an eastern European origin, more or less distant, which will
explain the important genetic divergence among both sides.
The mitochondrial genetic differentiation between the eastern
and western clades of M. terrestris, the marked structure within
the western region, and the low genetic variability and expansion
signals in the eastern part, may all have resulted from the complex
history of their habitat, i.e. the wet forests. When the glacial peri-
ods began, the Microplana populations that were already widely
distributed through Europe and had already differentiated, may
have become isolated in a few distant localities: the remnants of
the wet forests. In the west, the populations may have expanded
their range from these refuges and established secondary contacts
after the LGM, probably following the northern expansion of oak,
resulting in the present populations in Logroño, Asturias and
Coruña. On the other hand, the populations from the Pyrenees
(Navarra) would have remained isolated from the rest and among
them resulting in their high differentiation (a single individual col-
lected in locality 8 at high altitude has an extremely divergent hap-
lotype with respect to the individuals coming from the valley
regions). This fact suggests that due to the orography of the Pyre-
nees the genetic structure produced during the reduction of habitat
in the glacial period has persisted until today, a situation that is
also found for beech (Magri et al., 2006; Magri, 2008) and a species
of gasteropod (Vialatte et al., 2008) in that region.
The eastern Microplana populations may have arrived with oak
and beech forests (Magri et al., 2006; Petit et al., 2002b). Petit et al.
(2002b) hypothesize that oak populations coming from the east
and established in Catalonia would then have constituted a ‘‘sec-
ondary refuge’’ during the colder period of the Younger Dryas
(11–10 ky BP). The low genetic structure found in eastern Micro-
plana populations may have resulted from the reduced number
of refugia and their recent expansion, following the humid forests
(which started in the Pyrenees 4–3 kya (Magri, 2008; Petit et al.,
2002b)). On the basis of this hypothesis, we predict that the Micro-
plana populations in the eastern Iberian Peninsula have haplotypes
that are more similar to the southern France populations than to
the western clade. This hypothesis also explains the high genetic
distances found between eastern and western clades in the Iberian
Peninsula, and the fact that the other terrestrial planarian morpho-
types found in the eastern and western regions are exclusive of
each area (Table 1). In this case, however, the isolation-by-distance
pattern that we detected when analyzing the populations pairs
may be an artefact due to the genetic differentiation between these
two groups of populations and to the existence of a barrier (geolog-
ical, geographic, climatic or ecological) that still today keeps both
groups separated.
4.4. British-East clade relationship
The fact that M. terrestris specimens from England group among
the north-eastern populations of the Iberian Peninsula (Fig. 2)is
difficult to explain as a consequence of the known history of the
humid forest. The arrival of the species in the British Isles cannot
be explained by Fagus dispersion, since beech did not colonize cen-
tral and northern Europe from the Iberian Peninsula (Magri et al.,
2006). Nevertheless, palaeobotanical data support a spread of oak
from the west of the Iberian Peninsula along the Atlantic coast of
Europe and the exposed English Channel to the British Isles (Petit
et al., 2002b). With these data one may expect British Microplana
terrestris to be closely related to the western Iberian clade, leaving
unexplained the close affinity between the British and eastern Ibe-
rian clade. However, in some localities in the British Isles the pres-
ence of two oak haplotypes coming from the south of France and
Catalonia (Cottrell et al., 2002; Petit et al., 2002b) has been de-
tected. This presence has been interpreted as the result of recent
anthropogenic introduction due to oak planting and management
in Britain (Cottrell et al., 2002). Although the localities of the
terrestrial planarians analyzed do not match exactly those of the
M. Álvarez-Presas et al. / Molecular Phylogenetics and Evolution 64 (2012) 491–499 497
Author's personal copy
exotic oak haplotypes, it is possible that after having been intro-
duced, terrestrial planarians have dispersed through the island.
Other well documented examples of human introduction of terres-
trial planarians with plants already exist in the British Isles, as is
the case of some Neotropical species (Cannon et al., 1999; Jones
and Boag, 1996). However, the vast distribution of M. terrestris
through the British Isles (Jones, personal communication) casts
some doubt on this interpretation. The only M. terrestris specimen
from Barcelona that clusters within the western clade seems an-
other likely case of human introduction.
It will be necessary to do a wider sampling of M. terrestris in the
British Isles to find out whether the haplotypes found in the pres-
ent study are the only ones present there or, alternatively, whether
they are mixed with others related to the western clade of the Ibe-
rian Peninsula. In the latter case, the situation will be equivalent to
the one found for oaks. In the first case, if only introduced haplo-
types for terrestrial planarians will be found, there are two possible
explanations. One is that Microplana populations from the western
Iberian Peninsula were not able to follow the rapid expansion of
oaks through the British channel and, hence, the animals intro-
duced from the south of France/Catalonia are the only Microplana
that arrived to the British Isles. The second explanation would be
that planarians from the western Peninsula crossed the channel
but were replaced by the recently introduced M. terrestris.
Despite the scarcity of samples, due to the difficulty of collect-
ing a great number of terrestrial planarians, our data indicate a link
between the history of these animals and the evolution of wet
forests during the last glacial period. These data suggest that ter-
restrial planarians, as other edaphic fauna, can be good models to
test phylogeographical hypotheses on the evolution of forest
communities.
Acknowledgments
This research was supported by CGL2008-00378/BOS Grant
(Spanish Ministerio de Ciencia e Innovación) to M.R. We are grate-
ful for the financial contribution of SEG and REDES for M.A.-P.’s vis-
it to London. Jill McDonald and Hugh Jones are thanked for
identifying and making available British animals. Dr. Tim Little-
wood (NHM, London), kindly made available the body tissue of
T4 individual. We also thank Dr. Julio Rozas for his advice and
insightful discussions regarding population genetic analyses and
molecular evolution. Thanks are also due to Cristina Cabrera and
Eduard Solà for collecting some individuals and Gema Blasco for
technical support.
Appendix A. Supplementary material
Supplementary data associated with this article can be found, in
the online version, at http://dx.doi.org/10.1016/j.ympev.2012.05.
001.
References
Álvarez-Presas, M., Carbayo, F., Rozas, J., Riutort, M., 2011. Land planarians
(Platyhelminthes) as a model organism for fine-scale phylogeographic
studies: understanding patterns of biodiversity in the Brazilian Atlantic Forest
hotspot. J. Evol. Biol. 24, 887–896.
Baguñà, J., Carranza, S., Pala, M., Ribera, C., Giribet, G., Arnedo, M.A., Ribas, M.,
Riutort, M., 1999. From morphology and karyology to molecules. New methods
for taxonomical identification of asexual populations of freshwater planarians.
A tribute to Professor Mario Benazzi. Ital. J. Zool. 66, 207–214.
Bandelt, H., Forster, P., Röhl, A., 1999. Median-joining networks for inferring
intraspecific phylogenies. Mol. Biol. Evol. 16, 37–48.
Bendl, W.E., 1908. Beiträge zur Kenntnis des Genus Rhynchodemus. Z. wiss Zool. 89,
525–554.
Blanco-Castro, E., Casado-González, M.A., Costa-Tenorio, M., Escribano-Bombín, R.,
García-Antón, M., Génova-Fuster, M., Gómez-Manzaneque, A., Gómez-
Manzaneque, F., Moreno-Saiz, J.C., Morla-Jurasti, C., Regato-Pajares, P., Sainz-
Ollero, H. (Eds.), 2005. Los bosques ibéricos: Una interpretación geobotánica.
Editorial Planeta, Barcelona.
Borer, M., Alvarez, N., Buerki, S., Margraf, N., Rahier, M., Naisbit, R.E., 2010. The
phylogeography of an alpine leaf beetle: Divergence within Oreina elongata
spans several ice ages. Mol. Phylogenet. Evol. 57, 703–709.
Brown, W.M., George, M., Wilson, A.C., 1979. Rapid evolution of animal
mitochondrial DNA. Proc. Natl. Acad. Sci. 76, 1967–1971.
Cannon, R.J.C., Baker, R.H.A., Taylor, M.C., Moore, J.P., 1999. A review of the status of
the New Zealand flatworm in the UK. Ann. Appl. Biol. 135, 597–614.
Carbayo, F., Froehlich, E.M., 2008. Estado do conhecimento dos macroturbelários
(Platyhelminthes) do Brasil. Biota Neotrop. 8 (197), 177.
Carbayo, F., Leal-Zanchet, A.M., Vieira, E.M., 2002. Terrestrial flatworm
(Platyhelminthes: Tricladida: Terricola) diversity versus man-induced
disturbance in an ombrophilous forest in southern Brazil. Biodivers. Conserv.
11, 1091–1104.
Cottrell, J.E., Munro, R.C., Tabbener, H.E., Gillies, A.C.M., Forrest, G.I., Deans, J.D.,
Lowe, A.J., 2002. Distribution of chloroplast DNA variation in British oaks
(Quercus robur and Q. petraea): the influence of postglacial colonisation and
human management. For. Ecol. Manage. 156, 181–195.
Fauna Europaea Web Service, 2004. Fauna Europaea Version 1.1. <http://
www.faunaeur.org>.
Felsenstein, J., 1985. Confidence limits on phylogenies: an approach using the
bootstrap. Evolution 39, 783–791.
Fick, I.A., Leal-Zanchet, A.M., Vieira, E.M., 2006. Community structure of land
flatworms (Platyhelminthes, Terricola): comparisons between Araucaria and
Atlantic forest in Southern Brazil. Inv. Biol. 125, 306–313.
Fonseca, C.R., Ganade, G., Baldissera, R., Becker, C.G., Boelter, C.R., Brescovit, A.D.,
Campos, L.M., Fleck, T., Fonseca, V.S., Hartz, S.M., Joner, F., Käffer, M.I., Leal-
Zanchet, A.M., Marcelli, M.P., Mesquita, A.S., Mondin, C.A., Paz, C.P., Petry, M.V.,
Piovensan, F.N., Putzke, J., Stranz, A., Vergara, M., Vieira, E.M., 2009. Towards an
ecollogically-sustainable forestry in the Atlantic Forest. Biol. Conserv. 142,
1209–1219.
Fu, Y.X., 1997. Statistical tests of neutrality of mutations against population growth,
hitchhiking and background selection. Genetics 147, 915–925.
Hall, T.A., 1999. BioEdit: a user-friendly biological sequence alignment editor
and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 41, 95–
98.
Hewitt, G.M., 1996. Some genetic consequences of ice ages, and their role in
divergence and speciation. Biol. J. Linn. Soc. 58, 247–276.
Hewitt, G.M., 1999. Post-glacial re-colonization of European biota. Biol. J. Linn. Soc.
68, 87–112.
Humason, G.L., 1967. Animal Tissue Techniques, second ed. W. H. Freeman, San
Francisco, CA.
Jensen, J., Bohonak, A., Kelley, S., 2005. Isolation by distance, web service. BMC
Genet. 6, 13.
Johns, P.M., 1998. The New Zealand terrestrial flatworms: a 1997–98 perspective.
Pedobiologia 42, 464–468.
Jones, H.D., 2005. Identification: British land flatworms. British Wildlife 16, 189–
194.
Jones, H.D., Boag, B., 1996. The distribution of New Zealand and Australian
terrestrial flatworms (Platyhelminthes: Turbellaria: Tricladida: Terricola) in
the British Isles – the Scotish survey and Megalab Worms. J. Nat. Hist. 30, 955–
975.
Jones, H.D.J., Webster, B.L., Littlewood, D.T.J., McDonald, J.C., 2008. Molecular and
morphological evidence for two new species of terrestrial planarians of the
genus Microplana (Platyhelminthes; Turbellaria; Tricladida; Terricola) from
Europe. Zootaxa 1945 (1–38), 1.
Katoh, K., Asimenos, G., Toh, H., 2009. Multiple alignment of DNA sequences with
MAFFT. Methods Mol. Biol. 537, 39–64.
Kawakatsu, M., Froehlich, E.M., Jones, H.D., Sasaki, R.E., Ogren, G.-Y., 2003. Additions
and corrections of the previous land planarian indices of the world – 11. Bull.
Fuji Women’s Univ. 41, 89–114.
Lázaro, E.M., Sluys, R., Pala, M., Stocchino, G.A., Baguñà, J., Riutort, M., 2009.
Molecular barcoding and phylogeography of sexual and asexual freshwater
planarians of the genus Dugesia in the Western Mediterranean
(Platyhelminthes, Tricladida, Dugesiidae). Mol. Phyl. Evol. 52, 835–845.
Lazaro, E., Harrath, A.H., Stocchino, G., Pala, M., Baguna, J., Riutort, M., 2011.
Schmidtea mediterranea phylogeography: an old species surviving on a few
Mediterranean islands? BMC Evol. Biol. 11, 274.
Leal-Zanchet, A.M., Baptista, V., Campos, L.M., Raffo, J.F., 2011. Spatial and temporal
patterns of land flatworm assemblages in Brazilian Araucaria forests. Invertebr.
Biol. 130, 25–33.
Librado, P., Rozas, J., 2009. DnaSP v5: a software for comprehensive analysis of DNA
polymorphism data. Bioinformatics 25, 1451–1452.
Lindroth, C.H., Anderson, H., Bödvardsson, H., Richter, S.H., 1973. Surtsey, Iceland.
The development of a new fauna, 1963–1970. Terrestrial invertebrates.
Entomol. Scandinavica, Suppl. 5, 146–147.
Magri, D., 2008. Patterns of post-glacial spread and the extent of glacial refugia of
European beech (Fagus sylvatica). J. Biogeogr. 35, 450–463.
Magri, D., Vendramin, G.G., Comps, B., Dupanloup, I., Geburek, T., Gömöry, D.,
Latałowa, M., Litt, T., Paule, L., Roure, J.M., Tantau, I., van der Knaap, W.O., Petit,
R.J., de Beaulieu, J.L., 2006. A new scenario for the Quaternary history of
European beech populations: Palaeobotanical evidence and genetic
consequences. New Phytol. 171, 199–221.
Mateos, E., Giribet, G., Carranza, S., 1998. Terrestrial planarians (Platyhelminthes,
Terricola) from the Iberian Peninsula: first records of the family
498 M. Álvarez-Presas et al. / Molecular Phylogenetics and Evolution 64 (2012) 491–499
Author's personal copy
Rhynchodemidae, with the description of a new Microplana species. Contrib.
Zool. 67, 267–276.
Mateos, E., Cabrera, C., Carranza, S., Riutort, M., 2009. Molecular analysis of the
diversity of terrestrial planarians (Platyhelminthes, Tricladida, Continenticola)
in the Iberian Peninsula. Zool. Scr. 38, 637–649.
McDonald, J.C., Jones, H.D., 2007. Abundance, reproduction, and feeding of three
species of British terrestrial planarians: observations over 4 years. J. Nat. Hist.
41, 293–312.
Minelli, A., 1977. A taxonomic review of the terrestrial planarians of Europe. Boll.
Zool. 44, 399–419.
Müller, O.F., 1774. Vermium terrestrium et fluviatilium, seu animalium
infusoriorum, helminthicorum et testaceorum, non marinorum, succincta
historia. Vol. primi pars altera. Havniae et Lipsiae 4, 52–72.
Nei, M. (Ed.), 1987. Molecular Evolutionary Genetics. Columbia University Press,
New York.
Ogren, R.E., Kawakatsu, M., 1989. Index to the species of the Family
Rhynchodemidae (Turbellaria, Tricladida, Terricola). Part II: Microplaninae.
Bull. Fuji Women’s College 27, 53–111.
Ogren, R.E., Kawakatsu, M., Froehlich, E.M., 1997. Additions and corrections of the
previous land planarian indices of the world (Turbellaria, Seriata, Tricladida,
Terricola) Addendum IV. Geographic locus index: Bipaliidae; Rhynchodemidae
(Rhynchodeminae; Microplaninae); Geoplanidae (Geoplaninae; Caenoplaninae;
Pelmatoplaninae). Bull. Fuji Women’s College 35, 63–103.
Petit, R.J., Csaikl, U.M., Bordács, S., Burg, K., Coart, E., Cottrell, J., van Dam, B., Deans,
J.D., Dumolin-Lapègue, S., Fineschi, S., Finkeldey, R., Gillies, A., Glaz, I.,
Goicoechea, P.G., Jensen, J.S., König, A.O., Lowe, A.J., Madsen, S.F., Mátyás, G.,
Munro, R.C., Olalde, M., Pemonge, M.-H., Popescu, F., Slade, D., Tabbener, H.,
Taurchini, D., de Vries, S.G.M., Ziegenhagen, B., Kremer, A., 2002a. Chloroplast
DNA variation in European white oaks: phylogeography and patterns of
diversity based on data from over 2600 populations. For. Ecol. Manage. 156,
5–26.
Petit, R.J., Brewer, S., Bordács, S., Burg, K., Cheddadi, R., Coart, E., Cottrell, J., Csaikl,
U.M., Van Dam, B., Deans, J.D., Espinel, S., Fineschi, S., Finkeldey, R., Glaz, I.,
Goicoechea, P.G., Jensen, J.S., König, A.O., Lowe, A.J., Madsen, S.F., Mátyás, G.,
Munro, R.C., Popescu, F., Slade, D., Tabbener, H., De Vries, S.G.M., Ziegenhagen,
B., De Beaulieu, J.-L., Kremer, A., 2002b. Identification of refugia and post-glacial
colonisation routes of European white oaks based on chloroplast DNA and fossil
pollen evidence. For. Ecol. Manage. 156, 49–74.
Petit, R.J., Aguinagalde, I., de Beaulieu, J., Bittkau, C., Brewer, S., Cheddadi, R., Ennos,
R., Fineschi, S., Grivet, D., Lascoux, M., Mohanty, A., Müller-Starck, G., Demesure-
Musch, B., Palmé, A., Martín, J.P., Rendell, S., Vendramin, G.G., 2003. Glacial
refugia: hotspots but not melting pots of genetic diversity. Science 300, 1563–
1565.
Posada, D., 2008. JModelTest: phylogenetic model averaging. Mol. Biol. Evol. 25,
1253–1256.
Ramil-Rego, P., Guitian, M.A.R., Sobrino, C.M., Gomez-Orellana, L., 2000. Some
considerations about the postglacial history and recent distribution of Fagus
sylvatica in the NW Iberian Peninsula. Folia Geobot. 35, 241–271.
Ramos-Onsins, S.E., Rozas, J., 2002. Statistical properties of new neutrality tests
against population growth. Mol. Biol. Evol. 19, 2092–2100.
Ronquist, F., Huelsenbeck, J.P., 2003. MRBAYES 3: Bayesian phylogenetic inference
under mixed models. Bioinformatics 19, 1572–1574.
Semper, G., 1881. Animal life as affected by the natural conditions of existence. In:
D. Appletone & Co. (Ed.), Lectures at the Lowel Institute, Boston, 1877. New
York, pp. 186–187.
Sluys R., 1989. A Monograph of the Marine Triclads. Rotterdam and Brookfield: A.
Balkema, 463pp.
Sluys, R., 1999. Global diversity of land planarians (Platyhelminthes, Tricladida,
Terricola): a new indicator-taxon in biodiversity and conservation studies.
Biodivers. Conserv. 8, 1663–1681.
Stamatakis, A., 2006. RAxML-VI-HPC: maximum likelihood-based phylogenetic
analyses with thousands of taxa and mixed models. Bioinformatics 22, 2688–
2690.
Sunnucks, P., Blacket, M.J., Taylor, J.M., Sands, C.J., Ciavaglia, S.A., Garrick, R.C., Tait,
N.N., Rowell, D.M., Pavlova, A., 2006. A tale of two flatties: different responses of
two terrestrial flatworms to past environmental climatic fluctuations at
Tallaganda in montane southeastern Australia. Mol. Ecol. 15, 4513–4531.
Tajima, F., 1989. Statistical method for testing the neutral mutation hypothesis by
DNA polymorphism. Genetics 123, 585–595.
Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA5:
molecular evolutionary genetics analysis using maximum likelihood,
evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28,
2731–2739.
Vialatte, A., Guiller, A., Bellido, A., Madec, L., 2008. Phylogeography and historical
demography of the Lusitanian snail Elona quimperiana reveal survival in
unexpected separate glacial refugia. BMC Evol. Biol. 8, 339.
Vila-Farré, M., Mateos, E., Sluys, R., Romero, R., 2008. Terrestrial planarians
(Platyhelminthes, Tricladida, Terricola) from the Iberian Peninsula: new
records and description of three new species. Zootaxa 1739, 1–20.
Vila-Farré, M., Sluys, R., Mateos, E., Jones, H.D., 2011. Land planarians
(Platyhelminthes: Tricladida: Geoplanidae) from the Iberian Peninsula: new
records and description of two new species, with a discussion on ecology. J. Nat.
Hist. 45, 869–891.
Von Graff, L., 1896. Ueber die Morphologie des Geschlecht-sapparates der
landplanarien. Verhandl. deutsch. Zool. Ges. 6, 75–93.
Von Kennel, J., 1882. Die in Deutschland gefundenen Landplanarien Rhynchodemus
terrestris O. F Müller und Geodesmus bilineatus Mecznikoff. Arb. zool. Inst.
Wurzburg 5, 120–160.
Weir, B.S., 1990. Genetic Data Analysis: Methods for Discrete Population Analysis,
Sunderland, MA.
Winsor, L., 1998. Collection, handling, fixation, histological and storage procedures
for taxonomic studies of terrestrial flatworms (Tricladida: Terricola).
Pedobiologia 42, 405–411.
Winsor, L., Johns, P.M., Barker, G.M., 2004. Terrestrial planarians (Platyhelminthes:
Tricladida: Terricola) predaceous on terrestrial gastropods. In: Barker, G.M.
(Ed.), Natural Enemies of Terrestrial Molluscs. CAB International, Wallingford,
pp. 227–278.
M. Álvarez-Presas et al. / Molecular Phylogenetics and Evolution 64 (2012) 491–499 499
