Isolation and characterization of microsatellite loci in the Neotropical fish Astyanax altiparanae (Teleostei: Characiformes) and cross-species amplification

Article (PDF Available)inJournal of Genetics 91(1):e24-7 · April 2012with45 Reads
DOI: 10.1007/s12041-012-0143-9 · Source: PubMed
c
Indian Academy of Sciences
ONLINE RESOURCES
Isolation and characterization of microsatellite loci in the Neotropical
fish Astyanax altiparanae (Teleostei: Characiformes)
and cross-species amplification
ROSÂNGELA LOPES ZAGANINI
1
, DIOGO TERUO HASHIMOTO
1
, LUIZ HENRIQUE GARCIA PEREIRA
2
,
CLAUDIO OLIVEIRA
2
, FERNANDO FERNANDES MENDONÇA
2
, FAUSTO FORESTI
2
and FÁBIO PORTO-FORESTI
1
1
Departamento de Ciências Biológicas, Faculdade de Ciências, Universidade Estadual Paulista,
Júlio de Mesquita Filho, 17033-360, Bauru, SP, Brazil
2
Departamento de Morfologia, Instituto de Biociências, Universidade Estadual Paulista, Júlio de Mesquita Filho,
18618-000, Botucatu, SP, Brazil
[Zaganini R. L., Hashimoto D. T., Pereira L. H. G., Oliveira C., Mendonça F. F., Foresti F. and Porto-Foresti F. 2012 Isolation and characteri-
zation of microsatellite loci in the Neotropical fish Astyanax altiparanae (Teleostei: Characiformes) and cross-species amplification. J. Genet.
91, e24–e27. Online only: http://www.ias.ac.in/jgenet/OnlineResources/91/e24.pdf]
Introduction
We isolated and characterized 11 polymorphic microsatellite
loci from the Neotropical fish Astyanax altiparanae, consid-
ered of economic interest, whose stocks have been seriously
endangered by the introduction of predatory fishes. The anal-
yses in a population of 33 specimens detected a large number
of alleles (ranging from 4 to 11) and high levels of heterozy-
gosity (0.64–0.88) at these loci, indicating their usefulness in
population genetic studies. Cross-species amplification was
successful only in species of Astyanax, 43% of which were
polymorphic.
The Characiformes constitute one of the dominant and
more diverse orders among tropical fishes, with more than
1800 species, among which the family Characidae is the
most diverse, with species spread throughout the Neotropical
region. However, the interrelationships among the Characi-
dae are poorly known (Reis et al. 2003) and remain under
discussion (Javonillo et al. 2010; Mirande 2010).
The genus Astyanax (Characiformes, Characidae) com-
prises 163 described species (Froese and Paulay 2010), and
its systematics are very complex and several studies have
currently shown that the genus needs to be more thoroughly
characterized. A. altiparanae, encountered along the south
and southeast Brazilian rivers, was formerly included in the
complex A. bimaculatus (Garutti and Britski 2000), which
is widely distributed in South America. A. altiparanae is
of great economic interest, also being utilized as bait in
For correspondence. E-mail: fpforesti@fc.unesp.br.
sport fishing and in aquaculture programmes (Garutti and
Britski 2000; Porto-Foresti et al. 2010). However, the stocks
of this species are seriously endangered by introduced preda-
tory fishes, such as tucunaré (Cichla spp.) and corvina (Pla-
gioscion squamossissimus) (Agostinho et al. 2007).
Many molecular markers have been frequently used for
the Astyanax species (Prioli et al. 2002; Leuzzi et al. 2004;
Peres et al. 2005). However, there are no microsatellite data
available for this group. These markers can be valuable tools
to investigate genetic variability, with applications to conser-
vation and population genetics (Oliveira et al. 2006). Their
use in stock characterization of A. altiparanae may have
practical implications for fisheries, fish farming, and con-
servation biology. We describe the isolation and character-
ization of 11 novel microsatellite loci from A. altiparanae,
and their cross-amplification for potential utility in studies of
additional species.
Materials and methods
A microsatellite-enriched genomic library was obtained for
A. altiparanae following the protocol described by Billotte
et al.(1999). Genomic DNA was extracted using the com-
mercial Wizard Genomic DNA Purification kit (Promega,
São Paulo, Brazil). The total DNA was digested with RsaI
and enriched in (AC)
n
and (AG)
n
repeats. Enriched frag-
ments were amplified by polymerase chain reaction (PCR)
and then linked into a pGEM vector (Promega) and trans-
formed into competent XL1-blue Escherichia coli cells. Pos-
itive colonies were tested by PCR to confirm the presence
Keywords. molecular markers; fish conservation; aquaculture; polymorphic DNA.
Journal of Genetics Vol. 91, Online Resources e24
Isolation of microsatellites in Astyanax altiparanae
of inserts. Selected recombinant colonies were sequenced
using the primers T7 (5
-TAATACGACTCACTATAGGG-
3
) and SP6 (5
-ATTTAGGTGACACTATAGAA-3
) and the
BigDye Terminator kit (Applied Biosystems, São Paulo,
Brazil), and electrophoresed on an ABI Prism 377 automated
sequencer (Applied Biosystems, Foster City, USA). Flank-
ing primers were designed with Primer3 software (Rozen and
Skaletsky 2000).
Results and discussion
We isolated and sequenced a total of 48 positive colonies,
resulting in 25 good quality flanking sequences. The selected
sequences were used to characterize a sample of 33
A. altiparanae specimens, collected in the Batalha river
(22
6
40.92

S, 49
16
5.81

W), Brazil, and tested in five
individuals of the species Salminus brasiliensis, Brycon
amazonicus, Brycon hilarii, A. fasciatus, A. bockmanni,
A. paranae, A. abramis, A. schubarti, A. ribeirae and A.
jacuhiensis. PCR was performed in 20 μL reaction volume
containing approximately 10.9 μLH
2
O miliQ, 2.75 μLPCR
buffer 10×,1.25μLMgCl
2
50 mM, 1.5 μLdNTP1.25mM
(Invitrogen, São Paulo, Brazil), 1 μL of each primer
10 μM, 0.1 μL Taq DNA polymerase (Invitrogen) 5U/μL
and 1.5 μL of genomic DNA. The conditions for amplifi-
cation were 5 min at 95
Cfollowedby35cyclesof30s
at 95
C, 30 s at the annealing temperature (see table 1),
5sat72
C, and a final extension time of 5 min at 72
C.
The amplification products were separated in 6% denaturing
polyacrylamide gel and visualized by silver nitrate staining,
photographed, and analysed using the Kodak Digital Science
program Eastman Kodak Company, Rochester, USA. Allele
scoring was done using the 10-bp DNA Ladder (Invitrogen,
São Paulo, Brazil) as size standard.
Among the 25 tested primer pairs, 11 loci were highly
polymorphic (GenBank accession numbers JQ246359 to
JQ246369). The allele number varied from 4 (Asty12) to
11 (Asty21) by locus; the value of expected heterozygos-
ity varied from 0.64 (Asty12) to 0.88 (Asty13), and three
loci showed deviation from the Hardy–Weinberg equilibrium
(HWE) (P < 0.01) (table 1). They were calculated using
GENALEX v6.1 software (Peakall and Smouse 2007). Pair-
wise tests for linkage disequilibrium among loci were calcu-
lated using GENEPOP 3.3 package (Raymond and Rousset
1995), and were nonsignificant. Micro-Checker (Van Ooster-
hout et al. 2004) was used to verify possible causes of HWE
departures, and the analysis showed no evidence of stutter-
ing, allelic dropout, or null alleles as a possible cause of
HWE departures.
Cross-species amplification was investigated in 10 addi-
tional species of the same family (table 2). All 11 primers
analysed revealed a high level (89%) of cross-amplification
in species of Astyanax, 43% of which were polymorphic.
On the other hand, with noncongeneric species (Salminus
brasiliensis, Brycon amazonicus and B. hilarii), the cross-
amplification did not show positive results. Barbará et al.
(2007) revealed that the transferability for fish species can
be around 70% in congeners, lowering to 60% among
Table 1. Description of microsatellite loci and primer sequences in Astyanax altiparanae.
Primer sequence (5
-3
) Repeat motif Lenght (bp) T
a
(
C) nA H
o
H
e
F
is
Asty 4 GGTCACTGGAGGACAGATGTT (AC)
17
200 53 31 5 0.852 0.754 0,129
GGCATGTGCTTGAATGGA
Asty 11 TAAATCTATAAAGTCACCAT (AC)
12
151 50 32 9 0.630 0.837 0,248
TTTGTTTTTCTGCCGCTGTTT
Asty 12 AGACACAATCAGCCGCCGAAATG (GT)
8
163 58 25 4 0.742 0.638 0,162
ATCCCCTCTCCACAACCCAACACA
Asty 13 AAATGGGTGCAAGCAACG (GT)
8
160 58 25 10 0.563 0.877 0,359
TGCCTGTCTGTAAGCATGTG
Asty 15 CAACTTTTACTTAAAACCTGC (AC)
17
–(CT)
6
212 50 33 6 0.500 0.773 0,353
ATGGGTCTTTACTGCTGAATGTAT
Asty 16 AAAGTAAAGGGCATCTGTGGAGAA (AC)
10
165 52 32 8 0.769 0.860 0,106
AGAGGGCATCATTGTACATTTTTG
Asty 21 TTTATGGGGACCGTGAGATGTGC (CA)
9
150 57 24 11 0.500 0.852 0,413
CAGGGGCAGCGGTGATACCT
Asty 23 TCAATGGAACCTATGGACAAC (CA)
12
160 52 30 6 0.600 0.743 0,193
GTGGGAAGTAGCCTAATAAATA
Asty 24 AGACCAAACACTAGGGCTCAG (GT)
9
139 52 32 7 0.677 0.800 0,153
TTCGTCAATCTTCTTTCACTCTT
Asty 26 CCCATTGATCCTGCCTCTAA (GT)
8
190 58 25 8 0.654 0.856 0,236
CAGTCCTGACACAGAGAT
Asty 27 GCATTGTTCAGGTTGGGTCT (GT)
8
150 58 25 9 0.667 0.809 0,176
AAACGTGGTGAGAGGGAGTG
Intrapopulational analysis: T
a
, annealing temperature; n, number of individuals; A, allele number; H
o
, observed heterozygosity; H
e
,
expected heterozygosity; F
is
, endogamy index.
Loci that displayed significant deviations from Hardy–Weinberg equilibrium (P < 0.01).
Journal of Genetics Vol. 91, Online Resources e25
Rosângela Lopes Zaganini et al.
Table 2. Cross-amplification of the 11 polymorphic loci in seven species of Astyanax and three others species of Characidae.
Primer-Asty
Species 4 11121315162123242627
Astyanax paranae PMPMPMPMPMM
A. bockmanni PP–PMPPPPM
A. fasciatus PPPPPPPPPM
A. jacuhiensis PPPPPPPPPPP
A. abramis MPMP –MMP P PM
A. schubarti MP P MMP MMM
A. ribeirae MPPP–MPPPPM
S. brasiliensis M M MMMMMM
B. amazonicus M MMMMMMMMM
B. hilarii M MMMMMMMMM
P, polymorphic; M, monomorphic; –, no amplification.
genera of the same family, which showed that the success of
transferability of microsatellite loci were directly linked to
phylogenetic relationship between the groups tested.
Astyanax spp. represent an excellent model group for
studies of evolutionary mechanisms (Langecker et al. 1991;
Jeffery 2001) because they are naturally distributed into
structured groups (Garutti and Britski 2000), favouring
vicariant processes responsible for the great diversity of
Neotropical fishes (Castro 1999). Additionally, several
Astyanax spp. are distributed in species complexes, such as
bimaculatus, fasciatus and scabripinnis (Moreira-Filho and
Bertolo 1991; Fernandes and Martins-Santos 2004; Artoni
et al. 2006), which are abundant in rivers and other aquatic
habitats throughout the Neotropical region (Reis et al. 2003).
Consequently, the results obtained here reinforce the applica-
bility of the microsatellites for parentage population genetic
and studies in this heterogeneous group of fishes.
Acknowledgements
This work was supported by grants from Fundação de Amparo à
Pesquisa do Estado de São Paulo (FAPESP), Conselho Nacional
de Desenvolvimento Científico e Tecnológico (CNPq) and Coorde-
nação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES).
We are grateful to Laboratório de Análise Genética e Molecu-
lar, CBMEG UNICAMP, for help with microsatellite library
enrichment.
References
Agostinho A. A., Gomes L. C. and Pelicice F. M. 2007 Ecolo-
gia e manejo de recursos pesqueiros em reservatórios do Brasil.
EDUEM, Maringá, Brazil.
Artoni R. F., Shibatta O. A., Gross M. C., Schneider C. H., Almeida
M. C., Vicari M. R. and Bertollo L. A. C. 2006 Astyanax aff.
fasciatus Cuvier, 1819 (Teleostei; Characidae): evidences of a
species complex in the upper rio Tibagi Basin (Paraná, Brazil).
Neotrop. Ichthyol. 4, 197–202.
Barbará T., Palma-Silva C., Paggi G. M., Bered F., Fay M. F. and
Lexer C. 2007 Cross-species transfer of nuclear microsatellite
markers: potential and limitations. Mol. Ecol. 16, 3759–3767.
Billotte N., Lagoda P. J. L., Risterucci A. M. and Baurens F. C.
1999 Microsatellite-enriched libraries: applied methodology for
the development of SSR markers in tropical crops. Fruits 54,
277–288.
Castro R. M. C. 1999 Evolução da ictiofauna de riachos sul-
americanos: Padrões gerais e possíveis processos causais. In
Ecologia de Peixes de Riachos (ed. E. P. Caramashi, R. Mazzoni
and P. R. Peres-Neto), pp. 139–155. PPGE-UFRJ, Rio de Janeiro,
Brazil.
Fernandes C. A. and Martins-Santos I. C. 2004 Cytogenetic stud-
ies in two populations of Astyanax altiparanae (Pisces, Characi-
formes). Hereditas 141, 328–332.
Froese R. and Paulay D. 2010 FishBase. World Wide Web electron-
ics publication, http://www.fishbase.org/. (Acessed 03 November
2010).
Garutti V. and Britski H. A. 2000 Descrição de uma nova espécie de
Astyanax (Telostei, Characidae) da bacia do Alto Paraná e con-
siderações sobre as demais espécies do gênero na bacia. Comun.
Mus. Ciênc. Ser. Zool. PUCRS 13, 65–88.
Javonillo R., Malabarba L. R., Weitzman S. H. and Burns J. R. 2010
Relationships among major lineages of characid fishes (Teleostei:
Ostariophysi: Characiformes), based on molecular sequence data.
Mol. Phyl. Evol. 54, 498–511.
Jeffery W. R. 2001 Cavefish as a model system in evolutionary
developmental biology. Dev. Biol. 231, 1–12.
Langecker T. G., Wilkens H. and Junge P. 1991 Introgressive
hybridization in the Pachon cave population of Astyanax fascia-
tus. Ichthyol. Explor. Freshw. 2, 209–212.
Leuzzi M. S. P., Almeida F. S., Orsi M. L. and Sodré
L. M. K. 2004 Analysis by RAPD of the genetic structure of
Astyanax altiparanae (Pisces, Characiformes) in reservoirs on
the Paranapanema River, Brazil. Genet. Mol. Biol. 27, 355–
362.
Mirande J. M. 2010 Phylogeny of the family Characidae (Teleostei:
Characiformes): from characters to taxonomy. Neotrop. Ichthyol.
8, 385–568.
Moreira-Filho O. and Bertollo L. A. 1991 Astyanax scabripinnis
(Pisces: Characidae), a species complex. Rev. Bras. Genet. 14,
331–357.
Oliveira E. J., Pádua J. G., Zucchi M. I., Vencovsky R. and Vieira
M. L. C. 2006 Origin, evolution and genome distribution of
microsatellites. Genet. Mol. Biol. 2, 294–307.
Peakall R. and Smouse P. E. 2007 GENALEX 6.1: genetic anal-
ysis in Excel. Population genetic software for teaching and
research. Australian National University, Canberra, Australia,
(http://www.anu.edu.au/BoZo/GenAlEx).
Journal of Genetics Vol. 91, Online Resources e26
Isolation of microsatellites in Astyanax altiparanae
Peres M. D., Vasconcelos M. S. and Renesto E. 2005 Genetic
variability in Astyanax altiparanae Garutti and Britski, 2000
(Teleostei, Characidae) from the Upper Paraná River basin,
Brazil. Genet. Mol. Biol. 28, 717–724.
Porto-Foresti F., Castilho-Almeida R. B., Senhorini J. A. and Foresti
F. 2010 Biologia e criação do lambari-do-rabo-amarelo (Astyanax
altiparanae). In Espécies nativas para piscicultura no Brasil
(ed. B. Baldisserotto and L. C. Gomes), pp. 101–115. Editora
UFSM, Santa Maria.
Prioli S. M. A. P., Prioli A. J., Júlio Jr H. F., Pavanelli C. S.,
Oliveira A. V., Carrer H. et al. 2002 Identification of Astyanax
altiparanae (Teleostei, Characidae) in the Iguaçu River, Brazil,
based on mitochondrial DNA and RAPD markers. Genet. Mol.
Biol. 25, 421–430.
Raymond M. and Rousset F. 1995 Genepop (version 1.2): popula-
tion genetics software for exact tests and ecumenicism. J. Her.
86, 248–249.
Reis R. E., Kullander S. O. and Ferraris C. J. 2003 Check list of the
freshwater fishes of South and Central America. Edipucrs, Porto
Alegre, Brazil.
Rosen S. and Skaletsky H. 2000 Primer3 on the WWW for gen-
eral users and for biologist programmers. In Bioinformatics meth-
ods and protocols: methods in molecular biology (ed. S. Misener
and S. A. Krawetz), pp. 365–386. Humana Press, Totowa, New
Jersey, USA.
Van Oosterhout C., Hutchinson W. F. , Wills D. P. M. and Shipley
P. 2004 Micro-checker:softwarefor identifying andcorrectinggeno-
typing errors in microsatellite data. Mol. Ecol. Notes 4, 535–538.
Received 28 October 2011, in final revised form 30 December 2011; accepted 4 January 2012
Published on the Web: 28 March 2012
Journal of Genetics Vol. 91, Online Resources
e27
  • [Show abstract] [Hide abstract] ABSTRACT: Molecular ecologists increasingly require 'universal' genetic markers that can easily be transferred between species. The distribution of cross-species transferability of nuclear microsatellite loci is highly uneven across taxa, being greater in animals and highly variable in flowering plants. The potential for successful cross-species transfer appears highest in species with long generation times, mixed or outcrossing breeding systems, and where genome size in the target species is small compared to the source. We discuss the implications of these findings and close with an outlook on potential alternative sources of cross-species transferable markers.
    Full-text · Article · Oct 2007
  • [Show abstract] [Hide abstract] ABSTRACT: Four populations of Astyanax aff. fasciatus of the upper rio Tibagi (municipal district of Ponta Grossa, Parana State, Brazil), had their karyotypes and morphometry analyzed. The cytogenetic data show the occurrence of distinct karyotypes (cytotypes), here named cytotype A, with 2n=48 chromosomes (6m+18sm+14st+10a), cytotype B, with 2n=50 chromosomes (8m+18sm+14st+10a) and cytotype C, with 2n=50 chromosomes (8m+18sm+14st+10a). The distribution pattern of the constitutive heterochromatin was very similar between cytotypes A and B, but diverged in relation to cytotype C. Distinct cytotypes may occur in sympatry in the upper rio Tibagi region, with the exception of the Furna 2 sample, which presents cytotype A exclusively. In addition, a specimen with 2n=49 chromosomes (7m+18sm+14st+10a) was also found and, by the characteristics presented, may be a consequence of a rare hybridization event between cytotypes A and B. The morphometric analyses of canonical variates indicate a consistent isolation of the Furna 2 sample, while the other samples seem to be superimposed, indicating a possible gene flow or even a recent isolation event. This model points to a probable complex of cryptic species in the studied region.
    Full-text · Article · Apr 2006
  • [Show abstract] [Hide abstract] ABSTRACT: Astyanax fishes are among the most important food-web components of South America rivers. In the Iguaçu River basin, the Astyanax genus is represented mainly by endemic species. For millions of years, that hydrographic basin has been geographically isolated from the Paraná River basin by the Iguaçu Falls. Recently, a species from the Upper Paraná River basin identified as Astyanax bimaculatus was revised and described as a new species named Astyanax altiparanae Garutti & Britski, 2000. Fauna endemism and geographic isolation triggered interest in investigations to evaluate the identification and genetic relatedness among two A. altiparanae populations from the Upper Paraná River basin and the population identified as A. bimaculatus in the Iguaçu River, upstream from the Iguaçu Falls. Mitochondrial DNA sequences and RAPD markers revealed high genetic diversity within each population, as well as low genetic distance, high gene flow, and high mitochondrial DNA similarity among all three populations. In conjunction with morphological similarities, these results demonstrated that the population presently known as Astyanax bimaculatus in the Iguaçu River should actually be stated as Astyanax altiparanae. Furthermore, it could be inferred that the A. altiparanae population is not endemic and most likely it was recently introduced in the Iguaçu River basin, maintaining the ancestral genetic identity.
    Full-text · Article · Dec 2002
Show more