Article (PDF Available)

Neuronal sensitivity to TDP-43 overexpression is dependent on timing of induction

Department of Neuroscience, Mayo Clinic, Jacksonville, FL 32224, USA.
Acta Neuropathologica (Impact Factor: 10.76). 04/2012; 123(6):807-23. DOI: 10.1007/s00401-012-0979-3
Source: PubMed

ABSTRACT

Ubiquitin-immunoreactive neuronal inclusions composed of TAR DNA binding protein of 43 kDa (TDP-43) are a major pathological feature of frontotemporal lobar degeneration (FTLD-TDP). In vivo studies with TDP-43 knockout mice have suggested that TDP-43 plays a critical, although undefined role in development. In the current report, we generated transgenic mice that conditionally express wild-type human TDP-43 (hTDP-43) in the forebrain and established a paradigm to examine the sensitivity of neurons to TDP-43 overexpression at different developmental stages. Continuous TDP-43 expression during early neuronal development produced a complex phenotype, including aggregation of phospho-TDP-43, increased ubiquitin immunoreactivity, mitochondrial abnormalities, neurodegeneration and early lethality. In contrast, later induction of hTDP-43 in the forebrain of weaned mice prevented early death and mitochondrial abnormalities while yielding salient features of FTLD-TDP, including progressive neurodegeneration and ubiquitinated, phospho-TDP-43 neuronal cytoplasmic inclusions. These results suggest that neurons in the developing forebrain are extremely sensitive to TDP-43 overexpression and that timing of TDP-43 overexpression in transgenic mice must be considered when distinguishing normal roles of TDP-43, particularly as they relate to development, from its pathogenic role in FTLD-TDP and other TDP-43 proteinopathies. Finally, our adult induction of hTDP-43 strategy provides a mouse model that develops critical pathological features that are directly relevant for human TDP-43 proteinopathies.

Electronic supplementary material
The online version of this article (doi:10.1007/s00401-012-0979-3) contains supplementary material, which is available to authorized users.

Full-text (PDF)

Available from: Dennis W Dickson
ORIGINAL PAPER
Neuronal sensitivity to TDP-43 overexpression is dependent
on timing of induction
Ashley Cannon
Baoli Yang
Joshua Knight
Ian M. Farnham
Yongjie Zhang
Charles A. Wuertzer
Simon D’Alton
Wen-lang Lin
Monica Castanedes-Casey
Linda Rousseau
Brittany Scott
Michael Jurasic
John Howard
Xin Yu
Rachel Bailey
Matthew R. Sarkisian
Dennis W. Dickson
Leonard Petrucelli
Jada Lewis
Received: 9 March 2012 / Revised: 9 March 2012 / Accepted: 28 March 2012 / Published online: 27 April 2012
Ó The Author(s) 2012. This article is published with open access at Springerlink.com
Abstract Ubiquitin-immunoreactive neuronal inclusions
composed of TAR DNA binding protein of 43 kDa (TDP-
43) are a major pathological feature of frontotemporal lobar
degeneration (FTLD-TDP). In vivo studies with TDP-43
knockout mice have suggested that TDP-43 plays a critical,
although undefined role in development. In the current
report, we generated transgenic mice that conditionally
express wild-type human TDP-43 (hTDP-43) in the fore-
brain and established a paradigm to examine the sensitivity
of neurons to TDP-43 overexpression at different develop-
mental stages. Continuous TDP-43 expression during early
neuronal development produced a complex phenotype,
including aggregation of phospho-TDP-43, increased
ubiquitin immunoreactivity, mitochondrial abnormalities,
neurodegeneration and early lethality. In contrast, later
induction of hTDP-43 in the forebrain of weaned mice pre-
vented early death and mitochondrial abnormalities while
yielding salient features of FTLD-TDP, including progres-
sive neurodegeneration and ubiquitinated, phospho-TDP-43
neuronal cytoplasmic inclusions. These results suggest that
neurons in the developing forebrain are extremely sensitive
to TDP-43 overexpression and that timing of TDP-43 over-
expression in transgenic mice must be considered when
distinguishing normal roles of TDP-43, particularly as they
relate to development, from its pathogenic role in FTLD-
TDP and other TDP-43 proteinopathies. Finally, our adult
induction of hTDP-43 strategy provides a mouse model that
develops critical pathological features that are directly
relevant for human TDP-43 proteinopathies.
Keywords Amyotrophic lateral sclerosis Apoptosis
Frontotemporal lobar degeneration Neurodevelopment
TDP-43 Transgenic mice
Introduction
TAR DNA binding protein (TDP-43), encoded by the
TARDBP gene on human chromosome 1, is a major patho-
logical component of the neuronal inclusions associated with
amyotrophic lateral sclerosis (ALS) and frontotemporal
lobar degeneration (FTLD-TDP) [28]. The neuropathology
of these conditions is characterized by ubiquitin- and
TDP-43-positive neuronal and glial cytoplasmic inclusions,
neuronal intranuclear inclusions, and dystrophic neurites.
The majority of ALS cases have TDP-43 pathology, except
for cases caused by either SOD1 or FUS mutations [28].
TARDBP mutations have been identified in ALS, but they
only account for 4 % of familial and 1.5 % of sporadic cases
Electronic supplementary material The online version of this
article (doi:10.1007/s00401-012-0979-3) contains supplementary
material, which is available to authorized users.
A. Cannon J. Knight I. M. Farnham Y. Zhang
C. A. Wuertzer S. D’Alton W. Lin M. Castanedes-Casey
L. Rousseau B. Scott M. Jurasic J. Howard X. Yu
R. Bailey D. W. Dickson L. Petrucelli J. Lewis (&)
Department of Neuroscience, Mayo Clinic, Jacksonville,
FL 32224, USA
e-mail: jada.lewis@ufl.edu
B. Yang
Department of Obstetrics and Gynecology,
University of Iowa, Iowa City, IA 52242, USA
J. Knight S. D’Alton J. Howard R. Bailey
M. R. Sarkisian J. Lewis
Department of Neuroscience, University of Florida,
Gainesville, FL 32611, USA
J. Knight S. D’Alton J. Howard R. Bailey J. Lewis
Center for Translational Research in Neurodegenerative Disease,
University of Florida, Gainesville, FL 32611, USA
123
Acta Neuropathol (2012) 123:807–823
DOI 10.1007/s00401-012-0979-3
Page 1
[25]. FTLD-TDP is the most common FTLD subtype
accounting for nearly 50 % of all cases [8, 12], but only three
FTLD patients have been identified with TARDBP sequence
variants [5, 6, 20]. Recently, expansion repeats in the
C9ORF72 gene have been identified as the most common
genetic abnormality in familial FTLD-TDP and ALS [13,
30]. TDP-43 pathology in the absence of TARDBP mutations
is also found in hippocampal sclerosis of the elderly, as well
as a subset of patients with Alzheimer’s disease, Parkinson’s
disease or other neurodegenerative disorders [2, 3, 15, 17, 18,
29, 37], suggesting a pervasive involvement of TDP-43 in
neurodegeneration. Therefore, pathology with wild-type
TDP-43 is associated with a range of both primary and sec-
ondary TDP-43 proteinopathies.
TDP-43 plays a role in transcription and splicing regu-
lation, with the number of target genes constantly growing.
Other functional roles that are not well characterized
include microRNA processing, RNA transport, cell divi-
sion, and apoptosis [7]. It is currently unclear if TDP-43
promotes neurodegeneration through a loss of one or more
of these functions or through a toxic gain of function or
both. Loss of TDP-43 in mice is lethal at any age [9, 21, 32,
42], supporting loss of function as a potential neurode-
generative mechanism. Conversely, the phenotypes of
several transgenic TDP-43 mouse models have been
strikingly consistent, including weight loss, gait abnor-
malities, abnormal hind limb escape reflex, and early
lethality [35, 40, 41, 43]. These findings suggest that even
low levels of human TDP-43 (hTDP-43) overexpression
are pathogenic, regardless of wild type or mutant origin. A
number of studies from our lab and others have now shown
that murine TDP-43 is reduced in response to the overex-
pression of exogenous TDP-43; one study reported on a
conditional TDP-43 model similar to that utilized for our
current study [19]. None of these studies have examined
the impact of TDP-43 overexpression on neurons at dif-
ferent stages of development.
Given evidence that TDP-43 may be critically involved
in both development and neurodegeneration, we designed a
transgenic mouse model, termed iTDP-43
WT
that condi-
tionally expresses TDP-43 under the control of the
tetracycline conditional system of gene regulation [16].
These transgenic mice allowed us to determine if overex-
pression of hTDP-43 in neurons at different stages of
maturation alters the impact of TDP-43. Here, we show
that moderate hTDP-43 overexpression within the devel-
oping forebrain results in a complex phenotype, including
early lethality, early and extensive neuronal loss with
apoptosis, perikaryal clusters of abnormal mitochondria
and cytoplasmic inclusions of phosphorylated TDP-43 as
well as increased ubiquitin immunoreactivity and gliosis.
We also show that specific induction of hTDP-43 later in
forebrain maturation prevents early lethality, severe early
onset neurodegeneration, and mitochondrial abnormalities,
yet produces salient features of FTLD-TDP, including
progressive neuronal loss, reactive gliosis, and TDP-43
inclusions that co-localize with ubiquitin. These mice now
provide a model in which developmental effects of TDP-43
overexpression can be distinguished from degenerative
effects of TDP-43 in the mature nervous system.
Materials and methods
Ethics statement
All mice were utilized with approval and in accordance
with the Mayo Clinic Institutional Animal Care and Use
Committee and the University of Florida Institutional
Animal Care and Use Committee.
Transgenic mice
iTDP-43
WT
mice were generated similarly to a previously
described protocol [31]. Full length, untagged, human
TDP-43 cDNA, amplified using a TDP-43-myc plasmid as
a template [44], was inserted into the inducible expression
vector pUHD 10-3 (Hermann Bujard, ZMBH) containing
five tetracycline operator sequences. The construct was
confirmed by restriction enzyme digest and direct
sequencing. The transgenic fragment was obtained by
BsrBI digestion, gel purified followed by b–agarase
digestion (NEB), filtration and concentration. The modified
TDP-43 transgene was injected into the pronuclei of donor
FVB/NCr embryos (Charles River). These responder mice
were bred with 129S6 mice (Taconic) with the tetracycline
transactivator (tTA) transgene downstream of calcium-
calmodulin kinase II alpha (CaMKIIa) promoter elements
[27] to produce the iTDP-43
WT
transgenic mice with
forebrain hTDP-43 expression. For TDP-43 transgene
suppression studies during development, doxycycline water
(1.5 g/l doxycycline and 4 % sucrose) was placed in
breeding cages for 2 days in addition to doxycycline diet
(Harlan; 200 mg/kg), which remained in the breeding cage
until pups were weaned at 21 days. Doxycycline, a tetra-
cycline derivative, binds tTA and prevents transgene
expression. At 21 days, weanlings were placed in cages
with regular chow to allow hTDP-43 transgene expression
to commence.
Immunohistochemistry
After euthanasia via cervical dislocation, brains were har-
vested and divided along the midline. The right hemisphere
was flash-frozen on dry ice, while the left hemisphere was
drop fixed in 10 % neutral buffered formalin for
808 Acta Neuropathol (2012) 123:807–823
123
Page 2
histological analyses. Brains were embedded in paraffin
and cut into 5-lm sagittal sections. Tissues were immu-
nostained with monoclonal antibodies to TDP-43, pS403/
404-phosphorylated TDP-43, ubiquitin, ionized calcium-
binding adaptor molecule 1 (Iba1), glial fibrillary acidic
protein (GFAP), and cytochrome C oxidase subunit IV
(COX-IV), using the DAKO Autostainer (DAKO Auto
Machine Corporation, Carpinteria, CA) with DAKO
Envision? HRP System. For cleaved caspase 3 and neu-
ronal nuclear antigen (NeuN) double labeling, the DAKO
Envision G2 Double Stain System was used. The peroxi-
dase labeling of cleaved caspase 3 was visualized with
diaminobenzidine (DAB), and the alkaline phosphatase
labeling of NeuN was detected with Vector Blue alkaline
Phosphatase Substrate Kit III (Vector Laboratories,
Burlingame, CA). See Supplementary Table 1 for a com-
plete list of primary antibodies used. Hematoxylin and eosin
(H&E) staining was performed by standard procedures.
Protein isolation and Western blotting
Brains were weighed and homogenized in lysis buffer
(50 mM Tris base, 274 mM NaCl, 5 mM KCl pH 8.0, 1 %
Triton X-100, 2 % SDS, and protease and phosphatase
inhibitors) at 1 ml/100 mg. Samples were sonicated and
centrifuged at 16,200g for 20 min at 20 °C. Supernatant
protein concentration was determined by BCA assay
(Pierce). Approximately, 50 lg protein was loaded onto
10 % Tris–glycine polyacrylamide gel (Novex). After
electrophoresis, gels were transferred to a nitrocellulose
membrane for 2 h at 200 mA constant current. Membranes
were blocked with 5 % milk in Tris-buffered saline and
0.1 % Triton X-100 (TBS-T; Sigma-Aldrich) for 1 h and
probed overnight at 4 °C with one of the following primary
antibodies in 5 % TBS-T: mouse monoclonal TDP-43
antibody recognizing human TDP-43, rabbit polyclonal
TDP-43 antibody recognizing total TDP-43, and mouse
monoclonal glyceraldehyde-3-phosphate dehydrogenase
antibody (GAPDH). See Supplementary Table 1 for a
complete list of primary antibodies used. The membrane
was washed 5 times for 5 min in TBS-T and then incubated
in the appropriate secondary antibody for 1 h. The mem-
brane was again washed 5 times for 5 min in TBS-T. ECL
reagent was added for 2 min, and the membrane was
exposed to X-ray film. For reprobing, the membrane was
stripped with 70 mM SDS in Tris HCl (pH 6.8) with 0.7 %
BME for 15 min at 55 °C before processing as described
above.
Quantitative PCR
Total RNA was isolated from dissected hippocampus and
cortex using TRIzol reagent (Invitrogen) and Pure Link
RNA Mini Kit (Invitrogen), and 2 lg were used to syn-
thesize cDNA using the High Capacity cDNA Reverse
Transcription Kit (Applied Biosystems). All samples were
run in triplicate on the BioRad CFX384 Real-Time PCR
Detection System. A dilution series was used to construct a
standard curve for each primer pair from which normali-
zation and subsequent fold change calculations were
performed. Primer sequences for qPCR were mouse
Tardbp F (AAAGGTGTTTGTTGGACGTTGTACAG),
mouse Tardbp R (AAAGCTCTGAATGGTTTGGGAATG),
Gapdh F (CATGGCCTTCCGTGTTCCTA) and Gapdh R
(CCTGCTTCACCACCTTCTTGAT). Single PCR prod-
ucts were verified by melt curve analysis.
TUNEL staining
The ApopTag Peroxidase In Situ Apoptosis Detection Kit
(Chemicon) was used to detect DNA fragmentation by
labeling the free 3
0
-OH termini. Staining was performed
according to the manufacturer recommendations. TUNEL-
positive cells were visualized by the chromogen 3
0
-3
0
diaminobenzidine (DAB) in sections that were counter-
stained with methyl green.
Immunofluorescence staining
Paraffin sections of brain tissue were deparaffinized and
rehydrated in a graded series of alcohols. Tissue was
blocked in DAKO Protein Block for 1 h then incubated
with primary antibodies overnight at 4 °C. See Supple-
mentary Table 1 for a complete list of primary antibodies
used. After washing, tissue was incubated in Alexa Fluor
488 and Alexa Fluor 568 secondary antibodies (1:500,
Invitrogen) for 1 h at room temperature. Vectashield with
DAPI (Vector Laboratories) was used to stain nuclei.
Images were captured using an Axio Imager.Z1 micro-
scope (Zeiss).
Quantification of neurons, TDP-43 inclusions,
and caspase 3 immunoreactivity
Three samples per group were chosen and tissue sections
approximately 2.0–2.1 mm from the midline were used to
quantify the total number of neurons (labeled by NeuN)
and the number of neurons containing phospho-TDP-43
and ubiquitin inclusions in addition to neurons with cas-
pase 3 immunoreactivity. Immunofluorescent staining was
performed as described above. Images were captured from
different cortical regions (primary motor cortex, secondary
motor cortex, and primary sensory cortex) per sample after
scanning slides at 409 with ScanScope (Aperio). Images
were analyzed with ImageScope software (Aperio) for
quantification.
Acta Neuropathol (2012) 123:807–823 809
123
Page 3
Results
Continuous hTDP-43 overexpression yields complex
pathological profiles
To generate iTDP-43
WT
mice, wild-type human TDP-43
(hTDP-43) cDNA was placed behind a minimal CMV
promoter with tetracycline operator sequences that
effectively blocked human hTDP-43 expression in single
transgenic mice (TDP-43
WT
). By crossing these mice
with mice expressing the tetracycline transactivator
(tTA) under the CaMKIIa promoter [26], we created
bigenic iTDP-43
WT
mice that expressed hTDP-43 in the
cortex, hippocampus, olfactory bulb, and striatum, which
is the expected expression pattern for this CaMKIIa
promoter (Fig. 1a, Supplementary Fig. 1). We further
examined hTDP-43 expression in various organs and
found only low level expression in the cervical spinal
cord (Fig. 1b).
We screened 90 potential founders, identified 7 over-
expressing lines and focused our studies on two founder
lines, 5a and 17d, that expressed TDP-43 at the highest
levels in response to the introduction of the tTA transgene.
iTDP-43
WT
mice derived from founder lines 5a and 17d
expressed human TDP-43 protein at 3- and 2-fold,
respectively, over endogenous TDP-43 levels in NT brain
(Fig. 1c, d). Some variability in hTDP-43 expression was
observed in the 17d line (range from 1.6- to 2.4-fold;
Fig. 1d). iTDP-43
WT
mice from both founder lines showed
negligible expression of the transgene in the absence of the
tTA activator (Fig. 1c). We and others have previously
reported that TDP-43 levels appear to be tightly regulated
[4, 19, 33, 43], and we found similar results in the iTDP-
43
WT
mice at the RNA level. Compared to NT, mTDP-43
RNA was down-regulated in both the cortex (0.821 ±
0.036; P = 0.027) and hippocampus (0.575 ± 0.062;
P = 0.015) of iTDP-43
WT
mice (17d) in response to the
overexpression of hTDP-43 (Fig. 1e, f). Without a com-
mercially available antibody for mTDP-43, we were unable
to specifically assess down-regulation of mTDP-43 at the
protein level; however, Igaz and colleagues [19] previously
demonstrated that endogenous mouse TDP-43 protein is
down-regulated in a similar model system.
Only 30 % of iTDP-43
WT
mice from the 5a founder line
survived past 2 months (2M) of age, while 80 % of iTDP-
43
WT
mice from line 17d survived through the same time
point (Fig. 1g). iTDP-43
WT
mice from both founder lines
that failed to survive past 2M were phenotypically similar,
showing reduced spontaneous activity, weight, and
grooming prior to death (Supplementary Fig. 2). These
data demonstrate that survival is dose dependent with
respect to hTDP-43 expression.
Neuronal loss is a prominent feature of TDP-43 pro-
teinopathies such as FTLD-TDP and ALS. We examined
the brains of iTDP-43
WT
mice and found that they had
striking forebrain atrophy regardless of phenotype (Fig. 2);
however, the extent of atrophy and the relative age at which
atrophy occurred were dramatically different than observed
in human TDP-43 proteinopathies, with almost complete
obliteration of neuroanatomical structures, such as the
dentate fascia of the hippocampus. Brains from iTDP-43
WT
mice exhibit ventricular dilation, cortical thinning, reduced
cortical thickness and severe hippocampal atrophy, which
contribute to a macroscopic decrease in brain size (Fig. 2a–
d). While these features were present in both transgenic
lines, brains from symptomatic mice from both lines were
roughly twofold smaller than age-matched non-transgenic
(NT) mice (Fig. 2e, f). Postnatal brain weights of iTDP-
43
WT
mice from the 5a line had brain weights similar to NT
littermates until postnatal day 12 (Fig. 2e), suggesting that
early cortical and hippocampal development is not overtly
affected by hTDP-43 expression. In contrast, a drastic
decrease in brain weight was observed in symptomatic 5a
mice at 24d, implying that neuronal loss rapidly occurs from
P12 through the third postnatal week when the developing
mouse brain expands its axonal and dendritic arborizations
[22, 24] and synaptic pruning is ongoing [23]. 17d mice that
survived beyond 2M also had significantly lower brain
weights than NT counterparts at all ages examined; how-
ever, the observed brain atrophy was not progressive
(Fig. 2f). Variability in expression level within the 17d line
did not directly correlate with brain weight. We sought to
determine if overt neuronal loss in iTDP-43
WT
mice was
due to apoptosis. All weaned iTDP-43
WT
mice examined,
regardless of line or phenotype, had elevated TUNEL-
positive cells in cortex and hippocampus in comparison to
age-matched NT mice, with the greatest number of apop-
totic cells in symptomatic mice from both lines
(Supplementary Fig. 3a). We determined that the cells
undergoing apoptosis were neurons by double immuno-
staining for cleaved caspase 3 and the neuronal marker
NeuN (Supplementary Fig. 3b) as well as their anatomical
location in nerve cell layers of cortex and hippocampus.
Overall, these results suggest that even moderate levels of
wild-type hTDP-43 overexpression are extremely toxic to
developing cortical and hippocampal neurons, causing
severe and early neuronal loss through apoptosis.
Histological examination was performed on both foun-
der lines. We compared symptomatic 5a and 17d mice to
17d mice without an observable phenotype at 2M.
Approximately 11 % of cortical neurons in symptomatic
mice from the 5a line contained small (\1 lm) punctate
cytoplasmic inclusions when probed with phosphorylation-
specific TDP-43 antibodies that were absent in NT mice
810 Acta Neuropathol (2012) 123:807–823
123
Page 4
0 1 2 3 4 5 6 7 8 9 10 11 12
0
10
20
30
40
50
60
70
80
90
100
NT
17d iT
5a iT
Age (months)
Percent survival
g
b
GAPDH
iT NT iT NT iT NT iT NT iT NT iT NT iT NT
Br SC TM He Ki Sp Li
hTDP-43
*
*
OB
CTX
STR
HIP
c
17d (2x) 5a (3x)
T NT iT iT iT iT iT iT NT NT T
40kDa-
30kDa-
20kDa-
40kDa-
30kDa-
20kDa-
40kDa-
30kDa-
20kDa-
hTDP-43
Total
TDP-43
(light)
Total
TDP-43
(dark)
GAPDH
iT (17d) iT (5a) NT
0.0
0.5
1.0
1.5
2.0
2.5
3.0
3.5
Norm. RU
TDP
/RU
GAPDH
d
a
e
f
Cortex
iT NT
0.0
0.2
0.4
0.6
0.8
1.0
1.2
1.4
1.6
Fold change
Hippocampus
iT NT
0.0
0.2
0.4
0.6
0.8
1.0
1.2
1.4
1.6
Fold change
Fig. 1 Overexpression of hTDP-43 in the developing forebrain leads
to reduced survival and TDP-43 biochemical changes. a Immuno-
staining of a symptomatic 24-day-old 5a bigenic TDP-43/tTA iTDP-
43
WT
mice (iT) sagittal brain section shows an hTDP-43 expression
pattern that is anticipated with the CaMKIIa promoter, which
includes the cortex (CTX), hippocampus (HIP), olfactory bulb
(OB), and striatum (STR). b Western blot of tissue lysates from
6-month 17d iT and non-transgenic (NT) mice from brain (Br), spinal
cord (SC), thigh muscle (TM), heart (He), kidney (Ki), spleen (Sp),
and liver (Li) probed for hTDP-43 reveals expression in the brain with
lower levels in the spinal cord of iT mice. c Western blot of brain
lysates of NT mice, transgenic mice containing only the TDP-43
responder (T), and bigenic TDP-43/tTA mice (iT) from the 17d
(2-month old) and 5a (symptomatic, 24-day old) founder lines using
antibodies that either detects human TDP-43 (hTDP-43) or both
endogenous mouse TDP-43 and hTDP-43 (total TDP-43). GAPDH
was used as a loading control. iT mice from founder line 17d have
roughly 29 levels of TDP-43 expression when compared to NT
controls while iT mice from 5a have roughly 39 overexpression.
Minimal leakiness is shown in the TDP-43 only mice from founders
17d and 5a. d Densitometric analysis of the relative units of total
TDP-43 normalized by the relative units of the GAPDH loading
control shown in panel (c). e, f Quantitative real time PCR using
murine-specific TDP-43 primers demonstrate reduced expression of
endogenous TDP-43 in 2-month-old 17d iT cortex (e) and hippo-
campus (f) relative to NT littermates, (n = 3). g A survival curve of
the 5a and 17d founder lines shows that iT mice from line 5a (n = 16)
only has a 30 % survival after 2 months, while the iT mice from line
17d (n = 110) has 80 % survival after 2 months compared to NT
controls (n = 168). SEM shown in d. Statistical analysis was assessed
by Student’s t test in e, f.*P \ 0.05
Acta Neuropathol (2012) 123:807–823 811
123
Page 5
(pS403/404, Fig. 3a, b; pS409/410, Fig. 3c, e). Most
inclusions from the 17d line were also cytoplasmic, but the
mice that survived to 2M had pS403/404-positive-TDP-43
accumulations in the nucleus, particularly associated with
nuclear bodies (Supplementary Fig. 4). In addition to TDP-
43 inclusions, iTDP-43
WT
mice of both founder lines,
regardless of phenotype, had a general increase in ubiquitin
immunoreactivity predominantly located in neuronal peri-
karya and in neuritic processes compared to NT mice
(Fig. 3d, f, g and Supplementary Fig. 4). In some cases,
ubiquitin accumulated in punctate inclusions (Fig. 3f,
inset). Although pS409/410-TDP-43 and increased ubiq-
uitin immunoreactivity were both frequent, the two
co-localized in only about 50 % of the structures (Fig. 3c–e).
iTDP-43
WT
mice from both founder lines showed extensive
reactive microgliosis (Iba-1, Fig. 3h–i and Supplementary
Fig. 4) and astrocytosis (GFAP, Fig. 3j, k, Supplementary
Fig. 4) compared to NT mice; symptomatic mice displayed
the most robust gliosis. We also identified eosinophilic
aggregates within cortical and hippocampal neuronal
ba
dc
ef
***
*** ** ******
**
P0 iT
P0 NT
P5 iT
P5 NT
P12 iT
P12 NT
P18 iT
P18 NT
P24 iT
P24 NT
24d iT
24d NT
0.0
0.1
0.2
0.3
0.4
0.5
0.6
Line 5a Brain (g)
~1M iT
~1M NT
2M iT
2M NT
4.5M iT
4.5M NT
10M iT
10M NT
0.0
0.1
0.2
0.3
0.4
0.5
0.6
Line 17d Brain (g)
Fig. 2 hTDP-43 overexpression in the developing brain results in
early and severe neuronal loss. a, b Hematoxylin and eosin (H&E)
staining of sagittal sections from symptomatic 5a iT mice (a) shows
considerable ventricular enlargement, cortical thinning, and hippo-
campal atrophy when compared to NT, (b) age-matched mice at
24 days of age. c, d Higher magnification of the sagittal sections
highlights the significant ablation of CA1 and dentate gyrus in iT
(c) compared to NT (d) mice. Note the apoptotic bodies (c, inset)
suggesting the onset of apoptotic death in the CA1 of iT mice.
e Whole brain weights of 5a iT and NT mice at P0, P5, P12, P18 and
24-day old demonstrate that developing iT brains increase in weight
normally until P12 but drastically decrease in weight by 24-day old.
f Whole brain weights of 17d iT mice have significantly lower brain
weights than NT mice at all ages examined but are most severe in the
symptomatic iT mice approximately 1-M old (range 24–45 days). Of
note, the brain weights of 17d iT mice that survived past 2 months of
age did not progressively decrease with age. The bar represents
2,500 lmina, b and 500 lminc, d. Statistical analysis was assessed
by Student’s t test in e, f. ***P \ 0.001, **P \ 0.01
812 Acta Neuropathol (2012) 123:807–823
123
Page 6
ba
ced
gf
ih
kj
nlm
Fig. 3 Developing neurons
with hTDP-43 overexpression
yield complex pathological
profiles. a, b Phosphorylation of
TDP-43 (pTDP-43, amino acids
403/404) was prominent in the
cytoplasm of 24-day-old
symptomatic 5a iT
(a) compared to NT (b) mice.
Enlarged inset (box)
demonstrates small, cytoplasmic
phospho-TDP-43 aggregates.
pTDP-43 immunostaining was
also observed within the
nucleus, primarily surrounding
nuclear bodies in neurons.
ce Fluorescent
immunostaining of the cortex of
24-day-old symptomatic 5a iT
for pTDP-43 (amino acids
409–410; c; green) and
ubiquitin (d; red) partially
co-localize (e; yellow). DAPI
(e; blue) represents nuclear
staining. f, g Cortical
immunohistochemical staining
for ubiquitin in 24-day-old
symptomatic 5a iT mice
(f) shows a substantial increase
in ubiquitination when
compared to NT (g) mice.
Enlarged inset (box)
demonstrates occasional
cytoplasmic ubiquitin
aggregates. h, i Microgliosis
(Iba1) is apparent in 24-day-old
symptomatic 5a iT mice
(h) when compared to NT
(i) mice. j, k Cortical
immunohistochemical staining
for astrocytosis (GFAP) in
24-day-old symptomatic 5a iT
mice (j) shows abundant
reactive astrocytes when
compared to NT (k) mice.
ln Fluorescent immunostaining
of the cortex of 24-day-old
symptomatic 5a iT for the
mitochondrial marker, COX-IV
(l; green
), and ubiquitin
(m; red) demonstrates a large
perinuclear COX-IV aggregate
in a neuron with increased
ubiquitination (n). DAPI
(n; blue) represents nuclear
staining. Similar results were
obtained in line 17d
summarized in Supplementary
Table 2. The bar represents
100 lmina, b, fk and 20 lm
in ce, ln
Acta Neuropathol (2012) 123:807–823 813
123
Page 7
perikarya that were positive for the mitochondrial marker
COX-IV (Supplementary Fig. 5). While the eosinophilic
aggregates were similar to those previously described by
our group and others in constitutive transgenic TDP-43
mice, they were smaller and less frequent than those
observed in the brainstem and spinal cord of constitutive
a
d
* ***
ns
***
***
NT 24d
iT 24d
NT 45d
diT 45d
NT 5.5M
diT 5.5M
NT 11M
diT 11M
0.0
0.1
0.2
0.3
0.4
0.5
0.6
Brain Weight (g)
b
iT
diT
P0
21d
45d
24d
11M
5.5M
diT NT
0.0
0.2
0.4
0.6
0.8
1.0
1.2
1.4
1.6
Fold change
c
**
e
h
fg
ji
40kDa-
30kDa-
20kDa-
40kDa-
30kDa-
20kDa-
hTDP-43
Total
TDP-43
GAPDH
iT NT diT NT diT NT diT NT
24d 45d 5.5M 11M
814 Acta Neuropathol (2012) 123:807–823
123
Page 8
wild-type TDP-43 transgenic mice (TDP-43
PrP
)[33, 43].
Ultrastructurally, the juxtanuclear aggregates in the iTDP-
43
WT
mice were composed of abnormal mitochondria
(Supplementary Fig. 5), similar to that observed in the
spinal cord and brainstem of TDP-43
PrP
mice. Co-locali-
zation experiments demonstrated neurons with
mitochondrial aggregates often had increased ubiquitin
immunoreactivity (Fig. 3l–n), but the mitochondrial
aggregates themselves were not ubiquitinated. The mito-
chondrial aggregates were only present in iTDP-43
WT
mice
at 2M of age or younger. Symptomatic mice from both
founder lines showed the highest frequency of mitochon-
drial aggregates (Supplementary Fig. 5). In summary, the
pathological profiles of iTDP-43
WT
mice with hTDP-43
overexpression during early development is complex and
exhibits only limited features observed in human TDP-43
proteinopathies.
Induction of hTDP-43 expression after weaning
prevents early lethality phenotype
Given that hTDP-43 has been proposed to play crucial
roles in development, we sought to determine what features
of the phenotype observed in iTDP-43
WT
mice may be due
to the impact of hTDP-43 overexpression in the developing
forebrain as opposed to the TDP-43 mediated proteinopa-
thy. We utilized the conditional nature of this model to
suppress hTDP-43 expression during early development
with the introduction of doxycycline into the diet
(Supplementary Fig. 1). We focused our suppression
studies on line 5a, as this line had the most severe phe-
notype. hTDP-43 expression was suppressed in iTDP-43
WT
mice from line 5a from conception until the mice reached
weaning age (21d), when cortical neurons have normally
matured and display extensively developed dendritic arb-
orizations and synaptogenesis has peaked [22, 24]. At
weaning, doxycycline was removed from the diet of the
iTDP-43 mice to allow hTDP-43 expression; we term these
mice diTDP-43
WT
.
None of the diTDP-43
WT
mice (n = 16) showed
reduced spontaneous activity, weight loss, or poor
grooming, which were the phenotypes observed in 70 % of
5a iTDP-43
WT
mice with continuous hTDP-43 expression.
In addition, diTDP-43
WT
mice had no decrease in survival,
with the oldest animal without an observable phenotype at
12M. To directly compare pathology between diTDP-43
WT
and symptomatic iTDP-43
WT
5a mice, we aged a cohort of
diTDP-43
WT
mice for 24d after induction of the hTDP-43
at weaning (final age 45d). We chose this duration of
expression because 70 % of 5a iTDP-43
WT
mice with
continuous expression of hTDP-43 are moribund and must
be euthanized by postnatal day 24; therefore, both groups
of mice expressed the transgene for approximately the
same length of time. We also aged additional cohorts of
diTDP-43
WT
mice following induction of hTDP-43
expression to 5.5M and 11M to determine how the impact
of TDP-43 overexpression in the mature forebrain advan-
ces with age (Fig. 4a).
Biochemical examination revealed no difference in full-
length hTDP-43 or total TDP-43 expression between iTDP-
43
WT
and diTDP-43
WT
mice at 45d and 11M (Fig. 4b). The
5.5M diTDP-43
WT
mice exhibited a 20 % decrease in
hTDP-43. The symptomatic iTDP-43
WT
mice had more
low molecular weight species of hTDP-43 at around 35 and
25 kDa, with the latter also observed at 11M in the diTDP-
43
WT
mice. As in the iTDP-43
WT
17d mice, mTDP-43
RNA levels within the cortex of diTDP-43
WT
(5a) mice
were down-regulated in response to overexpression of
hTDP-43 (0.664 ± 0.023; P = 0.003; Fig. 4c). Hippo-
campal mTDP-43 RNA levels were difficult to assess as
the extensive atrophy within this region prevented a clear
delineation from surrounding tissue.
hTDP-43 induction after weaning produces key
pathological features of FTLD-TDP
While neuronal loss is a salient feature of FTLD-TDP and
other TDP-43 proteinopathies, the marked atrophy of the
cortex and near complete ablation of the hippocampus that
we observed in young iTDP-43
WT
mice with continuous
expression of hTDP-43 is far more severe and rapid than
Fig. 4 hTDP-43 induction in adult neurons overcomes early lethality
and results in a progressive neurodegeneration (Line 5a). a 5a iTDP-
43
WT
mice (iT) which continually expressed hTDP-43 were compared
to 5a diTDP-43
WT
mice (diT) in which hTDP-43 was suppressed with
doxycycline until weaning. Duration at hTDP-43 expression is shown
with green arrows. Duration of hTDP-43 suppression is shown with
red arrows. Final age of mice at analysis is listed at the end of each
arrow. b Western blot of brain lysates from a 24-day-old iT mouse
and diT mice at 45 days, 5.5 months, 11 months, and NT controls
shows that hTDP-43 levels were similar between iT mice and 45d and
11 M diT mice in which hTDP-43 had been induced post-weaning.
There was approximately 20 % decrease in hTDP-43 in 5.5M diT
mice. Increased lower molecular weight hTDP-43 products were
observed in the 24-day-old 5a iT mice at *35 and *25 kD, the latter
was also observed in the diT 11M old mice. Total TDP-43 levels were
equivalent across iT and diT mice. GAPDH was used as a loading
control. c Quantitative real time PCR using murine-specific TDP-43
primers demonstrates reduced expression of endogenous TDP-43 in
45-day-old diT mice in the cortex relative to NT littermates (n = 3).
d Whole brain weight comparison shows 45-day-old diT mice to be
equivalent to NT mice and significantly greater than iT mice.
However, diT brain weight decreases with age and is significantly less
than NT mice by 5.5 months. ej H&E staining of diT (eg) and NT
(hj) mice at 45 days (e, h), 5.5 months (f, i), and 11 months
(g, j) reveals progressive dentate gyrus ablation and hippocampal
formation atrophy in addition to cortical thinning at 11 months.
Statistical analysis was assessed by Student’s t test in c, d. The bar
represents 500 lm. ***P \ 0.001, **P \0.01, *P \ 0.05, ns no
significance
b
Acta Neuropathol (2012) 123:807–823 815
123
Page 9
observed in any known human TDP-43 proteinopathy. To
determine if the marked brain atrophy that we observed in
the iTDP-43
WT
mice was due to hTDP-43 overexpression
in the environment of the developing forebrain, we com-
pared brain weights between iTDP-43
WT
, diTDP-43
WT
,
and NT mice (Fig. 4d). Brain weights of diTDP-43
WT
at
45 days were equivalent to NT controls and significantly
increased (P \ 0.0001) over iTDP-43
WT
mice that were
matched for duration of hTDP-43 expression. The results
suggest that the brain atrophy observed in young iTDP-
43
WT
mice is due to overexpression of hTDP-43 in the
developing forebrain. In contrast, induction of hTDP-43
expression within more mature weanling forebrains yields
a progressive loss of brain weight that worsens with aging
(Fig. 4d), reaching significance at 5.5 months (P = 0.010)
and further declining by 11 months (P = 0.0003).
Although no overt neurodegeneration was observed in the
diTDP-43
WT
cortex at 45 days (Fig. 4e, Supplementary
Fig. 6a), apoptotic bodies were detected, predominantly in
the dentate gyrus (Fig. 4e, inset). The hippocampal for-
mation in the diTDP-43
WT
mice at 45d onward was
significantly atrophied compared to NT controls (Fig. 4e–j,
Supplementary Fig. 6b). Hippocampal atrophy progressed
with age and became severe at 11M at which point it was
accompanied by significant cortical atrophy (Supplemen-
tary Fig. 6). Striking ablation of the dentate gyrus in
diTDP-43
WT
mice became apparent by 5.5 months and
progressed by 11 months (Fig. 4e–j). The dentate gyrus
had a relatively high quantity of TUNEL-positive cells
(Supplementary Fig. 7), correlating with this region having
the most striking neuronal loss (Fig. 4e–j).
We evaluated the brains of diTDP-43
WT
mice for the
presence of ubiquitin- and TDP-43-positive inclusions
observed in human TDP-43 proteinopathies. In contrast to
that observed in the iTDP-43
WT
mice, large ([1 um)
pS409/410-TDP-43 inclusions were predominant and
co-localized with ubiquitin 94 % of the time in 45d diTDP-
43
WT
mice (Fig. 5a–c). Interestingly, multiple inclusions
were often found within the same neuronal cell process.
These were distinct, punctate inclusions akin to the TDP-43
cytoplasmic inclusions observed in FTLD-TDP. These
inclusions drastically decreased in the 5.5M and 11M
diTDP-43
WT
mice (Fig. 5d). Because inclusions decreased
with age while neuronal loss increased with age, we sought
to determine whether neurons containing inclusions were
more susceptible to neuronal loss. Co-localization studies
revealed that 92 % of pS409/410-TDP-43 inclusions were
co-labeled for cleaved caspase 3 (Fig. 5e–g, Supplemen-
tary Fig. 8) in 45d diT mice.
Further immunohistochemical analyses revealed that the
number of cells expressing hTDP-43 within the nucleus of
diTDP-43
WT
mice decreased with age (Supplementary
Fig. 9), likely reflecting the selective loss of those neurons.
Diffuse cytoplasmic hTDP-43 immunoreactivity increased
with age in diTDP-43
WT
mice (Supplementary Fig. 9).
diTDP-43
WT
mice showed a moderate increase in activated
microglia with age (Fig. 6a–f), while reactive astrocytes
dramatically increased at 11 months (Fig. 6g–l) when
compared to NT mice. In summary, the pathological profile
of diTDP-43
WT
mice with hTDP-43 overexpression in the
mature forebrain shared similarities with that observed in
human TDP-43 proteinopathies.
Degenerating and clustered mitochondria observed in
iTDP-43
WT
mice and other TDP-43 mouse models [33, 43]
are not typical of FTLD-TDP; therefore, we sought to
determine if this uncharacteristic phenotype observed in
iTDP-43
WT
mice was also present in diTDP-43
WT
mice. We
were not able to find eosinophilic aggregates by H&E in
diTDP-43
WT
mice. Moreover, abnormal immunoreactivity
for COX-IV observed in iTDP-43
WT
mice (Fig. 7a) was not
observed in the diTDP-43
WT
or NT mice at any age exam-
ined (Fig. 7b–h), even in neurons with increased ubiquitin
immunoreactivity (Fig. 7i–k). These results suggest that the
mitochondrial abnormality observed in iTDP-43
WT
mice
is, indeed, a consequence of hTDP-43 overexpression
before P21 during early neuronal development.
Because FTLD-TDP affects patients in mid to late life,
we sought to validate our observations from diTDP-43
WT
mice with induction of hTDP-43 expression at weaning in
diTDP-43 mice with induction of hTDP-43 expression at
10M. diTDP-43 mice were raised from conception until
10M of age on doxycycline to suppress hTDP-43 expres-
sion. At 10M, doxycycline was removed from the diet and
the diTDP-43 mice were allowed to express hTDP-43 for
24 days. These mice are termed -10M ? 24d to denote
suppressed for 10 months then expressed for 24 days to
distinguish them from the previously described diTDP-43
mice at 45d. hTDP-43 expression was equivalent between
45d and -10M ? 24d diTDP-43
WT
mice, demonstrating
that expression of the hTDP-43 transgene were similar
regardless of length of doxycycline suppression (Supple-
mentary Fig. 10a). diTDP-43
WT
(-10M ? 24d) mice
formed large pS409/410-TDP-43 inclusions that co-local-
ized with ubiquitin in [90 % of the inclusion bearing
neurons, similar to that previously observed in the diTDP-
43 mice at 45d (Supplementary Fig. 10b–g). This result
demonstrates that pTDP-43 inclusions can readily form in
adult neurons and that the loss of inclusions observed in
5.5M and 11M diTDP-43
WT
mice following hTDP-43
induction at weaning does not reflect a general inability of
aged mice to form inclusions. Histological examination of
sagittal H&E sections revealed apoptotic bodies, mainly in
the dentate gyrus of the diTDP-43
WT
(-10M ? 24d) mice
(Supplementary Fig. 10h). Futhermore, moderate micro-
gliosis and astrocytosis were observed in diTDP-43
WT
(-10M ? 24d) mice (Supplementary Fig. 10i, j). These
816 Acta Neuropathol (2012) 123:807–823
123
Page 10
neuropathological features were elevated over that
observed in NT controls (Supplementary Fig. 10k–m). In
total, these preliminary results suggest that hTDP-43
induction in both young adult mice (45d) and older adult
mice (-10M ? 24d) demonstrate characteristic features of
FTLD-TDP.
Discussion
We have demonstrated that expression of hTDP-43 during
early development yields a severe and complex phenotype
(see Supplementary Table 2 for summary), including
aggregation of phosphorylated TDP-43 and gliosis; how-
ever, these features are also accompanied by early
lethality, extensive neuronal loss at an early age, TDP-43
inclusions that lack ubiquitin immunoreactivity and
mitochondrial abnormalities that are not typical of human
TDP-43 proteinopathies. A subset of the iTDP-43
WT
mice
does survive until at least 12M; however, it is not
uncommon for transgenic mice to show variable pene-
trance and survival rates, even when on an inbred
background [1, 10, 11, 14]. As with prior examples, it is
difficult to pinpoint the cause of this bimodal survival;
however, it does not appear to be simply a matter of
transgene expression. One could conceive of unlimited
pathways through which this may occur including the
activity of ubiquitin-proteosomal system within each pup,
the ability of some pups to adjust mTDP-43 or other
unknown interacting factors quicker than others, individ-
ual pup distress during pregnancy and amount of care and
suckling that any one pup receives. It should be noted that
cab
pTDP-43
Ubiquitin Merge
45d diT
d
12
13
pTDP-43 and Ubiquitin
3
4
5
6
7
8
9
10
11
% Neurons
pTDP-43 Aggregates
Ubiquitin Aggregates
MergepTDP-43 Caspase 3
gef
1.5 5.5 11.0
0
1
2
Age (months)
45d diT
Fig. 5 hTDP-43 expression
after weaning in diTDP-43
WT
(diT) mice from Line 5a
produces salient
neuropathological features of
FTLD-TDP. ac 45-day diT
cortical tissue fluorescently
immunostained for phospho-
TDP-43 at amino acids 409–410
(a; green) and ubiquitin (b; red).
Overlay (c) reveals frequent
ubiquitin-positive, phospho-
TDP-43 aggregates
(arrowheads) at cell processes.
d Quantitative analysis of the
percent neurons containing
phospho-TDP-43 inclusions,
ubiquitin inclusions, and
inclusions positive for both
phospho-TDP-43 and ubiquitin
in 45d, 5.5M, and 11M diT mice
demonstrates that phospho-
TDP-43 inclusions are highest
in 45d diT mice (9.7 %) and
drastically decreases in 5.5M
(1.0 %) and 11M (1.3 %) diT
mice. The phospho-TDP-43
inclusions co-localize with
ubiquitin 94.3 % of the time in
45d diT mice. eg 45-day diT
cortical tissue fluorescently
immunostained for pTDP-43
(e; green) and cleaved caspase 3
(f; red). Overlay (g) shows that
cleaved caspase 3 selectively
co-localizes with pTDP-43
inclusions. The bar represents
20 lm. SEM shown in d
Acta Neuropathol (2012) 123:807–823 817
123
Page 11
pups that escape the moribund phenotype still have sig-
nificantly reduced brain weight (Fig. 2f).
hTDP-43 induction in the more mature forebrain of
weaned diTDP-43
WT
mice prevented early death, sponta-
neous movement deficits, severe neurodegeneration and
mitochondrial abnormalities. While the loss of these fea-
tures is interesting, it is rather the gain of the salient
features of FTLD-TDP in diTDP-43
WT
mice over that
observed in iTDP-43
WT
mice that is the most compelling
finding of our study. diTDP-43
WT
mice showed slowly
progressing neurodegeneration, progressive gliosis and
punctate cytoplasmic TDP-43 inclusions with ubiquitin
immunoreactivity—each of these features closely mimics
that observed in human TDP-43 proteinopathies and
is not akin to that observed in iTDP-43
WT
mice (see
Supplementary Table 2 for summary). TDP-43 inclusions
were primarily in cortical and hippocampal neurons, a
distribution that correlates with the brain regions with
highest hTDP-43 expression.
We and others have previously shown that endogenous
mTDP-43 is down-regulated in response to hTDP-43
overexpression [4, 19, 33, 43]. We found that this was also
the case in the cortex and hippocampus of non-symptom-
atic 17d iT mice and in the cortex of diT 5a mice.
Importantly, heterozygous TDP-43 knockout mice express
TDP-43 at levels equivalent to control mice [21, 32, 42].
Recently, a report has demonstrated that TDP-43 controls
its own expression via a negative feedback loop in a human
cell line [4]. Our data support these results, suggesting that
neurons have a compensatory mechanism to control tightly
45d 5.5M 11M
diTNTdiTNT
Iba1
GFAP
acb
dfe
gih
jlk
Fig. 6 diTDP-43
WT
mice exhibit progressive gliosis. af Cortical
immunohistochemical staining for microgliosis (Iba1) in diT (line 5a)
(ac) and NT (df) mice at 45 days (a, d), 5.5 months (b, e), and
11 months (c, f) exhibits a moderate increase in reactive microglia
with age in diT mice compared to NT mice. gl Cortical
immunohistochemical staining for astrocytosis (GFAP) in diT (line
5a) (gi) and NT (jl) mice at 45 days (g, j), 5.5 months (h, k), and
11 months (i, l) reveals a striking increase in reactive astrocytes in
11-month diT mice. The bar represents 100 lm
818 Acta Neuropathol (2012) 123:807–823
123
Page 12
TDP-43 levels. Moreover, this feedback mechanism
appears to be present at multiple stages of development.
These data implies that TDP-43 expression must remain
within a precise range for cellular homeostasis.
Early lethality observed in our iTDP-43
WT
mice and
other transgenic TDP-43 models continually expressing
hTDP-43 [35, 41, 43] indicates that hTDP-43 overexpres-
sion either results in an extremely rapid disease course in
mice or that TDP-43 plays a critical functional role during
development. The latter hypothesis was supported by one
of the first published reports of TDP-43 mutations [34],
where chick embryos transfected with TDP-43 mutant
plasmids developed abnormal limb and tail buds and only
15 % reached the normal stage of maturation. In the
current report, the severe neuronal loss and brain atrophy in
iTDP-43
WT
mice continually expressing hTDP-43 occurs
in the developing forebrain and the severe brain atrophy
appears not to progress in the iTDP-43
WT
animals who live
beyond 2 months of age. To determine whether TDP-43
had an impact on early brain development, we exploited
the conditional nature of our model by inducing hTDP-43
expression later in development after weaning. We dem-
onstrated that all diTDP-43
WT
developmentally suppressed
mice survived without early lethality of continually
expressing iTDP-43
WT
mice. They did not have an overt
phenotype up to 12M, the oldest age examined. This result
is consistent with the recent report by Igaz and colleagues
[19], who described a conditional TDP-43 transgenic
acb
egf
d
h
i kj
Fig. 7 Mitochondrial aggregates are absent in diTDP-43
WT
mice.
Cortical tissue of symptomatic 5a iT (a), diT (bd), and NT
(eh) mice at 24 days (a, e), 45 days (b, f), 5.5 months (c, g), and
11 months (d, h) demonstrates COX-IV immunopositive aggregates
within the iT mice that are absent from diT and NT mice at all ages.
ik Fluorescent immunostaining of the cortex in 45-day-old diT mice
for the mitochondrial marker, COX-IV (i; green), and ubiquitin
(j; red) reveals mitochondria are not aggregated even when ubiquitin-
positive aggregates are present (k). DAPI (k; blue) represents nuclear
staining. The bar represents 100 lminah and 20 lminik
Acta Neuropathol (2012) 123:807–823 819
123
Page 13
mouse model under the control of a CaMKIIa promoter
similar to our current diTDP-43
WT
model. Igaz and col-
leagues generated a high expressing line (8- to 9-fold) with
a defective nuclear localization signal (hTDP-43DNLS) as
well as a low expressing (0.4- to 1.7-fold) wild type line
(hTDP-43-WT) where the transgene was suppressed until
postnatal day 28 with subsequent aging to 6M without
lethality. In contrast to the current report, Igaz and col-
leagues did not explore the differences between hTDP-43
induction in the developing brain when compared with
the mature brain; therefore, it is difficult to determine if
continuous expression in their model would have produced
the severe phenotype and early lethality we observed in
continuously expressing mice. On the other hand, a con-
stitutive model over-expressing wild type TDP-43 at
twofold higher than endogenous levels under the CaMKIIa
promoter has been reported to have reduced survival
though not at the early time points that we have described
[36].
In the present study, iTDP-43
WT
mice developed fre-
quent neuronal perikaryal mitochondrial aggregates in the
cortex, particularly in layer V, and occasionally in the
hippocampus. Our group and others have previously gen-
erated transgenic models with continuous overexpression
of TDP-43 that develops mitochondrial aggregates [33, 43].
The neuronal cytoplasmic eosinophilic aggregates
observed in our iTDP-43
WT
model were much smaller than
those observed in the brainstem and spinal cord of our
previously reported constitutive TDP 43
PrP
mice [33, 43].
We did not observe eosinophilic aggregates and immuno-
histological (COX-IV) evidence of abnormal mitochondrial
clusters in the diTDP-43
WT
mice following post-weaning
induction of hTDP-43 in mature forebrain. Interestingly,
Igaz et al. also did not report the occurrence of mitochon-
drial clusters when they induced TDP-43 overexpression at
P28 in their inducible TDP-43 mice. Given our results, we
suggest that Igaz et al. did not report mitochondrial clus-
tering because they only expressed the TDP-43 transgene
in their mice from P28 onward. Our data suggest that the
mechanism through which TDP-43 regulates mitochondrial
biology occurs during early brain development, when the
brain appears to be unusually sensitive to hTDP-43 over-
expression. Our current iTDP-43
WT
lines combined with
the hTDP-43 post-weaning induction strategy will likely be
useful in elucidating how TDP-43 impacts mitochondrial
dynamics.
The early, severe neuronal loss and atrophy, with near
total ablation of the hippocampus was perhaps the most
striking phenotype that we observed in iTDP-43
WT
mice
but did not observe in diTDP-43
WT
mice. The severe
neuronal loss and atrophy in iTDP-43
WT
mice were
accompanied by comparable microgliosis and astrogliosis.
In contrast, diTDP-43
WT
mice at earlier ages had
equivalent brain weights as NT mice, but they had a pro-
gressive decrease in brain weight with increasing age—a
degenerative phenotype that is similar to the later onset,
progressive neuronal loss and gliosis that are features of
human TDP-43 proteinopathies. Igaz and colleagues pre-
viously reported that post-weaning (P28) induction of
hTDP-43DNLS (8- to 9-fold) or hTDP-43-WT (0.4- to
1.7-fold) resulted in progressive neuronal loss, which
suggests that TDP-43 dysregulation in the mature forebrain
results in progressive neurodegeneration regardless of
expression level [19]. Furthermore, both micro- and
astrogliosis increased with age in the diTDP-43
WT
mice.
These results strongly indicate that during early develop-
ment neuronal populations are highly sensitive to even
moderate (2- to 3-fold) levels of hTDP-43 overexpression.
The underlying mechanism through which this develop-
mental sensitivity to TDP-43 remains to be determined, but
we have identified the developmental window of selective
neuronal vulnerability and, therefore, we can postulate
which developmental milestones might be affected. The
timing of neuronal loss during the third postnatal week
suggests that neurogenesis and synaptogenesis are not
markedly affected by hTDP-43 overexpression. Instead, the
neuronal loss occurs when synaptic pruning is ongoing
[23] and dendritic and axonal arbors are increasing in
complexity [22, 24]. Consequently, activity-dependent
plasticity may be implicated, and interestingly TDP-43 has
been shown to act as an activity-responsive factor that
represses translation in the dendrites of hippocampal neurons
[39]. Thus, TDP-43 misregulation during this period could
have profound effects on RNA metabolism, which could be
highly toxic to neurons in the developing brain. In addition,
the role of overexpression of hTDP-43 on mitochondrial
pathology during early development may be associated with
compromise of energy dynamics in the immature neurons,
rendering them more prone to apoptosis. Certainly, the
availability of the conditional in vivo model described herein
will allow the field to uncover the basis of the sensitivity of
developing neurons to TDP-43 misregulation.
While iTDP-43
WT
mice develop cytoplasmic inclusions
that have phosphorylated TDP-43, these inclusions only
occasionally had ubiquitin immunoreactivity. In contrast,
45-day-old diTDP-43
WT
mice developed distinct, punctate
TDP-43 inclusions in neuronal perikarya and cell pro-
cesses, which also had ubiquitin immunoreactivity. In this
respect, TDP-43 aggregates in diTDP-43
WT
mice are sim-
ilar in appearance to TDP-43 neuronal cytoplasmic
inclusions in FTLD-TDP. Interestingly, inclusions in
diTDP-43
WT
mice decrease in size and number with age,
suggesting that neurons containing these inclusions may be
preferentially lost. The hTDP-43DNLS model reported by
Igaz and colleagues also had decrease in inclusions with
time; however, the number of inclusions at peak was rare,
820 Acta Neuropathol (2012) 123:807–823
123
Page 14
ranging from \1to\0.1 % depending on line [19]. In
contrast, the phospho-TDP-43 and ubiquitin immunoposi-
tive neuronal inclusions in the constitutive CaMKII-TDP-
43 Tg model reported by Tsai and colleagues were only
mentioned in mice 6-month old, so we cannot determine
when these inclusions became apparent or if they decreased
with age [36]. Our results strongly suggest that phospho-
TDP-43 aggregates are associated with neurotoxicity in
that they have co-localization with activated caspase 3.
Igaz and colleagues suggested that loss of murine TDP-43
within the nuclear compartment may render neurons in
inducible TDP-43 mice susceptible to neurodegeneration
[19]. Without a commercially available mTDP-43 anti-
body, we are unable to confirm these findings; however,
RNA analysis suggests that a similar reduction of nuclear
mTDP-43 occurs within our iTDP-43
WT
mice. Importantly,
human and mouse TDP-43 are highly homologous [38]. It
would therefore seem surprising that a moderate (2- to
3-fold) level of human TDP-43 overexpression would be
incapable of compensating for the nuclear loss of mTDP-
43. Without the availability of an hTDP-43 knockin mouse,
it is difficult to assess with certainty that the human TDP-
43 can compensate for murine TDP-43 in vivo.
In generating iTDP-43
WT
mice with forebrain expres-
sion, we sought to recapitulate features of FTLD-TDP and
other TDP-43 proteinopathies, but the conditional nature of
the model has also allowed us to determine the impact of
TDP-43 induction at different developmental periods on
the ensuing pathologic phenotype. Consequently, we report
for the first time that the developing brain is more sensitive
to hTDP-43 overexpression than more mature brain,
despite having the same ability to autoregulate endogenous
mTDP-43 levels. In addition, the early, severe neuronal
loss and brain atrophy in iTDP-43
WT
mice probably has a
different pathogenesis from the progressive neurodegen-
eration observed in diTDP-43
WT
mice when expression of
transgene is delayed. Moreover, the present results suggest
that ubiquitinated, phospho-TDP-43 aggregates may
themselves be neurotoxic in mature neurons. Finally and
most critically, the timing of hTDP-43 overexpression
certainly affects the integrity of model phenotype as it
relates to FTLD-TDP. The availability of this new TDP-43
model system provides the field with a more pathologically
similar transgenic mouse model for FTLD-TDP as well as
a system in which the role of TDP-43 in development
versus disease can now be distinguished.
Acknowledgments We thank Virginia Phillips, Sarah Miles, Brit-
tany Dugger, Melissa Murray, and Jennifer Gass for technical support.
We thank David Borchelt for helpful discussions. This work was
supported by the American Federation for Aging Research Affiliate
Research Grant Program (Y.Z.), National Institutes of Health/
National Institute on Aging [P50AG16574 (D.W.D.); R01AG026251
and R01AG026251–03A2 (L.P.); and P01-AG17216-08 (L.P.,
D.W.D.)], National Institutes of Health/National Institute of
Neurological Disorders and Stroke [R01 NS 063964-01 (L.P.),
5R21NS071097-02 (J.L.)], Amyotrophic Lateral Sclerosis Associa-
tion (L.P. and J.L.), and Department of Defense [USAMRMC
PR080354 (L.P. and J.L.)], Mayo Clinic (D.W.D, L.P., and J.L.),
McKnight Brain Research Foundation and the Evelyn F. and William
L. McKnight Brain Institute at the University of Florida (M.R.S.), and
University of Florida (J.L.).
Conflict of interest Disclosures have been filed for the transgenic
mice and the construct used to make the transgenic mice.
Open Access This article is distributed under the terms of the
Creative Commons Attribution License which permits any use, dis-
tribution, and reproduction in any medium, provided the original
author(s) and the source are credited.
References
1. Ahmed Z, Sheng H, Xu YF, Lin WL, Innes AE, Gass J, Yu X,
Wuertzer CA, Hou H, Chiba S, Yamanouchi K, Leissring M,
Petrucelli L, Nishihara M, Hutton ML, McGowan E, Dickson
DW, Lewis J (2010) Accelerated lipofuscinosis and ubiquitina-
tion in granulin knockout mice suggest a role for progranulin in
successful aging. Am J Pathol 177(1):311–324. doi:10.2353/
ajpath.2010.090915
2. Amador-Ortiz C, Lin WL, Ahmed Z, Personett D, Davies P,
Duara R, Graff-Radford NR, Hutton ML, Dickson DW (2007)
TDP-43 immunoreactivity in hippocampal sclerosis and Alzhei-
mer’s disease. Ann Neurol 61(5):435–445. doi:10.1002/ana.
21154
3. Arai T, Mackenzie IR, Hasegawa M, Nonoka T, Niizato K, Tsuchiya
K, Iritani S, Onaya M, AkiyamaH (2009) Phosphorylated TDP-43 in
Alzheimer’s disease and dementia with Lewy bodies. Acta Neuro-
pathol 117(2):125–136. doi:10.1007/s00401-008-0480-1
4. Ayala YM, De Conti L, Avendano-Vazquez SE, Dhir A, Romano
M, D’Ambrogio A, Tollervey J, Ule J, Baralle M, Buratti E,
Baralle FE (2010) TDP-43 regulates its mRNA levels through
a negative feedback loop. EMBO J. doi:emboj201031010.1038/
emboj.2010.310
5. Benajiba L, Le Ber I, Camuzat A, Lacoste M, Thomas-Anterion
C, Couratier P, Legallic S, Salachas F, Hannequin D, Decousus
M, Lacomblez L, Guedj E, Golfier V, Camu W, Dubois B,
Campion D, Meininger V, Brice A (2009) TARDBP mutations in
motoneuron disease with frontotemporal lobar degeneration. Ann
Neurol 65(4):470–473. doi:10.1002/ana.21612
6. Borroni B, Bonvicini C, Alberici A, Buratti E, Agosti C, Archetti
S, Papetti A, Stuani C, Di Luca M, Gennarelli M, Padovani A
(2009) Mutation within TARDBP leads to frontotemporal
dementia without motor neuron disease. Hum Mutat 30(11):
E974–E983. doi:10.1002/humu.21100
7. Buratti E, Baralle FE (2008) Multiple roles of TDP-43 in gene
expression, splicing regulation, and human disease. Front Biosci
13:867–878. doi:2727
8. Cairns NJ, Neumann M, Bigio EH, Holm IE, Troost D, Hatanpaa
KJ, Foong C, White CL 3rd, Schneider JA, Kretzschmar HA,
Carter D, Taylor-Reinwald L, Paulsmeyer K, Strider J, Gitcho M,
Goate AM, Morris JC, Mishra M, Kwong LK, Stieber A, Xu Y,
Forman MS, Trojanowski JQ, Lee VM, Mackenzie IR (2007)
TDP-43 in familial and sporadic frontotemporal lobar degenera-
tion with ubiquitin inclusions. Am J Pathol 171(1):227–240. doi:
171/1/227
Acta Neuropathol (2012) 123:807–823 821
123
Page 15
9. Chiang PM, Ling J, Jeong YH, Price DL, Aja SM, Wong PC
(2010) Deletion of TDP-43 down-regulates Tbc1d1, a gene linked
to obesity, and alters body fat metabolism. Proc Natl Acad
Sci USA 107(37):16320–16324. doi:100217610710.1073/pnas.
1002176107
10. Chishti MA, Yang DS, Janus C, Phinney AL, Horne P, Pearson J,
Strome R, Zuker N, Loukides J, French J, Turner S, Lozza G,
Grilli M, Kunicki S, Morissette C, Paquette J, Gervais F, Ber-
geron C, Fraser PE, Carlson GA, George-Hyslop PS, Westaway
D (2001) Early-onset amyloid deposition and cognitive deficits in
transgenic mice expressing a double mutant form of amyloid
precursor protein 695. J Biol Chem 276(24):21562–21570. doi:
10.1074/jbc.M100710200M100710200
11. Dai Q, Zhang C, Wu Y, McDonough H, Whaley RA, Godfrey V,
Li HH, Madamanchi N, Xu W, Neckers L, Cyr D, Patterson C
(2003) CHIP activates HSF1 and confers protection against
apoptosis and cellular stress. EMBO J 22(20):5446–5458. doi:
10.1093/emboj/cdg529
12. Davidson Y, Kelley T, Mackenzie IR, Pickering-Brown S, Du
Plessis D, Neary D, Snowden JS, Mann DM (2007) Ubiquitinated
pathological lesions in frontotemporal lobar degeneration contain
the TAR DNA-binding protein, TDP-43. Acta Neuropathol
113(5):521–533. doi:10.1007/s00401-006-0189-y
13. Dejesus-Hernandez M, Mackenzie IR, Boeve BF, Boxer AL,
Baker M, Rutherford NJ, Nicholson AM, Finch NA, Flynn H,
Adamson J, Kouri N, Wojtas A, Sengdy P, Hsiung GY, Karydas
A, Seeley WW, Josephs KA, Coppola G, Geschwind DH, Wsz-
olek ZK, Feldman H, Knopman DS, Petersen RC, Miller BL,
Dickson DW, Boylan KB, Graff-Radford NR, Rademakers R
(2011) Expanded GGGGCC hexanucleotide repeat in noncoding
region of C9ORF72 causes chromosome 9p-linked FTD and
ALS. Neuron 72(2):245–256. doi:S0896-6273(11)00828-210.1016/
j.neuron.2011.09.011
14. Dickey CA, Yue M, Lin WL, Dickson DW, Dunmore JH, Lee
WC, Zehr C, West G, Cao S, Clark AM, Caldwell GA, Caldwell
KA, Eckman C, Patterson C, Hutton M, Petrucelli L (2006)
Deletion of the ubiquitin ligase CHIP leads to the accumulation,
but not the aggregation, of both endogenous phospho- and cas-
pase-3-cleaved tau species. J Neurosci 26(26):6985–6996. doi:
26/26/698510.1523/JNEUROSCI.0746-06.2006
15. Geser F, Winton MJ, Kwong LK, Xu Y, Xie SX, Igaz LM,
Garruto RM, Perl DP, Galasko D, Lee VM, Trojanowski JQ
(2008) Pathological TDP-43 in parkinsonism-dementia complex
and amyotrophic lateral sclerosis of Guam. Acta Neuropathol
115(1):133–145. doi:10.1007/s00401-007-0257-y
16. Gossen M, Bujard H (1992) Tight control of gene expression in
mammalian cells by tetracycline-responsive promoters. Proc Natl
Acad Sci USA 89(12):5547–5551
17. Hasegawa M, Arai T, Akiyama H, Nonaka T, Mori H, Hashimoto
T, Yamazaki M, Oyanagi K (2007) TDP-43 is deposited in the
Guam parkinsonism-dementia complex brains. Brain 130(Pt
5):1386–1394. doi:10.1093/brain/awm065
18. Higashi S, Iseki E, Yamamoto R, Minegishi M, Hino H, Fujisawa
K, Togo T, Katsuse O, Uchikado H, Furukawa Y, Kosaka K, Arai
H (2007) Concurrence of TDP-43, tau and alpha-synuclein
pathology in brains of Alzheimer’s disease and dementia with
Lewy bodies. Brain Res 1184:284–294. doi:S0006-8993(07)
02224-X10.1016/j.brainres.2007.09.048
19. Igaz LM, Kwong LK, Lee EB, Chen-Plotkin A, Swanson E,
Unger T, Malunda J, Xu Y, Winton MJ, Trojanowski JQ, Lee VM
(2011) Dysregulation of the ALS-associated gene TDP-43 leads
to neuronal death and degeneration in mice. J Clin Invest
121(2):726–738. doi:10.1172/JCI4486744867
20. Kovacs GG, Murrell JR, Horvath S, Haraszti L, Majtenyi K,
Molnar MJ, Budka H, Ghetti B, Spina S (2009) TARDBP
variation associated with frontotemporal dementia, supranuclear
gaze palsy, and chorea. Mov Disord 24(12):1843–1847. doi:
10.1002/mds.22697
21. Kraemer BC, Schuck T, Wheeler JM, Robinson LC, Trojanowski
JQ, Lee VM, Schellenberg GD (2010) Loss of murine TDP-43
disrupts motor function and plays an essential role in embryo-
genesis. Acta Neuropathol 119(4):409–419. doi:10.1007/s00401-
010-0659-0
22. Larsen DD, Callaway EM (2006) Development of layer-specific
axonal arborizations in mouse primary somatosensory cortex.
J Comp Neurol 494(3):398–414. doi:10.1002/cne.20754
23. Lewis S (2011) Development: microglia go pruning. Nat Rev
Neurosci 12(9):492–493. doi:10.1038/nrn3095nrn3095
24. Li M, Cui Z, Niu Y, Liu B, Fan W, Yu D, Deng J (2010)
Synaptogenesis in the developing mouse visual cortex. Brain
Res Bull 81(1):107–113. doi:S0361-9230(09)00278-010.1016/
j.brainresbull.2009.08.028
25. Mackenzie IR, Rademakers R, Neumann M (2010) TDP-43 and
FUS in amyotrophic lateral sclerosis and frontotemporal
dementia. Lancet Neurol 9(10):995–1007. doi:S1474-4422(10)
70195-210.1016/S1474-4422(10)70195-2
26. Mayford M, Bach ME, Huang YY, Wang L, Hawkins RD, Kandel
ER (1996) Control of memory formation through regulated
expression of a CaMKII transgene. Science 274(5293):1678–1683
27. Mayford M, Wang J, Kandel ER, O’Dell TJ (1995) CaMKII
regulates the frequency-response function of hippocampal
synapses for the production of both LTD and LTP. Cell
81(6):891–904. doi:0092-8674(95)90009-8
28. Neumann M, Sampathu DM, Kwong LK, Truax AC, Micsenyi
MC, Chou TT, Bruce J, Schuck T, Grossman M, Clark CM,
McCluskey LF, Miller BL, Masliah E, Mackenzie IR, Feldman
H, Feiden W, Kretzschmar HA, Trojanowski JQ, Lee VM (2006)
Ubiquitinated TDP-43 in frontotemporal lobar degeneration and
amyotrophic lateral sclerosis. Science 314(5796):130–133
29. Probst A, Taylor KI, Tolnay M (2007) Hippocampal sclerosis
dementia: a reappraisal. Acta Neuropathol 114(4):335–345. doi:
10.1007/s00401-007-0262-1
30. Renton AE, Majounie E, Waite A, Simon-Sanchez J, Rollinson S,
Gibbs JR, Schymick JC, Laaksovirta H, van Swieten JC,
Myllykangas L, Kalimo H, Paetau A, Abramzon Y, Remes AM,
Kaganovich A, Scholz SW, Duckworth J, Ding J, Harmer DW,
Hernandez DG, Johnson JO, Mok K, Ryten M, Trabzuni D,
Guerreiro RJ, Orrell RW, Neal J, Murray A, Pearson J, Jansen IE,
Sondervan D, Seelaar H, Blake D, Young K, Halliwell N, Call-
ister JB, Toulson G, Richardson A, Gerhard A, Snowden J, Mann
D, Neary D, Nalls MA, Peuralinna T, Jansson L, Isoviita VM,
Kaivorinne AL, Holtta-Vuori M, Ikonen E, Sulkava R, Benatar
M, Wuu J, Chio A, Restagno G, Borghero G, Sabatelli M,
Heckerman D, Rogaeva E, Zinman L, Rothstein JD, Sendtner M,
Drepper C, Eichler EE, Alkan C, Abdullaev Z, Pack SD, Dutra A,
Pak E, Hardy J, Singleton A, Williams NM, Heutink P,
Pickering-Brown S, Morris HR, Tienari PJ, Traynor BJ (2011) A
hexanucleotide repeat expansion in C9ORF72 is the cause of
chromosome 9p21-linked ALS-FTD. Neuron 72(2):257–268.
doi:S0896-6273(11)00797-510.1016/j.neuron.2011.09.010
31. Santacruz K, Lewis J, Spires T, Paulson J, Kotilinek L, Ingelsson
M, Guimaraes A, DeTure M, Ramsden M, McGowan E, Forster
C, Yue M, Orne J, Janus C, Mariash A, Kuskowski M, Hyman B,
Hutton M, Ashe KH (2005) Tau suppression in a neurodegenera-
tive mouse model improves memory function. Science 309(5733):
476–481
32. Sephton CF, Good SK, Atkin S, Dewey CM, Mayer P 3rd, Herz J,
Yu G (2010) TDP-43 is a developmentally regulated protein
essential for early embryonic development. J Biol Chem 285(9):
6826–6834. doi:M109.06184610.1074/jbc.M109.061846
822 Acta Neuropathol (2012) 123:807–823
123
Page 16
33. Shan X, Chiang PM, Price DL, Wong PC (2010) Altered distribu-
tions of Gemini of coiled bodies and mitochondria in motor neurons
of TDP-43 transgenic mice. Proc Natl Acad Sci USA 107(37):
16325–16330. doi:100345910710.1073/pnas.1003459107
34. Sreedharan J, Blair IP, Tripathi VB, Hu X, Vance C, Rogelj B,
Ackerley S, Durnall JC, Williams KL, Buratti E, Baralle F, de
Belleroche J, Mitchell JD, Leigh PN, Al-Chalabi A, Miller CC,
Nicholson G, Shaw CE (2008) TDP-43 mutations in familial and
sporadic amyotrophic lateral sclerosis. Science 319(5870):1668–
1672. doi:115458410.1126/science.1154584
35. Stallings NR, Puttaparthi K, Luther CM, Burns DK, Elliott JL
(2010) Progressive motor weakness in transgenic mice expressing
human TDP-43. Neurobiol Dis 40(2):404–414. doi:S0969-9961
(10)00213-510.1016/j.nbd.2010.06.017
36. Tsai KJ, Yang CH, Fang YH, Cho KH, Chien WL, Wang WT, Wu
TW, Lin CP, Fu WM, Shen CK (2010) Elevated expression of TDP-
43 in the forebrain of mice is sufficient to cause neurological and
pathological phenotypes mimicking FTLD-U. J Exp Med
207(8):1661–1673. doi:jem.2009216410.1084/jem.20092164
37. Uryu K, Nakashima-Yasuda H, Forman MS, Kwong LK, Clark
CM, Grossman M, Miller BL, Kretzschmar HA, Lee VM, Tro-
janowski JQ, Neumann M (2008) Concomitant TAR-DNA-
binding protein 43 pathology is present in Alzheimer disease and
corticobasal degeneration but not in other tauopathies. J Neuro-
pathol Exp Neurol 67(6):555–564. doi:10.1097/NEN.0b013e318
17713b500005072-200806000-00004
38. Wang HY, Wang IF, Bose J, Shen CK (2004) Structural diversity
and functional implications of the eukaryotic TDP gene family.
Genomics 83(1):130–139. doi:S0888754303002143
39. Wang IF, Wu LS, Chang HY, Shen CK (2008) TDP-43, the
signature protein of FTLD-U, is a neuronal activity-responsive
factor. J Neurochem 105(3):797–806. doi:JNC519010.1111/j.
1471-4159.2007.05190.x
40. Wegorzewska I, Bell S, Cairns NJ, Miller TM, Baloh RH (2009)
TDP-43 mutant transgenic mice develop features of ALS and
frontotemporal lobar degeneration. Proc Natl Acad Sci USA
106(44):18809–18814. doi:090876710610.1073/pnas.0908767106
41. Wils H, Kleinberger G, Janssens J, Pereson S, Joris G, Cuijt I,
Smits V, Ceuterick-de Groote C, Van Broeckhoven C, Kumar-
Singh S (2010) TDP-43 transgenic mice develop spastic paralysis
and neuronal inclusions characteristic of ALS and frontotemporal
lobar degeneration. Proc Natl Acad Sci USA 107(8):3858–3863.
doi:091241710710.1073/pnas.0912417107
42. Wu LS, Cheng WC, Hou SC, Yan YT, Jiang ST, Shen CK (2010)
TDP-43, a neuro-pathosignature factor, is essential for early mouse
embryogenesis. Genesis 48(1):56–62. doi:10.1002/dvg.20584
43. Xu YF, Gendron TF, Zhang YJ, Lin WL, D’Alton S, Sheng H,
Casey MC, Tong J, Knight J, Yu X, Rademakers R, Boylan K,
Hutton M, McGowan E, Dickson DW, Lewis J, Petrucelli L (2010)
Wild-type human TDP-43 expression causes TDP-43 phosphory-
lation, mitochondrial aggregation, motor deficits, and early
mortality in transgenic mice. J Neurosci 30(32):10851–10859. doi:
30/32/1085110.1523/JNEUROSCI.1630-10.2010
44. Zhang YJ, Xu YF, Dickey CA, Buratti E, Baralle F, Bailey R,
Pickering-Brown S, Dickson D, Petrucelli L (2007) Progranulin
mediates caspase-dependent cleavage of TAR DNA binding
protein-43. J Neurosci 27(39):10530–10534. doi:27/39/1053010.
1523/JNEUROSCI.3421-07.2007
Acta Neuropathol (2012) 123:807–823 823
123
Page 17
  • Source
    • "Additionally, we failed to detect downregulation in the cortex and hippocampus of 2 month old iTDP-438A animals (figure 4F). Seeking to validate our methodology, we analyzed hippocampal RNA from a line of transgenic mice overexpressing human wild type TDP-43, iTDP-4317D, that have previously been reported to express reduced Tardbp mRNA [24]. We observed a statistically significant reduction in Tardbp using all three primer pairs (figure 4F). "
    [Show abstract] [Hide abstract] ABSTRACT: The majority of cases of frontotemporal lobar degeneration and amyotrophic lateral sclerosis are pathologically defined by the cleavage, cytoplasmic redistribution and aggregation of TAR DNA binding protein of 43 kDa (TDP-43). To examine the contribution of these potentially toxic mechanisms in vivo, we generated transgenic mice expressing human TDP-43 containing the familial amyotrophic lateral sclerosis-linked M337V mutation and identified two lines that developed neurological phenotypes of differing severity and progression. The first developed a rapid cortical neurodegenerative phenotype in the early postnatal period, characterized by fragmentation of TDP-43 and loss of endogenous murine Tdp-43, but entirely lacking aggregates of ubiquitin or TDP-43. A second, low expressing line was aged to 25 months without a severe neurodegenerative phenotype, despite a 30% loss of mouse Tdp-43 and accumulation of lower molecular weight TDP-43 species. Furthermore, TDP-43 fragments generated during neurodegeneration were not C-terminal, but rather were derived from a central portion of human TDP-43. Thus we find that aggregation is not required for cell loss, loss of murine Tdp-43 is not necessarily sufficient in order to develop a severe neurodegenerative phenotype and lower molecular weight TDP-43 positive species in mouse models should not be inherently assumed to be representative of human disease. Our findings are significant for the interpretation of other transgenic studies of TDP-43 proteinopathy.
    Full-text · Article · Jan 2014 · PLoS ONE
  • Source
    • "Several other studies demonstrated the potential contribution of TDP-43 deficiency to disease pathogenesis [10], [12], while our group and others have demonstrated that overexpression of the human TDP-43 (hTDP-43) protein, either wild-type (hTDP-43WT) or mutant hTDP-43, leads to pathological phenotypes consistent with certain TDP-43 proteinopathies. These phenotypes may include some of the following: increased ubiquitination, truncation, aggregation and phosphorylation of TDP-43, cytoplasmic TDP-43 inclusions, neuronal degeneration, motor dysfunction, learning and memory deficits, and mitochondrial abnormalities [13], [14], [15], [16], [17], [18], [19]. Moreover, we [14], [15] and others [12] have observed that expression of hTDP-43 protein in transgenic mice decreases the mRNA levels of endogenous mouse Tardbp. "
    [Show abstract] [Hide abstract] ABSTRACT: Tar DNA binding protein 43 (TDP-43) is the major component of pathological deposits in frontotemporal lobar degeneration with TDP-43 inclusions (FTLD-TDP) and in amyotrophic lateral sclerosis (ALS). It has been reported that TDP-43 transgenic mouse models expressing human TDP-43 wild-type or ALS-associated mutations recapitulate certain ALS and FTLD pathological phenotypes. Of note, expression of human TDP-43 (hTDP-43) reduces the levels of mouse Tdp-43 (mTdp-43). However, it remained unclear whether the mechanisms through which TDP-43 induces ALS or FTLD-like pathologies resulted from a reduction in mTdp-43, an increase in hTDP-43, or a combination of both. In elucidating the role of mTdp-43 and hTDP-43 in hTDP-43 transgenic mice, we observed that reduction of mTdp-43 in non-transgenic mice by intraventricular brain injection of AAV1-shTardbp leads to a dramatic increase in the levels of splicing variants of mouse sortilin 1 and translin. However, the levels of these two abnormal splicing variants are not increased in hTDP-43 transgenic mice despite significant downregulation of mTdp-43 in these mice. Moreover, further downregulation of mTdp-43 in hTDP-43 hemizygous mice, which are asymptomatic, to the levels equivalent to that of mTdp-43 in hTDP-43 homozygous mice does not induce the pathological phenotypes observed in the homozygous mice. Lastly, the number of dendritic spines and the RNA levels of TDP-43 RNA targets critical for synapse formation and function are significantly decreased in symptomatic homozygous mice. Together, our findings indicate that mTdp-43 downregulation does not lead to a loss of function mechanism or account for the pathological phenotypes observed in hTDP-43 homozygous mice because hTDP-43 compensates for the reduction, and associated functions of mTdp-43. Rather, expression of hTDP-43 beyond a certain threshold leads to abnormal metabolism of TDP-43 RNA targets critical for neuronal structure and function, which might be responsible for the ALS or FTLD-like pathologies observed in homozygous hTDP-43 transgenic mice.
    Full-text · Article · Jul 2013 · PLoS ONE
  • Source
    • "Functional studies which exploit the capabilities of the in vivo model systems utilized in this report could compliment these human studies. For example, the rTg4510 model of tauopathy can now be crossbred with conditional TDP-43 models created by our group and others [7, 24] to determine if the two pathologies act in concert to accelerate the FTLD-like neurodegeneration of these models. Furthermore, we can now suppress tau expression in the rTg4510 mice and determine if the TDP-43 pathology is reversible and if any reversion of TDP-43 pathology tracks with the cognitive recovery observed in tau suppressed rTg4510 mice [46]. "
    [Show abstract] [Hide abstract] ABSTRACT: Frontotemporal lobar degeneration (FTLD) has been subdivided based on the main pathology found in the brains of affected individuals. When the primary pathology is aggregated, hyperphosphorylated tau, the pathological diagnosis is FTLD-tau. When the primary pathology is cytoplasmic and/or nuclear aggregates of phosphorylated TAR-DNA-binding protein (TDP-43), the pathological diagnosis is FTLD-TDP. Notably, TDP-43 pathology can also occur in conjunction with a number of neurodegenerative disorders; however, unknown environmental and genetic factors may regulate this TDP-43 pathology. Using transgenic mouse models of several diseases of the central nervous system, we explored whether a primary proteinopathy might secondarily drive TDP-43 proteinopathy. We found abnormal, cytoplasmic accumulation of phosphorylated TDP-43 specifically in two tau transgenic models, but TDP-43 pathology was absent in mouse models of Aβ deposition, α-synucleinopathy or Huntington’s disease. Though tau pathology showed considerable overlap with cytoplasmic, phosphorylated TDP-43, tau pathology generally preceded TDP-43 pathology. Biochemical analysis confirmed the presence of TDP-43 abnormalities in the tau mice, which showed increased levels of high molecular weight, soluble TDP-43 and insoluble full-length and ~35 kD TDP-43. These data demonstrate that the neurodegenerative cascade associated with a primary tauopathy in tau transgenic mice can also promote TDP-43 abnormalities. These findings provide the first in vivo models to understand how TDP-43 pathology may arise as a secondary consequence of a primary proteinopathy. Electronic supplementary material The online version of this article (doi:10.1007/s00401-013-1123-8) contains supplementary material, which is available to authorized users.
    Full-text · Article · May 2013 · Acta Neuropathologica
Show more