Antisense Oligonucleotide-Mediated Exon Skipping for Duchenne Muscular Dystrophy: Progress and Challenges

Abstract

Duchenne muscular dystrophy (DMD) is the most common childhood neuromuscular disorder. It is caused by mutations in the DMD gene that disrupt the open reading frame (ORF) preventing the production of functional dystrophin protein. The loss of dystrophin ultimately leads to the degeneration of muscle fibres, progressive weakness and premature death. Antisense oligonucleotides (AOs) targeted to splicing elements within DMD pre-mRNA can induce the skipping of targeted exons, restoring the ORF and the consequent production of a shorter but functional dystrophin protein. This approach may lead to an effective disease modifying treatment for DMD and progress towards clinical application has been rapid. Less than a decade has passed between the first studies published in 1998 describing the use of AOs to modify the DMD gene in mice and the results of the first intramuscular proof of concept clinical trials. Whilst phase II and III trials are now underway, the heterogeneity of DMD mutations, efficient systemic delivery and targeting of AOs to cardiac muscle remain significant challenges. Here we review the current status of AO-mediated therapy for DMD, discussing the preclinical, clinical and regulatory hurdles and their possible solutions to expedite the translation of AO-mediated exon skipping therapy to clinic.

Full text

Author’s Pre-print copy
Please cite as Arechavala-Gomeza et al, Curr Gene Ther. 2012 Jun 1;12(3):152-60.
1
Antisense Oligonucleotide-Mediated Exon Skipping for
Duchenne Muscular Dystrophy: Progress and Challenges
Virginia Arechavala-Gomeza, Karen Anthony, Jennifer Morgan, Francesco Muntoni
Dubowitz Neuromuscular Centre, UCL Institute of Child Health, 30 Guilford Street, London, WC1N 1EH, UK
Abstract:Duchenne muscular dystrophy (DMD) is the most common childhood neuromuscular
disorder. It is caused by mutations in the DMD gene that disrupt the open reading frame (ORF)
preventing the production of functional dystrophin protein. The loss of dystrophin ultimately leads
to the degeneration of muscle fibres, progressive weakness and premature death. Antisense
oligonucleotides (AOs) targeted to splicing elements within DMD pre-mRNA can induce the skipping
of targeted exons, restoring the ORF and the consequent production of a shorter but functional
dystrophin protein. This approach may lead to an effective disease modifying treatment for DMD
and progress towards clinical application has been rapid. Less than a decade has passed between the
first studies published in 1998 describing the use of AOs to modify the DMD gene in mice and the
results of the first intramuscular proof of concept clinical trials. Whilst phase II and III trials are now
underway, the heterogeneity of DMD mutations, efficient systemic delivery and targeting of AOs to
cardiac muscle remain significant challenges. Here we review the current status of AO-mediated
therapy for DMD, discussing the pre-clinical, clinical and regulatory hurdles and their possible
solutions to expedite the translation of AO-mediated exon skipping therapy to clinic.
Keywords: Antisense oligonucleotides, clinical trials, duchenne muscular dystrophy, becker
muscular dystrophy, dystrophin, exon skipping, RNA therapy
Introduction
Duchenne muscular dystrophy
Duchenne muscular dystrophy (DMD) is a
fatal, X-linked, neuromuscular disorder
that affects 1 in 3,500 newborn boys.
Patients are typically diagnosed as
toddlers; they develop progressive muscle
weakness and cardiomyopathy and lose
the ability to walk by their early teens.
Unless appropriate standards of care
(including non-invasive ventilation,
glucocorticoid and cardio-protective
treatment) are implemented, premature
death by cardiac or respiratory failure
occurs in the second decade of life (1-3).
DMD is caused by mutations in the DMD
gene that disrupt the open reading frame
(ORF) thus aborting the full translation of
its protein product, dystrophin (4, 5). The
DMD gene comprises 79 exons and the
majority (~65%) of mutations responsible
for DMD are out-of-frame deletions,
although duplications (~10%), small
mutations including non-sense and splice
site changes (~22%) and deep intronic
mutations (~3%) are also documented (6,
7). Some DMD deletions are more

Author’s Pre-print copy
Please cite as Arechavala-Gomeza et al, Curr Gene Ther. 2012 Jun 1;12(3):152-60.
2
frequent than others and the gene has
two deletion hotspots (6): the most
commonly mutated region is exons 45–55
followed by exons 2–19.
Dystrophin is located underneath the
sarcolemma and connects the sub-
sarcolemmal cytoskeleton to the
extracellular matrix by binding N-
terminally to cytoskeletal F-actin and to
β–dystroglycan via a cysteine rich domain
near the C-terminus (8) (Top panel, Figure
1). It contains four main functional units:
an N-terminus, a central rod domain, a
cysteine rich domain and a C-terminal
domain. The central rod domain consists
of 24 spectrin-like repeats and four hinge
domains (9). Dystrophin interacts with
actin at both its N-terminus and via
spectrin-like repeats 11-17; the C-
terminus has also recently been shown to
allosterically affect actin binding (10). The
cysteine rich domain binds to β-
dystroglycan (BDG) (11-15) and the C-
terminal domain is required for binding to
syntrophin (16) and dystrobrevin (17).
These and other sarcolemmal proteins
such as the sarcoglycans are components
of the dystrophin associated glycoprotein
complex (DGC). Dystrophin and the DGC
play an important role in stabilising the
muscle fibre against the mechanical forces
of muscle contraction by providing a
shock-absorbing connection between the
cytoskeleton and the extracellular matrix.
Loss of dystrophin leads to disruption of
the complex, which results in
inflammation, increased intracellular
calcium influx, muscle degeneration and
replacement of muscle with adipo-fibrous
tissue (4). In addition, dystrophin plays a
role in signalling and is associated with
members of the stretch-activated calcium
channels; their mislocalisation and
dysfunction in dystrophic muscle
contributes to disease progression (18).
Spectrin repeats 16 and 17 within the
central rod domain, encoded by exons 42–
45, are also required for binding to
neuronal nitric oxide synthase (nNOS) (11,
12, 19). nNOS regulates the blood flow in
skeletal muscle (20); disruption of this
pathway may contribute to DMD
pathogenesis by inducing paradoxical
vasoconstriction during exercise (21).
Naturally-occurring dystrophin positive
“revertant fibres” (isolated or less
commonly small clusters of fibres strongly
positive for dystrophin) and “traces”
(fibres expressing very low levels of
dystrophin at the sarcolemma) occur in
more than 50% of the muscle biopsies of
DMD patients (22). Revertant fibres
represent a very small percentage of the
total fibres, in which somatic mutations or
stochastic alternative splicing events of
the dystrophin pre-mRNA lead to exon
skipping, the restoration of the ORF and
consequent expression of dystrophin (23,
24). Revertant dystrophins are correctly
localised to the sarcolemma and associate
with other DGC proteins, suggesting a
retained function (25, 26). Revertant
fibres have been well characterised in the
mouse model of DMD, the mdx mouse
(24, 27, 28). Whilst traces have not been
described in the mdx mouse, they are
present in approximately a third of DMD
patients (22) and may represent up to

Author’s Pre-print copy
Please cite as Arechavala-Gomeza et al, Curr Gene Ther. 2012 Jun 1;12(3):152-60.
3
25% of the total muscle fibres (29). The
molecular mechanism of trace dystrophin
expression remains to be elucidated, but
it is thought to be at least in part different
from that of revertant fibres. For example,
traces can express different dystrophin
epitopes than the surrounding revertant
fibres (22).
Becker muscular dystrophy
Mutations in the DMD gene are also
responsible for a milder disorder, Becker
muscular dystrophy (BMD), a disease with
an extremely variable spectrum of
severity ranging from patients with
walking difficulties in their late teens or
early twenties, to the majority of
individuals in whom ambulation is
preserved into late adulthood and who
have an essentially normal lifespan (30).
DMD and BMD mutations differentially
affect the DMD gene: in DMD the
mutations disrupt the reading frame,
while mutations that cause BMD maintain
the ORF (31, 32) leading to the production
of an internally deleted dystrophin
protein. The size of the deletion does not
correlate with the severity of the disease,
as long as the reading frame rule is
maintained (33-40), and provided crucial
domains of dystrophin such as the β-
dystroglycan binding site are not removed
by the deletion. While the central and
distal rod domain is less vital for function
(35), (some patients missing these
domains only have very mild disease
manifestations such as myalgia and
muscle cramps, and mild weakness), in
frame deletions that affect the binding of
dystrophin to other proteins such as
cytoskeletal actin or β-dystroglycan result
in a severe phenotype (41, 42).
The existence of revertant fibres in DMD
and the occurrence of mildly affected
BMD individuals with in-frame deletions
suggest that it is feasible to modify
splicing by exon skipping (Figure 1) and
induce the production of functional
dystrophin in DMD patients, as long as
crucial domains of dystrophin are not
disrupted. Artificially restoring the ORF in
this way is thus an attractive therapeutic
strategy for DMD, as approximately 70%
of DMD patients have mutations
amenable to exon skipping (43).
Figure1 Exon skipping principle. (Next page) Upper panel:
Schematic representation of dystrophin mRNA (in-frame exons
are represented as square boxes, out-of-frame exons round or
arrow boxes). Normal splicing of these exons produces
dystrophin protein (pictured immediately below) retaining
functional protein-binding domains and correctly localised to
the sarcolemma (see section of control muscle stained with
anti-dystrophin antibody Dys2). Lower panel: representation of
dystrophin pre-mRNA highlighting the differences in splicing
between a Del48-50 DMD patient (left) and a Del48-51BMD
patient (right). The DMD deletion disrupts the open reading
frame (ORFs) which results in unstable mRNA and the absence
of functional dystrophin protein in muscle sections. In the BMD
patient the deletion maintains the ORF and generates the
production of an internally deleted dystrophin isoform that
retains the critical amino and carboxyl terminals and Cysteine -
rich domains. The ORF can be corrected by forced skipping of
exon 51 by directing antisense oligonucleotides to sequences
within exon 51 or to neighbouring intronic regions. Exon 51
skipping restores the ORF, generating a dystrophin equivalent
to that of the BMD patient. Insert table: Theoretical
applicability of single exon skipping in a series of DMD
deletions.

Author’s Pre-print copy
Please cite as Arechavala-Gomeza et al, Curr Gene Ther. 2012 Jun 1;12(3):152-60.
4

Author’s Pre-print copy
Please cite as Arechavala-Gomeza et al, Curr Gene Ther. 2012 Jun 1;12(3):152-60.
5
Table 1 Comparison between the two leading candidates for exon 51 skipping.SC = subcutaneous; IV = intravenous; IM =
intramuscular
PRO051/GSK2402968 AVI-4658/ETEPLIRSEN
Company Prosensa/GlaxoSmithKline AVI-BioPharma
Type
2’O-methyl phosphorothioate
(2'OMe)
Phosphorodiamidate
morpholino oligomer (PMO)
Backbone structure
Size and sequence
20 mer
(TCAAGGAAGATGGCATTTCT)
30 mer
(CTCCAACATCAAGGAAGATG
GCATTTCTAG)
Delivery SC IV
Plasma protein binding
Backbone binds to serum
proteins No
Serum half life <4 h to 28 days (44, 45) 1.62 to 3.60 hours (46)
Max non-toxic dose in patients:
Proteinuria seen in all patients
at 6mg/kg (44) Not reached (46)
Max tested non-toxic dose in
mice: ?960mg/kg (47)
Max tested non-toxic dose in
primates: ?320mg/kg (47)
Orphan drug Yes Yes
SYSTEMIC TRIAL REPORTED RESULTS*
Total number of patients 12 (44) 19 (46)
Pre-
treatment
Post-
treatment
Pre-
treatment Post-treatment
Maximum reported
dystrophin-positive fibres Not done 100% 5% 55%
Maximum dystrophin signal
intensity to control muscles by
immunofluorescence Not done 15.6% 11% 27%
Maximum dystrophin protein
level to control muscles by
western blotting Not done Not done 5% 18%

Author’s Pre-print copy
Please cite as Arechavala-Gomeza et al, Curr Gene Ther. 2012 Jun 1;12(3):152-60.
6
Antisense oligonucleotide-mediated exon
skipping
Antisense oligonucleotides (AOs) targeted
to splicing elements represent the most
clinically advanced therapeutic tools
developed to induce dystrophin exon
skipping (48, 49). AOs are typically 20–30
nucleotides in length, and complementary
in sequence to regions of the pre-mRNA
transcript (50). While several AO
chemistries exist, the two AOs in clinical
development for DMD are 2’O-methyl
phoshophorothioate oligoribonucleotide
(2’OMe) and phosphorodiamidate
morpholino oligomers (PMO), (Table 1)
and (51, 52) for a detailed review. 2’OMe
AOs bind to albumin, showing high plasma
concentrations and long half-lives (45);
this might be an advantage as PK studies
indicate a longer persistence in blood
compared to PMO (up to 28 days as
opposed to less than 4 hours); however
binding to protein has been shown to
trigger activation of the immune system,
anaphylaxis, hypotension, or
antiarrhythmic effects in preclinical and
clinical studies (53). PMOs are not
metabolised and are resistant to
endonucleases (54); they are rapidly
eliminated from the bloodstream as they
are uncharged and do not bind serum
proteins, which is likely why they have not
been associated with the side effects
mentioned for the 2OMe clinical studies.
Both AOs have proven successful in pre-
clinical mouse models (55-58) and as far
as the PMO is concerned, also the more
severe dog model (59), in which systemic
delivery has resulted in dystrophin protein
production (60, 61) and physiological
improvement (58) of skeletal muscle.
Clinical progress
Both PMO (AVI-4658/eteplirsen) and
2’OMe (GSK-2402968) AOs targeting exon
51 (which will restore the ORF in the
largest group of DMD patients (13%))
have proven successful at inducing local
dystrophin expression in pivotal proof-of-
concept intramuscular clinical trials (62,
63). Recently, systemic studies using the
two different AO chemistries have been
completed (Table 2) (44, 46),
demonstrating that AO therapy for DMD is
indeed safe and well tolerated with no
significant drug-related adverse events.
Both studies reported significant
dystrophin restoration in a dose-
dependent manner as determined by
western blotting and
immunohistochemistry, with levels of
dystrophin approaching 20% of normal
levels in the PMO study.
The outcome of randomised placebo-
controlled studies of both eteplirsen and
GSK-2402968 is expected in 2012 and
further studies are planned. Table 2
summarises the design of both completed
and ongoing ClinicalTrials.gov registered
studies correct at the time of publication.
In addition, AOs for exons 45, 52, 53 and
55 are undergoing pre-clinical
development by GSK whilst AVI
BioPharma is developing PMOs targeting
exons 45, 50 and 53. Plans to extend trials
of systemically-delivered AOs to non-
ambulant boys are also underway for
exon 51 skippable patients (both with
eteplirsen and GSK2402968).

Author’s Pre-print copy
Please cite as Arechavala-Gomeza et al, Curr Gene Ther. 2012 Jun 1;12(3):152-60.
7
Completed
Ongoing
Intra
-
muscular
Systemic
Systemic
Study drug
AVI
-
4658
(Eteplirsen)
PRO051 (GSK
-
2402968)
AVI
-
4658
(Eteplirsen)
PRO051 (GSK
-
2402968)
AVI
-
4658
(Eteplirsen)
PRO051 (GSK
-
2402968)
PRO051 (GSK
-
2402968)
PRO051 (GSK
-
2402968)
PRO051 (GSK
-
2402968)
PRO051 (GSK
-
2402968)
PRO044
ClinicalTrials.gov
identifier
NCT00159250
Netherlands
trial register:
NTR712
NCT00844597
EudraCT
number: 2007-
004819-54
NCT01396239
NCT01153932
NCT01462292
NCT01254019
NCT01128855
NCT01451281
(parent study:
NCT01462292)
NCT01037309
Phase
I/II
I/II
I/II
I/II
II
II
II
III
I
n/a
I/II
Study design
Single
-
blind,
placebo-
controlled, dose-
escalation
Single dose
open
-
label,
dose-escalation
open
-
label,
dose-escalation
Randomised,
double-blind,
placebo-
controlled,
multiple Dose
Randomised,
double blind,
placebo
controlled
Randomised,
double blind
Randomised,
double blind
Double
-
blind,
escalating dose,
randomized,
placebo-controlled
n/a
Non
-
randomised,
open label
Chemistry
PMO
2’OMe
PMO
2’OMe
PMO
2’OMe
2’OMe
2’OMe
2’OMe
2’OMe
2’OMe
Number of patients
7
4
19
12
12
54
54
180
32
85
18
Target exon
51
51
51
51
51
51
51
51
51
51
44
Ambulant/Non
Ambulant
Ambulant
Ambulant
Ambulant
Ambulant
Ambulant
Ambulant
Ambulant
Ambulant
Non
-
ambulant
Ambulant
Ambulant
Delivery
IM (EDB)
IM (TA)
IV
Subcutaneous
IV
Sub
-
cutaneous
Sub
-
cutaneous
Sub
-
cutaneous
Subcutaneous
Sub
-
cutaneous
Subcutaneous &
I.V (1.5, 5mg/kg)
Dose
0.09 and 0.9 mg
0.8 mg
0.5, 1, 2, 4, 10,
and 20 mg/kg
body weight
0.5, 2, 4 and 6
mg/kg body
weight
30, 50
mg/kg
body weight
6
mg/kg body
weight
3, 6
mg/kg body
weight
6 mg/kg body
weight
3, 6, 9 & 12 mg/kg
body weight
3, 6 mg/kg body
weight
0.5, 1.5, 5, 8, 10,
12 mg/kg body
weight
Frequency of
administration
Single
Single
Weekly
Weekly
Weekly
Weekly & twice
weekly
Weekly
Weekly
Single
Weekly
Weekly
Duration
3
-
4 weeks
4 weeks
12 weeks
12 weeks
24 weeks
24
-
48 weeks
2
4 weeks
1 year
5 weeks
24 weeks
5 weeks
Primary outcome
measure
Safety
Adverse events
Safety
Safety
Dystrophin
positive fibers
Efficacy
6 minute walk
distance test
Efficacy
Pharmacokinetics
MRI ch
anges in
skeletal muscle
Safety,
tolerability,
pharmacokinetics
& dystrophin
expression
Start Date
October 2007
2006
January 2009
2008
July 2011
September
2010
October 2011
December 2010
July 2010
September
2011
December 2009
Completion date
March 2009
2007
December 2010
2011
June 2012
(estimated)
September
2012
(estimated)
April 2013
(estimated)
December 2012
(estimated)
November 2011
2012
(estimated)
December 2012
(estimated)

Author’s Pre-print copy
Please cite as Arechavala-Gomeza et al, Curr Gene Ther. 2012 Jun 1;12(3):152-60.
8
(Previous page) Table 2 Summary of completed
and on-going exon skipping clinical trials for DMD
IV = intravenous; IM = intramuscular
Current challenges
In-vitro optimisation of novel AOs
Systematic screening for AO targets has
already identified targets for most of the
79 dystrophin exons (64-66), but there is
variability in the processes used to design
and evaluate target AOs. For example,
variations in the cell type for in vitro
studies, transfection reagents, time of
evaluation and quantification of skipped
product (64, 67-69) make inter-study
comparisons difficult. Despite the fact
that bioinformatic tools (70-73) can
provide optimal target areas for AO
binding, and help rank AO sequences
according to their predicted bioactivity
(43, 65), empirical analysis in-vitro is
always necessary to confirm the suitability
of the sequence (69). Importantly,
restoration of dystrophin expression can
only be shown in differentiated myotubes
derived from patients’ cells as dystrophin
is only expressed in myotubes and not in
myoblasts. Ideally, cells from several
patients holding different amenable
deletions should be used to test the
efficacy of an AO, as the intronic
breakpoints differ between patients and
might affect splicing efficiency (74).
Primary myoblasts derived from DMD
muscle biopsies can be difficult to expand
in culture (75, 76) and the extent of
myogenic differentiation of DMD
myoblasts is often low (77, 78). Similar
levels of differentiation would be required
for quantitative comparison of the
efficacy of the same AO on cells from
patients with different mutations. In
order to improve the proliferative capacity
of human myoblasts so that large
numbers of cells are available for replicate
experiments, techniques to immortalise
human myoblasts have been developed
(79).
A less invasive alternative to the use of
muscle biopsies to prepare satellite cell-
derived myoblasts, are fibroblasts
prepared from a skin biopsy. Fibroblasts
can be induced to differentiate into
myotubes by forced expression of the
myogenic regulatory factor MyoD (80).
However, the levels of DMD transcripts in
myotubes derived from fibroblasts can be
low and the variable extent of myogenic
differentiation should be controlled for in
comparative experiments.Transgenic
mice, harboring the entire human DMD
locus, may be used to test antisense
oligonucleotides (64, 67, 81-83).
However, these mice also carry the mouse
dystrophin gene and have no skeletal
muscle pathology.
Outcome measures
A validated set of clinical outcome
measures for ambulant DMD patients is in
use in the ongoing phase II and III clinical
trials. Future trials on non-ambulant
patients pose a further challenge where
robust measurements of upper limb
strength and function in late disease stage
are required. While clinical outcome
measures are needed to demonstrate

Author’s Pre-print copy
Please cite as Arechavala-Gomeza et al, Curr Gene Ther. 2012 Jun 1;12(3):152-60.
9
functional improvement, biochemical
outcome measures (BOMs) are required
to monitor AO efficacy. However, critical
differences in the methodology used
between the different research centres
are of concern. Standardised BOMs are
essential in order to reliably compare the
efficacy of the different chemistries and
dosing regimens. Specifically, the most
reliable methods for quantification of
both exon skipping and dystrophin
restoration must now be established
through initiatives such as the TREAT-
NMD registry of outcome measures for
neuromuscular disorders
(www.researchrom.com/) and from on-
going international collaborative studies
aiming to cross-validate standard
operating procedures. The outcomes of
these should be the standardisation of
methodology across centres that could be
presented to regulatory authorities as the
preferred BOMs in future clinical trials.
The efficacy of exon skipping is measured
at both the RNA and protein level. Nested
RT-PCR is traditionally used to assess and
quantify (semi-quantitatively) AO efficacy
at the RNA level (84, 85). To detect
transcripts using this method, it is
necessary to use up to 70 PCR cycles after
which linearity is lost and it is therefore
not possible to accurately quantify the
percentage of exon skipping. Thus several
quantitative methods are currently in
development such as qRT-PCR using highly
specific TaqMan assays for skipped and
total dystrophin targets. The advent of
digital PCR and micro fluidic technology
enables the high throughput analysis of
patient RNA. For example, exon skipping
could be assessed by measuring changes
in mRNA decay pre and post treatment
using TaqMan assays that cover all 79
dystrophin exons. Such a platform, the
FluiDMD, has recently been described
which simultaneously analyses 85 TaqMan
assays recognising 76 out of 78 DMD exon
junctions (86).
As the aim of AO-mediated exon skipping
is to restore dystrophin production,
reliable methods to quantify dystrophin
expression are vital. The presence of
dystrophin traces and revertant fibres in
DMD muscles (22) makes it essential to
compare treated muscles with a pre-
treatment biopsy of the same patient, in
order to accurately distinguish and
quantify AO-mediated dystrophin protein
production (87). The two most commonly
used methods are western blotting and
immunostaining (46, 87, 88).
Consideration should be given to the
antibodies to be used, which must be
sensitive, specific and have an epitope
appropriate for the dystrophin exons
retained following exon skipping.
As muscle biopsies are invasive and
sample a single muscle, there are
limitations in their use to monitor
response to therapy and efforts are being
made to identify non-invasive biomarkers
to monitor DMD disease progression.
Studies aimed at validating the role of
magnetic resonance imaging (89) and
spectroscopy as well as serum or urine
biomarkers such as small non coding RNAs
(such as miRNA) are currently underway
both in animal models and in clinical

Author’s Pre-print copy
Please cite as Arechavala-Gomeza et al, Curr Gene Ther. 2012 Jun 1;12(3):152-60.
10
studies; it is hoped that these will reduce
the need for muscle biopsies (90).
Functionality of the de novo dystrophin
protein
Whilst the primary outcome measure of
the completed systemic trials was clinical
safety, the GSK-2402968 study also
reported a modest improvement in the 6-
minute walk test which is encouraging
(44). From a biochemical perspective, data
from both the intramuscular and systemic
eteplirsen trials further indicate that the
internally deleted dystrophins generated
by exon skipping in different patients are
indeed functional, as they led to the
restoration of proteins of the DGC (46,
91). Additional evidence of functional
improvement is provided by a reduction in
cytotoxic T cells within treated muscle
biopsies (46); this is promising considering
that the pre-symptomatic induction of
inflammatory cascades and the invasion of
muscle by immune cells is one of the
earliest pathways induced in dystrophin
deficient muscle and is thought contribute
to DMD pathology (92, 93). However, the
possibility of an immunological reaction
both against revertant and novel
dystrophin epitopes remains a possibility
(94) and presents a new issue to address
in future clinical trials that will require the
assessment of any pre-existing
immunological response to dystrophin
epitopes in patients prior to their
inclusion in a clinical trial, as well as any
post-treatment response to the newly-
generated dystrophin protein (94).
Some mild or asymptomatic BMD patients
naturally express the dystrophin proteins
that we aim to produce by exon skipping
(32). A recent study correlated dystrophin
and dystrophin-associated protein
expression with disease severity in a
cohort of BMD patients (26). The amount
of dystrophin, nNOS and BDG correlated
to clinical severity and BMD patients with
deletions equivalent to those created by
exon 51 skipping have higher dystrophin
levels than either those with large multi-
exon deletions, or those harbouring exon
53 skippable deletions (26). These findings
demonstrate the therapeutic potential of
the protein that will be generated by exon
51 skipping trials whilst the functionality
of other dystrophins, especially those with
larger internal deletions, is less clear (43,
95-97).
Variability of response
The completed AO-mediated exon
skipping clinical trials have revealed a high
degree of variability in patient response,
even between patients harbouring the
same deletions (46). These findings
suggest that the variability is unlikely to
be due to inter-patient differences in
stability of the resultant protein,
immunological response, or the
pharmacodynamics of the PMO (46).
However, it has been suggested (46) that
differences in the genetic background,
such as intronic deletion breakpoints,
differences in the efficiencies of mRNA
splicing, or differences in the vascular
access of the AO to individual muscles
may contribute to the variable response.

Author’s Pre-print copy
Please cite as Arechavala-Gomeza et al, Curr Gene Ther. 2012 Jun 1;12(3):152-60.
11
An important future goal must be to
understand the mechanisms behind this
variability and why some patients respond
better to treatment than others.
Interestingly studies in the mdx mouse
with both PMO and 2’OMe and in the
GRMD dog using PMO have identified
similar variability in response, even in the
same animal, when different muscles
were studied (61, 98-100). This- indirectly-
points towards stochastic events involved
in delivering the AO to skeletal muscle
rather than a genetic difference, although
more studies are needed to elucidate the
mechanism responsible for the observed
variability and whether this variability may
be reduced after long-term treatment as
indicated by studies on the mdx mouse
(98).
Next generation AOs
Although extremely high-doses of PMO
without modification can induce
dystrophin rescue in mdx cardiac muscle
(101), unmodified AOs are largely
unsuccessful at inducing exon skipping in
the heart and they do not cross the blood
brain barrier (56, 58). This is important
given that cardiac complications are
observed in up to 90% of DMD patients
(102) and that 1/3 of DMD patients suffer
cognitive impairment related to the
deficiency of dystrophin in the brain (103,
104). One approach to improve AO
targeting to cardiac muscle is the direct
conjugation of cell penetrating peptides to
AOs which improves AO delivery to
skeletal (105-112) and cardiac mdx mouse
muscles (111, 113-115); however the
toxicology of these conjugates has yet to
be ascertained. The fact that the
dystrophin protein is thought to have a
long half-life should increase the
possibility of achieving and maintaining
therapeutically-relevant dystrophin
protein levels with weekly or longer
dosing intervals
Regulatory hurdles
The regulatory process for developing AOs
to skip other dystrophin exons is at
present cumbersome as each new AO is
considered a novel drug and requires the
full battery of genotoxicity, rodent and
non-human primate acute and chronic
toxicity studies (reviewed in (116)). This
stringent assessment of safety is of
paramount importance, considering that
there has been little experience in dosing
individuals with AOs at high doses and for
durations exceeding 1 year (and
theoretically for a lifelong therapy).
Nevertheless, the current studies have not
reported severe drug related adverse
events; in addition most of the toxicity
related to AOs derives not from the
individual sequences but from the chronic
chemical load which is therefore largely
backbone but not sequence specific. It is
hoped that the positive clinical experience
gained from the exon 51 skipping studies
and hopefully also from other exons will
allow us to gather additional information
so that in the future these compounds
could obtain class approval and follow a
more informed and streamlined
regulatory process.

Author’s Pre-print copy
Please cite as Arechavala-Gomeza et al, Curr Gene Ther. 2012 Jun 1;12(3):152-60.
12
Conclusions
Preclinical and clinical studies using two
different chemistries have demonstrated
the potential of antisense oligonucleotide-
mediated DMD exon skipping to modify
the progression of DMD. If progress in
this field continues at the pace of the last
decade, treatment for common DMD
mutations may soon be feasible. If no
sequence-specific toxic effect is found,
treatment of rare mutations could follow
as regulatory hurdles are overcome.
Furthermore this approach could treat
nonsense mutations or other frame-
shifting mutations located in in-frame
exons that could be removed by skipping
a single exon. The clinical development of
next generation AOs that effectively
target cardiac as well as skeletal muscle
will provide a significant quality of life
improvement for patients.
Acknowledgements
Virginia Arechavala-Gomeza is supported
by a Health Innovation Challenge Grant
from the UK Department of Health and
the Wellcome Trust, Karen Anthony is
supported by the Association Francaise
contre les Myopathies, Jennifer Morgan is
supported by a Wellcome Trust University
Award and Francesco Muntoni is
supported by the Great Ormond Street
Hospital Children’s Charity.
REFERENCES
1. Bushby K, Finkel R, Birnkrant DJ, Case LE,
Clemens PR, Cripe L, et al. Diagnosis and management of
Duchenne muscular dystrophy, part 1: diagnosis, and
pharmacological and psychosocial management. Lancet
Neurol. 2010;9(1):77-93. Epub 2009/12/01.
2. Simonds AK, Muntoni F, Heather S, Fielding S.
Impact of nasal ventilation on survival in hypercapnic
Duchenne muscular dystrophy. Thorax.
1998;53(11):949-52.
3. Eagle M, Baudouin SV, Chandler C, Giddings
DR, Bullock R, Bushby K. Survival in Duchenne muscular
dystrophy: improvements in life expectancy since 1967
and the impact of home nocturnal ventilation.
Neuromuscul Disord. 2002;12(10):926-9.
4. Hoffman EP, Brown RH, Jr., Kunkel LM.
Dystrophin: the protein product of the Duchenne
muscular dystrophy locus. Cell. 1987;51(6):919-28.
5. Morris GE, Sedgwick SG, Ellis JM, Pereboev A,
Chamberlain JS, Nguyen thi M. An epitope structure for
the C-terminal domain of dystrophin and utrophin.
Biochemistry. 1998;37(31):11117-27.
6. Muntoni F, Torelli S, Ferlini A. Dystrophin and
mutations: one gene, several proteins, multiple
phenotypes. Lancet Neurol. 2003;2(12):731-40.
7. Abbs S, Tuffery-Giraud S, Bakker E, Ferlini A,
Sejersen T, Mueller CR. Best practice guidelines on
molecular diagnostics in Duchenne/Becker muscular
dystrophies. Neuromuscul Disord. 2010;20(6):422-7.
Epub 2010/05/15.
8. Ervasti JM, Campbell KP. A role for the
dystrophin-glycoprotein complex as a transmembrane
linker between laminin and actin. J Cell Biol.
1993;122(4):809-23. Epub 1993/08/01.
9. Ibraghimov-Beskrovnaya O, Ervasti JM, Leveille
CJ, Slaughter CA, Sernett SW, Campbell KP. Primary
structure of dystrophin-associated glycoproteins linking
dystrophin to the extracellular matrix. Nature.
1992;355(6362):696-702. Epub 1992/02/20.
10. Henderson DM, Lin AY, Thomas DD, Ervasti JM.
The carboxy-terminal third of dystrophin enhances actin
binding activity. J Mol Biol. 2012;416(3):414-24. Epub
2012/01/10.
11. Ervasti JM. Dystrophin, its interactions with
other proteins, and implications for muscular dystrophy.
Biochim Biophys Acta. 2007;1772(2):108-17. Epub
2006/07/11.
12. Le Rumeur E, Winder SJ, Hubert JF.
Dystrophin: more than just the sum of its parts. Biochim
Biophys Acta. 2010;1804(9):1713-22. Epub 2010/05/18.
13. Ishikawa-Sakurai M, Yoshida M, Imamura M,
Davies KE, Ozawa E. ZZ domain is essentially required for
the physiological binding of dystrophin and utrophin to
beta-dystroglycan. Hum Mol Genet. 2004;13(7):693-702.
Epub 2004/02/14.
14. Hnia K, Zouiten D, Cantel S, Chazalette D,
Hugon G, Fehrentz JA, et al. ZZ domain of dystrophin
and utrophin: topology and mapping of a beta-

Author’s Pre-print copy
Please cite as Arechavala-Gomeza et al, Curr Gene Ther. 2012 Jun 1;12(3):152-60.
13
dystroglycan interaction site. The Biochemical journal.
2007;401(3):667-77. Epub 2006/10/03.
15. Crawford GE, Faulkner JA, Crosbie RH,
Campbell KP, Froehner SC, Chamberlain JS. Assembly of
the dystrophin-associated protein complex does not
require the dystrophin COOH-terminal domain. The
Journal of cell biology. 2000;150(6):1399-410. Epub
2000/09/20.
16. Peters MF, Adams ME, Froehner SC.
Differential association of syntrophin pairs with the
dystrophin complex. J Cell Biol. 1997;138(1):81-93. Epub
1997/07/14.
17. Sadoulet-Puccio HM, Rajala M, Kunkel LM.
Dystrobrevin and dystrophin: an interaction through
coiled-coil motifs. Proceedings of the National Academy
of Sciences of the United States of America.
1997;94(23):12413-8. Epub 1997/11/14.
18. Brinkmeier H. TRP channels in skeletal muscle:
gene expression, function and implications for disease.
Adv Exp Med Biol. 2011;704:749-58. Epub 2011/02/04.
19. Lai Y, Thomas GD, Yue Y, Yang HT, Li D, Long C,
et al. Dystrophins carrying spectrin-like repeats 16 and
17 anchor nNOS to the sarcolemma and enhance
exercise performance in a mouse model of muscular
dystrophy. J Clin Invest. 2009;119(3):624-35. Epub
2009/02/21.
20. Percival JM, Anderson KN, Huang P, Adams
ME, Froehner SC. Golgi and sarcolemmal neuronal NOS
differentially regulate contraction-induced fatigue and
vasoconstriction in exercising mouse skeletal muscle. J
Clin Invest. 2010;120(3):816-26.
21. Cacchiarelli D, Martone J, Girardi E, Cesana M,
Incitti T, Morlando M, et al. MicroRNAs Involved in
Molecular Circuitries Relevant for the Duchenne
Muscular Dystrophy Pathogenesis Are Controlled by the
Dystrophin/nNOS Pathway. Cell Metab. 2010. Epub
2010/08/24.
22. Arechavala-Gomeza V, Kinali M, Feng L,
Guglieri M, Edge G, Main M, et al. Revertant fibres and
dystrophin traces in Duchenne muscular dystrophy:
implication for clinical trials. Neuromuscul Disord.
2010;20(5):295-301. Epub 2010/04/17.
23. Klein CJ, Coovert DD, Bulman DE, Ray PN,
Mendell JR, Burghes AH. Somatic reversion/suppression
in Duchenne muscular dystrophy (DMD): evidence
supporting a frame-restoring mechanism in rare
dystrophin-positive fibers. Am J Hum Genet.
1992;50(5):950-9.
24. Lu QL, Morris GE, Wilton SD, Ly T, Artem'yeva
OV, Strong P, et al. Massive idiosyncratic exon skipping
corrects the nonsense mutation in dystrophic mouse
muscle and produces functional revertant fibers by
clonal expansion. J Cell Biol. 2000;148(5):985-96.
25. Matsumura K, Tome FM, Collin H, Leturcq F,
Jeanpierre M, Kaplan JC, et al. Expression of dystrophin-
associated proteins in dystrophin-positive muscle fibers
(revertants) in Duchenne muscular dystrophy.
Neuromuscul Disord. 1994;4(2):115-20.
26. Anthony K, Cirak S, Torelli S, Tasca G, Feng L,
Arechavala-Gomeza V, et al. Dystrophin quantification
and clinical correlations in Becker muscular dystrophy:
implications for clinical trials. Brain. 2011. Epub
2011/11/22.
27. Bulfield G, Siller WG, Wight PA, Moore KJ. X
chromosome-linked muscular dystrophy (mdx) in the
mouse. Proc Natl Acad Sci U S A. 1984;81(4):1189-92.
28. Hoffman EP, Morgan JE, Watkins SC, Partridge
TA. Somatic reversion/suppression of the mouse mdx
phenotype in vivo. J Neurol Sci. 1990;99(1):9-25.
29. Nicholson LV, Johnson MA, Bushby KM,
Gardner-Medwin D. Functional significance of
dystrophin positive fibres in Duchenne muscular
dystrophy. Arch Dis Child. 1993;68(5):632-6.
30. Bushby KM, Gardner-Medwin D, Nicholson LV,
Johnson MA, Haggerty ID, Cleghorn NJ, et al. The clinical,
genetic and dystrophin characteristics of Becker
muscular dystrophy. II. Correlation of phenotype with
genetic and protein abnormalities. J Neurol.
1993;240(2):105-12.
31. England SB, Nicholson LV, Johnson MA, Forrest
SM, Love DR, Zubrzycka-Gaarn EE, et al. Very mild
muscular dystrophy associated with the deletion of 46%
of dystrophin. Nature. 1990;343(6254):180-2.
32. Monaco AP, Bertelson CJ, Liechti-Gallati S,
Moser H, Kunkel LM. An explanation for the phenotypic
differences between patients bearing partial deletions
of the DMD locus. Genomics. 1988;2(1):90-5.
33. Ferreiro V, Giliberto F, Muniz GM, Francipane
L, Marzese DM, Mampel A, et al. Asymptomatic Becker
muscular dystrophy in a family with a multiexon
deletion. Muscle Nerve. 2009;39(2):239-43. Epub
2008/11/18.
34. Lesca G, Testard H, Streichenberger N,
Pelissier JF, Lestra C, Burel E, et al. [Family study allows
more optimistic prognosis and genetic counselling in a
child with a deletion of exons 50-51 of the dystrophin
gene]. Arch Pediatr. 2007;14(3):262-5. Epub
2007/01/30. Impact de l'etude familiale sur le pronostic
et le conseil genetique chez un enfant porteur d'une
deletion des exons 50-51 du gene de la dystrophine.
35. Melis MA, Cau M, Muntoni F, Mateddu A,
Galanello R, Boccone L, et al. Elevation of serum creatine
kinase as the only manifestation of an intragenic
deletion of the dystrophin gene in three unrelated
families. Eur J Paediatr Neurol. 1998;2(5):255-61.
36. Morrone A, Zammarchi E, Scacheri PC, Donati
MA, Hoop RC, Servidei S, et al. Asymptomatic
dystrophinopathy. Am J Med Genet. 1997;69(3):261-7.
37. Muntoni F, Di Lenarda A, Porcu M, Sinagra G,
Mateddu A, Marrosu G, et al. Dystrophin gene
abnormalities in two patients with idiopathic dilated
cardiomyopathy. Heart. 1997;78(6):608-12.
38. Saengpattrachai M, Ray PN, Hawkins CE,
Berzen A, Banwell BL. Grandpa and I have
dystrophinopathy?: approach to asymptomatic
hyperCKemia. Pediatr Neurol. 2006;35(2):145-9.
39. Sanchez-Arjona MB, Rodriguez-Uranga JJ,
Giles-Lima M, Fernandez-Garcia R, Chinchon-Lara I,
Antinolo G, et al. Spanish family with myalgia and

Author’s Pre-print copy
Please cite as Arechavala-Gomeza et al, Curr Gene Ther. 2012 Jun 1;12(3):152-60.
14
cramps syndrome. J Neurol Neurosurg Psychiatry.
2005;76(2):286-9. Epub 2005/01/18.
40. Torelli S, Brown SC, Jimenez-Mallebrera C,
Feng L, Muntoni F, Sewry CA. Absence of neuronal nitric
oxide synthase (nNOS) as a pathological marker for the
diagnosis of Becker muscular dystrophy with rod domain
deletions. Neuropathol Appl Neurobiol. 2004;30(5):540-
5.
41. Muntoni F, Gobbi P, Sewry C, Sherratt T, Taylor
J, Sandhu SK, et al. Deletions in the 5' region of
dystrophin and resulting phenotypes. J Med Genet.
1994;31(11):843-7. Epub 1994/11/01.
42. Arahata K, Beggs AH, Honda H, Ito S, Ishiura S,
Tsukahara T, et al. Preservation of the C-terminus of
dystrophin molecule in the skeletal muscle from Becker
muscular dystrophy. J Neurol Sci. 1991;101(2):148-56.
Epub 1991/02/01.
43. Aartsma-Rus A, Fokkema I, Verschuuren J,
Ginjaar I, van Deutekom J, van Ommen GJ, et al.
Theoretic applicability of antisense-mediated exon
skipping for Duchenne muscular dystrophy mutations.
Hum Mutat. 2009.
44. Goemans NM, Tulinius M, van den Akker JT,
Burm BE, Ekhart PF, Heuvelmans N, et al. Systemic
Administration of PRO051 in Duchenne's Muscular
Dystrophy. N Engl J Med. 2011. Epub 2011/03/25.
45. Heemskerk H, de Winter C, van Kuik P,
Heuvelmans N, Sabatelli P, Rimessi P, et al. Preclinical PK
and PD Studies on 2'-O-Methyl-phosphorothioate RNA
Antisense Oligonucleotides in the mdx Mouse Model.
Mol Ther. 2010. Epub 2010/04/22.
46. Cirak S, Arechavala-Gomeza V, Guglieri M,
Feng L, Torelli S, Anthony K, et al. Exon skipping and
dystrophin restoration in patients with Duchenne
muscular dystrophy after systemic phosphorodiamidate
morpholino oligomer treatment: an open-label, phase 2,
dose-escalation study. Lancet. 2011;378(9791):595-605.
Epub 2011/07/26.
47. Sazani P, Weller DL, Shrewsbury SB. Safety
pharmacology and genotoxicity evaluation of AVI-4658.
Int J Toxicol. 2010;29(2):143-56. Epub 2010/01/30.
48. Wood MJ, Gait MJ, Yin H. RNA-targeted splice-
correction therapy for neuromuscular disease. Brain.
2010;133(Pt 4):957-72. Epub 2010/02/13.
49. Wilton SD, Fletcher S. RNA Splicing
Manipulation: Strategies to Modify Gene Expression for
a Variety of Therapeutic Outcomes. Curr Gene Ther.
2011. Epub 2011/04/02.
50. Sazani P, Graziewicz, MA and Kole, R.
Antisense Drug Technology, Principles, Strategies and
Applications. CBC Press. 2008:88-115.
51. Summerton JE. Morpholino, siRNA, and S-DNA
Compared: Impact of Structure and Mechanism of
Action on Off-Target Effects and Sequence Specificity.
Curr Top Med Chem. 2007;7(7):651-60.
52. Sazani P, Kole R. Therapeutic potential of
antisense oligonucleotides as modulators of alternative
splicing. J Clin Invest. 2003;112(4):481-6.
53. Muntoni F, Bushby KD, van Ommen G. 149th
ENMC International Workshop and 1st TREAT-NMD
Workshop on: "planning phase i/ii clinical trials using
systemically delivered antisense oligonucleotides in
duchenne muscular dystrophy". Neuromuscul Disord.
2008;18(3):268-75.
54. Amantana A, Moulton HM, Cate ML, Reddy
MT, Whitehead T, Hassinger JN, et al. Pharmacokinetics,
biodistribution, stability and toxicity of a cell-penetrating
peptide-morpholino oligomer conjugate. Bioconjug
Chem. 2007;18(4):1325-31.
55. Lu QL, Mann CJ, Lou F, Bou-Gharios G, Morris
GE, Xue SA, et al. Functional amounts of dystrophin
produced by skipping the mutated exon in the mdx
dystrophic mouse. Nat Med. 2003;9(8):1009-14.
56. Lu QL, Rabinowitz A, Chen YC, Yokota T, Yin H,
Alter J, et al. Systemic delivery of antisense
oligoribonucleotide restores dystrophin expression in
body-wide skeletal muscles. Proc Natl Acad Sci U S A.
2005;102(1):198-203.
57. Gebski BL, Mann CJ, Fletcher S, Wilton SD.
Morpholino antisense oligonucleotide induced
dystrophin exon 23 skipping in mdx mouse muscle. Hum
Mol Genet. 2003;12(15):1801-11.
58. Alter J, Lou F, Rabinowitz A, Yin H, Rosenfeld J,
Wilton SD, et al. Systemic delivery of morpholino
oligonucleotide restores dystrophin expression
bodywide and improves dystrophic pathology. Nat Med.
2006;12(2):175-7.
59. McClorey G, Moulton HM, Iversen PL, Fletcher
S, Wilton SD. Antisense oligonucleotide-induced exon
skipping restores dystrophin expression in vitro in a
canine model of DMD. Gene Ther. 2006.
60. Saito T, Nakamura A, Aoki Y, Yokota T, Okada
T, Osawa M, et al. Antisense PMO Found in Dystrophic
Dog Model Was Effective in Cells from Exon 7-Deleted
DMD Patient. PLoS ONE. 2010;5(8). Epub 2010/09/02.
61. Yokota T, Lu QL, Partridge T, Kobayashi M,
Nakamura A, Takeda S, et al. Efficacy of systemic
morpholino exon-skipping in duchenne dystrophy dogs.
Ann Neurol. 2009.
62. van Deutekom JC, Janson AA, Ginjaar IB,
Frankhuizen WS, Aartsma-Rus A, Bremmer-Bout M, et
al. Local dystrophin restoration with antisense
oligonucleotide PRO051. N Engl J Med.
2007;357(26):2677-86.
63. Kinali M, Arechavala-Gomeza V, Feng L, Cirak
S, Hunt D, Adkin C, et al. Local restoration of dystrophin
expression with the morpholino oligomer AVI-4658 in
Duchenne muscular dystrophy: a single-blind, placebo-
controlled, dose-escalation, proof-of-concept study.
Lancet Neurol. 2009;8(10):918-28. Epub 2009/08/29.
64. Popplewell LJ, Adkin C, Arechavala-Gomeza V,
Aartsma-Rus A, de Winter CL, Wilton SD, et al.
Comparative analysis of antisense oligonucleotide
sequences targeting exon 53 of the human DMD gene:
Implications for future clinical trials. Neuromuscul
Disord. 2010;20(2):102-10. Epub 2010/01/19.
65. Aartsma-Rus A, De Winter CL, Janson AA,
Kaman WE, Van Ommen GJ, Den Dunnen JT, et al.
Functional Analysis of 114 Exon-Internal AONs for
Targeted DMD Exon Skipping: Indication for Steric

Author’s Pre-print copy
Please cite as Arechavala-Gomeza et al, Curr Gene Ther. 2012 Jun 1;12(3):152-60.
15
Hindrance of SR Protein Binding Sites. Oligonucleotides.
2005;15(4):284-197.
66. Wilton SD, Fall AM, Harding PL, McClorey G,
Coleman C, Fletcher S. Antisense Oligonucleotide-
induced Exon Skipping Across the Human Dystrophin
Gene Transcript. Mol Ther. 2007.
67. Arechavala-Gomeza V, Graham IR, Popplewell
LJ, Adams AM, Aartsma-Rus A, Kinali M, et al.
Comparative analysis of antisense oligonucleotide
sequences for targeted skipping of exon 51 during
dystrophin pre-mRNA splicing in human muscle. Hum
Gene Ther. 2007;18(9):798-810. Epub 2007/09/05.
68. Mitrpant C, Adams AM, Meloni PL, Muntoni F,
Fletcher S, Wilton SD. Rational design of antisense
oligomers to induce dystrophin exon skipping. Molecular
therapy : the journal of the American Society of Gene
Therapy. 2009;17(8):1418-26. Epub 2009/03/19.
69. Popplewell LJ, Graham IR, Malerba A, Dickson
G. Bioinformatic and Functional Optimization of
Antisense Phosphorodiamidate Morpholino Oligomers
(PMOs) for Therapeutic Modulation of RNA Splicing in
Muscle. Methods Mol Biol. 2011;709:153-78. Epub
2011/01/05.
70. Cartegni L, Wang J, Zhu Z, Zhang MQ, Krainer
AR. ESEfinder: A web resource to identify exonic splicing
enhancers. Nucleic Acids Res. 2003;31(13):3568-71.
71. Fairbrother WG, Yeh RF, Sharp PA, Burge CB.
Predictive identification of exonic splicing enhancers in
human genes. Science. 2002;297(5583):1007-13. Epub
2002/07/13.
72. Zuker M. Mfold web server for nucleic acid
folding and hybridization prediction. Nucleic Acids Res.
2003;31(13):3406-15. Epub 2003/06/26.
73. Reuter JS, Mathews DH. RNAstructure:
software for RNA secondary structure prediction and
analysis. BMC Bioinformatics. 2010;11:129. Epub
2010/03/17.
74. Gualandi F, Rimessi P, Trabanelli C, Spitali P,
Neri M, Patarnello T, et al. Intronic breakpoint definition
and transcription analysis in DMD/BMD patients with
deletion/duplication at the 5' mutation hot spot of the
dystrophin gene. Gene. 2006;370:26-33.
75. Blau HM, Webster C, Pavlath GK. Defective
myoblasts identified in Duchenne muscular dystrophy.
Proc Natl Acad Sci U S A. 1983;80(15):4856-60. Epub
1983/08/01.
76. Webster C, Blau HM. Accelerated age-related
decline in replicative life-span of Duchenne muscular
dystrophy myoblasts: implications for cell and gene
therapy. Somat Cell Mol Genet. 1990;16(6):557-65. Epub
1990/11/01.
77. Melone MA, Peluso G, Petillo O, Galderisi U,
Cotrufo R. Defective growth in vitro of Duchenne
Muscular Dystrophy myoblasts: the molecular and
biochemical basis. J Cell Biochem. 1999;76(1):118-32.
Epub 1999/12/02.
78. Oexle K, Kohlschutter A. Cause of progression
in Duchenne muscular dystrophy: impaired
differentiation more probable than replicative aging.
Neuropediatrics. 2001;32(3):123-9. Epub 2001/08/25.
79. Mamchaoui K, Trollet C, Bigot A, Negroni E,
Chaouch S, Wolff A, et al. Immortalized pathological
human myoblasts: towards a universal tool for the study
of neuromuscular disorders. Skelet Muscle.
2011;1(1):34. Epub 2011/11/02.
80. Roest PA, van der Tuijn AC, Ginjaar HB,
Hoeben RC, Hoger-Vorst FB, Bakker E, et al. Application
of in vitro Myo-differentiation of non-muscle cells to
enhance gene expression and facilitate analysis of
muscle proteins. Neuromuscul Disord. 1996;6(3):195-
202.
81. Goyenvalle A. Engineering U7snRNA Gene to
Reframe Transcripts. Methods Mol Biol. 2012;867:259-
71. Epub 2012/03/29.
82. t Hoen PA, de Meijer EJ, Boer JM, Vossen RH,
Turk R, Maatman RG, et al. Generation and
characterization of transgenic mice with the full-length
human DMD gene. J Biol Chem. 2008;283(9):5899-907.
83. Bremmer-Bout M, Aartsma-Rus A, de Meijer
EJ, Kaman WE, Janson AA, Vossen RH, et al. Targeted
exon skipping in transgenic hDMD mice: A model for
direct preclinical screening of human-specific antisense
oligonucleotides. Mol Ther. 2004;10(2):232-40.
84. Spitali P, Heemskerk H, Vossen RH, Ferlini A,
den Dunnen JT, t Hoen PA, et al. Accurate quantification
of dystrophin mRNA and exon skipping levels in
duchenne muscular dystrophy. Lab Invest.
2010;90(9):1396-402. Epub 2010/05/12.
85. Aartsma-Rus A, Janson AA, Kaman WE,
Bremmer-Bout M, den Dunnen JT, Baas F, et al.
Therapeutic antisense-induced exon skipping in cultured
muscle cells from six different DMD patients. Hum Mol
Genet. 2003;12(8):907-14.
86. Bovolenta M, Scotton C, Falzarano MS,
Gualandi F, Ferlini A. Rapid, comprehensive analysis of
the dystrophin transcript by a custom micro-fluidic
exome array. Hum Mutat. 2011. Epub 2012/01/10.
87. Arechavala-Gomeza V, Kinali M, Feng L, Brown
SC, Sewry C, Morgan JE, et al. Immunohistological
intensity measurements as a tool to assess sarcolemma-
associated protein expression. Neuropathol Appl
Neurobiol. 2010;36(4):265–74. Epub 2009/12/17.
88. Arechavala-Gomeza V, Cirak S, Anthony K,
Morgan J, Muntoni F. Exon-skipping therapy for
Duchenne muscular dystrophy - Authors' reply. Lancet.
2012;379(9811):e10-1. Epub 2012/01/17.
89. Kinali M, Arechavala-Gomeza V, Cirak S, Glover
A, Guglieri M, Feng L, et al. Muscle histology vs MRI in
Duchenne muscular dystrophy. Neurology.
2011;76(4):346-53. Epub 2011/01/26.
90. Cacchiarelli D, Legnini I, Martone J, Cazzella V,
D'Amico A, Bertini E, et al. miRNAs as serum biomarkers
for Duchenne muscular dystrophy. EMBO Mol Med.
2011. Epub 2011/03/23.
91. Cirak S, Feng L, Anthony K, Arechavala-Gomeza
V, Torelli S, Sewry C, et al. Restoration of the Dystrophin-
associated Glycoprotein Complex After Exon Skipping
Therapy in Duchenne Muscular Dystrophy. Mol Ther.
2011. Epub 2011/11/17.

Author’s Pre-print copy
Please cite as Arechavala-Gomeza et al, Curr Gene Ther. 2012 Jun 1;12(3):152-60.
16
92. Chen YW, Nagaraju K, Bakay M, McIntyre O,
Rawat R, Shi R, et al. Early onset of inflammation and
later involvement of TGFbeta in Duchenne muscular
dystrophy. Neurology. 2005;65(6):826-34. Epub
2005/08/12.
93. Spencer MJ, Tidball JG. Do immune cells
promote the pathology of dystrophin-deficient
myopathies? Neuromuscul Disord. 2001;11(6-7):556-64.
Epub 2001/08/30.
94. Mendell JR, Campbell K, Rodino-Klapac L,
Sahenk Z, Shilling C, Lewis S, et al. Dystrophin immunity
in Duchenne's muscular dystrophy. N Engl J Med.
2010;363(15):1429-37. Epub 2010/10/12.
95. Yokota T, Pistilli E, Duddy W, Nagaraju K.
Potential of oligonucleotide-mediated exon-skipping
therapy for Duchenne muscular dystrophy. Expert Opin
Biol Ther. 2007;7(6):831-42. Epub 2007/06/09.
96. Yokota T, Takeda S, Lu QL, Partridge TA,
Nakamura A, Hoffman EP. A renaissance for antisense
oligonucleotide drugs in neurology: exon skipping breaks
new ground. Arch Neurol. 2009;66(1):32-8.
97. Beroud C, Tuffery-Giraud S, Matsuo M,
Hamroun D, Humbertclaude V, Monnier N, et al.
Multiexon skipping leading to an artificial DMD protein
lacking amino acids from exons 45 through 55 could
rescue up to 63% of patients with Duchenne muscular
dystrophy. Hum Mutat. 2007;28(2):196-202.
98. Malerba A, Sharp PS, Graham IR, Arechavala-
Gomeza V, Foster K, Muntoni F, et al. Chronic systemic
therapy with low-dose morpholino oligomers
ameliorates the pathology and normalizes locomotor
behavior in mdx mice. Mol Ther. 2011;19(2):345-54.
Epub 2010/11/26.
99. Aartsma-Rus A. Antisense-mediated
modulation of splicing: Therapeutic implications for
duchenne muscular dystrophy. RNA Biol. 2010;7(4).
Epub 2010/06/05.
100. Heemskerk HA, de Winter CL, de Kimpe SJ, van
Kuik-Romeijn P, Heuvelmans N, Platenburg GJ, et al. In
vivo comparison of 2'-O-methyl phosphorothioate and
morpholino antisense oligonucleotides for Duchenne
muscular dystrophy exon skipping. J Gene Med. 2009.
101. Wu B, Lu P, Benrashid E, Malik S, Ashar J,
Doran TJ, et al. Dose-dependent restoration of
dystrophin expression in cardiac muscle of dystrophic
mice by systemically delivered morpholino. Gene Ther.
2009.
102. Bushby K, Muntoni F, Bourke JP. 107th ENMC
international workshop: the management of cardiac
involvement in muscular dystrophy and myotonic
dystrophy. 7th-9th June 2002, Naarden, the
Netherlands. Neuromuscul Disord. 2003;13(2):166-72.
103. Sekiguchi M, Zushida K, Yoshida M, Maekawa
M, Kamichi S, Yoshida M, et al. A deficit of brain
dystrophin impairs specific amygdala GABAergic
transmission and enhances defensive behaviour in mice.
Brain. 2008.
104. Ricotti V, Roberts RG, Muntoni F. Dystrophin
and the brain. Dev Med Child Neurol. 2011;53(1):12.
Epub 2010/12/21.
105. Fletcher S, Honeyman K, Fall AM, Harding PL,
Johnsen RD, Steinhaus JP, et al. Morpholino oligomer-
mediated exon skipping averts the onset of dystrophic
pathology in the mdx mouse. Mol Ther.
2007;15(9):1587-92.
106. Moulton HM, Fletcher S, Neuman BW,
McClorey G, Stein DA, Abes S, et al. Cell-penetrating
peptide-morpholino conjugates alter pre-mRNA splicing
of DMD (Duchenne muscular dystrophy) and inhibit
murine coronavirus replication in vivo. Biochem Soc
Trans. 2007;35(Pt 4):826-8.
107. Jearawiriyapaisarn N, Moulton HM, Buckley B,
Roberts J, Sazani P, Fucharoen S, et al. Sustained
dystrophin expression induced by peptide-conjugated
morpholino oligomers in the muscles of mdx mice. Mol
Ther. 2008;16(9):1624-9.
108. Morcos PA, Li Y, Jiang S. Vivo-Morpholinos: a
non-peptide transporter delivers Morpholinos into a
wide array of mouse tissues. Biotechniques.
2008;45(6):613-4, 6, 8 passim.
109. Yin H, Moulton HM, Seow Y, Boyd C, Boutilier
J, Iverson P, et al. Cell-penetrating peptide-conjugated
antisense oligonucleotides restore systemic muscle and
cardiac dystrophin expression and function. Hum Mol
Genet. 2008;17(24):3909-18.
110. Moulton HM, Wu B, Jearawiriyapaisarn N,
Sazani P, Lu QL, Kole R. Peptide-morpholino conjugate: a
promising therapeutic for Duchenne muscular
dystrophy. Ann N Y Acad Sci. 2009;1175:55-60.
111. Wu B, Li Y, Morcos PA, Doran TJ, Lu P, Lu QL.
Octa-guanidine morpholino restores dystrophin
expression in cardiac and skeletal muscles and
ameliorates pathology in dystrophic mdx mice. Mol
Ther. 2009;17(5):864-71.
112. Yin H, Moulton HM, Betts C, Seow Y, Boutilier
J, Iverson PL, et al. A fusion peptide directs enhanced
systemic dystrophin exon skipping and functional
restoration in dystrophin-deficient mdx mice. Hum Mol
Genet. 2009;18(22):4405-14.
113. Wu B, Moulton HM, Iversen PL, Jiang J, Li J, Li
J, et al. Effective rescue of dystrophin improves cardiac
function in dystrophin-deficient mice by a modified
morpholino oligomer. Proc Natl Acad Sci U S A.
2008;105(39):14814-9.
114. Jearawiriyapaisarn N, Moulton HM, Sazani P,
Kole R, Willis MS. Long-Term Improvement in mdx
Cardiomyopathy after Therapy with Peptide-conjugated
Morpholino Oligomers. Cardiovasc Res. 2009.
115. Fletcher S, Honeyman K, Fall AM, Harding PL,
Johnsen RD, Wilton SD. Dystrophin expression in the
mdx mouse after localised and systemic administration
of a morpholino antisense oligonucleotide. J Gene Med.
2006;8(2):207-16.
116. Goyenvalle A, Seto JT, Davies KE, Chamberlain
J. Therapeutic approaches to muscular dystrophy. Hum
Mol Genet. 2011. Epub 2011/03/26.

Author’s Pre-print copy
Please cite as Arechavala-Gomeza et al, Curr Gene Ther. 2012 Jun 1;12(3):152-60.
17