ArticlePDF Available

Genetic variation across the current range of the Asian Houbara Bustard (Chlamydotis undulata macqueenii)

Authors:

Abstract and Figures

The houbara bustard (Chlamydotisundulata), the main quarry for Arab falconry,is currently threatened by excessive huntingand poaching as well as by habitat loss andfragmentation. We have investigated the geneticdiversity, population structure and demographichistory of houbara bustards across theirgeographical range by analyzing mitochondrial(mt)DNA sequences (a 370 bp fragment of controlregion I and a 264 bp fragment of thecytochrome b gene) and 4 microsatelliteloci in 74 individuals sampled from the CanaryIslands to China. Both markers revealed low tomoderate diversity that could be partitionedinto two monophyletic groups or evolutionarysignificant units belonging to the NorthAfrican (C. u. undulata) and Asian (C. u. macqueenii) subspecies. A history ofrelatively recent population growth (∼35,000years ago) accompanied by range expansion isthe most likely demographic scenario for theAsian subspecies. In addition, Macqueen'sbustards are able to disperse efficiently overbroad areas, which is consistent with ourinference of weak phylogeographic structure(global FST = 0.20 and 0.04 formtDNA and microsatellites, respectively) andhigh levels of homogenizing gene flow on widegeographical scales. We therefore suggest thatmanagement actions should focus on maintainingmigratory connectivity between breeding andnon-breeding areas.
Content may be subject to copyright.
Conservation Genetics 5: 205–215, 2004.
© 2004 Kluwer Academic Publishers. Printed in the Netherlands. 205
Genetic variation across the current range of the Asian houbara bustard
(Chlamydotis undulata macqueenii)
Christian Pitra1, Marie-Ann D’Aloia2, Dietmar Lieckfeldt1& Olivier Combreau2
1Department of Evolutionary Genetics, Institute for Zoo- and Wildlife Research, PF 1103, D-10252 Berlin,
Germany; 2National Avian Research Center, Environmental Research and Wildlife Development Agency, P.O. Box
45553 Abu Dhabi, United Arab Emirates (Corresponding author: E-mail: Pitra@IZW-Berlin.de)
Received 31 March 2003; accepted 16 July 2003
Key words: Chlamydotis, microsatellites, mitochondrial DNA, phylogeography, population expansion
Abstract
The houbara bustard (Chlamydotis undulata), the main quarry for Arab falconry, is currently threatened by
excessive hunting and poaching as well as by habitat loss and fragmentation. We have investigated the genetic
diversity, population structure and demographic history of houbara bustards across their geographical range by
analyzing mitochondrial (mt)DNA sequences (a 370 bp fragment of control region I and a 264 bp fragment of the
cytochrome bgene) and 4 microsatellite loci in 74 individuals sampled from the Canary Islands to China. Both
markers revealed low to moderate diversity that could be partitioned into two monophyletic groups or evolutionary
significant units belongingto the North African (C. u. undulata)andAsian(C. u. macqueenii) subspecies. A history
of relatively recent population growth (35,000 years ago) accompanied by range expansion is the most likely
demographic scenario for the Asian subspecies. In addition, Macqueen’s bustards are able to disperse efficiently
over broad areas, which is consistent with our inference of weak phylogeographicstructure (global FST =0.20and
0.04 for mtDNA and microsatellites, respectively) and high levels of homogenizing gene flow on wide geographical
scales. We therefore suggest that management actions should focus on maintaining migratory connectivity between
breeding and non-breeding areas.
Introduction
The houbara bustard (Chlamydotis undulata)is
a desert-adapted avian species patchily distributed
across the arid zones of the Northern Hemisphere.
Traditionally, the houbara bustard has been classified
into three subspecies groups based on size, colour,
distribution (Cramp and Simmons 1980), courtship
display (Launay and Paillat 1990; Gaucher et al.
1996), and genetic divergence (Granjon et al. 1994;
Gaucher et al. 1996; D’Aloia 2001; Pitra et al. 2002,
Broders et al. 2003). These subspecies were desig-
nated C. u. fuertaventurae occurring in the eastern
Canary Islands, C. u. undulata occurring from North
Africa and Mauritania to the western part of the
Nile river valley in Egypt, and C. u. macqueenii,
the Asian houbara bustard or Macqueen’s bustard,
extending from the Sinai, across Arabia and the
Caspian Sea, further east to Middle Asia, Mongolia
and China (Figure 1). The North African subspecies
is considered sedentary or locally nomadic, whereas
the northern breeding populations of the Asian subspe-
cies are strongly migratory, wintering mainly in
India, Pakistan, Iran and the Arabian Peninsula.
Given the broad range and the tremendous mobility
of C. u. macqueenii (distances covered range from
1,000 to 14,000 km per year), it remains difficult
to design recovery strategies until demographic inter-
connections between breeding and wintering sites
or along migration routes can be characterised, and
to elucidate factors/processes with the most impact
both on historical and recent population structuring.
Recent tracking studies via satellite have provided
much data on individual movements and migration
routes (Osborne et al. 1997; Launay et al. 1999;
Combreau et al. 1999). However, it is unknown
206
Figure 1. Macqueen’s bustard sample locations and generalized distribution. Larger circles refer to breeding areas of migratory birds. Smaller
circles indicate localities which harbour residents and/or wintering migrants. Frequency of the numerically prominent haplotype M1 (black) in
each population is indicated in pie charts.
whether these movements led to gene flow. We there-
fore conducted a survey on the variability at mitochon-
drial and microsatellite loci among and within eleven
populations of the Macqueen’s bustard to address
issues of phylogeography and population history of
this species. Results from population genetic analyses
of these data are used to draw inferences on past
demographic processes, and to provide conservation
relevant insights.
Material and methods
Population samples
66 Macqueen’s bustard samples were collected from
11 localities over most of the subspecies distribu-
tion range (Figure 1 and Table 1). All samples were
collected either from recently dead animals (tissue
biopsies) or from birds captured as part of ongoing
radio-telemetry projects. In order to obtain intra-
specific divergence estimates, we analysed three and
five specimens of the North African C. u. undu-
lata and Canary Islands C. u. fuertaventurae subspe-
cies, respectively. Two great bustards, representing
different subspecies (O. t. tarda and O. t. dybow-
skii), were also sampled. The specimens are currently
held in the vertebrate collection in the National Avian
Research Center, Abu Dhabi, United Arab Emirates
under the accession numbers HUBA.1 to HUBA.74.
Data collection
Total genomic DNA was extracted using the
method of Müllenbach et al. (1989) or by use of
standard commercial kits (E.Z.N.A.Tissue DNA kit,
PEQLAB). A 264 bp fragment of the mitochon-
drial cytochrome bgene (cyt b) was amplified using
the primers Cb1L and Cb2H (Kocher et al. 1989).
The entire cyt bgene (1143 bp) was amplified with
primers Nd5L1 5GCCTACYTAGGATCITTYGC 3
and Cb6ThrH (Palumbi et al. 1991). All of
these primers and additional Cb3RL (Palumbi et
al. 1991), aTrCb1L, aTrCb3L, and aTrCb8H
(Pitra et al. 2002) were used for the sequen-
cing procedure. For the hypervariable part I
(370 bp) of the mitochondrial control region (HV1),
PCR and sequencing reactions were carried out
207
Table 1. Geographic distribution of composite mtDNA haplotypes, average number of nucleotide differences (k), haplotype diversity (h), and nucleotide diversity (π) within houbara bustard
populations (M = Mori, China; G = Gansu, China; A = Afghanistan; P = Pakistan; I = Iran; O = Oman, SA = Saudi Arabia; UAE = United Arabian Emirates; S = Sinai; EK = East Kazakhstan;
WK = West Kazakhstan; AL = Algeria; CI = Canary Islands)
HaplotypeVariable sites∗∗ M G A P I O SA UAE S EK WK AL CI Number of
Control region cyt b 45.50 N 39.00 N 31.20 N 28.30 N 31.00 N 18.50 N 31.00 N 23.75 N 31.00 N 45.50 N 52.00 N 33.50 N 28.42 N individuals
11111111111122333 4455 75.00 E 102.70 E 64.00 E 64.85 E 56.00 E 56.00 E 40.50 E 53.30 E 34.50 E 75.00 E 45.00 E 05.00 E 13.98 W
311222334578948256 4726
378348035275565632 8299
M1 CCC-TCTAGCCAGTACTA CCCT 53 15412131 94 48
M2 ...-..........G... .... 22 4
M3 ...-.....T........ .... 11
M4 ...-.........C.... .... 31 1 5
M5 ...-C.......A...C. T... 1 1
M6 T..-.............. .... 11
M7 ...-.............G .... 1 1
M8 ..T-.............. ..T. 33
M9 ...-......T....... .... 22
U1 ...ACT.GA..G.CGTC. .T.C 11
U2 T..ACTCGA..G.CGTC. .T.C 11
U3 ...ACTCGA..G.CGTC. .T.C 11
F1 T..-CTCGA..G.CGTC. .T.C 44
F2 TT.-CTCGA..G.CGTC. .T.C 11
Numberof 94 1851216410635 =74
individuals
k1.39 0.50 0.68 0.40 — 0.36 1.00 0.20 0.53 1.33 0.40
h0.64 0.50 0.61 0.40 — 0.34 0.50 0.20 0.53 1.00 0.40
π0.22 0.08 0.11 0.06 — 0.06 0.16 0.03 0.08 0.21 0.06
Lables of haplotypes encountered in each classical subspecies (M = C. u. macqueenii;U=C. u. undulata;F=C. u. fuertaventurae).
∗∗The sequenced fragments correspond to positions 298-669 in control region and 15574-15837 in cytochrome bin the complete Ciconia ciconia mitochondrial genome (AB026818). Dots
indicate identity with the reference sequence (haplotype M1), and letters designate base substitutions. Nucleotide position numbers of the houbara bustard mtDNA correspond to positions in
the alignment.
208
with primers CtrIaL (Martin et al. 2002) and
TetCtrIH 5ATGGCCCTGAAATAGGAACC 3.PCR
and cycling conditions are described in detail in
Martin et al. (2002). All PCR products were
purified (E.Z.N.A. Cycle-Pure kit, PEQLAB), and
directly sequenced using the fluorescent Prism
BigDye Terminator Cycle Sequencing kit (Applied
Biosystems) according to the manufacturers instruc-
tions followed by product separation on automated
310/3100 Genetic Analyzers (Applied Biosystems).
The observation that the entire cyt bsequences
contained no stop codons, and that the nucleotide
diversity in our sequences was 2.5 times higher in the
noncoding HV1 than in the coding cyt bgene render
it unlikely that nuclear copies of mtDNA genes were
sequenced accidentally (Arctander 1995). Sequences
were deposited in the GenBank database (accession
numbers AY078586-AY078659 for the 370 bp frag-
ment of the HV1, AY078581-AY078585 for the
complete cyt bgene, and AY078511-AY078543 for
the 264 bp fragment of the cyt b).
Four microsatellite loci (Otmic26, Otmic33,
Otmic27, and Otmic38) developed originally for the
great bustard and also polymorphic in houbara
bustards were amplified by PCR from houbara bustard
genomic DNA using fluorescently labelled primers.
Loci Otmic26 and Otmic33, corresponding primers
and the standard reaction conditions for all loci
are described in Lieckfeldt et al. (2001). Primers
designed for locus Otmic27 (cloned fragment length
217 bp, repeat (AG)10, GenBank acc.nr. AY173113)
were Otmic27F 5AACCAACATTAAGAGCTTACG
3; Otmic27R 5CAGAGTGAACTTTGCTACAG 3,
and primers for locus Otmic38 (cloned fragment
length 264 bp, repeat (AC)5AA(AC)5,GenBank
acc.nr. AY173114) were Otmic38F 5CTAGTTATC-
CTAAGTAATG 3; Otmic38R 5AAGGACTATGT-
TGACTTTTC 3. The PCR products were sepa-
rated on automated 310/3100 Genetic Analyzers
(Applied Biosystems), scored and analysed using the
computer program GENESCAN 3.1 (Applied Biosys-
tems). The alignments of the combined mtDNA haplo-
types and the microsatellite data are available at
the Population Genetics Database (PGDB) website
(http://seahorse.louisiana.edu/PGDB/).
Data analysis
MtDNA sequences were aligned using CLUSTALX
(Thompson et al. 1997). Initial sequence comparisons
and measures of variability were performed using
MEGA 2.0 (Kumar et al. 1993). Several population
genetic parameters such as nucleotide diversity and
haplotype diversity were estimated from the mtDNA
data set using DNASP 3.0 (Rozas and Rozas 1999).
To assess the extent of differentiation within and
among populations an Analysis of Molecular Vari-
ance (AMOVA) (Excoffier et al. 1992) was used to
estimate FST and M (absolute number of migrants
exchanged between populations) values, whose statis-
tical significance was tested using 10000 permutations
as implemented in ARLEQUIN 2.0 (Schneider et al.
2000). The genealogical relationship between haplo-
types was examined by statistical parsimony (TCS
program, Clement et al. 2000) to depict phylogen-
etic, geographical, and potential ancestor-descendant
relationships among the identified mtDNA haplo-
types. This network construction method defines first
the uncorrected distance above which the parsimony
criterion is violated with more than 5% probability
(parsimony limit). Then, all connections are estab-
lished among haplotypes starting with the smallest
distances and ending either when all haplotypes are
connected or the distance corresponding to the parsi-
mony limit has been reached (Crandall and Templeton
1993).
Inference of past population expansion events was
performed using Fu’s (1997) Fs test of selective
neutrality as implemented in ARLEQUIN. The Fs
statistic is particularly suited to detect departures from
neutrality in nonrecombining sequences characterized
by a high frequency of rare haplotypes, which gener-
ally lead to large negative Fs values (Fu 1997). The
significance of the Fs statistic was tested by gener-
ating 5000 random samples under the hypothesis of
selective neutrality and population equilibrium. Fu’s
Fs statistic should be considered significant if the
P-value is below 0.02 (Fu 1997). The ARLEQUIN
program was also used to calculate values of Tajima’s
(1989) Dstatistic. Negative Dvalues indicate an
excess of rare variants, as can result from a recent
population expansion or processes such as background
selection, whereas positive values indicate an excess
of intermediate-frequency variants. The significance
of the Dstatistic was tested by generating 5000
random samples under the hypothesis of selective
neutrality and population equilibrium.
To accurately estimate the mutation rate and diver-
gence times of bustard mtDNAs, the cyt bgene
of one animal from each lineage was completely
sequenced and a neighbour-joining (NJ) tree from
the Kimura (1980)-corrected distances was recon-
209
structed using MEGA. Divergence times and their
corresponding 95% confidence intervals (CI95%)in
conjunction with a conservative fossil record calibra-
tion were computed using the method of Haubold and
Wiehe (2001) implemented in CITE (downloadable at
http://www.soft.ice.mpg.de/cite).
The software FSTAT version 2.9.2 (updated by
Goudet 1995) was used to estimate microsatel-
lite allele frequencies, observed heterozygosities
(Ho) and expected heterozygosities (Hs) within
samples as well as gene diversity and allelic rich-
ness, r(n), the expected number of alleles in a
standard sample size of n. ARLEQUIN was used
to test for deviations from Hardy–Weinberg and
linkage equilibrium, and to derive estimates of
population subdivision (Michalakis and Excoffier
1996). The statistical significance of FST values
was tested using 10000 permutations. A principal
component analysis (PCA) was performed on the
covariance matrix of untransformed microsatellite
frequency data to investigate spatial patterns of
genetic variation. We used the computer package
PCAGEN written by J. Goudet (downloadable at
http://www.unil.ch/izea/softwares/pcagen.html). An
important characteristic of this program is that it tests
the significance of the total inertia as well as indi-
vidual PCA axes inertia by using a randomization
procedure (Manly 1997). Therefore, it allows us to
avoid the interpretation of nonsignificant axes. We
performed 1000 randomizations of genotypes to test
for significance of individual axes inertia. Genotypes
are permuted among samples and a PCA is realized on
each permuted data set. The observed value (propor-
tion of inertia per axis) is compared to the distribu-
tion of the values obtained from the randomized data
sets. The proportion of values larger or equal to the
observed one is an unbiased estimate of the P-value of
the test (J. Goudet, pers. comm.).
Results
mtDNA sequence variation
The two combined mtDNA regions (a total of 634 bp)
of 74 houbara bustards revealed 22 variable sites (17
transitions and one indel in HV1 and four transitions
in cyt b), which defined 14 haplotypes (Table 1).
Using statistical parsimony network analysis, North
African and Asian houbara bustards assorted into two
separate haplogroups with a division of eleven steps
between the C. u. undulata and C. u. macqueenii
group (Figure 2A). The only uncertainty found in the
cladogram was the connection between these groups,
where two equidistant alternatives exist. The haplo-
types representative of C. u. fuertaventurae clustered
closely to C. u. undulata, differing by only a single site
in the combined mtDNA sequence. AMOVA results
confirmed the distinctive undulata macqueenii split
with 94.3% of the total variation resulting from differ-
ences between the subspecies and 4.6% of the vari-
ation from within the subspecies (p= 0.005). Within
the C. u. macqueenii haplogroup, a star-like pattern
was identified in the haplotype network constructed
using the program TCS (Figure 2A). Using criteria
outlined in Crandall and Templeton (1993), haplotype
M1 was designated as ancestral. All sequences rooted
back to haplotype M1 that was also the most common
and geographically widespread haplotype depicted in
the centre of the network surrounded by rare haplo-
types differing by a small number of mutational
steps. Both the numerical (pooled frequency of 72%)
and topological (out group weight of 87%) predomi-
nance of haplotype M1 were indicative for its interior
(presumably ancestral) status. Furthermore, the occur-
rence of haplotype M1 in all populations sampled
(Figure 1) and the low divergence between haplotypes
resulted in relatively small nucleotide diversity esti-
mates (Table 1) and a weak phylogeographicstructure.
AMOVA revealed that a large percentage of the total
mtDNA variation in C. u. macqueenii was distrib-
uted within populations (79.87%) and a small but
significant percentage was found among populations
(20.13%; P<0.01). Grouping locations in different
ways in hierarchical AMOVAs did not increase the
global FST . This degree of subdivision is expected
if there are on average >9 female migrants (in the
genetic sense) entering each population each genera-
tion, assuming an island model of migration (Whitlock
and McCauley 1999). On the basis of pairwise FST
estimates there was no significant genetic differen-
tiation between most of the populations (Table 2).
The Sinai population was genetically most divergent
from other populations, with a mean pairwise FST of
60.7%. Because this amount of subdivision represents
approximately 0.35 migrants entering each popula-
tion per generation, the Sinai Peninsula population
at the western end of the current range, is likely
to be demographically more isolated from the other
populations.
210
Figure 2. (A) Statistical parsimony network of houbara bustard mtDNA haplotypes (numbered as in Table 1). The size of circle is proportional
to the number of individuals found with that haplotype. Small open circles indicate missing haplotypes. The broken lines represent possible
evolutionary pathways. (B) Time-corrected NJ tree on the entire cytochrome bgene sequence obtained from different bustard taxa. The nodes
are arranged by the age estimated from the branch length. Confidence intervals (95%) for dates are indicated by grey bars. The reference node
() has a minimum age given by the fossil record (see text).
Table 2. Genetic differentiation among Macqueen’s bustard populations. Population labels are the same as listed in Table 1
MG WKEK P I UAES
M 0.000 0.105 0.1060.028 0.033 0.1410.451
G 0.000 0.111 0.081 0.000 0.006 0.055 0.571
WK 0.000 0.013 0.198 0.1380.119 0.1740.606
EK 0.000 0.033 0.008 0.093 0.040 0.017 0.727
P 0.0790.1180.1240.037 0.040 0.000 0.577
I 0.000 0.021 0.000 0.000 0.062 0.608
UAE 0.018 0.0860.024 0.000 0.033 0.000 0.697
S 0.041 0.052 0.000 0.000 0.1150.008 0.073
Upper triangular matrix = FST estimates from mtDNA data; lower triangular matrix = FST estimates from microsatellite data. Significant
differentiation at the 95% level.
211
Table 3. Measures of diversity at four microsatellite loci in Houbara bustard populations (= 3 individuals). Population labels
are the same as listed in Table 1
Loci Population
EKPI M&GUAEWKSALCI
No. individuals 10 8 5 13 16 6 4 3 4
No. of alleles 26 4 3 4 4 5 3 3 2 2
33433 4 44312
27221 1 31223
38222 3 34321
Allelic richness 26 2.84 2.35 3.07 2.90 3.12 2.76 2.71 2.00 2.00
33 2.93 2.57 2.47 2.92 2.67 3.05 2.75 1.00 1.96
27 1.79 1.97 1.00 1.00 1.66 1.00 1.96 2.00 2.75
38 1.87 1.63 1.87 1.86 1.86 2.99 2.75 2.00 1.00
Gene diversity 26 0.61 0.57 0.68 0.63 0.71 0.67 0.58 0.67 0.50
33 0.69 0.61 0.53 0.67 0.59 0.65 0.63 0.00 0.50
27 0.34 0.50 0.00 0.00 0.23 0.00 0.42 0.50 0.71
38 0.39 0.23 0.35 0.31 0.33 0.73 0.71 0.50 0.00
Hobserved all 0.50 0.50 0.30 0.52 0.47 0.47 0.69 0.33 0.29
Hexpected all 0.48 0.45 0.34 0.49 0.45 0.46 0.52 0.33 0.33
Microsatellite variation
The four microsatellites were at least marginally poly-
morphic in all populations, and 6, 4, 4 and 5 alleles
were detected at the loci Otmic26, 33, 27, and
38, respectively (Table 3). The sizes of alleles in
the most polymorphic locus, Otmic26, ranged from
273 to 291 bp with alleles differing by 2–18 bp.
No locus showed significant departure from Hardy–
Weinberg and linkage equilibrium in populations
(3 individuals) although the most localities prob-
ably contained not enough individuals. The levels of
genetic polymorphism estimated from the microsatel-
lite data were relatively similar for all nine populations
(Table 3). To examine the overall pattern of population
differentiation, PCA was conducted with the first two
axes (PC1 and PC2), which cumulatively explained
64.3% of the total inertia contained in the data set
(Figure 3). The portions of inertia associated with
the first two axes were significant (P= 0.001). From
this plot it can be seen that all the local macqueenii
populations clustered together, well separated from
the undulata and fuertaventurae populations. Thus,
the pattern of large-scale geographical differentiation
in microsatellites was generally congruent with that
revealed by mtDNA.
There were eight alleles found exclusively within
C. u. macqueenii, but none of them was specific for
any of the seven macqueenii populations listed in
Table 3. As for mtDNA, a series of AMOVAs was
performed for pairwise comparisons (Table 2) and
different hypothesized geographical partitions. Aver-
aged over all four microsatellite loci, there was a
low yet significant genetic differentiation among C. u.
macqueenii populations (FST = 0.0419; P<0.001),
ranging from 0.0142 for locus Otmic26 to 0.1607 for
locus Otmic27. Several possible scenarios of popula-
tion subdivision were considered, but could not be
thoroughly assessed at the present time due to limit-
ations in sample size for particular areas.
Population expansion
The star-like pattern of derived variants surrounding
the most common haplotype M1 (Figure 2A) indicated
a history of recent ancestral monomorphism followed
by a population expansion (Slatkin and Hudson 1991;
Troy et al. 2001). Such a demographic event was
supported by the results of two other treatments of
the data. First, Fu’s FSstatistic, which is particularly
sensitive to population growth (Fu 1997) yielded a
significantly large negative value (FS= –5.42; P=
0.0025) for the entire Macqueen’s bustard popula-
tion, indicating an excess of low frequency haplotypes
(8) as compared with the expected number (3.81) in
a stationary population and thus providing evidence
212
Figure 3. Principal component analysis on four autosomal microsatellites allele frequency data. The proportion of inertia of the first two axes
is significant (P= 0.001). Plot names are as follows: East Kazakhstan (1), Pakistan (2), Iran (3), China (4), UAE (5), West Kazakhstan (6),
Sinai (7), Algeria (8), and Canary Islands (9). The ellipse (dotted) was drawn by hand to include the distributions of the Macqueen’s bustards
sampled in different localities. Subspecies designations are indicated.
for recent population expansion. However, when the
Chinese population was analysed separately, the FS
value became positive (0.93; P= 0.687), while that for
all other populations remained negative (–5.36; P=
0.001). Second, Tajima’s test of selective neutrality
also yielded significantly large negative Dvalues
for the entire Macqueen’s bustard population (–1.91;
P= 0.008) and for the population outside of China
(–2.12; P= 0.002), but not for the Chinese population
(–1.18; P= 0.12). Hence, the Chinese population itself
seems to be relatively stable, whereas the populations
outside of China show evidence of recent demographic
expansion.
Estimating date of expansion
We determined the nucleotide differences between
mtDNAs of the genus Chlamydotis and the previously
identified sister-genus Otis (Pitra et al. 2002) in an
attempt to estimate most accurately the mutation rate
and divergence times of bustard mtDNAs. This was
done by inferring the required information from the
NJ tree shown in Figure 2B. Under the assumptions
that Chlamydotis and Otis bustards diverged about
4 million years ago (Sanchez Marco 1990; Kretzoi
1960/61; Bochenski and Kurochkin 1987) and that
the mutation rate remained relatively constant, we
obtained conventional mutation rates of 0.89 ×108
and 2.25 ×108/ site per year for the cyt bgene
and the HV1, respectively. Using both mutation rates,
we inferred the age of the last common ancestor of
the mtDNAs obtained from the Macqueen’s bustards
at 32.8 thousand years (32.8 kyr) (CI95% =5.01–
87.30 kyr) for the cyt bgene and at 36.1 kyr (CI95% =
13.8 – 70.2 kyr) for the HV1 region. Although a wide
error is associated with these estimates, any error in
the clock calibration would only affect the absolute
time estimates, but not the chronological order of
evolutionary processes.
Discussion
Observed levels of genetic diversity in Macqueen’s
bustard were low for the mtDNA data, and medium
in terms of microsatellite variability when compared
to many other avian taxa (Moore 1995; Primmer and
Ellegren 1998). However, if only the 370 bp long
HV1 fragment is considered also used by Martín et al.
(2002) in the great bustard (Otis tarda), Macqueen’s
bustards show similar values in several measures of
diversity (e.g., 0.6% versus 0.8% sequence divergence
among haplotypes, 0.0015 versus 0.0050 nucleotide
diversity) relative to the great bustard. The microsatel-
lite variation observed in Macqueen’s bustard is also
comparable to that of great bustards, for which these
213
markers were originally designed (Lieckfeldt et al.
2001). Taken together, these results suggest a fairly
recent divergence of the present-day Macqueen’s
bustard lineages or a recent origin of all extant
Macqueen’s bustards from an ancestral population
which in itself was limited in diversity, perhaps
as a result of climatically mediated range restric-
tion. The pattern observed in the mtDNA network
of Macqueen’s bustard is consistent with a recent
population expansion, with little divergence among
haplotypes (Figure 2A) and insufficient time and/or
isolation to generate regional differentiation. The
inference of a population expansion in the rela-
tively recent past is also supported by significantly
negative Fu’s Fs and Tajima’s Destimates. The
overall coalescence date of all sampled Macqueen’s
bustard mtDNA sequences around the central haplo-
type M1 was estimated at 32.8–36.1 kyr ago, indi-
cating a population expansion around or before this
time. These molecular dates should also be confirmed
in the future using other dating methods, such as
for example the Bayesian approach of Thorne et al.
(1998).
Analyses of the genetic structure of Macqueen’s
bustard populations showed no evidence of major
geographical partitions, old subdivision events, or
complete barriers to historical gene flow (Table 2).
This is consistent with findings of D’Aloia (2001)
that were based on RAPD analysis using ten random
decamer primers. The only evidence for statistically
significant phylogeographical differentiation seems to
support the traditional division of houbara bustard
subspecies (Cramp and Simmons 1980; Collar 1996).
The historical separation and geographical distribution
of the African and Asian houbara bustards revealed by
both marker types appears concordant.
The observed patterns of low genetic variability
and weak population differentiation can be interpreted
as being caused by a combination of several demo-
graphic processes, starting with a relatively recent
expansion of the modern Macqueen’s bustard as a
whole, so that sufficient time for extensive genetic
differentiation has not yet accumulated. In addi-
tion, Macqueen’s bustards are able to disperse effi-
ciently over broad areas, which is consistent with
our inference of high levels of homogenizing gene
flow on wide geographical scales. Recent migra-
tion studies have shown that Macqueen’s bustards
from different breeding populations share the same
wintering grounds (Launay et al. 1999), and birds
from the same breeding populations are wintering in
different places (Combreau et al. 1999). Therefore, the
observed distribution of haplotypes may be attributed
to populations in panmixia or to long distance gene
flow between populations over the recent past. With
a larger sample size and a higher level of polymorph-
isms it might be possible to discriminate between these
two possibilities.
Conservation implications
The houbara bustard (Chlamydotis undulata)isthe
prime quarry for traditional Arab falconry with
diametrical consequences: steady decline in numbers
during the 20th century, mainly due to over-hunting
and poaching (Collar 1996; Goriup 1997; Combreau
et al. 2001) on one hand, and extensive conserva-
tion efforts, including ecological research, captive-
breeding and reintroduction/restocking programmes
as well as habitat protection (Combreau et al. 1995;
Seddon et al. 1995) on the other. The current status
of the houbara bustard is lower risk – near vulner-
able, and the population trend is listed as deteri-
orating (Hilton-Taylor 2000), based on observed
declines in many populations. In addition, our data
provide support for the existence of at least two
major geographical partitions defining old and isolated
groups which could be viewed as subspecies or
Evolutionary Significant Units (sensu Moritz 1994).
Our results are compatible with currently favoured
strategies for Macqueen’s bustard conservation on a
broad regional basis (Fox et al. 2000), with large-
scale biomes or ecosystems as operational manage-
ment units. This strategy is advisable both in terms
of maintaining Macqueen’s bustards as an important
component of functional desert ecosystems and as an
intricate part of the Arab heritage. To preserve the
evolutionary potential of the migratory Macqueen’s
bustard and to increase its chances of long-term
survival, it will be important to manage breeding
populations separately and to raise caution when
issuing harvest quotas in these areas. Finally, because
of continued reduction and isolation of remaining
Macqueen’s bustard populations, it is important to
consider the inference presented here for high histor-
ical levels of gene flow over broad areas. Thus,
our results encourage management alternatives that
maintain these original and likely adaptive popula-
tion dynamics, possibly including joint international
efforts and intervention to ensure an intermediate level
of gene flow by annual long-distance migration among
remnant populations.
214
The authors are grateful to the Environmental
Research and Wildlife Development Agency
(ERWDA) for the financial support of the project and
ERWDA’s Management for their support and interest
in this study. For providing tissue samples we thank
J.C. Alonso, E.C. Vidal, A. Martin, G. Diaz, J.L.
Rodriguez and J.C. Cillera from Spain, H. Litzbarski
from Germany, M. Yiqing and T. Xiuhua from China,
S. Chan from Japan, S. Hemon from Saudi Arabia,
and F. Launay and X. Eichaker from the United
Arab Emirates. We thank A. Schmidt for technical
assistance. We also thank J. Fickel, the Associate
Editor, and two anonymous reviewers for enhancing
the manuscript.
References
Arctander P (1995) Comparison of a mitochondrial gene and a
corresponding nuclear pseudogene. Proc. Roy. Soc. Lond. B,262,
13–19.
Bochenski Z, Kurochkin EN (1987) Pliocene bustards (Aves:
Otididae and Gryzajidae) of Moldavia and S. Ukraine. In:
L’Evolution des oiseaux dþapres le temoignage des fossiles
(ed Mourer-Chauvire C), pp. 173–186. Docum. Lab. Géol. 99,
Lyon.
Broders O, Osborne T, Wink M (2003) A mtDNA phylogeny of
bustards (family Otididae) based on nucleotide sequences of the
cytochrome b-gene. J. Ornithol.,144, 176–185.
Clement M, Posada D, Crandall KA (2000) TCS: a computer
program to estimate gene genealogies. Mol. Ecol.,9, 1657–1659.
Collar NJ (1996) Family Otididae (bustards). In: Handbook of the
Birds of the World, Vol. 3. (eds. Del Hoyo J, Elliot A, Sargatal J),
pp. 240–273. Lynx Edicions, Barcelona.
Combreau O, Saint-Jalme M, Seddon P et al. (1995) A program
for houbara bustard restoration in Saudi Arabia. In: Integrating
People and Wildlife for a Sustainable Future (eds. Bissonette
JA, Kraussman PR), pp. 520–524. The Wildlife Society USA,
Bethesda.
Combreau O, Launay F, Al Bowardi M, Gubin B (1999) Outward
migration of houbara bustards Chlamydotis undulata macqueenii
from two breeding areas in Kazakhstan. Condor,101, 159–164.
Combreau O, Launay F, Lawrence P (2001) An assessment
of annual mortality rates in adult Asian houbara bustards
(Chlamydotis [undulata] macqueenii). Anim. Conserv.,4, 133–
141.
Cramp S, Simmons K (1980) Handbook of the Birds of Europe, the
Middle East and North Africa, Vol. 2. Oxford University Press,
Oxford.
Crandall KA, Templeton AR (1993) Empirical tests of some predic-
tions from coalescent theory with applications to intraspecific
phylogeny reconstruction. Genetics,134, 959–969.
D’Aloia M-A (2001) Studies on the population structure of the
houbara bustard Chlamydotis undulata in the Middle East with
DNA analysis techniques. Zool. Middle East,22, 25–35.
Excoffier L, Smouse P, Quattro J (1992) Analysis of molecular
variance inferred from metric distances among DNA haplo-
types: application to human mitochondrial DNA restriction data.
Genetics,131, 479–491.
Fox N, Al Bowardi M, Macdonald H, Launay F (2000) A Global
Strategy for the Conservation of Falcons and Houbara. Environ-
mental Research and Wildlife Development Agency, Abu Dhabi.
Fu Y-X (1997) Statistical tests of neutrality of mutations against
population growth, hitchhiking and background selection.
Genetics,147, 915–925.
Gaucher P, Paillat P, Chappuis C, Saint Jalme M, Lotfikhah F,
Wink M (1996) Taxonomy of the houbara bustard Chlamydotis
undulata subspecies considered on the basis of sexual display
and genetic divergence. Ibis,138, 273–282.
Goudet J (1995) fstat Version 1.2.: a computer program to calculate
F-statistics. J. Hered. ,4, 485–486.
Goriup PD (1997) The world status of the houbara bustard
Chlamydotis undulata.Bird Conserv. Inter.,7, 373–397.
Granjon L, Gaucher P, Greth A, Paillat P, Vassart M (1994)
Allozyme study of two subspecies of houbara bustard
(Chlamydotis undulata undulata and C. u. macqueenii).
Biochem. Syst. Ecol.,22, 775–779.
Haubold B, Wiehe T (2001) Statistics of divergence times. Mol.
Biol. Evol.,18, 1157–1160.
Hilton-Taylor C (2000) IUCN Red List of Threatened Species.
IUCN, Gland, Switzerland & Cambridge, UK.
Kocher TD, Thomas WK, Meyer A et al. (1989) Dynamics of
mitochondrial DNA evolution in mammals: amplification and
sequencing with conserved primers. Proc. Nat. Acad. Sci. USA,
86, 6196–6200.
Kimura M (1980) A simple method for estimating evolutionary rates
of base substitutions through comparative studies of nucleotide
sequences. J. Mol . Evol.,16, 111–120.
Kretzoi M (1960/61) Prähistorischer Großtrappenfund und die
Geschichte der Trappen. Aquila,67–68, 189–190.
Kumar S, Tamura K, Nei M (1993) MEGA: Molecular Evolutionary
Genetics Analysis, Version 1.02. Pennsylvania State University,
University Park.
Launay F, Paillat P (1990) A behavioural repertoire of the adult
houbara bustard (Chlamydotis undulata macqueenii). Rev. Ecol.
(Terre Vie), 45, 65–88.
Launay F, Combreau O, Al Bowardi M (1999) Annual migration
of houbara bustard Chlamydotis undulata macqueenii from the
United Arab Emirates. Bird Conserv. Inter.,9, 155–161.
Lieckfeldt D, Schmidt A, Pitra C (2001) Isolation and characteriz-
ation of microsatellite loci in the great bustard, Otis tarda.Mol.
Ecol. Notes,3, 133–134.
Manly BFJ (1997) Randomization, Bootstrap and Monte Carlo
Methods in Biology, 2nd edn. Chapman & Hall, London.
Martín CA, Alonso JC, Alonso J, Pitra C, Lieckfeldt D (2002) Great
bustard population structure in central Spain: concordant results
from genetic analysis and dispersal study. Proc. Roy. Soc. Lond.
B,269, 119–125.
Michalakis Y, Excoffier L (1996) A generic estimation of popula-
tion subdivision using distances between alleles with special
reference to microsatellite loci. Genetics,142, 1061–1064.
Moore WS (1995) Inferring phylogenies from mtDNA variation:
mitochondrial-gene trees versus nuclear-gene trees. Evolution,
49, 718–726.
Moritz C (1994) Defining ‘Evolutionarily Significant Units’ for
conservation. Trends Ecol. Evol.,9, 373–375.
Müllenbach R, Lagoda PJL, Welter C (1989) An efficient salt-
chloroform extraction of DNA from blood and tissues. Trends
Genet.,5, 391.
Osborne PE, Al Bowardi M, Bailey TA (1997). Migration of the
houbara bustard Chlamydotis undulata from Abu Dhabi to Turk-
menistan: the first results from satellite tracking studies. Ibis,
139, 192–196.
215
Palumbi SR, Martin A, Romano S et al. (1991) The Simple Fool’s
Guide to PCR. University of Hawaii, Department of Zoology,
Honolulu.
Pitra C, Lieckfeldt D, Frahnert S, Fickel J (2002) Phylogenetic
relationships and ancestral areas of the bustards (Gruiformes:
Otididae), inferred from mitochondrial DNA and nuclear intron
sequences. Mol. Phyl. Evol.,23, 63–74.
Primmer CR, Ellegren H (1998) Patterns of molecular evolution in
avian microsatellites. Mol. Biol. Evol.,15, 997–1008.
Rozas J, Rozas R (1999) DnaSPversion 3: an integrated program for
molecular population genetics and molecular evolution analysis.
Bioinformatics,15, 174–175.
Sanchez Marco A (1990) A new bustard (Otididae; Aves) from the
early Pliocene of Layna (Soria, Spain). Paleontol. Evol.,23, 223–
229.
Seddon PJ, Saint-Jalme M, Van Heezik Y, Paillat P, Gaucher P,
Combreau O (1995) Restoration of Houbara bustard populations
in Saudi Arabia: developments and future directions. Oryx,29,
136–142.
Schneider S, Kueffer JM, Roessli D, Excoffier L (2000) ARLE-
QUIN, Version 2.01: A Software for Population Genetic Data
Analysis. University of Geneva, Geneva.
Slatkin M, Hudson RR (1991) Pairwise comparisons of mito-
chondrial DNA sequences in stable and exponentially growing
populations. Genetics,129, 555–562.
Tajima F (1989) Statistical method for testing the neutral mutation
hypothesis by DNA polymorphism. Genetics,123, 585–595.
Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG
(1997) The ClustalX windows interface: flexible strategies for
multiple sequence alignment aided by quality analysis tools.
Nucleic Acids Res.,25, 4876–4882.
Thorne JL, Kishino H, Painter IS (1998) Estimating the rate of
evolution of the rate of molecular evolution Mol. Biol. Evol., 15,
1647–1657.
Troy CS, MacHugh DE, Bailey JF et al. (2001) Genetic evidence
for Near-Eastern origins of European cattle. Nature,410, 1088–
1091.
Whitlock M, McCauley D (1999) Indirect measures of gene flow
and migration: Fst not equal to 1/(4Nm-1). Heredity,82, 117–
125.
... L'essentiel des analyses sur la structure génétique des populations d'outardes houbara a été réalisé pour l'espèce asiatique C. macqueenii (d'Aloia, 2001;Pitra et al., 2004). L'analyse de marqueurs mitochondriaux et microsatellite a révélé une faible différentiation génétique globale malgré la taille de l'aire de répartition. ...
... macqueenii. Similarly, the observed heterozygosity is higher in C. u. undulata than in C. macqueenii, where levels ranged from 0.29 to 0.69 (Pitra et al., 2004). Asian populations are thought to be of larger size than North African ones and, therefore, may present a greater potential to maintain genetic diversity (Azafzaf et al., 2005;Birdlife International, 2004). ...
... Both C. undulata and C. macqueenii are monophyletic, having no common haplotypes and corresponding to Moritz's definition of ESUs (Moritz, 1994). They therefore need to be managed independently (Pitra et al., 2004). Within C. undulata, we did not find any respective monophyly between C. u. undulata and C. u. fuerteventurae, although this is a prerequisite for the definition of a subspecies (Phillimore et al., 2006;Zink, 2004). ...
Thesis
Full-text available
Wild populations of the endangered Houbara bustard (Chlamydotis undulata undulata) are currently being reinforced in the eastern part of Morocco. In order to evaluate the potential genetic impact of the population reinforcement, the genetic structure and mating system of wild populations was investigated using both mitochondrial and microsatellite markers. We found low genetic differentiation at the North African scale. This result reduces potential constrains for the reinforcement management strategy. A study of the captive flock indicated that most of the initial genetic diversity was preserved, despite some risks of loosing allelic diversity. Combined with a strict genetic management, the regular addition of few founders will allow the preservation of a high level of genetic diversity in the captive flock. The use of these genetic data combined with demographic ones will allow the evaluation of the global impact of the reinforcement on wild populations.
... The genetic structure of Macqueen's Bustard and Houbara Bustard has been assessed using mitochondrial sequence analysis and microsatellite markers for individuals within their geographic range from the Canary Islands to China. The results revealed that there was low genetic diversity among both species (considered to be subspecies of Houbara Bustard at the time; Pitra et al. 2004, Lesobre et al. 2010. ...
... The Macqueen's Bustard, despite its broad distribution, has relatively low genetic exchange within its own range (Pitra et al. 2004). Our results show that while birds within Iran have gene exchange, there seems to be no gene flow or inter-breeding with bustards in Saudi Arabia. ...
Article
Capsule: There is low genetic diversity in the Macqueen’s Bustard Chlamydotis macqueenii in Iran. Aims: To investigate the genetic diversity and population structure of Macqueen’s Bustard in Iran, using two mitochondrial DNA loci. Methods: Molecular diversity of the mitochondrial cytochrome oxidase c subunit I (COI) gene and part of the mitochondrial control region D-loop (in total 1183 base pairs) were analysed from 26 individual Macqueen’s Bustards from three regions of Iran. Results: There was little variation in nucleotides and haplotypes in the populations for genes of both CR and COI. The population had free breeding and gene flow between the three study regions in Iran: Petregan, Ferdows and Yazd. Conclusion: The use of molecular and genetic studies is essential to strengthen the protection of genetic diversity of the Macqueen’s Bustard.
... The genotyping of 19 microsatellite loci, that is A10, A18, A205, A106, A113a. A120, A208, A21, A210, A29, A2, CAM-04, CAM-07, CAM-19, D117, D118, D119, Otmic27, Otmic38 (Chbel et al., 2002;Pitra et al., 2004), was performed by Genoscreen (Lille, France) following conditions described in (Lesobre et al., 2010a). ...
Article
Conservation breeding programs pursue the double objective of preserving genetic diversity and producing individuals to support in situ conservation measures. Genetic management and monitoring are commonly based on pedigree analyses and are therefore dependent on the pedigree quality and the underlying assumption that founders of the captive population are neither inbred nor related to each other or to the captive population. Should founders be related, this assumption may lead to an overestimation of genetic diversity and an underestimation of inbreeding in captivity. In this study, we examined the effects of the founder assumption on estimates of genetic diversity by combining three approaches: (1) computer simulations of pedigrees of theoretical captive populations and their associated in situ source populations, (2) analysis of pedigrees of real conservation breeding programs and (3) microsatellite‐based computation of kinship among founders from a captive population of houbara bustard. The theoretical approach revealed that the captive population's average mean kinship Mk increases linearly with founder average Mk. The bias in Mk due to the founder assumption was strongly related to the effective size of the source population and to pedigree quality while remaining critical after 25 generations of captivity. Results based on real populations were consistent with theoretical ones and confirmed the overestimation of genetic diversity in captive populations. Overall, our results indicate that under situations classically encountered in conservation breeding programs (e.g. small and isolated source population, incomplete pedigrees), estimates of genetic diversity are potentially highly overestimated, challenging the genetic management of captive populations of species of conservation concern. Under situations classically encountered in conservation breeding programs, ignoring true founder relationships can lead to significant overestimation of genetic diversity and underestimation of inbreeding. This is especially true when founders are highly related and collected within a small source population (Nes).
... It has been reported as opportunistic bird on their feeding bases. (Bahmanpour et al., 2012;Pitra et al., 2004;Collar et al., 1994;Combreau et al., 2011;Islam et al., 2013;Heydari et al., 2010). ...
... The only known cytogenetic data are a metaphase of this species, without a precise description of the chromosomes, which was reported in the study that allowed the development of chromosome paints and BACs for the characterization of inter-and intrachromosomal rearrangements of avian microchromosomes (Lithgow et al. 2014). However, several molecular studies based on the characterisation of microsatellites have been conducted in the Houbara bustard for the genotyping of individuals (Chbel et al. 2002, Pitra et al. 2004, Arif et al. 2012. ...
Article
Full-text available
The Houbara bustard Chlamydotisundulata (Jacquin, 1784) is an emblematic and endangered bird of steppes and desert spaces of North Africa. This species belonging to Otidiformes is recognized as vulnerable by the International Union for Nature Conservation. The critical situation of this species and the revision of its classification on the tree of birds encouraged the authors to start accumulating chromosome data. For that, we propose the GTG- and RBG-banded karyotypes of the Houbara bustard prepared from primary fibroblast cell cultures. The first eight autosomal pairs and sex chromosomes have been described and compared to those of the domestic fowl Gallusdomesticus (Linnaeus, 1758). The diploid number has been estimated as 78 chromosomes with 8 macrochromosomes pairs and 30 microchromosomes pairs, attesting of the stability of chromosome number in avian karyotypes. The description of the karyotype of the Houbara is of crucial importance for the management of the reproduction of this species in captivity. It can be used as a reference in the detection of chromosomal abnormalities, which would be responsible of the early embryonic mortalities.
... Chlamydotis comprend deux espèces distinctes longtemps considérées comme espèces polytypiques. Une récente révision taxonomique (Tobias et al. 2010) basée sur des divergences génétiques notamment au niveau du codage du cytochrome c (Broders et al. 2003;D'Aloia 2001;Pitra et al. 2002Pitra et al. , 2004, des différences comportementales notamment au niveau de la parade des mâles ) et morphologiques, et de distribution des populations (Cramp & Simmons 1980), a mené à la reconnaissance de deux espèces congénériques: l'outarde houbara asiatique et l'outarde houbara nord-africaine ( Figure 1). (Combreau et al. 2011;Gao et al. 2009;Goriup 1997;Judas et al. 2006 (Carrascal et al. 2006(Carrascal et al. , 2008. ...
Thesis
Dans un contexte de sélection sexuelle, les systèmes de communication permettant l’attraction et la stimulation du partenaire sexuel et la compétition entre individus du même sexe sont indispensables. Ceci est particulièrement vrai chez les espèces à système d’appariement polygyne de type lek, où les mâles rassemblés dans l’espace sont en compétition pour l’accès aux femelles. Chez notre sujet d’étude, l’outarde houbara nord-africaine les males réalisent des parades incluant des démonstrations visuelles et des vocalisations appelées booms, sur des sites espacés les uns des autres par des distances importantes dans un système qualifié de lek explosé. Notre objectif était d’étudier les systèmes de codage-décodage des informations exprimées durant la parade des mâles chez cette espèce. Nous avons démontré l’existence d’un codage de l’identité individuelle porté par des paramètres visuels et des paramètres acoustiques des vocalisations. Des associations significatives entre des paramètres des booms et des caractéristiques physiques et comportementales des mâles susceptibles de refléter leur qualité, ont également été mises en évidence. Ainsi, les mâles qui produisent les booms les plus graves avaient les masses les plus importantes et paradaient le plus intensément. Lorsque des interactions agonistiques étaient simulées expérimentalement en diffusant des leurres acoustiques, les mâles avaient des réponses comportementales différentes en fonction de la fréquence des booms diffusés. Ainsi le niveau fréquentiel des booms des autres mâles est effectivement perçu et décodé par les individus en compétition. Par ailleurs, plusieurs paramètres des booms sont génétiquement déterminés et héritables, et pourraient porter une information sur l’apparentement entre individus.Certains paramètres sont également liés à la consanguinité des individus. Nous avons montré également que les booms sont particulièrement bien adaptés à la communication à grande distance. En effet, les booms sont de très basse fréquence, se propagent à des distances supérieures à 640 m, et les paramètres supportant le codage-décodage de l’information sont résistants à la propagation et produits de manière redondante. Enfin, les signaux acoustiques et des signaux visuels et semblent agir en synergie (multimodalité) ce qui pourraient améliorer l’efficacité de la communication à grande distance. Ainsi notre étude a démontré que des informations complexes sont transmises durant la parade des mâles au travers de signaux acoustiques et visuels au sein d’un réseau de communication à grande distance.
... La avutarda hubara, gracias a su singularidad en el contexto de la avifauna del archipiélago (especie de gran tamaño -los machos adultos superan los tres kg -con identidad subespecífica endémica, aunque recientemente puesta en cuestión -C. u. fuertaventurae, Idaghdour et al., 2004;Pitra et al., 2004) se ha empleado como 'especie-bandera' (Simberloff, 1998) para la protección de los medios estepárico-desérticos, pues los esfuerzos de conservación complejos y/o costosos son más fácilmente abordables por las agencias gestoras cuando se orientan a estas especies. Esta situación implica que la avutarda hubara sea protagonista de numerosos conflictos entre las políticas de ordenación territorial canaria (esencialmente relativas al crecimiento urbano y de las actividades agropecuarias) y las estrategias de conservación de su medio natural. ...
Article
Full-text available
Aims:To quantify the population size and the distribution patterns of the houbara bustard (Chlamydotis undulata fuertaventurae) in Lanzarote and La Graciosa islands (Canary Islands). To analyze habitat preferences of the species according to topographic, soil, vegetation and human impact variables. Location: Lanzarote and La Graciosa islands (Canary Islands). Methods: Bird censuses using the line transect method and the estimation of detection probabilities. Bootstrap to calculate the confidence interval of population size estimations. Classification trees were used to analyze the effect of habitat descriptors on bird species occurrence in 671 0.5 km-transects. Results: The population size of the houbara bustard was 500 birds (90 % confidence interval: 272- 801) in Lanzarote and 6 birds (3 - 10) in La Graciosa. The average density in the occupied semiarid environments was 1.63 birds/km 2 in Lanzarote and 0.32 birds/km 2 in La Graciosa. The maximum ecological density recorded was 3 birds/km 2. The most important areas for the species were the steppe plains of Famara- Soo-Zonzamas, Guatiza and Teguise (202 km 2), where 85 % of the whole population of Lanzarote is included. Slope of the terrain, rock cover on the ground and the density of roads and unpaved tracks had a highly negative influence on the habitat preferences of the houbara bustard. The probability of occurrence of the species increased as the distance to the nearest urban area also increased. Habitat descriptors related to vegetation structure played a minor role in the distribution of the houbara bustard. Conclusions: According to the data provided by this paper, and those previously published in 1990 decade, the population of houbara bustard in Lanzarote has shown a 40 % increase in the last 10-15 years. Only 20 % of this population is included in protected areas. The density of the species in Lanzarote is the highest recorded in the whole geographic range of the species in northern Africa and central Asia. Although the species has a favourable protection status in Lanzarote and La Graciosa, conservation efforts should be reinforced in order to preserve semiarid grasslands and shrublands with a steepness of the terrain lower than 15 %, a rock cover less than 60 %, a low density of roads and tracks (less than 0.5 km/20 ha) and away from urban sprawls (at least further than 650 m).
... We used Qiagen DNA Blood and Tissue kits to extract DNA and 17 microsatellite loci were amplified using fluorescent primers: loci A2, A10, A21, A22, A29, A106, A120, A204, A205, A210, D12, D110, D118, D119 (Chbel et al. 2002), O26 (Lieckfeldt et al. 2001) and O27, O38 (Pitra et al. 2004). PCR mixtures contained 0.5 U DNA Polymerase (Solis Biodyne), 80 mM Tris-HCl (pH 9.5), 20 mM (NH 4 ) 2 SO 4 , 2.5 mM MgCl 2 , 200 lM dNTPs, 2 ll BSA (2 mg/ml), 10 pmol of each primer and approximately 100 ng of DNA. ...
Article
Full-text available
(Lekking is a promiscuous breeding system in which females visit groups of displaying males only for the purpose of mating. The spatial organization of these groups can range from tight aggregations of individuals, or leks, to loose clusters of males displaying on exploded-leks, and it can also include males seemingly displaying alone. As the distance between displaying males increases, it becomes possible for them to hold fixed territories and for females to select mates not for their genetic quality, as on true leks, but for the quality of the resource on their territory, i.e., resource-defense polygyny. Here, in a 2-year study of a breeding population of MacQueen's Bustard Chlamyd)otis macqueenii in southwest Kazakhstan, we used GPS and radio-tracking coupled with observation to understand male territoriality and the spatial distribution of sites, and we followed the breeding behavior of cryptic females using nest locations and genetic paternity analysis. We found that males were faithful throughout the season and across years to a small and exclusive territory centered on their display site. These sites were significantly overdispersed in space and thus we could not delimit any leks in a study area spanning 350 km(2). Females nested in the vicinity of male territories and sometimes inside them, but based on a sample of six resolved paternities, they did not favor the territory of their mate for nesting. This is inconsistent with the hypothesis of resource-based female choice and implies that the breeding system of MacQueen's Bustard can be treated as a special case of lekking, albeit without male aggregation. Six broods were fathered by at least five different males, which lends support to the hypothesis that overdispersion of male sites is related to variability in female mate choice, and thus low male mating-skew in a lekking system.
Article
Understanding the mechanisms underlying population structure is a crucial issue in evolutionary biology and ecology. Identifying the processes driving biodiversity is also of prime interest to draw up guidelines for population management and conservation planning. Level of differentiation depends on a subtle balance between gene flow, genetic drift and natural selection and insight into the relative contribution of these factors can be provided by spatial and temporal patterns of intra-specific phenotypic and genetic variations. Differentiation has mainly been studied in insular systems because i) islands give ideal framework to study divergence in species ii) islands enclosed endemic fauna and flora. These endemic species are characterised by small population sizes and small distribution areas. They are consequently more fragilized by strong environmental changes. The Forest thrush Turdus lherminieri is an endemic and understorey bird present in four islands of Lesser Antilles: Montserrat, Guadeloupe, Dominica and Saint-Lucia. Four subspecies have been described on each island on the basis of feathers coloration but no study has really quantified the divergence between these subspecies. In addition, bird numbers have decline since 15 years and now Forest thrushes are protected on three islands but are always hunted in Guadeloupe. Aims proposed in this study are i) to study the spatial structure in Forest thrush in order to deduce potential causes of this structure ii) to describe the temporal evolution of genetic diversity, iii) to determine if parasites can exert contrasted selection pressures which follow gentic and morphological pattern in Forest thrushes populations. In this study, we have identified three clades and subspecies on each island which are differentiated morphologically and genetically. At fine scale i.e Guadeloupe only, we have revealed an uncommon level of differentiation. In last, the parasites’ structure seems to follow the morphological and genetic structure observed in Forest thrushes. To conclude, three management units can be defined: a first in Saint- Lucia, a second in Dominica and a third including Montserrat and Guadeloupe
Article
The phylogeographic structure of Asian Houbara revealed by genetic analysis suggests some level of differentiation between south and east Arabian resident populations, Sinai populations and the main bulk of Central Asian migrant and resident populations. Satellite tracking in southernmost populations failed to reveal population exchange with northern population and explains partly the genetic structure observed. Although central Asian birds show population specific migratory patterns and strong philopatry, possibilities of dissemination of genetic material between migrant populations and between migrants and residents exist in year-old birds and in adult birds during migration and could contribute to explain the absence of genetic differentiation between Central Asian populations.
Article
Full-text available
An electrophoretic analysis was made of eleven populations of Unio pictorum from Central Europe and of nine populations of U. elongatulus from Italy, considering eight enzyme systems (17 loci). Mean heterozygosity levels and polymorphism diminish in small and/or isolated populations. No diagnostic loci were found for the two supposed species and the low Nei genetic distances suggest a very close relationship between them. The phenogram based on genetic distance values shows a nearly perfect arrangement of populations according to river systems. The case of elongatulus and pictorum might be explained as an example of speciation in action.
Article
An accurately resolved gene tree may not be congruent with the species tree because of lineage sorting of ancestral polymorphisms. DNA sequences from the mitochondrially encoded genes (mtDNA) are attractive sources of characters for estimating the phylogenies of recently evolved taxa because mtDNA evolves rapidly, but its utility is limited because the mitochondrial genes are inherited as a single linkage group (haplotype) and provide only one independent estimate of the species tree. In contrast, a set of nuclear genes can be selected from distinct chromosomes, such that each gene tree provides an independent estimate of the species tree. Another aspect of the gene-tree versus species-tree problem, however, favors the use of mtDNA for inferring species trees. For a three-species segment of a phylogeny, the branching order of a gene tree will correspond to that of the species tree if coalescence of the alleles or haplotypes occurred in the internode between the first and second bifurcation. From neutral theory, it is apparent that the probability of coalescence increases as effective population size decreases. Because the mitochondrial genome is maternally inherited and effectively haploid, its effective population size is one-fourth that of a nuclear-autosomal gene. Thus, the mitochondrial-haplotype tree has a substantially higher probability of accurately tracking a short internode than does a nuclear-autosomal-gene tree. When an internode is sufficiently long that the probability that the mitochondrial-haplotype tree will be congruent with the species tree is 0.95, the probability that a nuclear-autosomalgene tree will be congruent is only 0.62. If each of k independently sampled nuclear-gene trees has a probability of congruence with the species tree of 0.62, then a sample of 16 such trees would be required to be as confident of the inference based on the mitochondrial-haplotype tree. A survey of mtDNA-haplotype diversity in 34 species of birds indicates that coalescence is generally very recent, which suggests that coalescence times are typically much shorter than internodal branch lengths of the species tree, and that sorting of mtDNA lineages is not likely to confound the species tree. Hybridization resulting in transfer of mtDNA haplotypes among branches could also result in a haplotype tree that is incongruent with the species tree; if undetected, this could confound the species tree. However, hybridization is usually easy to detect and should be incorporated in the historical narrative of the group, because reticulation, as well as cladistic events, contributed to the evolution of the group.
Article
North American freshwater bivalves of the families Unionidae and Margaritiferidae represent one of the endangered faunas of the world. Effective management of threatened and endangered species requires knowledge not only of abundances of these species but also the degree of variation within species and the geographic distribution of this intraspecific variation. We used allozyme electrophoresis to examine the genetic structure of seven Quadrula quadrula populations from the Ohio, Tennessee, and Tensas Rivers. We then considered the implications of our results for the development of effective bivalve conservation strategies. Descriptive measures of genetic variation within populations are quite high (2.1 ± 0.1(se) alleles per locus; 61.4 ± 2.6% polymorphic loci; 0.24 ± 0.01 heterozygosity) relative to other unionids. Genotype frequencies met Hardy-Weinberg expectations at all polymorphic loci. Among-population variation was low and mostly confined to differences between the Tensas River population (lower Mississippi River basin) and the Ohio River basin populations. Significant differences in allele frequencies among populations were only detected at 3 of 10 loci; no differences in allele frequencies were found among Ohio River basin populations. Genetic distances, though all small, were significantly correlated with geographic distance. Estimated gene flow was high among populations, but variation among populations did tend to follow the predictions of an isolation-by-distance model of dispersal. The low levels of among-population genetic variation are remarkable given that these populations are separated by distances as great as 2,500+ river kilometers. High levels of gene flow may ensure that within-population variation remains high and that populations do not become differentiated due to genetic drift. An optimum conservation strategy for this species in the mainstem of the Ohio River would center on the protection of a number of large populations and maintenance of corridors for dispersal of host fishes. Successful protection of threatened and endangered species requires conservation of both abundance and genetic diversity of unionids. Further work is needed to characterize general patterns of genetic structure within freshwater bivalve species.
Article
Freshwater bivalves (Unionacea) are among the most endangered faunal elements in North America. Molecular genetic studies have much to offer conservation efforts directed to this declining fauna. Molecular genetic data can provide information needed to identify evolutionarily significant units, resolve taxonomic ambiguities, describe population structure, evaluate impacts of habitat fragmentation and reduced gene flow among populations, reconstruct phylogenetic relationships, clarify fish host-glochidia relationships, and provide evidence in legal actions. Molecular genetic techniques and their application to freshwater bivalves are reviewed.
Article
In Margaritifera margaritifera (L.) individuals collected from the Ähtävänjoki river in July 1988, the histological structure of the pre-spawn ovaries and testes was neat, and a normal reproductive capacity could be predicted. The sex ratio was even, and no true hermaphrodites were present. The commonly occurring "microhermapnrodite" gonads with small nests of the germ cells of the opposite sex may show that the mussels are capable of hermaphroditism or sex reversal. The experimental transplantation of freshwater pearl mussels for conservation purposes 10 km upstream in the same river in 1987 did not disturb the mussels' gonad development. This was assessed from examination of the histological structure of the gonads in July, a year after the transfer. The sizes of testis follicles, the numbers of sperm morulae and oocytes per follicle, the occurrence of microhermaphrodite or out-of-phase follicles were similar both in endemic and transplanted mussels. From these results it could be concluded that transplantation of freshwater pearl mussels can be undertaken in a home river without reducing the gamete producing capacity of the mussels during the breeding season of the next year.