ArticlePDF Available

Abstract and Figures

The high risk of metabolic disease traits in Polynesians may be partly explained by elevated prevalence of genetic variants involved in energy metabolism. The genetics of Polynesian populations has been shaped by island hoping migration events which have possibly favoured thrifty genes. The aim of this study was to sequence the mitochondrial genome in a group of Maoris in an effort to characterise genome variation in this Polynesian population for use in future disease association studies. We sequenced the complete mitochondrial genomes of 20 non-admixed Maori subjects using Affymetrix technology. DNA diversity analyses showed the Maori group exhibited reduced mitochondrial genome diversity compared to other worldwide populations, which is consistent with historical bottleneck and founder effects. Global phylogenetic analysis positioned these Maori subjects specifically within mitochondrial haplogroup--B4a1a1. Interestingly, we identified several novel variants that collectively form new and unique Maori motifs--B4a1a1c, B4a1a1a3 and B4a1a1a5. Compared to ancestral populations we observed an increased frequency of non-synonymous coding variants of several mitochondrial genes in the Maori group, which may be a result of positive selection and/or genetic drift effects. In conclusion, this study reports the first complete mitochondrial genome sequence data for a Maori population. Overall, these new data reveal novel mitochondrial genome signatures in this Polynesian population and enhance the phylogenetic picture of maternal ancestry in Oceania. The increased frequency of several mitochondrial coding variants makes them good candidates for future studies aimed at assessment of metabolic disease risk in Polynesian populations.
Content may be subject to copyright.
Complete Mitochondrial Genome Sequencing Reveals
Novel Haplotypes in a Polynesian Population
Miles Benton
1,3
, Donia Macartney-Coxson
2
, David Eccles
1,2
, Lyn Griffiths
3
, Geoff Chambers
1
, Rod Lea
2,3
*
1School of Biological Science, Victoria University of Wellington, New Zealand, 2Kenepuru Science Centre, Institute of Environmental Science and Research, Sand ringham ,
3
Abstract
The high risk of metabolic disease traits in Polynesians may be partly explained by elevated prevalence of genetic variants
involved in energy metabolism. The genetics of Polynesian populations has been shaped by island hoping migration events
which have possibly favoured thrifty genes. The aim of this study was to sequence the mitochondrial genome in a group of
Maoris in an effort to characterise genome variation in this Polynesian population for use in future disease association
studies. We sequenced the complete mitochondrial genomes of 20 non-admixed Maori subjects using Affymetrix
technology. DNA diversity analyses showed the Maori group exhibited reduced mitochondrial genome diversity compared
to other worldwide populations, which is consistent with historical bottleneck and founder effects. Global phylogenetic
analysis positioned these Maori subjects specifically within mitochondrial haplogroup - B4a1a1. Interestingly, we identified
several novel variants that collectively form new and unique Maori motifs – B4a1a1c, B4a1a1a3 and B4a1a1a5. Compared to
ancestral populations we observed an increased frequency of non-synonymous coding variants of several mitochondrial
genes in the Maori group, which may be a result of positive selection and/or genetic drift effects. In conclusion, this study
reports the first complete mitochondrial genome sequence data for a Maori population. Overall, these new data reveal
novel mitochondrial genome signatures in this Polynesian population and enhance the phylogenetic picture of maternal
ancestry in Oceania. The increased frequency of several mitochondrial coding variants makes them good candidates for
future studies aimed at assessment of metabolic disease risk in Polynesian populations.
Citation: Benton M, Macartney-Coxson D, Eccles D, Griffiths L, Chambers G, et al. (2012) Complete Mitochondrial Genome Sequencing Reveals Novel Haplotypes
in a Polynesian Population. PLoS ONE 7(4): e35026. doi:10.1371/journal.pone.0035026
Editor: Manfred Kayser, Erasmus University Medical Center, The Netherlands
Received September 26, 2011; Accepted March 11, 2012; Published April 13, 2012
Copyright: ß2012 Benton et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits
unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: This research was funded by the Wellington Health Research Council Grant #1387. The funders had no role in study design, data collection and
analysis, decision to publish, or preparation of the manuscript.
Competing Interests: The authors have declared that no competing interests exist.
* E-mail: r.lea@griffith.edu.au
Introduction
Scientific evidence from linguistics, archaeology and genetics
indicates that the Maori population of New Zealand (NZ) represents
the final link in a long chain of island-hopping voyages by
Polynesians, which began in Taiwan and stretched through
Melanesia and across the Pacific Islands over a period of 5–6000
years (Figure 1). Around 800 years ago one or more small groups of
voyagers arrived in NZ from Tahiti, via the Cook Islands. This event
marked the last of the great human migrations and the creation of an
isolated founder population. The widespread intermarriage between
Maoris and Europeans over the past 200 years (8–10 generations)
has introduced substantial European genomic ancestry (,40%) into
the contemporary Maori gene pool [1].
Maoris, and Polynesians more generally, are disproportionately
affected with certain metabolic disease traits eg. obesity and type 2
diabetes mellitus [2,3,4,5]. Given that these traits are partially
influenced by genetic factors it is likely that genes involved in
energy metabolism play a role in disease risk [6]. Mitochondrial
genes could potentially account for some of the high prevalence of
metabolic disease traits in Maoris. Coding variants in mitochon-
drial genes that exhibit unusually high frequencies in Maori may
have been driven to high frequency by positive selection due to
periods of feast and famine during the migrations (ie. thrifty genes)
[7]. Alternatively, these mitochondrial variants may have simply
increased in frequency in Maoris via genetic drift as a consequence
of repeated founder events and subsequent population bottlenecks.
Complete mitochondrial genome sequence data have been
previously investigated to elucidate the evolutionary history among
human populations around the world [8]. Studies have also
comprehensively investigated mitochondrial genome variation in
relation to metabolic syndrome traits [9,10]. However, no
complete mitochondrial genome surveys have involved a Maori
sample and Polynesians more generally have been under-
represented. Given the unusual maternal history of Maoris it is
likely that a unique mitochondrial genomic makeup exists in this
Polynesian subgroup. In this study we sequenced the entire
mitochondrial genome in a group of Maori individuals and
performed population genetic analyses to characterise the patterns
of genomic variation in this Polynesian population. These new
data provide the opportunity to enhance the phylogenetic picture
of the mitochondrial genome in the South Pacific region and
establish a foundation for future studies of mitochondrial DNA
and metabolic disease traits in Polynesian populations.
Results
Complete mtDNA sequences and genetic diversity
A summary of mitochondrial (mt) sequence variation for all 20
Maori mtDNA genomes is shown in Table 1. These sequences are
PLoS ONE | www.plosone.org 1 April 2012 | Volume 7 | Issue 4 | e35026
New Zealand, GenQomics Research Centre, Griffith Health Institute, Griffith University, QQueensland, Australia
Q
the only complete NZ Maori sequences currently available (at time
of writing). Previous studies have suggested that there is very
limited mtDNA variation in Polynesians in general, and even less
in Maori [11,12] and no Maori-specific genetic mtDNA markers
have yet been identified.
Sequence variation was identified by comparison against the
revised Cambridge Reference Sequence (CRS) [13], which
belongs to haplogroup H (commonly found in European peoples).
The mt sequence variation identified in the Maori individuals
differed from the CRS at 44 variable sites (see Table 1). Of these
variant sites, 22 were fixed in all 20 Maori individuals – these are
the defining markers of mitochondrial haplogroup B, and its
further substructure (haplotypes) such as B4a1a1, to which Maoris
belong. There were 12 singleton variants identified and a further
10 variants were shared by two or more individuals and define
subclades within the Maori mtDNA phylogeny.
The limited sequence variation was validated by calculation of h
and pdiversity statistics in DNAspV5 [14]. Table 2 shows the
amount of DNA sequence diversity of 189 complete mtDNA
sequences as well as diversity within each specific population. The
Maori group were found to exhibit high haplotype diversity
(h = 0.92), yet diversity was substantially lower than that seen in
any of the other three populations (see Table 2). When looking at
the nucleotide (p) diversity it can be seen that Maoris exhibit a
value 10-fold lower (p= 0.00018) compared to that of the other
populations. As expected there is no maternal European
admixture identified in this group. All mtDNA sequences are
clearly Polynesian (Maori) and show the characteristic, and well
documented, Polynesian Motif markers [15,16]: 16189, 16217,
16247, and 16261 (see Table 1).
Phylogenetic Analysis
Phylogenetic analysis of the Maori sequences in the software
mtPhy [17] confirmed that all 20 belong to haplogroup B. As
expected from previous studies of the Hyper Variable Region
(HVR) in Polynesians [11,12,15,18,19], these Maori sequences all
group deep within haplogroup B (for reference see Phylotree [20]).
To further investigate the sub-structure of haplogroup B a detailed
phylogeny was reconstructed to include 64 complete sequences
representing B4a (10 Asian, 14 Taiwanese, 4 Coastal PNG, 16
Pacific Islanders and 20 Maori). Figure 2 illustrates this tree
(Asian/Austronesian mt DNA sequences) and shows that all 20
Maori sequences group within B4a1a1, with Pacific Islander and
Coastal PNG (Melanesian) mt sequences. These groupings fit well
with previous mtDNA work [18,19,21,22,23,24], and complement
the hypothetical model of Polynesian origin stemming from
Taiwan [25]. Apart from the variants which define haplogroup B,
we have identified three novel Polynesian (Maori) haplotypes –
until now all documented Polynesian mt haplotypes have been
B4a1a1a. Table 3 displays the frequency and specific markers for
the haplotypes identified in the 20 complete Maori mt sequences.
The most interesting haplotype, B4a1a1a3 (unpublished data), was
recently included in an updated build of Phylotree (http://www.
phylotree.org/ [20]). This haplotype was present in 35% (n = 7) of
the individuals sequenced, and is defined by the variants 1185T
and 4769A.
Novel mt DNA sequence variants in Maori
This study has identified six novel (undocumented) mtDNA
variants in the Maori sample: five within protein coding regions
and one in the control region (see Table 4). An extended database
search of mtDB [26] and Mitomap [27] and for these variants
returned no hits, thus these positions are deemed to be novel. Two
variants result in amino acid sequence changes; 9255T (ProRSer)
and 15014C (PheRLeu). Apart from variant 3909T, the novel
variants were only noted in individuals and are not present in the
wider population and are thus probably sporadic, rather than
ancestral.
Figure 1. Map outlining migratory paths of Austronesian speaking populations, including estimated dates. Adapted from Bellwood et
al., (2011) [52].
doi:10.1371/journal.pone.0035026.g001
Mitochondrial Genome Variation in Polynesians
PLoS ONE | www.plosone.org 2 April 2012 | Volume 7 | Issue 4 | e35026
Table 1. Variation across 20 complete Maori mtDNA sequences.
HVRII 12SrRNA 16SrRNA ND1 ND2 COI ATP6
Position 73 146 151 263 750 1185 1438 1692 1806 2416 2706 3909 4769! 5465 6261 6719 6782 6905 7028 8860 8865 9123 9145
CRS
*
ATCAACAATTACATGT TACA GGG
mt3 GC.GGTG...G..C.C..TG .A.
mt6 GC. GG. G. . . G. GC. C . . T G . A.
mt8 GC.GGTG...G..C.C..TG .A.
mt9 GC. GG. G. . . GT GC. C . . T G . A.
mt10 GCT GG. GG. CG. GC. C . . T G . A.
mt11 GC. GG. G. . . G. GC. C. . T G AA .
mt12 GC. GG. G. . . G. GC. C. . T G AA .
mt13 GC. GGTG. . . G. . C. C. . T G . A.
mt14 GC. GGTG. . . G. . C. C. . T G . A.
mt16 GC. GG. G. . . G. GC. C. . T G . A.
mt18 GC. GG. G. . . G. GCAC . GT G . AA
mt19 GC. GG. G. . . GT GCAC . . T G . A.
mt21 GC. GG. G. . . GTGC . C. . T G . A.
mt23 GC. GG. G. . . G. GC. C. . T G . A.
mt24 GC. GG. G. . . G. GC. C. . T G . A.
mt25 GC. GGTG. . . G. . C. C. . T G . A.
mt26 GC. GG. G. . . G. GC. CC . T G . A.
mt28 GC. GGTG. . . G. . C. C. . T G . A.
mt29 GC. GGTG. CCG. . C . C. . T G . A.
mt30 GCT GG. GG. . G. GC. C. . T G . A.
n (variant) 20 20 2 20 20 7 20 2 1 2 20 3 13 20 2 20 1 1 20 20 2 20 1
Amino-acid
change
syn syn syn A120T syn syn syn syn T112A syn syn A207T
Conservation
Index
8 28 51 97 100 100 97 100 72 92 100 100
Protein Position 201 100 332 120 272 293 334 375 112 113 199 207
Mitochondrial Genome Variation in Polynesians
PLoS ONE | www.plosone.org 3 April 2012 | Volume 7 | Issue 4 | e35026
COIII ND3 ND4 S(AGY) ND5 Cyt b NC D-loop & HVRI
9255 9722 10238 11719 12239 14022 14766 15014 15326 15746 16051 16086 16126 16189 16217 16243 16247 16260 16261 16295 16519
CTTGCACTAAATTTTTACCCT
..CATGT. GG. . . CC. G. T.C
..CATGT. GG. . CCC. . . T.C
..CATGT. GG. . . CC. G. T.C
..CATGT. GG. . CCC. G. T.C
..CATGT. GG. . CCC. . . T.C
..CATGT. GG. . CCC. . . T.C
..CATGT. GG. . CCC. . . T.C
..CATGT. GG. . . CC. G. T+AC
..CATGT. GG. . . CC. G. T.C
..CATGTCGG. . . CC. GTT.C
..CATGT. GGGC. CC. G. T.C
..CATGT. GG. . CCC. G. T.C
..CATGT. GG. . CCC. . . T.C
..CATGT. GG. . CCC. . . T.C
..CATGT. GG. . CCC. G. T.C
..CATGT.GG...CC G.T.C
T.CATGT. GG. . . CCCG. T.C
..CATGT. GG. . . CC. G. T.C
.CCATGT. GG. . . CC. G. T.C
..CATGT. GG. . CCC. G. T.C
1 1 20 20 20 20 20 1 20 20 1 1 10 20 20 1 14 1 20 1 20
P17S syn syn syn syn T7I F90L T194A I334V
100 100 100 97 44 49 90 21 26
17 172 60 320 562 7 90 194 334
*CRS = Cambridge Reference Sequence, Boldface positions represent rare variants in the CRS. As per phylotree nomenclature, variants toward a base identical-to-state to the CRS are indicated with !
Table 1. Cont.
Mitochondrial Genome Variation in Polynesians
PLoS ONE | www.plosone.org 4 April 2012 | Volume 7 | Issue 4 | e35026
Mitochondrial gene variant frequencies in different
subpopulations
Estimated frequencies of variants within mitochondrial genes
were calculated for the NZ Maori as well as for European, Chinese
and Melanesian subgroups, selected because they are each
putative ancestral contributor populations of NZ Maori. Of the
13 mtDNA genes, the Maori mtDNA sequences contained
variable sites in 9 genes, the majority being population specific
polymorphisms (haplogroup B defining variants). There were 19
variants spread across these 9 genes, with COI,ATP6, and Cyt b
showing the largest number of variants among the ethnic
subgroups. The variant frequency differences between these four
groups are displayed in Table 5. Of particular interest in terms of
metabolic disease risk was the presence of non-synonymous
variants in COI,ATP6,COIII and Cyt b genes compared to the
ancestral subgroups. The most notable population specific
polymorphism, variant A15746G in Cyt b, was observed in all 20
Maori samples but was absent or rare in all ancestral subgroups
(Table 5). The rare variant, 4769A in ND2, is also of particular
interest for several reasons; 1) it is a rare polymorphism identified
in the CRS [13], yet it is identified at 35% (n =7) in the NZ Maori
cohort, and 2) alongside variant 1185T this variant forms a unique
Maori haplotype.
Discussion
This study provides the first complete mitochondrial sequence
data for a Polynesian (Maori) population, and as such allows a rare
opportunity to enhance the maternal phylogeny in Oceania as well
as explore the mitochondrial genome for potential metabolic risk
genes in Polynesians. Although sequence alignment of the Maori
mt genomes illustrated high concordance with other Polynesian mt
sequences, phylogenetic analysis was able to refine the haplotype
substructure of Polynesians. Specifically, Maori mt sequences were
deemed as belonging to major mt haplogroup B and formed sub
structures within the B4a1a1 ‘haplotype’. This analysis also
confirmed the presence of the 9-bp deletion and characteristic
control region variants which have become collectively know as
the ‘‘Polynesian motif’’ [15]. Identification of these Polynesian
informative sites is consistent with previous mt DNA studies in NZ
Maori [11,12].
It has been previously documented that Polynesian and central/
eastern Micronesian populations show reduced mtDNA diversity,
sharing high frequencies of the single mtDNA haplotype - B4a1a1
[23,28]. We explored the possibility of decreased mt sequence
diversity within the Maori population. Both haplotype (h) and
nucleotide diversity (p) were shown to be lower in Maori mt
genomes compared to putative ancestral populations. Nucleotide
diversity exhibited a 10-fold decrease when compared to three
ancestral populations. Evidence of such dramatically reduced
diversity of the mt genome in Maori is probably due to founder
effects during island hoping migrations and is supported by
previous studies [11,12]. It is perhaps not surprising that due to
Table 2. Estimated haplotype (h) and nucleotide (p) diversity.
Population
N
ind
N
haplo
hP
European 67 64 0.999 0.00145
Chinese 52 52 1.000 0.00186
Melanesian 50 48 0.998 0.00172
Maori 20 11 0.916 0.00018
All populations 189 174 0.999 0.00174
N
ind
(number of sequences),
N
haplo
(number of haplotypes), h(haplotype
diversity), p(nucleotide diversity).
doi:10.1371/journal.pone.0035026.t002
Figure 2. Phylogenetic reconstruction detailing haplogroup B4a1 in complete mtDNA sequences. This neighbour-joining tree was
created in MEGA4, using the Tamura-Nei substitution model. The sequences used were sourced from Trejaut et al. (2005), and include the 20
complete Maori mtDNA’s. Shown in red are the respective tribes of the Taiwanese Aboriginal sequences.
doi:10.1371/journal.pone.0035026.g002
Mitochondrial Genome Variation in Polynesians
PLoS ONE | www.plosone.org 5 April 2012 | Volume 7 | Issue 4 | e35026
this reduced mt genetic diversity no unique mtDNA haplotypes
have so far been discovered within the Maori population.
However, our complete mitochondrial genome scan revealed the
presence of at least 3 specific sub-haplotypes of haplogroup B in
Maori, which are derived from variants 1185T, 4769A, and
16126C. These three variants could have arisen in the seafaring
Polynesian ancestors of Maori, or they could have occurred more
recently, i.e. since the settlement of NZ. These variants form a
unique mt signature within this Maori population, one that is
worth exploring further in other NZ Maori populations to
determine its generalizability. As there is very little coding region
information available for other Polynesian mt sequences, with only
7 complete Polynesian sequences listed in mtDB [26], it is not
currently possible to determine whether these ‘signatures’ are
unique to Maori. They may in fact be present, but as yet
undetected, in the broader Polynesian population. Nevertheless,
these new findings provide a more specific mt ancestry informative
marker for future genetic studies involving Maori subjects.
Our results also indicate that the protein coding regions within
the mitochondrial genome for the populations of Island Southeast
Asia, Coastal Melanesia (PNG), Polynesia, and NZ Maori, which
are all mt haplogroup B, are heavily conserved and have not
changed much over the ,5000 years since the suggested
movement from Taiwan. The presence of population specific
polymorphisms consistent with those previously identified in
haplogroup B was confirmed via comparison across four putative
ancestral populations. There was one coding variant (4769A) that
is not a haplogroup B defining marker which showed increased
frequency in the NZ Maori group, although further work is
require to accurately confirm it’s prevalence in the wider
Polynesian community. The lack of coding variation is most likely
attributed to genetic drift attributed to the rapid expansion and
migration of Austronesian peoples from Taiwan throughout
Oceania in the last ,5000 years [25,29]. Regardless, our findings
make these variants good candidates for future genetic association
studies of metabolic disease in Maori populations.
Disease association with specific mtDNA variants has been
previously noted for several metabolic traits, including; type-2
diabetes (T2D) [30,31,32,33,34], insulin resistance [35,36,37], and
BMI/fat mass [10,33,38]. One specific mtDNA variant, 16189C –
a fundamental haplogroup B variant, has previously been
identified to associate with T2D, insulin resistance and BMI in
separate studies [30,33,34,36,38]. Whether the variant itself is the
cause of the association, or simply a marker for the larger
haplotype/signature or in linkage with other causal variants
located in the nuclear genome is yet to be seen.
In conclusion, this study reports the first complete mitochon-
drial genome sequence data for a Maori population. Overall, these
new data reveal unique mitochondrial genome characteristics in
this Polynesian population and enhance the phylogenetic picture
of maternal ancestry in Oceania. The presence of several newly
identified novel variants, as well as the presence of previously
identified disease associated variants, offers plausible candidates
for future studies aimed at assessment of metabolic disease risk in
Polynesian populations.
Materials and Methods
Samples
This project is part of the Rakaipaaka Health and Ancestry
Study (RHAS) which is aimed at identifying the genetic and
environmental determinants of health in the indigenous Maori
tribe (iwi) – Ngati Rakaipaaka. Being a DNA-based genetic study
involving indigenous Maori participants the RHAS has taken
several years to develop in terms of ethical and cultural approval.
The RHAS is governed by Te Iwi o Rakaipaaka (TIORI) in
Table 3. RHAS Maori mt DNA haplotype markers.
Haplotype
f
1185 4769 14022 16126 16189 16217 16247 16261
B4a1a1c
##
6.GGCCC. T
B4a1a1a
*
3. G G . C C G T
B4a1a1a3
##
7T . G . C C G T
B4a1a1a5
##
4.GGCCCGT
*Previously reported Polynesian mt DNA haplotype.
##
Novel Polynesian (Maori) haplotypes, numbered following Phylotree nomenclature. B4a1a1a3 was included in a recent update to Phylotree. Variants to the CRS are
indicated.
doi:10.1371/journal.pone.0035026.t003
Table 4. Novel mtDNA variants observed in 20 Maori individuals.
Gene Nucleotide Change Protein Change No. Individuals Percentage
16SrRNA m.1806T.C NA 1 (20) 5
ND1 m.3909C.T Syn 3 (20) 15
COXI m.6782T.C Syn 1 (20) 5
COXIII m.9255C.T p.MT-COXIII:Pro17Ser 1 (20) 5
Cyt b m.15014T.C p.MT-Cyt b:Phe90Leu 1 (20) 5
HVRI
*
m.16295C insA NA 1 (20) 5
*HVRI is non-coding. NA, not applicable; 16SrRNA, 16S ribosomal RNA; ND1, NADH dehydrogenase subunit 1; COXI, cytochrome c oxidase I; COXIII, cytochrome c
oxidase III; Cyt b, cytochrome b; HVRI, hyper variable region I.
doi:10.1371/journal.pone.0035026.t004
Mitochondrial Genome Variation in Polynesians
PLoS ONE | www.plosone.org 6 April 2012 | Volume 7 | Issue 4 | e35026
Nuhaka and has received full ethical approval from the Multi-
regional ethics committee of New Zealand (MEC/05/12/174). All
individuals involved signed a consent form acknowledging they
understood the genetic nature of this health research and wished
to participate. For this mitochondrial project we selected a
subsample of 20 adult individuals who were deemed to be non-
admixed (ie. have full Maori ancestry). This was determined by the
individual self-reporting that they had four Maori grandparents.
Genomic DNA was isolated with the use of commercial kits
(FlexiGene – QIAGEN). Polynesian mt DNA ancestry was
validated using the previously documented ‘‘Polynesian motif’’[15]
(9-bp deletion plus three control region SNPs), which was found to
be present in all 20 DNA(unpublished data).
mtDNA sequencing of 20 Maori individuals
Complete mitochondrial DNA sequence information was
obtained for the 20 Maori individuals using the Mitochip
Resequencing Array [39]. The Mitochip Resequencing protocol
(Affymetrix, Santa Clara, CA) laid out by Affymetrix was followed
(Affymetrix GeneChip CustomSeq Resequencing Array Protocol
version 2.1.), and the chips were run on Affymetrix GeneChip
equipment (GeneChip Hybridization Oven, GeneChip Fluidics
Station, and GeneChip Scanner 3000). The raw data files were
analysed using the GeneChip Sequence Analysis Software 4.1
(GSEQ 4.1). Complete mtDNA sequences were exported from
GSEQ4.1 and aligned against the revised Cambridge Reference
Sequence [13] (CRS) in MEGA4.1 [40]. All sequence data has
been submitted to GenBank (awaiting Accession numbers).
Sequence analysis and mtDNA diversity
Aligned sequences were exported as FASTA files from
MEGA4.1, these were then entered into the program mtPhyl
[17], where sequence haplotypes and sequence variation statistics
were calculated. The mtPhyl software also reported information
regarding changes in amino acids and respective position and
conservation of these changes. Mitochondrial DNA diversity
calculations were performed in DNAspV5 [14] on groups of
sequences from four different ethnic populations; European
(n = 101) [8,41,42,43,44], Chinese (n = 52) [42,43,45,46], Mela-
nesian (n = 56) [24,42,47,48], and NZ Maori (n = 20). European,
Chinese and Melanesian sequences were obtained from the
databases mtDB [26] and PhyloTree [20]. Haplotype (h) and
nucleotide (p) diversity statistics were calculated in each ethnic
group, as well as in the total sample (all sequences pooled
together).
Phylogeny reconstruction
A consensus neighbour joining tree showing the detail of sub-
branching patterns within haplogroup B was reconstructed for a
total of 64 complete mitochondrial sequences; all 20 Maori
sequences and 44 mitochondrial sequences (Austronesian, Coastal
Melanesian and Oceania) obtained from previous studies
[25,32,47,49,50]. The phylogeny was constructed in MEGA4.1
[51] using the Tamura-Nei method and a bootstrap of 500
replicates.
Novel variants and ‘global’ variant frequencies
Observed mtDNA variants in the Maori sequences were
searched against known electronic databases (mtDB [26] and
mitomap [27]) to identify potential unreported (novel) DNA
sequence variants. Identification of possible thrifty genes in Maori
involved comparing mitochondrial gene variant frequencies
between candidate ancestral populations: European, Chinese
(Asian), Melanesian. Sequences were aligned in MEGA4.1 and
variant frequencies between population groups were calculated.
Author Contributions
Conceived and designed the experiments: RL. Performed the experiments:
RL MB DM. Analyzed the data: MB DE. Contributed reagents/
materials/analysis tools: GC DM. Wrote the paper: MB RL DM LG.
References
1. Lea RA, Chambers GK (2007) Pharmacogenetics in Admixed Polynesian
Populations. Chapter in Pharmacogenetics and Admixed populations Edited by:
Guilherme Suarez-Kurtz Eureka Bioscience Database (ISBN: 1-58706-130-9).
2. Ministry of Health (2008) A Portrait of Health: Key Results of the 2006/2007
New Zealand Health Survey. Wellington: Ministry of Health.
3. Dowse GK, Zimmet PZ, Finch CF, Collins VR (1991) Decline in Incidence of
Epidemic Glucose Intolerance in Nauruans: Implications for the ‘‘Thrifty
Genotype’’. American Journal of Epidemiology 133: 1093–1104.
4. Zimmet P, Dowse G, Finch C, Serjeantson S, King H (1990) The epidemiology
and natural history of niddm–lessons from the South Pacific. Diabetes/
Metabolism Reviews 6: 91–124.
5. Zimmet P, Taft P, Guinea A, Guthrie W, Thoma K (1977) The high prevalence
of diabetes mellitus on a Central Pacific island. Diabetologia 13: 111–115.
6. O’Rahilly S (2009) Human genetics illuminates the paths to metabolic disease.
Nature 462: 307–314.
7. Neel JV (1962) Diabetes Mellitus - A thrifty genotype rendered detrimental by
progress. American Journal of Human Genetics 14: 353–362.
8. Mishmar D, Ruiz-Pesini E, Golik P, Macaulay V, Clark AG, et al. (2003)
Natural selection shaped regional mtDNA variation in humans. Proceedings of
the National Academy of Sciences of the United States of America 100:
171–176.
Table 5. mtDNA coding variant frequencies in four human
populations.
Rare allele frequency
*
Gene Variant European Chinese Melanesian Maori
(n = 101) (n = 52) (n = 56) (n = 20)
ND1 C3909T 0 0 0 0.15
ND2 G4769A 0.01 0 0 0.35
T5465C 0 0 0.16 1
COI G6261A 0.01 0 0 0.10
T6719C 0 0 0.16 1
T6782C 0 0 0 0.05
A6905G 0 0 0.04 0.05
C7028T 0.63 1 0.98 1
ATP6 G8865A 0 0 0.02 0.10
G9123A 0 0 0.016 1
G9145A 0 0 0 0.05
COIII C9255T 0 0 0 0.05
T9722C 0 0 0 0.05
ND3 T10238C 0.03 0 0.16 1
ND4 G11719A 0.56 1 1 1
ND5 A14022G 0 0 0.14 1
Cyt b C14766T 0.57 1 1 1
T15014C 0 0 0 0.05
A15746G 0 0 0.16 1
*compared to CRS.
doi:10.1371/journal.pone.0035026.t005
Mitochondrial Genome Variation in Polynesians
PLoS ONE | www.plosone.org 7 April 2012 | Volume 7 | Issue 4 | e35026
9. Saxena R, de Bakker PIW, Singer K, Mootha V, Burtt N, et al. (2006)
Comprehensive Association Testing of Common Mitochondrial DNA Variation
in Metabolic Disease. The American Journal of Human Genetics 79: 54–61.
10. Yang T-L, Guo Y, Shen H, Lei S-F, Liu Y-J, et al. (2 011) Genetic Association
Study of Common Mitochondrial Variants on Body Fat Mass. PLoS ONE 6:
e21595.
11. Murray-Mcintosh RP, Scrimshaw BJ, Hatfield PJ, Penny D (1998) Testing
migration patterns and estimating founding population size in Polynesia by using
human mtDNA sequences. Proceedings of the National Academy of Sciences of
the United States of America 95: 9047–9052.
12. Whyte ALH, Marshall SJ, Chambers GK (2005) Human evolution in Polynesia.
Human Biology 77: 157–177.
13. Andrews RM, Kubacka I, Chinnery PF, Lightowlers RN, Turnbull DM, et al.
(1999) Reanalysis and revision of the Cambridge reference sequence for human
mitochondrial DNA. Nature Genetics 23: 147–147.
14. Librado P, Rozas J (2009) DnaSP v5: a software for comprehen sive analysis of
DNA polymorphism data. Bioinformatics 25: 1451–1452.
15. Redd A, Takezake JN, Sherry ST (1995) Evolutionary history of the COII/
tRNA lys intergenic 9 base pair deletion in human mitochondrial DNAs from
the Pacific. Molecular Biology and Evolution 12: 604–615.
16. Melton T, Peterson R, Redd AJ, Saha N, Sofro ASM, et al. (1995) Polynesian
Genetic Affinities with Southeast Asian Populations as Identified by mtDNA
Analysis. The American Society of Human Genetics 57: 403–414.
17. Eltsov N, Volodko N (2009) mtPhyl - software tool for human mtDNA analysis
and phylogeny reconstruction.
18. Lum JK, Rickards O, Ching C, Cann RL (1994) Polynesian mitochondrial
DNAs reveal three deep maternal lineage clusters. Human Biology 66: 567(524).
19. Sykes B, Leiboff A, Lowbeer J, Tetzner S, Richards M (1995) The origins of the
Polynesians - An interpretation from mitochondrial lineage analysis. American
Journal of Human Genetics 57: 1463–1475.
20. van Oven M, Kayser M (2009) Updated comprehensive phylogenetic tree of
global human mitochondrial DNA variation. Human Mutation 30: E386–E394.
21. Hertzberg M, Mickleson KN, Serjeantson SW, et al. (1989) An Asian-specific 9-
bp deletion of mitochondrial DNA is frequently found in Polynesians. American
Journal of Human Genetics. pp 504–510.
22. Hagelberg E, Clegg JB (1993) Genetic Polymorphisms in Prehistoric Pacific
Islanders Determined by Analysis of Ancient Bone DNA. Proceedings of the
Royal Society of London Series B: Biological Sciences 252: 163–170.
23. Lum JK, Cann RL (1998) mtDNA and Language Supp ort a Common Origin of
Micronesians and Polynesians in Island Southeast Asia. American Journal of
Physical Anthropology 105: 109–119.
24. Pierson MJ, Martinez-Arias R, Holland BR, Gemmell NJ, Hurles ME, et al.
(2006) Deciphering Past Human Population Movements in Oceania: Provably
Optimal Trees of 127 mtDNA Genomes. Society for Molecular Biology and
Evolution.
25. Trejaut JA, Kivisild T, Loo JH, Lee CL, He CL, et al. (2005) Traces of archaic
mitochondrial lineages persist in Austronesian-speaking Formosan populations.
PLoS Biology 3: 1–11.
26. Ingman M, Gyllensten U (2006) mtDB: Human Mitochondrial Genome
Database, a resource for population genetics and medical sciences. Nucleic Acids
Research 34: D749–D751.
27. Ruiz-Pesini E, Lott MT, Procaccio V, Poole J, Brandon MC, Mishmar D, Yi C,
Kreuziger J, Baldi P, Wallace CD (2007) An enhanced MITOMAP with a
global mtDNA mutational phylogeny. Nucleic Acids Research 35 (Database
issue):D823–D828.
28. Lum JK, Cann RL (2000) mtDNA Lineage Analyses: Origins and Migrations of
Micronesians and Polynesians. American Journal of Physical Anthropology 113:
151–168.
29. Tabbada KA, Trejaut J, Loo J-H, Chen Y-M, Lin M, et al. (2010) Philippine
Mitochondrial DNA Diversity: A Populated Viaduct between Taiwan and
Indonesia? Molecular Biology and Evolution 27: 21–31.
30. Bhat A, Koul A, Sharma S, Rai E, Bukhari SIA, et al. (2007) The possible role of
10398A and 16189C mtDNA variants in providing susceptibility toT2DM in
two North Indian populations: a replicative study. Human Genetics 120:
821–826.
31. Chinnery PF, Mowbray C, Patel SK, Elson JL, Sampson M, et al. (2007)
Mitochondrial DNA haplogroups and type 2 diabetes: a study of 897 cases and
1010 controls. Journal of Medical Genetics 44.
32. Guo LJ, Oshida Y, Fuku N, Takeyasu T, Fujita Y, et al. (2005) Mitochondrial
genome polymorphisms associated with type-2 diabetes or obesity. Mitochon-
drion 5: 15–33.
33. Liou CW, Lin TK, Weng HH, Lee CF, Chen TL, et al. (2007) A common
mitochondrial DNA variant and increased body mass index as associated factors
for development of type 2 diabetes: Additive effects of genetic and environmental
factors. Journal of Clinical Endocrinology and Metabolism 92: 235–239.
34. Mohlk e KL, Jackson AU, Scot t LJ, Peck EC, Suh YD, et al. (2005)
Mitochondrial polymorphisms and susceptibility to type 2 diabetes-related traits
in Finns. Human Genetics 118: 245–254.
35. Poulton J, Bednarz AL, Scott-Brown M, Thomps on C, Macaulay VA, et al.
(2002) The presence of a common mitochondrial DNA variant is associated with
fasting insulin levels in Europeans in Auckland. Diabetic Medicine 19: 969–971.
36. Poulton J, Brown MS, Cooper A, Marchington DR, Phillips DIW (1998) A
common mitochondrial DNA variant is associated with insulin resistance in
adult life. Diabetologia 41: 54–58.
37. Maechler P, de Andrade PBM (2006) Mitochondrial damages and the regulation
of insulin secretion. Biochemical Society Transactions 34: 824–827.
38. Kim JH, Park KS, Cho YM, Kang BS, Kim SK, et al. (2002) The prevalence of
the mitochondrial DNA 16189 variant in non-diabetic Korean adults and its
association with higher fasting glucose and body mass index. Diabetic Medicine
19: 681–684.
39. Maitra A, Cohen Y, Gillespie SED, Mambo E, Fukushima N, et al. (2004) The
Human MitoChip: a high-throughput sequencing microarray for mitochondrial
mutation detection. Genome Research 14: 812–819.
40. Kumar S, Nei M, Dudley J, Tamura K (2008) MEGA: A biologist-centric
software for evolutionary analysis of DNA and protein sequences. Briefings in
Bioinformatics 9: 299–306.
41. Achilli A, Rengo C, Magri C, Battaglia V, Olivieri A, et al. (2004) The
Molecular Dissection of mtDNA Haplogroup H Confirms That the Franco-
Cantabrian Glacial Refuge Was a Major Source for the European Gene Pool.
The American Journal of Human Genetics 75: 910–918.
42. Ingman M, Kaessmann H, Paabo S, Gyllensten U (2000) Mitochondrial genome
variation and the origin of modern humans. Nature 408: 708–713.
43. Kivisild T, Shen P, Wall DP, Do B, Sung R, et al. (2006) The Role of Selection
in the Evolution of Human Mitochondrial Genomes. Genetics 172: 373–387.
44. Moilanen JS, Finnila S, Majamaa K (2003) Lineage-specific selection in human
mtDNA: Lack of polymorphisms in a segment of MTND5 gene in haplogroup J.
Molecular Biology and Evolution 20: 2132–2142.
45. Kong Q-P, Yao Y-G, Sun C, Bandelt H-J, Zhu C-L, et al. (2003) Phylogeny of
East Asian Mitochondrial DNA Lineages Inferred from Complete Sequences.
American Journal of Human Genetics 73: 671–676.
46. Macaulay V, Hill C, Achilli A, Rengo C, Clarke D (2005) Single, Rapid Coastal
Settlement of Asia Revealed by Analysis of Complete Mitochondrial Genomes.
Science 308: 1034–1036.
47. Ingman M, Gyllensten U (2003) Mitoch ondrial Genome Variatio n and
Evolutionary History of Australian and New Guinean Aborigines. Genome
Research 13: 1600–1606.
48. Merriwether DA, Hodgson JA, Friedlaender FR, Allaby R, Cerchio S, et al.
(2005) Ancient mitochondrial M haplogroups identified in the Southwest Pacific.
Proceedings of the National Academy of Sciences of the United States of
America 102: 13034–13039.
49. Soares P, Rito T, Trejaut J, Mormina M, Hill C, et al. (2011) Ancient Voyaging
and Polynesian Origins. The American Journal of Human Genetics 88:
239–247.
50. Ingman M, Gyllensten U (2001) Analysis of the Complete Human mtDNA
Genome: Methodology and Inferences for Human Evolution. The American
Genetic Association 92: 454–461.
51. Tamura K, Dudley J, Nei M, Kumar S (2007) MEGA4: Molecular Evolutionary
Genetics Analysis (MEGA) software version 4.0. Molecular Biology and
Evolution10.1093/molbev/msm092.
52. Bellwood P, Chambers G, Ross M, Hung H-c (2011) Are ‘Cultures’ Inherited?
Multidisciplinary Perspectives on the Origins and Migrations of Austronesian-
Speaking Peoples Prior to 1000 BC. In: Roberts BW, Vander Linden M, eds.
Investigating Archaeological Cultures: Springer New York. pp 321–354.
Mitochondrial Genome Variation in Polynesians
PLoS ONE | www.plosone.org 8 April 2012 | Volume 7 | Issue 4 | e35026
... A general overview of Austronesian population movements. This global map was developed from one first shown in Bellwood et al. (2011) and is taken from Benton et al. (2012). It shows the global spread of Austronesian people with routes and dates as known at that time. ...
Article
Full-text available
The Austronesian Diaspora is a 5,000-year account of how a small group of Taiwanese farmers expanded to occupy territories reaching halfway around the world. Reconstructing their detailed history has spawned many academic contests across many disciplines. An outline orthodox version has eventually emerged but still leaves many unanswered questions. The remarkable power of whole-genome technology has now been applied to people across the entire region. This review gives an account of this era of genetic investigation and discusses its many achievements, including revelation in detail of many unexpected patterns of population movement and the significance of this information for medical genetics.
... A general overview of Austronesian population movements. This global map was developed from one first shown inBellwood et al. (2011) is taken fromBenton et al. (2012).It shows the global spread of Austronesian people with routes and dates as known at that time. Its purpose is to present a picture of the 5000-year expansion of Austronesian-speaking people from a focal origin in mainland south east Asia to Madagascar in the west to Columbia in the east. ...
Article
The Austronesian Diaspora is a 5000-year account of how a small group of Taiwanese farmers expanded to occupy territories reaching halfway round the world. Reconstructing their detailed history has spawned many academic contests across many disciplines. An outline orthodox version has eventually emerged, but still leaves many unanswered questions. The remarkable power of whole-genome technology has now been applied to people across the entire region. This review gives an account of this era of genetic investigation and discusses its many achievements including revelation in detail of many unexpected patterns of population movement and the significance of this information for medical genetics.
... To investigate the phylogenetic relationships between the mitogenomes of the ancient and modern Tokelauans, we obtained other publicly available Pacific mitochondrial sequences from GenBank (Duggan et al. 2014;Duggan and Stoneking 2013;Benton et al. 2012;Hudjashov et al. 2018;Brandão et al. 2016) (See Supplemental Table 6). These data include sequences from West Polynesia (Tuvalu, Niue, Tonga, Samoa), East Polynesia (Cook Islands, Leeward Society Islands, and New Zealand), Northern Polynesian Outliers (Ontong Java, Bellona, Rennell, and Tikopia) and Micronesia (Kiribati, Nauru, Kapingamarangi, and Majuro). ...
Article
Full-text available
Tokelau is a remote archipelago of atolls in western Polynesia, located approximately 500 km north of Samoa. It is thought to have been settled as part of the Austronesian expansion(s). However, its exact role in this population dispersal is not completely understood. Here we describe the results of complete mitochondrial genome sequencing for both the current inhabitants and ancient individuals from the archipelago in addition to an assessment of Y-chromosome diversity among the present population. We find relatively little genetic diversity compared with other western Polynesian populations, most likely due to historically reported bottleneck events. However, the presence of rare mitochondrial lineages hints at prehistoric occupation by peoples from the northwest (e.g., Tuvalu and Micronesia). Ancient DNA data from Atafu, the northernmost Tokelauan atoll, is further consistent with abandonment and later resettlement of the island from a Samoan or Samoan-derived source population. Moreover, the ancient and modern mitogenomes also suggest links with other atoll populations in the western Pacific.
... Dental samples and SHSU bone samples were amplified at 100 pg inputs; PSU bone samples were amplified at~8000 mtDNA copies. Hair and buccal swabs were extracted with PrepFiler forensic DNA extraction kit (Thermo Fisher, Waltham, MA, USA), and the protocol described by Gallimore et al. was followed for hair samples [33]. ...
Article
Full-text available
Forensic mitochondrial DNA (mtDNA) analysis conducted using next-generation sequencing (NGS), also known as massively parallel sequencing (MPS), as compared to Sanger-type sequencing brings modern advantages, such as deep coverage per base (herein referred to as read depth per base pair (bp)), simultaneous sequencing of multiple samples (libraries) and increased operational efficiencies. This report describes the design and developmental validation, according to forensic quality assurance standards, of end-to-end workflows for two multiplexes, comprised of ForenSeq mtDNA control region and mtDNA whole-genome kits the MiSeq FGxTM instrument and ForenSeq universal analysis software (UAS) 2.0/2.1. Polymerase chain reaction (PCR) enrichment and a tiled amplicon approach target small, overlapping amplicons (60–150 bp and 60–209 bp for the control region and mtGenome, respectively). The system provides convenient access to data files that can be used outside of the UAS if desired. Studies assessed a range of environmental and situational variables, including but not limited to buccal samples, rootless hairs, dental and skeletal remains, concordance of control region typing between the two multiplexes and as compared to orthogonal data, assorted sensitivity studies, two-person DNA mixtures and PCR-based performance testing. Limitations of the system and implementation considerations are discussed. Data indicated that the two mtDNA multiplexes, MiSeq FGx and ForenSeq software, meet or exceed forensic DNA quality assurance (QA) guidelines with robust, reproducible performance on samples of various quantities and qualities.
Conference Paper
Full-text available
The regions of Oceania have long been an interesting place of study for academics. Fiji, which is positioned at the center of the Oceanic world, has been in a unique position and intrigued researchers from all fields. Although there is a substantial amount of literature that has been and continues to be done, there are not many cross-disciplinary conversations about the various studies being done. All too often the works of archaeologists' dip into historical linguistics, or that geneticists utilize archaeological materials to support their claims, but the level of interaction stops there. This paper will attempt to bridge this gap by involving many of the different studies being done on the Fijian islands. And by doing so, it will aim to uncover how the Fijian peoples came to be. By analyzing the various linguistic, anthropological, ethnoarchaeological, archaeological, archaeobotanical, zooarchaeological, and genetic studies done in Fiji and the greater Oceanic region, we can begin to take steps in forming the holistic story of the Fijians.
Article
Full-text available
Our exploration of the genetic constitution of Nuku Hiva (n = 51), Hiva Oa (n = 28) and Tahuata (n = 8) of the Marquesas Archipelago based on the analyses of genome-wide autosomal markers as well as high-resolution genotyping of paternal and maternal lineages provides us with information on the origins and settlement of these islands at the fringe of the Austronesian expansion. One widespread theme that emerges from this study is the genetic uniformity and relative isolation exhibited by the Marquesas and Society populations. This genetic homogeneity within East Polynesia groups is reflected in their limited average heterozygosity, uniformity of constituents in the Structure analyses, reiteration of complete mtDNA sequences, marked separation from Asian and other Oceanic populations in the PC analyses, limited differentiation in the PCAs and large number of IBD segments in common. Both the f3 and the Outgroup f3 results provide indications of intra-East Polynesian gene flow that may have promoted the observed intra-East Polynesia genetic homogeneity while ALDER analyses indicate that East Polynesia experienced two gene flow episodes, one relatively recent from Europe that coincides roughly with the European incursion into the region and an early one that may represent the original settlement of the islands by Austronesians. Median Network analysis based on high-resolution Y-STR loci under C2a-M208 generates a star-like topology with East Polynesian groups (especially from the Society Archipelago) in central stem positions and individuals from the different populations radiating out one mutational step away while several Samoan and outlier individuals occupy peripheral positions. This arrangement of populations is congruent with dispersals of C2a-M208 Y chromosomes from East Polynesia as a migration hub signaling dispersals in various directions. The equivalent ages of the C2a-M208 lineage of the populations in the Network corroborate an east to west flow of the most abundant Polynesian Y chromosome.
Book
Discovering World Prehistory introduces the general field of archaeology and highlights for students the difference between obtaining data (basic archaeology) and interpreting those data into a prehistory, a coherent model of the past.
Article
Introduction The present-day Zoroastrian-Parsis have roots in ancient pastoralist migrations from circumpolar regions leading to their settlement on the Eurasian Steppes and later, as Indo-Iranians in the Fertile Crescent. After migrating from the Persian province of Pars to India, the Zoroastrians from Pars (“Parsis”) practiced endogamy, thereby preserving their genetic identity and social practices. The study was undertaken to gain an insight into the genetic consequences of migration on the community, the practice of endogamy, to decipher the phylogenetic relationships with other groups, and elucidate the disease linkages to their individual haplotypes. Results We generated the de novo the Zoroastrian-Parsi Mitochondrial Reference Genome (AGENOME-ZPMS-HV2a-1), which is the first complete mitochondrial reference genome assembled for this group. Phylogenetic analysis of an additional 99 Parsi mitochondrial genome sequences showed the presence of HV, U, T, A and F (belonging to the macrohaplogroup N) and Z and other M descendents of the macrohaplogroup M (M5, M39, M33, M44’52, M24, M3, M30, M2, M4’30, M2, M35 and M27) and a largely Persian origin for the Parsi community. We assembled individual reference genomes for each major haplogroup and the Zoroastrian-Parsi Mitochondrial Consensus Genome (AGENOME-ZPMCG V1.0), which is the first consensus genome assembled for this group. We report the existence of 420 mitochondrial genetic variants, including 12 unique variants, in the 100 Zoroastrian-Parsi mitochondrial genome sequences. Disease association mapping showed 217 unique variants linked to longevity and 41 longevity-associated disease phenotypes across the majority of haplogroups. Conclusions Analysis of the coding genes, tRNA genes, and the D-loop region revealed haplogroup-specific disease associations for Parkinson's disease, Alzheimer's disease, cancers, and rare diseases. No known mutations linked to lung cancer were found in our study. Mutational signatures linked to tobacco carcinogens, specifically, the C > A and G > T transitions, were observed at extremely low frequencies in the Parsi cohort, suggestive of an association between the cultural norm prohibiting smoking and its reflection in the genetic signatures. In sum, the Parsi mitochondrial genome provides an exceptional resource for determining details of their migration and uncovering novel genetic signatures for wellness and disease.
Article
The use of mitochondrial DNA (mtDNA) profiling as a tool for forming a link between an individual and a crime sample is a well‐established forensic biology technique. Though nuclear DNA typing is considered the gold standard method, certain evidence types have limited nuclear DNA available, such as telogen hairs and ancient or degraded remains, for which mtDNA analysis may be required. Traditionally mtDNA typing has been carried out using Sanger type sequencing, which is labor, time, and cost intensive. This has restricted the analysis of the mitochondrial genome to the control region, limiting the discrimination power of the technique. The introduction of massively parallel sequencing (MPS) into forensic laboratories has brought about the ability to analyze the whole mitochondrial genome of forensically relevant samples. The use of MPS for mtDNA analysis has resulted in an increase in the range of methods available for analysis, including: midi‐ and mini‐sized amplification strategies for whole genome analysis of casework‐type samples; whole genome single nucleotide polymorphism (SNP) multiplexes; and DNA capture methods allowing the analysis of highly degraded remains. The resulting increase in discriminatory power and the continued progression of the technology and associated methods increase its appeal as a DNA analysis method and may facilitate its implementation as a routinely used forensic tool. Here, we give an overview of current laboratory practices for the analysis of mtDNA using MPS. This article is categorized under: • Forensic Biology > Haploid Markers • Forensic Biology > Forensic DNA Technologies
Chapter
Full-text available
This paper provides the first complete overview of human leukocyte antigen (HLA) variation across Austronesian populations as a whole and includes the effects of admixture along the migration path during their 5,000 year diaspora. We show that intermarriage has shifted allele frequencies in migrant peoples from those found in their original pure Austronesian stock (Taiwanese natives) towards those populations with
Chapter
Full-text available
Collectively, the islands of the remote Pacific Ocean form the last geographic region on earth to be colonised by humans. The region is known as Polynesia and is defined by a triangular boundary joining, Hawaii in the North, Easter Island in The East and New Zealand in the South. Polynesia contains many island populations each with a farcinatin generic history that has been shaped by unique evolutionary Forces. Such forces have created substantial population differences in generic variation which may explain, at least in part, the variable disease and drug response characteristics of Polynesian populations. This chapter summarises some of the gcneric research that 11as been conductcd in the largest Polynesian population-The Maori of New Zealand-including measurements of genetic admixture and studics of drug metabolismg genes and drug response traits.
Chapter
Full-text available
This chapter examines the evidence for the movement of Austronesian-speaking peoples from Taiwan into the Philippines and beyond, drawing upon data from comparative linguistics, archaeology and genetics. The chronological focus is mainly on the period between 2500 and 1000 bc. These three disciplines in combination make a migration of Austronesian-speaking communities a more likely conclusion than independent movements of languages, genes and items of material culture. This implies that a non-exclusive cultural tradition that can be defined archaeologically was transmitted through space and time via inheritance, and render insufficient all explanations for Austronesian patterning that are based entirely on interaction models without migration.
Article
Full-text available
Based on the mtDNA first hypervariable segment sequence variation data, statistical analysis of the diversity in Yukaghirs in comparison with the other indigenous populations of Siberia, was carried out. The level of the Yukaghir mtDNA gene diversity (GD) constituted 0.920, which was only slightly different from the corresponding estimate for the other Siberian populations. Integral estimates of the genetic structure of Siberian populations (k, S, θ S , and π) are presented. Phylogenetic analysis, performed using the neighbor-joining method, showed that the Siberian populations clustered irrespectively to their language affiliation. Negative F s values found in Yukaghirs pointed to the possible influence of adaptive selection.
Article
Full-text available
Mitochondria play a central role in ATP production and energy metabolism. Previous studies suggest that common variants in mtDNA are associated with several common complex diseases, including obesity. To test the hypothesis that common mtDNA variants influence obesity-related phenotypes, including BMI and body fat mass, we genotyped a total of 445 mtSNPs across the whole mitochondrial genome in a large sample of 2,286 unrelated Caucasian subjects. 72 of these 445 mtSNPs passed quality control criteria, and were used for subsequent analyses. We also classified all subjects into nine common European haplogroups. Association analyses were conducted for both BMI and body fat mass with single mtSNPs and mtDNA haplogroups. Two mtSNPs, mt4823 and mt8873 were detected to be significantly associated with body fat mass, with adjusted P values of 4.94 × 10⁻³ and 4.58 × 10⁻², respectively. The minor alleles mt4823 C and mt8873 A were associated with reduced fat mass values and the effect size (β) was estimated to be 3.52 and 3.18, respectively. These two mtSNPs also achieved nominally significant levels for association with BMI. For haplogroup analyses, we found that haplogroup X was strongly associated with both BMI (adjusted P = 8.31 × 10⁻³) and body fat mass (adjusted P = 5.67×10⁻⁴) Subjects classified as haplogroup X had lower BMI and fat mass values, with the β estimated to be 2.86 and 6.03, respectively. Our findings suggest that common variants in mitochondria might play a role in variations of body fat mass. Further molecular and functional studies will be needed to clarify the potential mechanism.
Article
Full-text available
Mitochondrial DNA is maternally inherited. Mitochondrial DNA mutations could contribute to the excess of maternal over paternal inheritance of non-insulin-dependent diabetes mellitus (NIDDM). We therefore investigated the relationship between this variant, insulin resistance and other risk factors in a cohort which had been well characterised with respect to diabetes. Blood DNA was screened from 251 men born in Hertfordshire 1920-1930 in whom an earlier cohort study had shown that glucose tolerance was inversely related to birthweight. The 16189 variant (T--> C transition) in the first hypervariable region of mitochondrial DNA was detected using the polymerase chain reaction and restriction digestion. DNA analysis showed that 28 of the 251 men (11%) had the 16189 variant. The prevalence of the 16189 variant increased progressively with fasting insulin concentration (p < 0.01). The association was independent of age and body mass index and was present after exclusion of the patients with NIDDM or impaired glucose tolerance. We found that insulin resistance in adult life was associated with the 16189 variant. This study provides the first evidence that a frequent mitochondrial variant may contribute to the phenotype in patients with a common multifactorial disorder.
Article
The origins and relationships among Micronesians, Polynesians, and Melanesians were investigated. Five different mtDNA region V length polymorphisms from 873 individuals representing 24 Oceanic and Asian populations were analyzed. The frequency cline of a common deletion and the distributions of a rare expanded length polymorphism support the origin of both Micronesians and Polynesians in Island Southeast Asia. Genetic, linguistic, and geographic distances were compared to assess the relative importance of isolation and gene flow during the prehistory of 19 Austronesian-speaking populations subdivided into five potential spheres of interaction. We observed significant correlations (P < 0.05) between genetic and linguistic distances in four of five comparisons. These data indicate extensive gene flow throughout much of Micronesia, but substantial isolation in other Pacific regions. Although recent advancements in our understanding of intentional voyaging within Remote Oceania have challenged the existence of the "myth of the primitive isolate," we caution against the adoption of panmictic alternatives.