Complete Mitochondrial Genome Sequencing Reveals Novel Haplotypes in a Polynesian Population

Abstract

The high risk of metabolic disease traits in Polynesians may be partly explained by elevated prevalence of genetic variants involved in energy metabolism. The genetics of Polynesian populations has been shaped by island hoping migration events which have possibly favoured thrifty genes. The aim of this study was to sequence the mitochondrial genome in a group of Maoris in an effort to characterise genome variation in this Polynesian population for use in future disease association studies. We sequenced the complete mitochondrial genomes of 20 non-admixed Maori subjects using Affymetrix technology. DNA diversity analyses showed the Maori group exhibited reduced mitochondrial genome diversity compared to other worldwide populations, which is consistent with historical bottleneck and founder effects. Global phylogenetic analysis positioned these Maori subjects specifically within mitochondrial haplogroup--B4a1a1. Interestingly, we identified several novel variants that collectively form new and unique Maori motifs--B4a1a1c, B4a1a1a3 and B4a1a1a5. Compared to ancestral populations we observed an increased frequency of non-synonymous coding variants of several mitochondrial genes in the Maori group, which may be a result of positive selection and/or genetic drift effects. In conclusion, this study reports the first complete mitochondrial genome sequence data for a Maori population. Overall, these new data reveal novel mitochondrial genome signatures in this Polynesian population and enhance the phylogenetic picture of maternal ancestry in Oceania. The increased frequency of several mitochondrial coding variants makes them good candidates for future studies aimed at assessment of metabolic disease risk in Polynesian populations.

Full text

Complete Mitochondrial Genome Sequencing Reveals
Novel Haplotypes in a Polynesian Population
Miles Benton
1,3
, Donia Macartney-Coxson
2
, David Eccles
1,2
, Lyn Griffiths
3
, Geoff Chambers
1
, Rod Lea
2,3
*
1School of Biological Science, Victoria University of Wellington, New Zealand, 2Kenepuru Science Centre, Institute of Environmental Science and Research, Sand ringham ,
3
Abstract
The high risk of metabolic disease traits in Polynesians may be partly explained by elevated prevalence of genetic variants
involved in energy metabolism. The genetics of Polynesian populations has been shaped by island hoping migration events
which have possibly favoured thrifty genes. The aim of this study was to sequence the mitochondrial genome in a group of
Maoris in an effort to characterise genome variation in this Polynesian population for use in future disease association
studies. We sequenced the complete mitochondrial genomes of 20 non-admixed Maori subjects using Affymetrix
technology. DNA diversity analyses showed the Maori group exhibited reduced mitochondrial genome diversity compared
to other worldwide populations, which is consistent with historical bottleneck and founder effects. Global phylogenetic
analysis positioned these Maori subjects specifically within mitochondrial haplogroup - B4a1a1. Interestingly, we identified
several novel variants that collectively form new and unique Maori motifs – B4a1a1c, B4a1a1a3 and B4a1a1a5. Compared to
ancestral populations we observed an increased frequency of non-synonymous coding variants of several mitochondrial
genes in the Maori group, which may be a result of positive selection and/or genetic drift effects. In conclusion, this study
reports the first complete mitochondrial genome sequence data for a Maori population. Overall, these new data reveal
novel mitochondrial genome signatures in this Polynesian population and enhance the phylogenetic picture of maternal
ancestry in Oceania. The increased frequency of several mitochondrial coding variants makes them good candidates for
future studies aimed at assessment of metabolic disease risk in Polynesian populations.
Citation: Benton M, Macartney-Coxson D, Eccles D, Griffiths L, Chambers G, et al. (2012) Complete Mitochondrial Genome Sequencing Reveals Novel Haplotypes
in a Polynesian Population. PLoS ONE 7(4): e35026. doi:10.1371/journal.pone.0035026
Editor: Manfred Kayser, Erasmus University Medical Center, The Netherlands
Received September 26, 2011; Accepted March 11, 2012; Published April 13, 2012
Copyright: ß2012 Benton et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits
unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: This research was funded by the Wellington Health Research Council Grant #1387. The funders had no role in study design, data collection and
analysis, decision to publish, or preparation of the manuscript.
Competing Interests: The authors have declared that no competing interests exist.
* E-mail: r.lea@griffith.edu.au
Introduction
Scientific evidence from linguistics, archaeology and genetics
indicates that the Maori population of New Zealand (NZ) represents
the final link in a long chain of island-hopping voyages by
Polynesians, which began in Taiwan and stretched through
Melanesia and across the Pacific Islands over a period of 5–6000
years (Figure 1). Around 800 years ago one or more small groups of
voyagers arrived in NZ from Tahiti, via the Cook Islands. This event
marked the last of the great human migrations and the creation of an
isolated founder population. The widespread intermarriage between
Maoris and Europeans over the past 200 years (8–10 generations)
has introduced substantial European genomic ancestry (,40%) into
the contemporary Maori gene pool [1].
Maoris, and Polynesians more generally, are disproportionately
affected with certain metabolic disease traits eg. obesity and type 2
diabetes mellitus [2,3,4,5]. Given that these traits are partially
influenced by genetic factors it is likely that genes involved in
energy metabolism play a role in disease risk [6]. Mitochondrial
genes could potentially account for some of the high prevalence of
metabolic disease traits in Maoris. Coding variants in mitochon-
drial genes that exhibit unusually high frequencies in Maori may
have been driven to high frequency by positive selection due to
periods of feast and famine during the migrations (ie. thrifty genes)
[7]. Alternatively, these mitochondrial variants may have simply
increased in frequency in Maoris via genetic drift as a consequence
of repeated founder events and subsequent population bottlenecks.
Complete mitochondrial genome sequence data have been
previously investigated to elucidate the evolutionary history among
human populations around the world [8]. Studies have also
comprehensively investigated mitochondrial genome variation in
relation to metabolic syndrome traits [9,10]. However, no
complete mitochondrial genome surveys have involved a Maori
sample and Polynesians more generally have been under-
represented. Given the unusual maternal history of Maoris it is
likely that a unique mitochondrial genomic makeup exists in this
Polynesian subgroup. In this study we sequenced the entire
mitochondrial genome in a group of Maori individuals and
performed population genetic analyses to characterise the patterns
of genomic variation in this Polynesian population. These new
data provide the opportunity to enhance the phylogenetic picture
of the mitochondrial genome in the South Pacific region and
establish a foundation for future studies of mitochondrial DNA
and metabolic disease traits in Polynesian populations.
Results
Complete mtDNA sequences and genetic diversity
A summary of mitochondrial (mt) sequence variation for all 20
Maori mtDNA genomes is shown in Table 1. These sequences are
PLoS ONE | www.plosone.org 1 April 2012 | Volume 7 | Issue 4 | e35026
New Zealand, GenQomics Research Centre, Griffith Health Institute, Griffith University, QQueensland, Australia
Q

the only complete NZ Maori sequences currently available (at time
of writing). Previous studies have suggested that there is very
limited mtDNA variation in Polynesians in general, and even less
in Maori [11,12] and no Maori-specific genetic mtDNA markers
have yet been identified.
Sequence variation was identified by comparison against the
revised Cambridge Reference Sequence (CRS) [13], which
belongs to haplogroup H (commonly found in European peoples).
The mt sequence variation identified in the Maori individuals
differed from the CRS at 44 variable sites (see Table 1). Of these
variant sites, 22 were fixed in all 20 Maori individuals – these are
the defining markers of mitochondrial haplogroup B, and its
further substructure (haplotypes) such as B4a1a1, to which Maoris
belong. There were 12 singleton variants identified and a further
10 variants were shared by two or more individuals and define
subclades within the Maori mtDNA phylogeny.
The limited sequence variation was validated by calculation of h
and pdiversity statistics in DNAspV5 [14]. Table 2 shows the
amount of DNA sequence diversity of 189 complete mtDNA
sequences as well as diversity within each specific population. The
Maori group were found to exhibit high haplotype diversity
(h = 0.92), yet diversity was substantially lower than that seen in
any of the other three populations (see Table 2). When looking at
the nucleotide (p) diversity it can be seen that Maoris exhibit a
value 10-fold lower (p= 0.00018) compared to that of the other
populations. As expected there is no maternal European
admixture identified in this group. All mtDNA sequences are
clearly Polynesian (Maori) and show the characteristic, and well
documented, Polynesian Motif markers [15,16]: 16189, 16217,
16247, and 16261 (see Table 1).
Phylogenetic Analysis
Phylogenetic analysis of the Maori sequences in the software
mtPhy [17] confirmed that all 20 belong to haplogroup B. As
expected from previous studies of the Hyper Variable Region
(HVR) in Polynesians [11,12,15,18,19], these Maori sequences all
group deep within haplogroup B (for reference see Phylotree [20]).
To further investigate the sub-structure of haplogroup B a detailed
phylogeny was reconstructed to include 64 complete sequences
representing B4a (10 Asian, 14 Taiwanese, 4 Coastal PNG, 16
Pacific Islanders and 20 Maori). Figure 2 illustrates this tree
(Asian/Austronesian mt DNA sequences) and shows that all 20
Maori sequences group within B4a1a1, with Pacific Islander and
Coastal PNG (Melanesian) mt sequences. These groupings fit well
with previous mtDNA work [18,19,21,22,23,24], and complement
the hypothetical model of Polynesian origin stemming from
Taiwan [25]. Apart from the variants which define haplogroup B,
we have identified three novel Polynesian (Maori) haplotypes –
until now all documented Polynesian mt haplotypes have been
B4a1a1a. Table 3 displays the frequency and specific markers for
the haplotypes identified in the 20 complete Maori mt sequences.
The most interesting haplotype, B4a1a1a3 (unpublished data), was
recently included in an updated build of Phylotree (http://www.
phylotree.org/ [20]). This haplotype was present in 35% (n = 7) of
the individuals sequenced, and is defined by the variants 1185T
and 4769A.
Novel mt DNA sequence variants in Maori
This study has identified six novel (undocumented) mtDNA
variants in the Maori sample: five within protein coding regions
and one in the control region (see Table 4). An extended database
search of mtDB [26] and Mitomap [27] and for these variants
returned no hits, thus these positions are deemed to be novel. Two
variants result in amino acid sequence changes; 9255T (ProRSer)
and 15014C (PheRLeu). Apart from variant 3909T, the novel
variants were only noted in individuals and are not present in the
wider population and are thus probably sporadic, rather than
ancestral.
Figure 1. Map outlining migratory paths of Austronesian speaking populations, including estimated dates. Adapted from Bellwood et
al., (2011) [52].
doi:10.1371/journal.pone.0035026.g001
Mitochondrial Genome Variation in Polynesians
PLoS ONE | www.plosone.org 2 April 2012 | Volume 7 | Issue 4 | e35026

Table 1. Variation across 20 complete Maori mtDNA sequences.
HVRII 12SrRNA 16SrRNA ND1 ND2 COI ATP6
Position 73 146 151 263 750 1185 1438 1692 1806 2416 2706 3909 4769! 5465 6261 6719 6782 6905 7028 8860 8865 9123 9145
CRS
*
ATCAACAATTACATGT TACA GGG
mt3 GC.GGTG...G..C.C..TG .A.
mt6 GC. GG. G. . . G. GC. C . . T G . A.
mt8 GC.GGTG...G..C.C..TG .A.
mt9 GC. GG. G. . . GT GC. C . . T G . A.
mt10 GCT GG. GG. CG. GC. C . . T G . A.
mt11 GC. GG. G. . . G. GC. C. . T G AA .
mt12 GC. GG. G. . . G. GC. C. . T G AA .
mt13 GC. GGTG. . . G. . C. C. . T G . A.
mt14 GC. GGTG. . . G. . C. C. . T G . A.
mt16 GC. GG. G. . . G. GC. C. . T G . A.
mt18 GC. GG. G. . . G. GCAC . GT G . AA
mt19 GC. GG. G. . . GT GCAC . . T G . A.
mt21 GC. GG. G. . . GTGC . C. . T G . A.
mt23 GC. GG. G. . . G. GC. C. . T G . A.
mt24 GC. GG. G. . . G. GC. C. . T G . A.
mt25 GC. GGTG. . . G. . C. C. . T G . A.
mt26 GC. GG. G. . . G. GC. CC . T G . A.
mt28 GC. GGTG. . . G. . C. C. . T G . A.
mt29 GC. GGTG. CCG. . C . C. . T G . A.
mt30 GCT GG. GG. . G. GC. C. . T G . A.
n (variant) 20 20 2 20 20 7 20 2 1 2 20 3 13 20 2 20 1 1 20 20 2 20 1
Amino-acid
change
syn syn syn A120T syn syn syn syn T112A syn syn A207T
Conservation
Index
8 28 51 97 100 100 97 100 72 92 100 100
Protein Position 201 100 332 120 272 293 334 375 112 113 199 207
Mitochondrial Genome Variation in Polynesians
PLoS ONE | www.plosone.org 3 April 2012 | Volume 7 | Issue 4 | e35026

COIII ND3 ND4 S(AGY) ND5 Cyt b NC D-loop & HVRI
9255 9722 10238 11719 12239 14022 14766 15014 15326 15746 16051 16086 16126 16189 16217 16243 16247 16260 16261 16295 16519
CTTGCACTAAATTTTTACCCT
..CATGT. GG. . . CC. G. T.C
..CATGT. GG. . CCC. . . T.C
..CATGT. GG. . . CC. G. T.C
..CATGT. GG. . CCC. G. T.C
..CATGT. GG. . CCC. . . T.C
..CATGT. GG. . CCC. . . T.C
..CATGT. GG. . CCC. . . T.C
..CATGT. GG. . . CC. G. T+AC
..CATGT. GG. . . CC. G. T.C
..CATGTCGG. . . CC. GTT.C
..CATGT. GGGC. CC. G. T.C
..CATGT. GG. . CCC. G. T.C
..CATGT. GG. . CCC. . . T.C
..CATGT. GG. . CCC. . . T.C
..CATGT. GG. . CCC. G. T.C
..CATGT.GG...CC G.T.C
T.CATGT. GG. . . CCCG. T.C
..CATGT. GG. . . CC. G. T.C
.CCATGT. GG. . . CC. G. T.C
..CATGT. GG. . CCC. G. T.C
1 1 20 20 20 20 20 1 20 20 1 1 10 20 20 1 14 1 20 1 20
P17S syn syn syn syn T7I F90L T194A I334V
100 100 100 97 44 49 90 21 26
17 172 60 320 562 7 90 194 334
*CRS = Cambridge Reference Sequence, Boldface positions represent rare variants in the CRS. As per phylotree nomenclature, variants toward a base identical-to-state to the CRS are indicated with !
Table 1. Cont.
Mitochondrial Genome Variation in Polynesians
PLoS ONE | www.plosone.org 4 April 2012 | Volume 7 | Issue 4 | e35026

Mitochondrial gene variant frequencies in different
subpopulations
Estimated frequencies of variants within mitochondrial genes
were calculated for the NZ Maori as well as for European, Chinese
and Melanesian subgroups, selected because they are each
putative ancestral contributor populations of NZ Maori. Of the
13 mtDNA genes, the Maori mtDNA sequences contained
variable sites in 9 genes, the majority being population specific
polymorphisms (haplogroup B defining variants). There were 19
variants spread across these 9 genes, with COI,ATP6, and Cyt b
showing the largest number of variants among the ethnic
subgroups. The variant frequency differences between these four
groups are displayed in Table 5. Of particular interest in terms of
metabolic disease risk was the presence of non-synonymous
variants in COI,ATP6,COIII and Cyt b genes compared to the
ancestral subgroups. The most notable population specific
polymorphism, variant A15746G in Cyt b, was observed in all 20
Maori samples but was absent or rare in all ancestral subgroups
(Table 5). The rare variant, 4769A in ND2, is also of particular
interest for several reasons; 1) it is a rare polymorphism identified
in the CRS [13], yet it is identified at 35% (n =7) in the NZ Maori
cohort, and 2) alongside variant 1185T this variant forms a unique
Maori haplotype.
Discussion
This study provides the first complete mitochondrial sequence
data for a Polynesian (Maori) population, and as such allows a rare
opportunity to enhance the maternal phylogeny in Oceania as well
as explore the mitochondrial genome for potential metabolic risk
genes in Polynesians. Although sequence alignment of the Maori
mt genomes illustrated high concordance with other Polynesian mt
sequences, phylogenetic analysis was able to refine the haplotype
substructure of Polynesians. Specifically, Maori mt sequences were
deemed as belonging to major mt haplogroup B and formed sub
structures within the B4a1a1 ‘haplotype’. This analysis also
confirmed the presence of the 9-bp deletion and characteristic
control region variants which have become collectively know as
the ‘‘Polynesian motif’’ [15]. Identification of these Polynesian
informative sites is consistent with previous mt DNA studies in NZ
Maori [11,12].
It has been previously documented that Polynesian and central/
eastern Micronesian populations show reduced mtDNA diversity,
sharing high frequencies of the single mtDNA haplotype - B4a1a1
[23,28]. We explored the possibility of decreased mt sequence
diversity within the Maori population. Both haplotype (h) and
nucleotide diversity (p) were shown to be lower in Maori mt
genomes compared to putative ancestral populations. Nucleotide
diversity exhibited a 10-fold decrease when compared to three
ancestral populations. Evidence of such dramatically reduced
diversity of the mt genome in Maori is probably due to founder
effects during island hoping migrations and is supported by
previous studies [11,12]. It is perhaps not surprising that due to
Table 2. Estimated haplotype (h) and nucleotide (p) diversity.
Population
N
ind
N
haplo
hP
European 67 64 0.999 0.00145
Chinese 52 52 1.000 0.00186
Melanesian 50 48 0.998 0.00172
Maori 20 11 0.916 0.00018
All populations 189 174 0.999 0.00174
N
ind
(number of sequences),
N
haplo
(number of haplotypes), h(haplotype
diversity), p(nucleotide diversity).
doi:10.1371/journal.pone.0035026.t002
Figure 2. Phylogenetic reconstruction detailing haplogroup B4a1 in complete mtDNA sequences. This neighbour-joining tree was
created in MEGA4, using the Tamura-Nei substitution model. The sequences used were sourced from Trejaut et al. (2005), and include the 20
complete Maori mtDNA’s. Shown in red are the respective tribes of the Taiwanese Aboriginal sequences.
doi:10.1371/journal.pone.0035026.g002
Mitochondrial Genome Variation in Polynesians
PLoS ONE | www.plosone.org 5 April 2012 | Volume 7 | Issue 4 | e35026

this reduced mt genetic diversity no unique mtDNA haplotypes
have so far been discovered within the Maori population.
However, our complete mitochondrial genome scan revealed the
presence of at least 3 specific sub-haplotypes of haplogroup B in
Maori, which are derived from variants 1185T, 4769A, and
16126C. These three variants could have arisen in the seafaring
Polynesian ancestors of Maori, or they could have occurred more
recently, i.e. since the settlement of NZ. These variants form a
unique mt signature within this Maori population, one that is
worth exploring further in other NZ Maori populations to
determine its generalizability. As there is very little coding region
information available for other Polynesian mt sequences, with only
7 complete Polynesian sequences listed in mtDB [26], it is not
currently possible to determine whether these ‘signatures’ are
unique to Maori. They may in fact be present, but as yet
undetected, in the broader Polynesian population. Nevertheless,
these new findings provide a more specific mt ancestry informative
marker for future genetic studies involving Maori subjects.
Our results also indicate that the protein coding regions within
the mitochondrial genome for the populations of Island Southeast
Asia, Coastal Melanesia (PNG), Polynesia, and NZ Maori, which
are all mt haplogroup B, are heavily conserved and have not
changed much over the ,5000 years since the suggested
movement from Taiwan. The presence of population specific
polymorphisms consistent with those previously identified in
haplogroup B was confirmed via comparison across four putative
ancestral populations. There was one coding variant (4769A) that
is not a haplogroup B defining marker which showed increased
frequency in the NZ Maori group, although further work is
require to accurately confirm it’s prevalence in the wider
Polynesian community. The lack of coding variation is most likely
attributed to genetic drift attributed to the rapid expansion and
migration of Austronesian peoples from Taiwan throughout
Oceania in the last ,5000 years [25,29]. Regardless, our findings
make these variants good candidates for future genetic association
studies of metabolic disease in Maori populations.
Disease association with specific mtDNA variants has been
previously noted for several metabolic traits, including; type-2
diabetes (T2D) [30,31,32,33,34], insulin resistance [35,36,37], and
BMI/fat mass [10,33,38]. One specific mtDNA variant, 16189C –
a fundamental haplogroup B variant, has previously been
identified to associate with T2D, insulin resistance and BMI in
separate studies [30,33,34,36,38]. Whether the variant itself is the
cause of the association, or simply a marker for the larger
haplotype/signature or in linkage with other causal variants
located in the nuclear genome is yet to be seen.
In conclusion, this study reports the first complete mitochon-
drial genome sequence data for a Maori population. Overall, these
new data reveal unique mitochondrial genome characteristics in
this Polynesian population and enhance the phylogenetic picture
of maternal ancestry in Oceania. The presence of several newly
identified novel variants, as well as the presence of previously
identified disease associated variants, offers plausible candidates
for future studies aimed at assessment of metabolic disease risk in
Polynesian populations.
Materials and Methods
Samples
This project is part of the Rakaipaaka Health and Ancestry
Study (RHAS) which is aimed at identifying the genetic and
environmental determinants of health in the indigenous Maori
tribe (iwi) – Ngati Rakaipaaka. Being a DNA-based genetic study
involving indigenous Maori participants the RHAS has taken
several years to develop in terms of ethical and cultural approval.
The RHAS is governed by Te Iwi o Rakaipaaka (TIORI) in
Table 3. RHAS Maori mt DNA haplotype markers.
Haplotype
f
1185 4769 14022 16126 16189 16217 16247 16261
B4a1a1c
##
6.GGCCC. T
B4a1a1a
*
3. G G . C C G T
B4a1a1a3
##
7T . G . C C G T
B4a1a1a5
##
4.GGCCCGT
*Previously reported Polynesian mt DNA haplotype.
##
Novel Polynesian (Maori) haplotypes, numbered following Phylotree nomenclature. B4a1a1a3 was included in a recent update to Phylotree. Variants to the CRS are
indicated.
doi:10.1371/journal.pone.0035026.t003
Table 4. Novel mtDNA variants observed in 20 Maori individuals.
Gene Nucleotide Change Protein Change No. Individuals Percentage
16SrRNA m.1806T.C NA 1 (20) 5
ND1 m.3909C.T Syn 3 (20) 15
COXI m.6782T.C Syn 1 (20) 5
COXIII m.9255C.T p.MT-COXIII:Pro17Ser 1 (20) 5
Cyt b m.15014T.C p.MT-Cyt b:Phe90Leu 1 (20) 5
HVRI
*
m.16295C insA NA 1 (20) 5
*HVRI is non-coding. NA, not applicable; 16SrRNA, 16S ribosomal RNA; ND1, NADH dehydrogenase subunit 1; COXI, cytochrome c oxidase I; COXIII, cytochrome c
oxidase III; Cyt b, cytochrome b; HVRI, hyper variable region I.
doi:10.1371/journal.pone.0035026.t004
Mitochondrial Genome Variation in Polynesians
PLoS ONE | www.plosone.org 6 April 2012 | Volume 7 | Issue 4 | e35026

Nuhaka and has received full ethical approval from the Multi-
regional ethics committee of New Zealand (MEC/05/12/174). All
individuals involved signed a consent form acknowledging they
understood the genetic nature of this health research and wished
to participate. For this mitochondrial project we selected a
subsample of 20 adult individuals who were deemed to be non-
admixed (ie. have full Maori ancestry). This was determined by the
individual self-reporting that they had four Maori grandparents.
Genomic DNA was isolated with the use of commercial kits
(FlexiGene – QIAGEN). Polynesian mt DNA ancestry was
validated using the previously documented ‘‘Polynesian motif’’[15]
(9-bp deletion plus three control region SNPs), which was found to
be present in all 20 DNA(unpublished data).
mtDNA sequencing of 20 Maori individuals
Complete mitochondrial DNA sequence information was
obtained for the 20 Maori individuals using the Mitochip
Resequencing Array [39]. The Mitochip Resequencing protocol
(Affymetrix, Santa Clara, CA) laid out by Affymetrix was followed
(Affymetrix GeneChip CustomSeq Resequencing Array Protocol
version 2.1.), and the chips were run on Affymetrix GeneChip
equipment (GeneChip Hybridization Oven, GeneChip Fluidics
Station, and GeneChip Scanner 3000). The raw data files were
analysed using the GeneChip Sequence Analysis Software 4.1
(GSEQ 4.1). Complete mtDNA sequences were exported from
GSEQ4.1 and aligned against the revised Cambridge Reference
Sequence [13] (CRS) in MEGA4.1 [40]. All sequence data has
been submitted to GenBank (awaiting Accession numbers).
Sequence analysis and mtDNA diversity
Aligned sequences were exported as FASTA files from
MEGA4.1, these were then entered into the program mtPhyl
[17], where sequence haplotypes and sequence variation statistics
were calculated. The mtPhyl software also reported information
regarding changes in amino acids and respective position and
conservation of these changes. Mitochondrial DNA diversity
calculations were performed in DNAspV5 [14] on groups of
sequences from four different ethnic populations; European
(n = 101) [8,41,42,43,44], Chinese (n = 52) [42,43,45,46], Mela-
nesian (n = 56) [24,42,47,48], and NZ Maori (n = 20). European,
Chinese and Melanesian sequences were obtained from the
databases mtDB [26] and PhyloTree [20]. Haplotype (h) and
nucleotide (p) diversity statistics were calculated in each ethnic
group, as well as in the total sample (all sequences pooled
together).
Phylogeny reconstruction
A consensus neighbour joining tree showing the detail of sub-
branching patterns within haplogroup B was reconstructed for a
total of 64 complete mitochondrial sequences; all 20 Maori
sequences and 44 mitochondrial sequences (Austronesian, Coastal
Melanesian and Oceania) obtained from previous studies
[25,32,47,49,50]. The phylogeny was constructed in MEGA4.1
[51] using the Tamura-Nei method and a bootstrap of 500
replicates.
Novel variants and ‘global’ variant frequencies
Observed mtDNA variants in the Maori sequences were
searched against known electronic databases (mtDB [26] and
mitomap [27]) to identify potential unreported (novel) DNA
sequence variants. Identification of possible thrifty genes in Maori
involved comparing mitochondrial gene variant frequencies
between candidate ancestral populations: European, Chinese
(Asian), Melanesian. Sequences were aligned in MEGA4.1 and
variant frequencies between population groups were calculated.
Author Contributions
Conceived and designed the experiments: RL. Performed the experiments:
RL MB DM. Analyzed the data: MB DE. Contributed reagents/
materials/analysis tools: GC DM. Wrote the paper: MB RL DM LG.
References
1. Lea RA, Chambers GK (2007) Pharmacogenetics in Admixed Polynesian
Populations. Chapter in Pharmacogenetics and Admixed populations Edited by:
Guilherme Suarez-Kurtz Eureka Bioscience Database (ISBN: 1-58706-130-9).
2. Ministry of Health (2008) A Portrait of Health: Key Results of the 2006/2007
New Zealand Health Survey. Wellington: Ministry of Health.
3. Dowse GK, Zimmet PZ, Finch CF, Collins VR (1991) Decline in Incidence of
Epidemic Glucose Intolerance in Nauruans: Implications for the ‘‘Thrifty
Genotype’’. American Journal of Epidemiology 133: 1093–1104.
4. Zimmet P, Dowse G, Finch C, Serjeantson S, King H (1990) The epidemiology
and natural history of niddm–lessons from the South Pacific. Diabetes/
Metabolism Reviews 6: 91–124.
5. Zimmet P, Taft P, Guinea A, Guthrie W, Thoma K (1977) The high prevalence
of diabetes mellitus on a Central Pacific island. Diabetologia 13: 111–115.
6. O’Rahilly S (2009) Human genetics illuminates the paths to metabolic disease.
Nature 462: 307–314.
7. Neel JV (1962) Diabetes Mellitus - A thrifty genotype rendered detrimental by
progress. American Journal of Human Genetics 14: 353–362.
8. Mishmar D, Ruiz-Pesini E, Golik P, Macaulay V, Clark AG, et al. (2003)
Natural selection shaped regional mtDNA variation in humans. Proceedings of
the National Academy of Sciences of the United States of America 100:
171–176.
Table 5. mtDNA coding variant frequencies in four human
populations.
Rare allele frequency
*
Gene Variant European Chinese Melanesian Maori
(n = 101) (n = 52) (n = 56) (n = 20)
ND1 C3909T 0 0 0 0.15
ND2 G4769A 0.01 0 0 0.35
T5465C 0 0 0.16 1
COI G6261A 0.01 0 0 0.10
T6719C 0 0 0.16 1
T6782C 0 0 0 0.05
A6905G 0 0 0.04 0.05
C7028T 0.63 1 0.98 1
ATP6 G8865A 0 0 0.02 0.10
G9123A 0 0 0.016 1
G9145A 0 0 0 0.05
COIII C9255T 0 0 0 0.05
T9722C 0 0 0 0.05
ND3 T10238C 0.03 0 0.16 1
ND4 G11719A 0.56 1 1 1
ND5 A14022G 0 0 0.14 1
Cyt b C14766T 0.57 1 1 1
T15014C 0 0 0 0.05
A15746G 0 0 0.16 1
*compared to CRS.
doi:10.1371/journal.pone.0035026.t005
Mitochondrial Genome Variation in Polynesians
PLoS ONE | www.plosone.org 7 April 2012 | Volume 7 | Issue 4 | e35026

9. Saxena R, de Bakker PIW, Singer K, Mootha V, Burtt N, et al. (2006)
Comprehensive Association Testing of Common Mitochondrial DNA Variation
in Metabolic Disease. The American Journal of Human Genetics 79: 54–61.
10. Yang T-L, Guo Y, Shen H, Lei S-F, Liu Y-J, et al. (2 011) Genetic Association
Study of Common Mitochondrial Variants on Body Fat Mass. PLoS ONE 6:
e21595.
11. Murray-Mcintosh RP, Scrimshaw BJ, Hatfield PJ, Penny D (1998) Testing
migration patterns and estimating founding population size in Polynesia by using
human mtDNA sequences. Proceedings of the National Academy of Sciences of
the United States of America 95: 9047–9052.
12. Whyte ALH, Marshall SJ, Chambers GK (2005) Human evolution in Polynesia.
Human Biology 77: 157–177.
13. Andrews RM, Kubacka I, Chinnery PF, Lightowlers RN, Turnbull DM, et al.
(1999) Reanalysis and revision of the Cambridge reference sequence for human
mitochondrial DNA. Nature Genetics 23: 147–147.
14. Librado P, Rozas J (2009) DnaSP v5: a software for comprehen sive analysis of
DNA polymorphism data. Bioinformatics 25: 1451–1452.
15. Redd A, Takezake JN, Sherry ST (1995) Evolutionary history of the COII/
tRNA lys intergenic 9 base pair deletion in human mitochondrial DNAs from
the Pacific. Molecular Biology and Evolution 12: 604–615.
16. Melton T, Peterson R, Redd AJ, Saha N, Sofro ASM, et al. (1995) Polynesian
Genetic Affinities with Southeast Asian Populations as Identified by mtDNA
Analysis. The American Society of Human Genetics 57: 403–414.
17. Eltsov N, Volodko N (2009) mtPhyl - software tool for human mtDNA analysis
and phylogeny reconstruction.
18. Lum JK, Rickards O, Ching C, Cann RL (1994) Polynesian mitochondrial
DNAs reveal three deep maternal lineage clusters. Human Biology 66: 567(524).
19. Sykes B, Leiboff A, Lowbeer J, Tetzner S, Richards M (1995) The origins of the
Polynesians - An interpretation from mitochondrial lineage analysis. American
Journal of Human Genetics 57: 1463–1475.
20. van Oven M, Kayser M (2009) Updated comprehensive phylogenetic tree of
global human mitochondrial DNA variation. Human Mutation 30: E386–E394.
21. Hertzberg M, Mickleson KN, Serjeantson SW, et al. (1989) An Asian-specific 9-
bp deletion of mitochondrial DNA is frequently found in Polynesians. American
Journal of Human Genetics. pp 504–510.
22. Hagelberg E, Clegg JB (1993) Genetic Polymorphisms in Prehistoric Pacific
Islanders Determined by Analysis of Ancient Bone DNA. Proceedings of the
Royal Society of London Series B: Biological Sciences 252: 163–170.
23. Lum JK, Cann RL (1998) mtDNA and Language Supp ort a Common Origin of
Micronesians and Polynesians in Island Southeast Asia. American Journal of
Physical Anthropology 105: 109–119.
24. Pierson MJ, Martinez-Arias R, Holland BR, Gemmell NJ, Hurles ME, et al.
(2006) Deciphering Past Human Population Movements in Oceania: Provably
Optimal Trees of 127 mtDNA Genomes. Society for Molecular Biology and
Evolution.
25. Trejaut JA, Kivisild T, Loo JH, Lee CL, He CL, et al. (2005) Traces of archaic
mitochondrial lineages persist in Austronesian-speaking Formosan populations.
PLoS Biology 3: 1–11.
26. Ingman M, Gyllensten U (2006) mtDB: Human Mitochondrial Genome
Database, a resource for population genetics and medical sciences. Nucleic Acids
Research 34: D749–D751.
27. Ruiz-Pesini E, Lott MT, Procaccio V, Poole J, Brandon MC, Mishmar D, Yi C,
Kreuziger J, Baldi P, Wallace CD (2007) An enhanced MITOMAP with a
global mtDNA mutational phylogeny. Nucleic Acids Research 35 (Database
issue):D823–D828.
28. Lum JK, Cann RL (2000) mtDNA Lineage Analyses: Origins and Migrations of
Micronesians and Polynesians. American Journal of Physical Anthropology 113:
151–168.
29. Tabbada KA, Trejaut J, Loo J-H, Chen Y-M, Lin M, et al. (2010) Philippine
Mitochondrial DNA Diversity: A Populated Viaduct between Taiwan and
Indonesia? Molecular Biology and Evolution 27: 21–31.
30. Bhat A, Koul A, Sharma S, Rai E, Bukhari SIA, et al. (2007) The possible role of
10398A and 16189C mtDNA variants in providing susceptibility toT2DM in
two North Indian populations: a replicative study. Human Genetics 120:
821–826.
31. Chinnery PF, Mowbray C, Patel SK, Elson JL, Sampson M, et al. (2007)
Mitochondrial DNA haplogroups and type 2 diabetes: a study of 897 cases and
1010 controls. Journal of Medical Genetics 44.
32. Guo LJ, Oshida Y, Fuku N, Takeyasu T, Fujita Y, et al. (2005) Mitochondrial
genome polymorphisms associated with type-2 diabetes or obesity. Mitochon-
drion 5: 15–33.
33. Liou CW, Lin TK, Weng HH, Lee CF, Chen TL, et al. (2007) A common
mitochondrial DNA variant and increased body mass index as associated factors
for development of type 2 diabetes: Additive effects of genetic and environmental
factors. Journal of Clinical Endocrinology and Metabolism 92: 235–239.
34. Mohlk e KL, Jackson AU, Scot t LJ, Peck EC, Suh YD, et al. (2005)
Mitochondrial polymorphisms and susceptibility to type 2 diabetes-related traits
in Finns. Human Genetics 118: 245–254.
35. Poulton J, Bednarz AL, Scott-Brown M, Thomps on C, Macaulay VA, et al.
(2002) The presence of a common mitochondrial DNA variant is associated with
fasting insulin levels in Europeans in Auckland. Diabetic Medicine 19: 969–971.
36. Poulton J, Brown MS, Cooper A, Marchington DR, Phillips DIW (1998) A
common mitochondrial DNA variant is associated with insulin resistance in
adult life. Diabetologia 41: 54–58.
37. Maechler P, de Andrade PBM (2006) Mitochondrial damages and the regulation
of insulin secretion. Biochemical Society Transactions 34: 824–827.
38. Kim JH, Park KS, Cho YM, Kang BS, Kim SK, et al. (2002) The prevalence of
the mitochondrial DNA 16189 variant in non-diabetic Korean adults and its
association with higher fasting glucose and body mass index. Diabetic Medicine
19: 681–684.
39. Maitra A, Cohen Y, Gillespie SED, Mambo E, Fukushima N, et al. (2004) The
Human MitoChip: a high-throughput sequencing microarray for mitochondrial
mutation detection. Genome Research 14: 812–819.
40. Kumar S, Nei M, Dudley J, Tamura K (2008) MEGA: A biologist-centric
software for evolutionary analysis of DNA and protein sequences. Briefings in
Bioinformatics 9: 299–306.
41. Achilli A, Rengo C, Magri C, Battaglia V, Olivieri A, et al. (2004) The
Molecular Dissection of mtDNA Haplogroup H Confirms That the Franco-
Cantabrian Glacial Refuge Was a Major Source for the European Gene Pool.
The American Journal of Human Genetics 75: 910–918.
42. Ingman M, Kaessmann H, Paabo S, Gyllensten U (2000) Mitochondrial genome
variation and the origin of modern humans. Nature 408: 708–713.
43. Kivisild T, Shen P, Wall DP, Do B, Sung R, et al. (2006) The Role of Selection
in the Evolution of Human Mitochondrial Genomes. Genetics 172: 373–387.
44. Moilanen JS, Finnila S, Majamaa K (2003) Lineage-specific selection in human
mtDNA: Lack of polymorphisms in a segment of MTND5 gene in haplogroup J.
Molecular Biology and Evolution 20: 2132–2142.
45. Kong Q-P, Yao Y-G, Sun C, Bandelt H-J, Zhu C-L, et al. (2003) Phylogeny of
East Asian Mitochondrial DNA Lineages Inferred from Complete Sequences.
American Journal of Human Genetics 73: 671–676.
46. Macaulay V, Hill C, Achilli A, Rengo C, Clarke D (2005) Single, Rapid Coastal
Settlement of Asia Revealed by Analysis of Complete Mitochondrial Genomes.
Science 308: 1034–1036.
47. Ingman M, Gyllensten U (2003) Mitoch ondrial Genome Variatio n and
Evolutionary History of Australian and New Guinean Aborigines. Genome
Research 13: 1600–1606.
48. Merriwether DA, Hodgson JA, Friedlaender FR, Allaby R, Cerchio S, et al.
(2005) Ancient mitochondrial M haplogroups identified in the Southwest Pacific.
Proceedings of the National Academy of Sciences of the United States of
America 102: 13034–13039.
49. Soares P, Rito T, Trejaut J, Mormina M, Hill C, et al. (2011) Ancient Voyaging
and Polynesian Origins. The American Journal of Human Genetics 88:
239–247.
50. Ingman M, Gyllensten U (2001) Analysis of the Complete Human mtDNA
Genome: Methodology and Inferences for Human Evolution. The American
Genetic Association 92: 454–461.
51. Tamura K, Dudley J, Nei M, Kumar S (2007) MEGA4: Molecular Evolutionary
Genetics Analysis (MEGA) software version 4.0. Molecular Biology and
Evolution10.1093/molbev/msm092.
52. Bellwood P, Chambers G, Ross M, Hung H-c (2011) Are ‘Cultures’ Inherited?
Multidisciplinary Perspectives on the Origins and Migrations of Austronesian-
Speaking Peoples Prior to 1000 BC. In: Roberts BW, Vander Linden M, eds.
Investigating Archaeological Cultures: Springer New York. pp 321–354.
Mitochondrial Genome Variation in Polynesians
PLoS ONE | www.plosone.org 8 April 2012 | Volume 7 | Issue 4 | e35026