Methylphenidate and cocaine self‐administration produce distinct dopamine terminal alterations

Article (PDF Available)inAddiction Biology 19(2) · March 2012with53 Reads
DOI: 10.1111/j.1369-1600.2012.00456.x · Source: PubMed
Abstract
Methylphenidate (MPH) is a commonly abused psychostimulant prescribed for the treatment of attention deficit hyperactivity disorder. MPH has a mechanism of action similar to cocaine (COC) and is commonly characterized as a dopamine transporter (DAT) blocker. While there has been extensive work aimed at understanding dopamine (DA) nerve terminal changes following COC self-administration, very little is known about the effects of MPH self-administration on the DA system. We used fast scan cyclic voltammetry in nucleus accumbens core slices from animals with a 5-day self-administration history of 40 injections/day of either MPH (0.56 mg/kg) or COC (1.5 mg/kg) to explore alterations in baseline DA release and uptake kinetics as well as alterations in the interaction of each compound with the DAT. Although MPH and COC have similar behavioral effects, the consequences of self-administration on DA system parameters were found to be divergent. We show that COC self-administration reduced DAT levels and maximal rates of DA uptake, as well as reducing electrically stimulated release, suggesting decreased DA terminal function. In contrast, MPH self-administration increased DAT levels, DA uptake rates and DA release, suggesting enhanced terminal function, which was supported by findings of increased metabolite/DA tissue content ratios. Tyrosine hydroxylase messenger RNA, protein and phosphorylation levels were also assessed in both groups. Additionally, COC self-administration reduced COC-induced DAT inhibition, while MPH self-administration increased MPH-induced DAT inhibition, suggesting opposite pharmacodynamic effects of these two drugs. These findings suggest that the factors governing DA system adaptations are more complicated than simple DA uptake blockade.
Methylphenidate and cocaine self-administration
produce distinct dopamine terminal alterations
Erin S. Calipari
1
, Mark J. Ferris
1
, James R. Melchior
1
, Kristel Bermejo
2
, Ali Salahpour
2
,
David C. S. Roberts
1
& Sara R. Jones
1
Department of Physiology and Pharmacology,Wake Forest School of Medicine,Winston Salem, NC, USA
1
and Department of Pharmacology,University ofToronto,
Toronto, Canada
2
ABSTRACTadb_456 1..11
Methylphenidate (MPH) is a commonly abused psychostimulant prescribed for the treatment of attention deficit
hyperactivity disorder. MPH has a mechanism of action similar to cocaine (COC) and is commonly characterized as a
dopamine transporter (DAT) blocker. While there has been extensive work aimed at understanding dopamine (DA)
ner ve terminal changes following COC self-administration, very little is known about the effects of MPH self-
administration on the DA system. We used fast scan cyclic voltammetry in nucleus accumbens core slices from animals
with a 5-day self-administration history of 40 injections/day of either MPH (0.56 mg/kg) or COC (1.5 mg/kg) to
explore alterations in baseline DA release and uptake kinetics as well as alterations in the interaction of each compound
with the DAT. Although MPH and COC have similar behavioral effects, the consequences of self-administration on DA
system parameter s were found to be divergent. We show that COC self-administration reduced DAT levels and maximal
rates of DA uptake, as well as reducing electrically stimulated release, suggesting decreased DA terminal function. In
contrast, MPH self-administration increased DAT levels, DA uptake rates and DA release, suggesting enhanced terminal
function, which was supported by findings of increased metabolite/DA tissue content ratios. Tyrosine hydroxylase
messenger RNA, protein and phosphorylation levels were also assessed in both groups. Additionally, COC self-
administration reduced COC-induced DAT inhibition, while MPH self-administration increased MPH-induced DAT
inhibition, suggesting opposite pharmacodynamic effects of these two drugs. These findings suggest that the factor s
governing DA system adaptations are more complicated than simple DA uptake blockade.
Keywords Cocaine, dopamine transpor ter, dopamine, methylphenidate, nucleus accumbens, self-administration.
Correspondence to: Sara R. Jones, Department of Physiology and Pharmacology, Wake Forest School of Medicine, Winston Salem, NC 27157, USA. E-mail:
srjones@wakehealth.edu
INTRODUCTION
Methylphenidate (MPH), the active ingredient in medica-
tion [Ritalin® (Novartis; East Hanover, NJ, USA)] used in
the treatment of attention deficit hyperactivity disorder
(ADHD) and narcolepsy, is prone to diversion for non-
medical use. MPH abuse in non-ADHD individuals has
become increasingly prevalent through oral, intranasal
or intravenous (i.v.) routes of administration (Sherman,
Hudson & Pierson 1987; Teter et al. 2006). The drug is
used for cognitive enhancement and to ‘get high’,
causing effects indistinguishable from cocaine (COC)
when taken i.v. or intranasally (Sherman et al. 1987;
Mor ton & Stockton 2000; Rush & Baker 2001; Teter et al.
2006). In 2008, 4.8 million people reported abusing
MPH in the past year, compared with 5.3 million for COC,
suggesting that both of these drugs pose a significant
threat to public health (SAMHSA, National Survey on
Drug Use and Health, 2008).
From a behavioral standpoint, MPH and COC share a
very similar pre-clinical profile. In rats, the discriminative
stimulus effects of MPH and COC are nearly identical
as seen by MPH’s ability to fully substitute for COC (Li,
Campbell & Katz 2006). Several i.v. self-administration
studies in rats have demonstrated that COC and MPH
have similar reinforcing effects. Both compounds main-
tain high rates of operant responding, and extended
access to MPH results in an escalation of intake similar to
COC self-administration (Ahmed & Koob 1998; Marusich
et al. 2010). With regard to reinforcing efficacy, doses of
ORIGINAL ARTICLE
bs_bs_banner
Addiction Biology
doi:10.1111/j.1369-1600.2012.00456.x
© 2012 The Authors, Addiction Biology © 2012 Society for the Study of Addiction Addiction Biology
MPH or COC at the peak of their respective progressive
ratio (PR) dose–response curves engender similar break-
points, indicating that the motivation to take each drug is
comparable (Roberts, Morgan & Liu 2007; Marusich et al.
2010; Calipari et al. unpublished).
Like many psychostimulants, COC and MPH exert
their rewarding and reinforcing properties primarily via
their ability to bind to dopamine transporters (DATs)
and inhibit dopamine (DA) uptake, elevating DA in the
nucleus accumbens (Di Chiara & Imperato, 1988; Woods
& Meyer 1991; Gerasimov et al. 2000). For example, a
triple mutation in the second transmembrane domain of
the DAT, which reduces affinity for MPH and COC, also
abolishes conditioned place preference (Chen, Han & Gu
2005; Chen et al. 2006; Tilley & Gu, 2008a,b), highlight-
ing the role of DAT inhibition in their rewarding proper-
ties. Acute inhibition of DA uptake by psychostimulants
consistently results in enhanced DA signaling, but
repeated or prolonged exposure to such drugs can lead to
compensatory changes in presynaptic DA terminal func-
tion as well as alterations in the pharmacological actions
of the drugs themselves (Biederman & Spencer, 2002;
Bouffard et al. 2003; Cadet et al. 2009).
The neurobiological effects of MPH self-
administration on the DA system remain to be elucidated;
however, COC effects on the DA system have been well
characterized, and we hypothesized that MPH, a DAT
blocker with a similar mechanism of action, would
produce similar changes. In previous studies, COC
self-administration resulted in lower basal levels of DA,
decreased stimulated DA release and modestly decreased
maximal rate of uptake (V
max
) (Mateo et al. 2005;
Ferris et al. in press, 2011). In addition to baseline DA
system alterations, COC self-administration also resulted
in a decreased potency of COC in the nucleus accumbens,
producing a marked tolerance to its DA-elevating and
DAT-inhibiting effects (Hurd et al. 1989; Mateo et al.
2005; Ferris et al. in press, 2011). Taken together, these
data, suggest an overall hypodopaminergic and less
responsive DA state following COC self-administration.
Because MPH is increasingly becoming a drug of
abuse (Botly et al. 2008; Marusich & Bardo, 2009;
Bur ton, Nobrega & Fletcher 2010; Marusich et al. 2010),
but the neurochemical alterations following contingent
administration have yet to be characterized, we chose to
compare the behavioral and neurochemical effects of
MPH self-administration with self-administration of an
extensively studied DA uptake blocker, COC. The pur-
pose of this study was to systematically evaluate the
neurochemical consequences of MPH and COC self-
administration by evaluating baseline presynaptic DA
system parameters such as release and uptake rate, as
well as the ability of COC and MPH to inhibit the reup-
take of endogenous DA. Surprisingly, MPH produced a
distinctly different pattern of results from COC, suggest-
ing that MPH does not behave as a prototypical DA
uptake blocker. The present results suggest that the
factors governing DA system adaptations are more com-
plicated than simple DA uptake blockade.
MATERIALS AND METHODS
Animals
Male, Sprague Dawley rats (375–400 g; Harlan Labora-
tories, Frederick, MD, USA) were maintained according to
the National Institutes of Health (NIH) guidelines in
Association for Assessment and Accreditation of Labora-
tory Animal Care accredited facilities. The experimental
protocol was approved by the Institutional Animal Care
and Use Committee at Wake Forest School of Medicine.
Self-administration
Rats were anesthetized with ketamine (100 mg/kg) and
xylazine (10 mg/kg), implanted with chronic indwelling
jugular catheters, and trained for i.v. self-administration
as previously described (Roberts & Goeders 1989). Fol-
lowing surgery, animals were singly housed, and all self-
administration sessions took place in the home cage.
Each animal was maintained on a reverse light cycle
(3:00 am lights off; 3:00 pm lights on), and all self-
administration procedures occurred during the active/
dark cycle. Sessions were 6 hours in length and were
terminated at the end of the 6 hours or after 40 injections
of drug. Animals self-administered either COC (1.5 mg/
kg/injection over 4 seconds) or MPH (0.56 mg/kg/
injection over 4 seconds) on a fixed ratio one schedule of
administration. Concurrent with the start of each injec-
tion, the lever retracted and a stimulus light was activated
for 20 seconds to signal a time-out period. Under these
conditions, animals acquired a stable pattern of COC
or MPH self-administration within 1–5 days. For self-
administering animals, acquisition (day 1) was counted
when the animal reached 35 or more responses. There
was no significant difference between groups in the injec-
tions received before acquisition criteria was met. Follow-
ing acquisition, the animals were given access to 40
injections per day for a period of five consecutive days for
both the COC and MPH self-administration experiments.
Fixed ratio self-administration allows animals to
titrate drug intake by spacing injections to maintain a
preferred brain concentration of drug (Norman & Tsibul-
sky, 2006). We compared doses of MPH and COC that
were behaviorally equivalent. Because of the significant
difference in the half-life of MPH, which is approximately
two times longer than COC (Huff & Davies 2002; Weikop,
Egestad & Kehr 2004), we compared 0.56 mg/kg
MPH and 1.5 mg/kg COC, doses that produce maximal
2 Erin S. Calipari et al.
© 2012 The Authors, Addiction Biology © 2012 Society for the Study of Addiction Addiction Biology
responding on a PR schedule of reinforcement (Richard-
son & Roberts 1996; Mar usich et al. 2010). To confirm
behavioral equivalence, we also measured the time to
complete session, interdose interval and rate of intake.
Control animals were naïve rats housed under the
same reverse light–dark light cycle for at least 1 week
prior to neurochemical analysis.
Fast scan cyclic voltammetry in brain slices
Animals were sacrificed 24 hours after commencement
of the last session, during the dark phase of the light
cycle. Coronal brain sections 400-mm thick, containing
the nucleus accumbens core, were cut using a vibrating
tissue slicer. A carbon fiber electrode was placed approxi-
mately 75 mm below the surface of the slice in close prox-
imity to a bipolar-stimulating electrode in the nucleus
accumbens core. DA release was evoked by a single elec-
trical pulse (300 mA, 4 ms, monophasic) applied every 5
minutes. Extracellular DA was recorded using fast scan
cyclic voltammetry (FSCV) by applying a triangular
waveform (-0.4 to +1.2 to -0.4 V versus silver/silver
chloride, 400 V/second) to the electrode every 100 ms.
Once the extracellular DA response was stable for three
consecutive stimulations, individual brain slices were
treated with either COC or MPH (0.3–30 mM), with
increasing concentrations cumulatively added after
stable responses were recorded, approximately every
45 minutes.
Western blot hybridization
Tissue sections were dissected 24 hours after commence-
ment of the last self-administration session, and homog-
enized in ice-cold lysis buffer [10 mM Tris, 2% sodium
dodecyl sulfate (SDS), 1 mM ethylenediaminetetraacetic
acid (EDTA) ] and spun in a centrifuge at 13 000 g for 20
minutes to remove cellular debris. Bicinchoninic acid
(BCA) protein assays (Thermo Scientific, Rockford, IL,
USA) were used to determine the protein content of each
sample. Proteins were separated on 10% reducing SDS–
polyacrylamide gel electrophoresis gels (Invitrogen,
Carlsbad, CA, USA) and transferred to hydrophobic poly-
vinylidene difluoride membranes (Bio-Rad, Hercules, CA,
USA). For estimation of the molecular weight of the
protein bands, Precision Plus protein standards (10–
250 kDa, Bio-Rad) were run in parallel with the samples
on gels. Non-specific binding was blocked by incubation
with blocking buffer (5% non-fat milk in tris-buffered
saline with tween-20) for 30 minutes before incubation
with primary antibodies: rabbit anti-DAT antibody (Milli-
pore, Temecula, CA, USA; 1 : 5000 dilution), rabbit
antiphosphorylated tyrosine hydroxylase (TH) Ser19,
Ser31, Ser40 (PhosphoSolutions, Aurora, CO, USA;
1 : 2000) and mouse anti-TH (Millipore; 1 : 5000) at 4°C
overnight. Membranes were then incubated with either
secondary goat antirabbit horseradish peroxidase-
conjugated antibody (Millipore; 1 : 10 000, Rockland,
Gilber tsville, PA, USA; 1 : 5000) or donkey antimouse
antibody (Invitrogen; 1 : 5000). Immunoreactive prod-
ucts were visualized by either chemiluminescence (Pico
chemiluminescent substrate, Thermo Scientific) or by
infrared detection using the Odyssey LI-COR Infrared
Imaging System and quantified using ImageJ (NIH).
Protein loading was visualized by incubation with either
a monoclonal antibody to b-actin (Abcam, Cambridge,
MA, USA; 1 : 10 000) or mouse anti-glyceraldehyde-3-
phosphate dehydrogenase (Sigma, St. Louis, MO, USA;
1 : 6000).
Tissue content
The striatum was dissected, snap-frozen, and samples
(10–30 mg/sample wet weight) were homogenized in
250 ml of 0.1 M HClO
4
and analyzed for protein con-
centration by the BCA method (Thermo Scientific).
Extracts were centrifuged and the supernatants removed
and analyzed for DA and its metabolites 3,4-
dihydroxyphenylacetic acid (DOPAC) and homovanillic
acid (HVA) using high-performance liquid chromatogra-
phy (HPLC) coupled to electrochemical detection at
+220 mV (ESA Inc., Chelmsford, MA, USA) and sepa-
rated on a Luna 100 ¥ 3.0 mm C
18
3 mm HPLC column
(Phenomenex, Torrance, CA, USA). The mobile phase
consisted of 50 mM citric acid, 90 mM sodium dihydro-
gen phosphate, 1.7–2.0 mM 1-octanesulfonic acid,
50 mM EDTA, 10–12% acetonitrile and 0.3% triethy-
lamine in a volume of 1 l (pH 3.0). Analytes were quan-
tified using PowerChrom software (eDAQ Inc, Colorado
Spring, CO, USA) and a calibration curve.
Quantitative Polymerase Chain Reaction (PCR)
To obtain RNA from tissues, snap-frozen ventral tegmen-
tal area (VTA) tissue sections were homogenized in cold
TRI-Reagent (BioShop Canada Inc., Burlington, ON,
Canada) as described previously (Hu, Caron & Sieber-
Blum 2009). Optical density readings at 260/280 nm
were used to determine the quality and concentration of
the resuspended RNA. For reverse-transcriptase PCR,
1 mg of RNA was used to obtain complementary DNA
using SuperScript III Reverse Transcriptase (Invitrogen)
following the manufacturer’s instructions. Relative
quantification of gene targets was obtained using the
GoTaq® qPCR Master Mix (Promega, Fitchburg,WI,
USA) on the Applied Biosystems 7500 Real-Time PCR
System. Phosphogycerlate kinase 1 (PGK1) was used as
the reference gene (forward primer: ACCAAAGGATC
AAGGCTGCTGTC; reverse primer: GACGGCCCAGGTGG
CTCATA). DAT (forward primer: CCTGGTTCTACGGCG
DA changes after MPH or COC 3
© 2012 The Authors, Addiction Biology © 2012 Society for the Study of Addiction Addiction Biology
TCCAGC; reverse primer: GCCGCCAGTACAGGTTGGGT)
and TH (forward primer: TTGAAGGAGCGGACTGGCT
TCCA; reverse primer: TGGCCAGAAAATCACGGGCGG)
were used as the target genes. Target genes were relatively
quantified using the DDCt method, and are represented as
percentage control normalized to PGK1.
Data analysis
DA current was converted to concentration by calibration
with 3 mM DA at the end of each experiment. For all
analyses of FSCV data, Demon voltammetry and analysis
software was used (Yorgason, España & Jones 2011). To
evaluate the effects of MPH and COC self-administration
on baseline DA system kinetics, evoked levels of DA were
modeled using Michaelis–Menten kinetics, as a balance
between release and uptake (Yorgason et al. 2011). For
COC and MPH dose–response curves, apparent K
m
,a
measure of apparent affinity of DA for the DAT, was used
to determine changes in ability of the psychostimulants
to inhibit DA uptake in the nucleus accumbens core rela-
tive to baseline.
Statistics
Graph Pad Prism (version 4, La Jolla, CA, USA) was used
to statistically analyze data sets and create graphs. Base-
line voltammetry, Western blot hybridization and PCR
data were compared across groups using a two-tailed
Student’s t-test. Data obtained after perfusion of COC or
MPH were subjected to a two-way analysis of variance
(ANOVA) with experimental group and concentration of
COC or MPH as the factors. When significant interactions
or main effects were obtained (P < 0.05), differences
between groups were tested using Bonferroni post hoc
tests. Behavioral data were subjected to a two-way
ANOVA with experimental group and hours to complete
self-administration session as the factors.
RESULTS
COC and MPH intake increases over time
Each self-administration session was 6 hours in length
and consisted of 40 injections per session. Time to com-
plete 40 injections of COC (n = 8) significantly decreased
over the five sessions (F
(4,7)
= 8.858, P < 0.01) (Fig. 1a,
top). In addition, the inter-infusion interval was also sig-
nificantly decreased across sessions, demonstrating an
escalation in rate of intake over sessions (F
(4,7)
= 8.180,
P < 0.01).
MPH self-administration resulted in nearly identical
changes in behavior. MPH self-administration (n = 11)
engendered an increase in rate of lever pressing over
self-administration sessions (F
(4,10)
= 7.956, P < 0.01)
(Fig. 1a, bottom). The same trend was observed with
inter-infusion interval, demonstrating that the rate of
intake also escalates across MPH self-administration
sessions (F
(4,10)
= 7.041, P < 0.01).
Thus, the effects of MPH (n = 11) and COC (n = 8)
self-administration on behavioral responding for dr ug
were not significantly different as the two compounds
produced the same interdose intervals and the same esca-
lation (decreases in time to complete sessions) over days
(Fig. 1b).
Opposite effect of MPH and COC self-administration on
baseline DA system kinetics
Baseline DA system kinetics were measured using FSCV
and DAT levels were determined using Western blot
hybridization. COC self-administration (n = 11) engen-
dered a decrease in electrically stimulated DA release as
compared with naïve control animals (n = 22) (t
31
=
2.348, P < 0.05, Fig. 2a, center; Fig. 2b). Also, after COC
Figure 1 Escalation in rate of cocaine (COC) and methylphenidate
(MPH) self-administration (SA). (a) Representative SA plots from
individual animals; each tick mark represents an infusion that was
obtained. Five sessions with a maximum of 40 injections of either
COC (1.5 mg/kg/injection) or MPH (0.56 mg/kg/injection) resulted in
significant increases in rate of intake in over sessions. (b)The increase
in rate of intake of was not significantly different between COC (
)
and MPH (
)
4 Erin S. Calipari et al.
© 2012 The Authors, Addiction Biology © 2012 Society for the Study of Addiction Addiction Biology
self-administration there was a significant decrease in
maximal rate of DA uptake (t
30
= 2.719, P < 0.05)
(Fig. 2a, center; Fig. 2c). This decrease in maximal rate of
uptake was accompanied by a decrease in DAT density in
the COC group (n = 5) compared with controls (n = 3),
as measured by Western blot hybridization (t
6
= 2.182,
P < 0.05) (Fig. 3a, center; Fig. 3b). Relative expression
levels of DAT messenger RNA (mRNA) as measured by
quantitative PCR in the VTA (n = 12) were not signifi-
cantly different from controls (n = 18).
Conversely, MPH self-administration resulted in
increases in all DA system measurements. Stimulated
DA release in the MPH group (n = 11) was increased
compared with controls (n = 22) (t
31
= 2.076, P < 0.05)
(Fig. 2a, right; Fig. 2b). Maximal rate of DA uptake was
also significantly increased in MPH (n = 7) versus control
animals (n = 22) (t
24
= 2.719, P < 0.05) (Fig. 2a, right;
Fig. 2c). Total DAT levels were significantly increased
following MPH self-administration (n = 4) compared
with controls (n = 5) (t
7
= 3.532, P < 0.01) (Fig. 3a,
right; Fig. 3b). In addition, DAT mRNA levels were
assessed in the VTA. MPH group levels (n = 18) were not
significantly different than control animals (n = 18),
suggesting that the increases in protein expression are
not due to increased synthesis of new protein.
Differential effects of COC and MPH self-administration
on tissue content of DA and metabolite
Postmortem tissue content of DA and its metabolites
DOPAC and HVA were assessed in the striatum following
COC and MPH self-administration (Fig. 4a). COC self-
administration (n = 5) had no effect on DA or any of its
metabolites as compared with controls (n = 6) (Fig. 4a).
MPH self-administration (n = 9) resulted in a significant
decrease in DA tissue content as compared with control
animals (n = 6) (t
13
= 3.598, P < 0.01) (Fig. 4a). While
DA tissue content was significantly decreased, there was
no significant difference between control and MPH self-
administrationin the metabolitesHVA or DOPAC (Fig. 4a).
Metabolite to monoamine ratios were assessed in the
striatum to determine changes in functional activity of
the DA neurons in this region (Fig. 4b). COC self-
administration (n = 5) did not produce significant differ-
ences in either DOPAC/DA or HVA/DA ratios as compared
with controls (n = 6) (Fig. 4b). MPH self-administration
(n = 9) resulted in a significant increase in the DOPAC/DA
ratio as compared with control animals (n = 6)
(t
13
= 2.852, P < 0.01), and although not significant,
there was a trend toward an increased HVA/DA ratio
(t
13
= 2.144, P = 0.0515) (Fig. 4b).
Figure 2 Baseline dopamine (DA) system kinetics following methylphenidate (MPH) and cocaine (COC) self-administration (SA). (a)
Representative traces of electrically evoked DA signals in nucleus accumbens core slices from control, MPH SA or COC SA animals.Traces
show decreased maximal rate of uptake (rate of return to baseline) and DA release (peak height max) following COC SA and increased
uptake and release following MPH SA. Insets: background-subtracted cyclic voltammograms indicate signal is DA. (b) Grouped data showing
that stimulated DA release is reduced after COC SA and increased after MPH SA. (c) Grouped data showing that the maximal rate of DA
uptake was decreased after COC SA and increased after MPH SA. *P < 0.05 versus control animals
DA changes after MPH or COC 5
© 2012 The Authors, Addiction Biology © 2012 Society for the Study of Addiction Addiction Biology
No effect of MPH or COC self-administration on TH
protein, mRNA, or phosphorylation levels
To determine if changes in stimulated DA release could be
due to differences in TH, mRNA levels of TH were assessed
in the VTA of COC and MPH groups using quantitative
PCR. COC self-administration (n = 18) resulted in a sig-
nificant increase in TH mRNA levels as compared with
controls (n = 12) (t
28
= 5.704, P < 0.0001) (see Support-
ing Information, Fig. S1a). MPH self-administration
(n = 18) also significantly increased levels of TH mRNA in
the VTA versus controls (n = 18) (t
34
= 2.480, P < 0.05)
(see Supporting Information, Fig. S1a), although the
levels were higher in COC (n = 12) than MPH groups
(n = 18) (t
28
= 4.475, P < 0.0001) (see Supporting Infor-
mation, Fig. S1a). However, this difference was not
reflected in protein levels (see Supporting Information,
Fig. S1b–d), highlighting the well-known complex trans-
lational regulation of this protein (Tank et al. 2008).
TH protein levels as well as two phosphorylation sites
were quantified via Western blot hybridization (see Sup-
por ting Information, Fig. S1b). COC self-administration
(n = 5) did not change total TH levels or phosphorylation
at either serine 40 (THp Ser40) or 19 (THp Ser19) in the
striatum (see Supporting Information, Fig. S1b, left; S1c)
or VTA (see Supporting Information, Fig. S1b right; S1d)
as compared with controls (n = 6). Serine 31 was not
quantifiable in any samples. Similarly, MPH self-
administration (n = 7) also resulted in no changes in TH,
THp Ser40 or THp Ser19, in either the striatum (see Sup-
por ting Information, Fig. S1b, left; S1c) or the VTA (see
Suppor ting Information, Fig. S1b; S1d) as compared with
controls (n = 6).
MPH self-administration resulted in increased MPH
potency, while COC potency remained unchanged
Cumulative dose–response curves of COC and MPH were
collected to determine changes in the compounds’ ability
to inhibit DA uptake following MPH self-administration.
The Michaelis–Menten measure of DA affinity for the
transporter, apparent K
m
, was used to measure changes
in the ability of a drug to inhibit DA uptake relative
to baseline. Following MPH self-administration (n = 4),
there was a significant main effect of MPH treatment
Figure 3 Western blot hybridization for the dopamine transporter
(DAT) after cocaine (COC) or methylphenidate (MPH) self-
administration (SA). (a) Representative photographs of Western
blots on tissue from the nucleus accumbens core region of control,
COC SA and MPH SA groups. (b) COC SA reduced DAT levels
while MPH SA increased DAT levels in the nucleus accumbens.
Protein expression levels were determined as the ratio of DAT to
the level of b-actin and are reported as percent control values.
*P < 0.05 versus control group
Figure 4 Tissue content of dopamine (DA) and metabolites (a) in
the striatum of cocaine (COC) and methylphenidate (MPH) self-
administration (SA) groups. The MPH group had significantly lower
DA tissue content levels with no differences in metabolite levels.
Tissue content levels of DA and metabolites were unaffected by
COC SA. (b) Metabolite/monoamine ratios, a measure of functional
activity, in MPH and COC groups as compared with controls. COC
SA did not affect ratios, while MPH increased DOPAC/DA ratio.
*P < 0.05 versus control group
6 Erin S. Calipari et al.
© 2012 The Authors, Addiction Biology © 2012 Society for the Study of Addiction Addiction Biology
as compared with controls (n = 4) (F
(4,1)
= 23.74,
P < 0.001), with significant increases in the maximal
apparent K
m
of MPH self-administration groups at 30 mM
(P < 0.001) (Fig. 5d). MPH self-administration resulted
in a leftward shift in the dose–response curve, indicating
that MPH potency is increased following MPH
self-administration.
Cumulative COC dose–response curves were per-
formed to determine if there was a shift in the potency of
COC following MPH self-administration. There was no
change in the dose–response curve for COC (n = 3) as
compared with controls (n = 3), indicating that COC’s
ability to inhibit DA uptake in the nucleus accumbens
core remained unchanged after MPH self-administration
(Fig. 5e).
COC self-administration resulted in decreased COC
potency, while MPH potency remained unchanged
COC self-administration resulted in an overall group
effect (F
(4,1)
= 13.85, P < 0.01) and a rightward shift in
the dose–response curve for COC (n = 3) as compared
with controls (n = 4), signifying a significant decrease in
COC-induced DA uptake inhibition (Fig. 6e). Bonferroni
analysis demonstrated a significant effect at 30 mM
(P < 0.001).
Conversely, following 5 days of COC self-
administration, there was no significant change in MPH’s
DA uptake-inhibiting effects (Fig. 6d), indicating that
MPH (n = 5) potency remained unaltered as compared
with controls (n = 3) following repeated administration
of COC.
DISCUSSION
MPH and COC are both DAT inhibitors and produce
similar acute DA-elevating effects. Despite the close simi-
larities in self-administration behavior, the current study
demonstrates that MPH and COC intake can produce
strikingly different effects on DA system kinetics and
drug potency. Consistent with previous studies, 5 days of
high-dose COC self-administration resulted in decreased
DAT density, V
max
and stimulated DA release (Mateo
et al. 2005; Ferris et al. in press, 2011). In contrast, MPH
self-administration increased DAT density, V
max
and
stimulated DA release. In addition to robust differences
in baseline DA nerve-terminal kinetics, COC self-
administration resulted in a decreased potency of COC
Figure 5 Significantly greater dopamine (DA) uptake inhibition by methylphenidate (MPH), but not cocaine (COC), after MPH self-
administration (SA).The effect of COC and MPH applied to nucleus accumbens core slices on representative electrically evoked (one pulse)
DA signals is shown in (a) Pre-drug (b) 10 mM MPH and (c) 10 mM COC from control and MPH self-administering rats. Representative plots
are shown as normalized peak height; control and MPH SA animals are overlaid. MPH-induced DA uptake inhibition is present in naïve animals
but significantly increased in MPH self-administering rats as depicted by a longer time course of the signal to return to baseline; there is no
effect of MPH SA on COC uptake inhibition. Group data showed that MPH inhibited DA uptake to a greater extent (d), and that COC uptake
is unaffected (e) following 5 days of MPH SA (
) compared with control rats ( ), with uptake inhibition measured as apparent K
m
(***P < 0.001, app., apparent)
DA changes after MPH or COC 7
© 2012 The Authors, Addiction Biology © 2012 Society for the Study of Addiction Addiction Biology
to inhibit DA uptake, with no change in potency of
MPH. Conversely, MPH self-administration resulted in
increased potency of MPH and no change in COC
potency. These profound differences in the neurobiologi-
cal effects of two DA uptake inhibitors provide evidence
that the DA-elevating effects of psychostimulants are not
solely, or even primarily, responsible for altered DA system
function after repeated exposure.
The goal of this study was to compare DA system alter-
ations that occurred following 5 days of COC or MPH
self-administration. One challenge was to select compa-
rable doses of these two drugs with different time courses
and binding affinities. The doses we chose for MPH
(0.56 mg/kg) and COC (1.5 mg/kg) are at the peak of the
respective PR dose–response curves, indicating that these
are the maximally reinforcing dose of each drug. The
selected doses of these two drugs produced similar inter-
injection intervals within a session and produced escala-
tion in rates of intake across sessions, indicating that
these doses are behaviorally equivalent. Therefore,
although there are differences in half-life and potency, we
were able to equate the behavioral responses to these
drugs in order to compare the neurochemical conse-
quences of MPH and COC self-administration.
Despite almost identical behavioral profiles, baseline
changes in V
max
and stimulated DA release following MPH
and COC self-administration were found to be opposite.
COC self-administration resulted in a decreased V
max
and
decreased stimulated release, effects that have been
obser ved previously with the same paradigm (Ferris et al.
in press, 2011). DAT density was found to be decreased
following COC self-administration, suggesting that the
obser ved decrease in uptake rate was due to reduced
numbers of DA transpor ters. The alterations in DAT
density following self-administration are most likely due
to differences in protein processing as there were no
obser ved changes in mRNA levels in COC or MPH self-
administration groups. In the literature, there are reports
of increased, decreased and unaltered DA uptake rates
following COC self-administration (Wilson & Kish 1996;
Mateo et al. 2005; Ramamoor thy et al. 2010; Ferris et al.
2011), and clearly, different self-administration para-
digms produce different neurobiological effects, empha-
sizing the need for equating doses as well as injection
frequency, timing and duration. Self-administration of
MPH resulted in an increase in V
max
and DAT density as
well as an increase in stimulated DA release in the
nucleus accumbens core, demonstrating that two drugs
that cause identical self-administration behavior are
capable of causing opposite neurobiological adaptations.
To address the differences in stimulated DA release
between COC and MPH groups, various markers of
Figure 6 Significant reduction in dopamine (DA) uptake inhibition by cocaine (COC), but not methylphenidate (MPH), after COC
self-administration (SA).The effect of COC and MPH on representative electrically evoked (one pulse) DA signals in nucleus accumbens core
slices is shown. (a) Pre-drug (b) 10 mM MPH and (c) 10 mM COC from control and COC SA rats. Representative plots are represented as
percent peak height; control and COC SA animals are overlaid. COC-induced DA uptake inhibition is significantly reduced in COC
self-administering r ats as evidenced by a shorter time course of the signal’s return to baseline; there is no effect of COC SA on MPH uptake
inhibition. Group data showed that MPH uptake is unaffected (d) but DA uptake inhibition by COC is reduced (e) following 5 days of COC
SA (
) compared with control rats ( ), measured as apparent K
m
(***P < 0.001, app., apparent)
8 Erin S. Calipari et al.
© 2012 The Authors, Addiction Biology © 2012 Society for the Study of Addiction Addiction Biology
presynaptic function were evaluated. DA tissue content
was found to be decreased in the MPH group, with corre-
sponding increases in metabolite/DA ratios, indicating
increased functional activity, consistent with the
increased DA release in this group. No changes were
found in the COC group. A number of factors could be
responsible for the observed difference between COC and
MPH. For example, MPH has been shown to redistribute
vesicular DA pools (Volz et al. 2008) and may alter both
release and tissue content directly. Also, MPH has a
longer half-lif e of uptake inhibition than COC, which in
combination with the increased release and ability to
mobilize DA vesicles, could lead to a reduced ability to
refill vesicular stores and explain the difference in tissue
content between the two groups. These findings further
emphasize the differential impact of these two psycho-
stimulant blockers on the DA system.
We initially postulated that the MPH-induced DA
release and tissue content changes might be explained by
alterations in TH, the rate-limiting enzyme in DA synthe-
sis, but no differences were found in protein or phospho-
rylation levels indicating that TH is most likely not driving
the changes. There were, however, increases in TH mRNA
levels in both self-administration groups, indicating that
either post-translational processing or protein degrada-
tion may be altered.
With regard to the interaction of stimulants with the
DAT, previous work found reduced pharmacological
effects of COC in the nucleus accumbens after high-dose
COC self-administration (Hurd et al. 1989; Mateo et al.
2005; Ferris et al. 2011). In order to determine if the
effects of COC self-administration were unique to COC or
common to all psychostimulants, Ferris et al. (2011)
determined that the effects of amphetamine (AMPH) on
DA uptake in nucleus accumbens core slices remained
unchanged following COC self-administration. The same
study also showed that self-administration of AMPH had
no effect on either COC or AMPH potency in slices, sug-
gesting that COC self-administration produced COC-
specific pharmacological changes. We hypothesized that
AMPH did not alter the pharmacology of the DAT
because it was recognized as a substrate/releaser, while
COC, a pure uptake blocker, induced allosteric modifica-
tions resulting in altered pharmacology. Next, it was
reasonable to test whether self-administration of a struc-
turally dissimilar uptake inhibitor, MPH, would also
produce altered DAT pharmacology. The current results
demonstrate that MPH self-administration produces
opposite effects from COC self-administration, with
increased MPH potency on slices but no change in COC
effects. Thus, it appears that DAT pharmacology is altered
according to individual drug interactions with the DAT
and not according to drug class, such as blocker or
releaser.
While MPH and COC are both classified as uptake
blockers, they have different chemical structures, which
may account for the disparate neurochemical changes
that occur following self-administration. MPH is structur-
ally related to AMPH, while COC is a tropane (Uhl, Hall &
Sora 2002; Volkow et al. 2002; Han & Gu 2006; Heal,
Cheetham & Smith 2009). MPH, although typically cat-
egorized as a DAT blocker, has unique properties that are
distinct from both releasers and blockers. Studies using
cell culture and striatal tissue preparations have shown
that MPH exhibits binding properties of both blockers
and releasers (Wayment et al. 1999; Dar, Mayo & Uhl
2005). MPH is not a DAT substrate, as it is not trans-
por ted into cells (Sonder s et al. 1997); however, some
studies have shown that MPH has the ability to promote
reverse-transport of DA through the DAT at very high
doses (Heal et al. 1996; Russell et al. 1998; Sproson et al.
2001). It is clear that DAT inhibition-induced increases in
extracellular DA levels do not explain the distinct adapta-
tions produced by the two drugs studied here, and we
hypothesize that drug interactions with specific regions of
the DAT may explain the differences observed.
Changes in DAT density and V
max
do not explain the
potency changes found with MPH and COC. With regard
to COC self-administration, in the present study we show
decreases in DAT protein levels and V
max
for DA uptake
after COC self-administration. However, in previous
studies with COC self-administration, V
max
was either
increased or unchanged, with the same reduction in
potency for DA uptake inhibition in slices (Mateo et al.
2005; Ferris et al. 2011). With regard to MPH self-
administration, to our knowledge this is the first study
examining neurochemical changes and thus we cannot
compared with other regimens; however, the Michaelis–
Menten-based kinetic model used to fit the DA release and
uptake profiles takes into account any changes in base-
line uptake rate using the pre-drug electrically stimulated
DA overflow curves, and this allows the effects of uptake
inhibition to be separated from changes in maximal
uptake rate. This indicates that the V
max
, which is corre-
lated with DA transporter number, cannot account for
the observed alterations in DA uptake inhibition by both
COC and MPH. Thus, these effects are most likely due to
allosteric alterations in the DA transporter, making it
more or less sensitive to inhibition by specific drugs.
These DA system alterations induced by self-
administration of COC or MPH have important implica-
tions for the subsequent abuse or co-abuse of other
psychostimulants. MPH and COC are dependent upon
their actions at the DAT for their reinforcing effects, and
changes that occur to the DA system would be expected to
affect the reinforcing potency or efficacy of other psycho-
stimulant drugs (Chen et al. 2005, 2006; Tilley &
Gu, 2008a,b). Because psychostimulants that are DA
DA changes after MPH or COC 9
© 2012 The Authors, Addiction Biology © 2012 Society for the Study of Addiction Addiction Biology
releasers rely on DATs to have their reverse-transport
effects, the present results from MPH self-administering
animals would predict greater behavioral potency. Con-
sistent with this prediction, previous studies have already
demonstrated that MPH self-administration, as well as
increasing DAT levels by transgenic overexpression,
results in increased AMPH-induced locomotor activity
(Yang, Swann & Dafny 2003; Salahpour et al., 2008;
Bur ton et al. 2010). In ad dition, epidemiological studies
have provided evidence that individuals who abuse MPH
are more likely to abuse other substances and to have
problems with drug use (Barrett et al. 2005; Teter et al.
2006; Wilens et al. 2008). Given the widespread abuse of
MPH and the potential risk for greater stimulant effects of
other drugs, further studies of the consequences of MPH
self-administration will be important.
Acknowledgements
This work was funded by NIH grants
R01DA024095, RO1DA03016 (SRJ), R01DA014030
(DCSR), T32DA007246 (MJF), T32DA007246 and
F31DA031533(ESC), and a Canadian Institutes of Health
Research (CIHR) grant (AS).
Author Contribution
ESC, MJF, SRJ and DCSR were responsible for the study
concept and design. JRM and ESC contributed to the self-
administration experiments. ESC, MJF and JRM contrib-
uted to the acquisition of voltammetric data. ESC and KB
performed the Western blot analysis. KB performed all
PCR experiments. ESC, MJF and AS assisted with data
analysis and interpretation of findings. ESC drafted the
manuscript. MJF, AS, SRJ and DCSR provided critical revi-
sion of the manuscript for important intellectual content.
All authors critically reviewed content and approved the
final version for publication.
References
Ahmed SH, Koob GF (1998) Transition from moderate to exces-
sive drug intake: change in hedonic set point. Science
282:298–300.
Barrett SP, Darredeau C, Bordy LE, Pihl RO (2005) Characteris-
tics of methylphenidate misuse in a university student sample.
Can J Psychiatry 50:457–461.
Biederman J, Spencer T (2002) Methylphenidate in treatment of
adults with attention-deficit/hyperactivity disorder. J Atten
Disord 6:S101–S107.
Botly LC, Burton CL, Rizos Z, Fletcher PJ (2008) Characte-
rization of methylphenidate self-administration and reinstate-
ment in the rat. Psychopharmacology (Berl) 199:55–66.
Bouffard R, Hechtman L, Minde K, Iaboni-Kassab F (2003) The
efficacy of 2 different dosages of methylphenidate in treating
adults with attention-deficit hyperactivity disorder. Can J
Psychiatry 48:546–554.
Burton CL, Nobrega JN, Fletcher PJ (2010) The effects of adoles-
cent methylphenidate self-administration on responding for a
conditioned reward, amphetamine-induced locomotor activ-
ity, and neuronal activation. Psychopharmacology (Berl)
208:455–468.
Cadet JL, McCoy MT, Cai NS, Krasnova IN, Ladenheim B, Beau-
vais G, Wilson N, Wood W, Becker KG, Hodges AB (2009)
Methamphetamine preconditioning alter s midbrain tran-
scriptional responses to methamphetamine-induced injury in
the rat striatum. PLoS ONE 12:e7812.
Chen R, Han DD, Gu HH (2005) A triple mutation in the second
transmembrane domain of mouse dopamine transporter
markedly decreases sensitivity to cocaine and methylpheni-
date. J Neurochem 94:352–359.
Chen R, Tilley MR, Wei H, Zhou F, Zhou FM, Ching S, Quan N,
Stephens RL, Hill ER, Nottoli T, Han DD, Gu HH (2006) Abol-
ished cocaine reward in mice with a cocaine-insensitive
dopamine transporter. Proc Natl Acad Sci U S A 103:9333–
9338.
Dar DE, Mayo C, Uhl GR (2005) The interaction of methylpheni-
date and benztropine with the dopamine transporter is differ-
ent than other substrates and ligands. Biochem Pharmacol
70:461–469.
Di Chiara G, Imperato A (1988) Drugs abused by humans pref-
erentially increase synaptic dopamine concentrations in the
mesolimbic system of freely moving rats. Proc Natl Acad Sci U
S A 85:5274–5278.
Ferris MJ, Calipari ES, Mateo Y, Melchior JR, Roberts DC, Jones
SR (in press) Cocaine self-administration produces pharmaco-
dynamic tolerance: differential effects on the potency of
dopamine transporter blockers, releasers, and methylpheni-
date. Neuropsychopharmacology.
Ferris MJ, Mateo Y, Roberts DC, Jones SR (2011) Cocaine-
insensitive dopamine transporters with intact substrate
transport produced by self-administration. Biol Psychiatry
69:201–207.
Gerasimov MR, Franceschi M, Volkow ND, Gifford A, Gatley SJ,
Marsteller D, Molina PE, Dewey SL (2000) Comparison
between intraperitoneal and oral methylphenidate adminis-
tration: a microdialysis and locomotor activity study. J Phar-
macol Exp Ther 295:51–57.
Han DD, Gu HH (2006) Comparison of the monoamine trans-
porters from human and mouse in their sensitivities to psy-
chostimulant drugs. BMC Pharmacol 3:6.
Heal DJ, Cheetham SC, Smith SL (2009) The neuropharmacol-
ogy of ADHD drugs in vivo: insights on efficacy and safety.
Neuropharmacology 57:608–618.
Heal DJ, Prow MR, Hearson M, Buckett WR (1996) Efflux of
[3H]dopamine from superfused rat striatal slices: predictive
value for detecting stimulant drugs of abuse. Br J Pharmacol
117:325P.
Hu YF, Caron MG, Sieber-Blum M (2009) Norepinephrine
transport-mediated gene expression in noradrenergic neuro-
genesis. BMC Genomics 10:151.
Huff JK, Davies MI (2002) Microdialysis monitoring of meth-
ylphenidate in blood and brain cor related with changes in
dopamine and rat activity. J Pharm Biomed Anal 29:767–777.
Hurd YL, Weiss F, Koob GF, And NE, Ungerstedt U (1989)
Cocaine reinforcement and extracellular dopamine overflow
in rat nucleus accumbens: an in vivo microdialysis study.
Brain Res 498:199–203.
Li SM, Campbell BL, Katz JL (2006) Interactions of cocaine
with dopamine uptake inhibitors or dopamine releasers in rats
discriminating cocaine. J Pharmacol Exp Ther 317:1 088–1096.
10 Erin S. Calipari et al.
© 2012 The Authors, Addiction Biology © 2012 Society for the Study of Addiction Addiction Biology
Marusich JA, Bardo MT (2009) Differences in impulsivity on a
delay-discounting task predict self-administration of a low
unit dose of methylphenidate in rats. Behav Pharmacol
20:447–454.
Marusich JA, Beckmann JS, Gipson CD, Bardo MT (2010) Meth-
ylphenidate as a reinforcer for rats: contingent delivery and
intake escalation. Exp Clin Psychopharmacol 18:257–266.
Mateo Y, Lack CM, Morgan D, Roberts DC, Jones SR (2005)
Reduced dopamine terminal function and insensitivity to
cocaine following cocaine binge self-administration and dep-
rivation. Neuropsychopharm 30:1455–1463.
Morton WA, Stockton GG (2000) Methylphenidate abuse and
psychiatric side effects. Prim Care Companion J Clin Psychia-
try 2:159–164.
Norman AB, Tsibulsky VL (2006) The compulsion zone: a phar-
macological theory of acquired cocaine self-administration.
Brain Res 1116:143–152.
Ramamoorthy S, Samuvel DJ, Balasubramaniam A, See RE,
Jayanthi LD (2010) Altered dopamine transporter function
and phosphorylation following chronic cocaine self-
administration and extinction in rats. Biochem Biophys Res
Commun 391:1517–1521.
Richardson NR, Roberts DC (1996) Progressive ratio schedules
in drug self-administration studies in rats: a method to evalu-
ate reinforcing efficacy. J Neurosci Methods 66:1–11.
Roberts DC, Goeders NE (1989) Dr ug self-administration: experi-
mental methods and determiants. In: Boalton AA, Baker GB,
Greenshaw AS, eds. Neuromethods, Vol. 13. Psychopharma-
cology, pp. 349–398. Clifton, NJ: Humana press.
Roberts DC, Morgan D, Liu Y (2007) How to make a rat addicted
to cocaine. Prog Neuropsychopharmacol Biol Psychiatry
31:1614–1624.
Rush CR, Baker RW (2001) Behavioral pharmacological simi-
larities between methylphenidate and cocaine in cocaine
abusers. Exp Clin Psychopharmacol 9:59–73.
Russell V, de Villiers A, Sagvolden T, Lamm M, Taljaard J (1998)
Differences between electrically-, ritalin- and d-amphetamine-
stimulated release of [3H]dopamine from brain slices suggest
impaired vesicular storage of dopamine in an animal model
of attention-deficit hyperactivity disorder. Behav Brain Res
94:163–171.
Salahpour A, Ramsey AJ, Medvedev IO, Kile B, Sotnikova TD,
Holmstrand E, Ghisi V, Nicholls PJ, Wong L, Murphy K, Sesack
SR, Wightman RM, Gainetdinov RR, Caron MG (2008)
Increased amphetamine-induced hyperactivity and reward in
mice overexpressing the dopamine transporter. Proc Natl
Acad Sci USA 105:4405–4410.
Sherman CB, Hudson LD, Pierson DJ (1987) Severe precocious
emphysema in intravenous methylphenidate (Ritalin)
abusers. Chest 92:1085–1087.
Sonders MS, Zhu SJ, Zahniser NR, Kavanaugh MP, Amara SG
(1997) Multiple ionic conductances of the human dopamine
transporter: the actions of dopamine and psychostimulants.
J Neurosci 17:960–974.
Sproson EJ, Chantrey J, Hollis C, Marsden CA, Fonel KC (2001)
Effect of repeated methylphenidate administration on presyn-
aptic dopamine and behaviour in young adult rats. J Psychop-
harmacol 15:67–75.
Substance Abuse and Mental Health Services Administra-
tion (SAMHSA) (2008) National Survey on Drug Use and
Health. Retrieved at http://www.oas.samhsa.gov/nhsda.htm.
Accessed 15 May 2010.
Tank AW, Xu L, Chen X, Radcliffe P, Sterling CR (2008) Post-
transcriptional regulation of tyrosine hydroxylase expression
in adrenal medulla and brain. Ann N Y Acad Sci 1148:238–
248.
Teter CJ, McCabe SE, LaGrange K, Cranford JA, Boyd CJ (2006)
Illicit use of specific prescription stimulants among college
students: prevalence, motives, and routes of administration.
Pharmacotherapy 26:1501–1510.
Tilley MR, Gu HH (2008a) The effects of methylphenidate on
knockin mice with a methylphenidate-resistant dopamine
transporter. J Pharmacol Exp Ther 327:554–560.
Tilley MR, Gu HH (2008b) Dopamine transporter inhibition is
required for cocaine-induced stereotypy. Neuroreport
19:1137–1140.
Uhl GR, Hall FS, Sora I (2002) Cocaine, reward, movement and
monoamine transporters. Mol Psychiatry 7:21–26.
Volkow ND, Fowler JS, Wang G, Ding Y, Gatley SJ (2002) Mecha-
nism of action of methylphenidate: insights from PET imaging
studies. J Atten Disord 6 (Suppl 1):S31–S43.
Volz TJ, Farnsworth SJ, Hanson GR, Fleckenstein AE (2008)
Methylphenidate-induced alterations in synaptic vesicle traf-
ficking and activity. Ann N Y Acad Sci 1139:285–290.
Wayment HK, Deutsch H, Schweri MM, Schenk JO (1999) Effects
of methylphenidate analogues on phenethylamine substrates
for the striatal dopamine transporter: potential as amphet-
amine antagonists? J Neurochem 72:1266–1274.
Weikop P, Egestad B, Kehr J (2004) Application of triple-probe
microdialysis for fast pharmacokinetic/pharmacodynamic
evaluation of dopamimetic activity of drug candidates in the
rat brain. J Neurosci Methods 140:59–65.
Wilens TE, Adler LA, Adams J, Sgambati S, Rotrosen J,
Sawtelle R, Utzinger L, Fusillo S (2008) Misuse and diversion
of stimulants prescribed for ADHD: a systematic review of the
literature. J Am Acad Child Adolesc Psychiatry 47:21–31.
Wilson JM, Kish SJ (1996) The vesicular monoamine trans-
porter, in contrast to the dopamine transporter, is not altered
by chronic cocaine self-administration in the rat. J Neurosci
16:3507–3510.
Woods SK, Meyer JS (1991) Exogenous tyrosine potentiates the
methylphenidate-induced increase in extracellular dopamine
in the nucleus accumbens: a microdialysis study. Brain Res
560:97–105.
Yang PB, Swann AC, Dafny N (2003) Chronic pretreatment with
methylphenidate induces cross-sensitization with amphet-
amine. Life Sci 73:2899–2911.
Yorgason JT, España RA, Jones SR (2011) Demon Voltammetry
and Analysis software: analysis of cocaine-induced alterations
in dopamine signaling using multiple kinetic measures. J Neu-
rosci Methods 202:158–164.
SUPPORTING INFORMATION
Additional Supporting Information may be found in the
on-line version of this article:
Figure S1 Quantification of tyrosine hydroxylase (TH)
mRNA levels, protein levels and phosphorylation by
Western blot hybridization and quantitative PCR.
Please note: Wiley–Blackwell are not responsible for the
content or functionality of any supporting materials sup-
plied by the authors. Any queries (other than missing
material) should be directed to the corresponding author
for the article.
DA changes after MPH or COC 11
© 2012 The Authors, Addiction Biology © 2012 Society for the Study of Addiction Addiction Biology
    • "In the current investigation and in work over the course of 10 years, we have established that multiple models that demonstrate increases in specific behavioral characteristics and responses for cocaine, such as escalation of cocaine intake/ motivation on fixed and progressive ratios, result in a hypodopaminergic resting state of dopamine terminal function in addition to a reduced ability of cocaine to inhibit dopamine uptake and correspondingly increase dopamine in the extracellular space (Ferris et al, 2012; Calipari et al, 2014b; however, see Ahmed et al, 2003). Phillips and colleagues (Willuhn et al, 2014) have mechanistically linked dopamine system deficits with escalation of cocaine intake and showed that restoration of phasic dopamine release eliminated escalated intake of cocaine. "
    [Show abstract] [Hide abstract] ABSTRACT: There are approximately 1.6 million people who meet the criteria for cocaine addiction in the United States, and there are currently no FDA approved pharmacotherapies. Amphetamine-based dopamine releasing drugs have shown efficacy for reducing the motivation to self-administer cocaine and reducing intake in animals and humans. It is hypothesized that amphetamine acts as a replacement therapy for cocaine through elevation of extracellular dopamine levels. Using voltammetry in brain slices, we tested the ability of a single amphetamine infusion in vivo to modulate dopamine release, uptake kinetics, and cocaine potency in cocaine naïve animals and after a history of cocaine self-administration (1.5 mg/kg/infusion, fixed-ratio 1, 40 injections/day x 5 days). Dopamine kinetics were measured 1 and 24 hours after amphetamine infusion (0.56 mg/kg, i.v.). Following cocaine self-administration, dopamine release, maximal rate of uptake (Vmax), and membrane-associated dopamine transporter (DAT) levels were reduced, and the DAT was less sensitive to cocaine. A single amphetamine infusion reduced Vmax and membrane DAT levels in cocaine naïve animals, but fully restored all aspects of dopamine terminal function in cocaine self-administering animals. Here, for the first time, we demonstrate pharmacologically-induced, immediate rescue of deficits in dopamine nerve-terminal function in animals with a history of high dose cocaine self-administration. This observation supports the notion that the DAT expression and function can be modulated on a rapid time-scale and also suggests that the pharmacotherapeutic actions of amphetamine for cocaine addiction go beyond that of replacement therapy.
    Full-text · Article · Feb 2015
    • "Here we demonstrate that that is not the case, as high, continuous intake is not necessary to produce robust neurochemical effects. The sensitization of cocaine potency at the DAT, observed in the current study, is opposite from the well-documented decrease in cocaine potency after extended-access cocaine self-administration (Hurd et al, 1989; Ferris et al, 2011 Ferris et al, , 2012 Ferris et al, , 2013a Calipari et al, 2013c, d; Calipari et al, 2014a) and suggests that cocaine is more effective at elevating DA in the NAc core following brief intermittent usage, and that an abstinence period increases the effects. The NAc core is involved in reinstatement of drug seeking after periods of abstinence (Millan et al, 2011), and increased cocaine potency in this region may promote increased rewarding and reinforcing effects of cocaine, potentially leading to greater risk of compulsive or addictive-like cocaine intake. "
    [Show abstract] [Hide abstract] ABSTRACT: Although traditional sensitization paradigms, which result in an augmentation of cocaine-induced locomotor behavior and dopamine (DA) overflow following repeated experimenter-delivered cocaine injections, are often used as a model to study drug addiction, similar effects have been difficult to demonstrate following cocaine self-administration. We have recently shown that intermittent access (IntA) to cocaine can result in increased cocaine potency at the DA transporter (DAT); however, traditional sensitization paradigms often show enhanced effects following withdrawal/abstinence periods. Therefore, we determined a time course of IntA-induced sensitization by examining the effects of I or 3 days of IntA, as well as a 7-day abstinence period on DA function, cocaine potency, and reinforcement. Here we show that cocaine potency is increased following as little as 3 days of IntA and further augmented following an abstinence period. In addition, IntA plus abstinence produced greater evoked DA release in the presence of cocaine as compared with all other groups, demonstrating that following abstinence, both cocaine's ability to increase DA release and inhibit uptake at the DAT, two separate mechanisms for increasing DA levels, are enhanced. Finally, we found that IntA-induced sensitization of the DA system resulted in an increased reinforcing efficacy of cocaine, an effect that was augmented after the 7-day abstinence period. These results suggest that sensitization of the DA system may have an important role in the early stages of drug abuse and may drive the increased drug seeking and taking that characterize the transition to uncontrolled drug use. Human data suggest that intermittency, sensitization, and periods of abstinence have an integral role in the process of addiction, highlighting the importance of utilizing pre-clinical models that integrate these phenomena, and suggesting that IntA paradigms may serve as novel models of human addiction.
    Full-text · Article · Sep 2014
    • "These neurochemical changes have important behavioral implications , because stimulant effects on behavior, such as reward and reinforcement, are primarily mediated by the ability of the drug to inhibit the dopamine transporter and elevate dopamine levels (Ritz and Kuhar, 1989; Roberts et al., 1977). Further, changes in the NAc core have been shown to be directly associated with changes in reinforcement-related behaviors, where increased accumbal dopamine responses to cues or drugs result in increased in reinforcing efficacy/drug-seeking behaviors (Calipari et al., 2014a; Saunders et al., 2013; Graf et al., 2013; Holmes and Fam, 2013). This suggests that intermittent administration of MPH may lead to an increase in reward and reinforcement-related behaviors for amphetamines and other releasers, which could increase the abuse liability/addiction potential of these compounds. "
    [Show abstract] [Hide abstract] ABSTRACT: Long-access methylphenidate (MPH) self-administration has been shown to produce enhanced amphetamine potency at the dopamine transporter and concomitant changes in reinforcing efficacy, suggesting that MPH abuse may change the dopamine system in a way that promotes future drug abuse. While long-access self-administration paradigms have translational validity for cocaine, it may not be as relevant a model of MPH abuse, as it has been suggested that people often take MPH intermittently. Although previous work outlined the neurochemical and behavioral consequences of long-access MPH self-administration, it was not clear whether intermittent access (6 h session; 5min access/30min) would result in similar changes. For cocaine, long-access self-administration resulted in tolerance to cocaine's effects on dopamine and behavior while intermittent-access resulted in sensitization. Here we assessed the neurochemical consequences of intermittent-access MPH self-administration on dopamine terminal function. We found increased maximal rates of uptake, increased stimulated release, and subsensitive D2-like autoreceptors. Consistent with previous work using extended-access MPH paradigms, the potencies of amphetamine and MPH, but not cocaine, were increased, demonstrating that unlike cocaine, MPH effects were not altered by the pattern of intake. Although the potency results suggest that MPH may share properties with releasers, dopamine release was increased following acute application of MPH, similar to cocaine, and in contrast to the release decreasing effects of amphetamine. Taken together, these data demonstrate that MPH exhibits properties of both blockers and releasers, and that the compensatory changes produced by MPH self-administration may increase the abuse liability of amphetamines, independent of the pattern of administration.
    Full-text · Article · Mar 2014
Show more