Article

A Highly Efficient Escherichia coli-Based Chromosome Engineering System Adapted for Recombinogenic Targeting and Subcloning of BAC DNA

NCI-Frederick, Фредерик, Maryland, United States
Genomics (Impact Factor: 2.28). 05/2001; 73(1):56-65. DOI: 10.1006/geno.2000.6451
Source: PubMed

ABSTRACT

Recently, a highly efficient recombination system for chromosome engineering in Escherichia coli was described that uses a defective λ prophage to supply functions that protect and recombine a linear DNA targeting cassette with its substrate sequence (Yu et al., 2000, Proc. Natl. Acad. Sci. USA 97, 5978–5983). Importantly, the recombination is proficient with DNA homologies as short as 30–50 bp, making it possible to use PCR-amplified fragments as the targeting cassette. Here, we adapt this prophage system for use in bacterial artificial chromosome (BAC) engineering by transferring it to DH10B cells, a BAC host strain. In addition, arabinose inducible cre and flpe genes are introduced into these cells to facilitate BAC modification using loxP and FRT sites. Next, we demonstrate the utility of this recombination system by using it to target cre to the 3′ end of the mouse neuron-specific enolase (Eno2) gene carried on a 250-kb BAC, which made it possible to generate BAC transgenic mice that specifically express Cre in all mature neurons. In addition, we show that fragments as large as 80 kb can be subcloned from BACs by gap repair using this recombination system, obviating the need for restriction enzymes or DNA ligases. Finally, we show that BACs can be modified with this recombination system in the absence of drug selection. The ability to modify or subclone large fragments of genomic DNA with precision should facilitate many kinds of genomic experiments that were difficult or impossible to perform previously and aid in studies of gene function in the postgenomic era.

Download full-text

Full-text

Available from: E-Chiang Lee, Mar 19, 2014
  • Source
    • "A targeting vector was designed to fuse a farnesylated yellow fluorescent protein (YFPF) into the second exon of Ntn5. This was done using bacterial recombineering to introduce the YFPF and a downstream neomycin-resistance cassette flanked by FRT recombination sites into the beginning of exon 2, deleting through exon 6 of Ntn5, leaving only exons 1 and 7 intact (Lee et al., 2001). The Ntn5 gene was contained on mouse BAC RP22- 513I7, and the following synthetic oligonucleotides were used to generate the YFPF-FRT-Neo-FRT insert that was recombined into the BAC: GGA ATC CTC AGC AGG GTG GAC ACC AAC TGA CCC CAT CTG CC ACCT CTG TCT ACA GGT GCC acc atg tgt agc aag ggc (uppercase-Ntn5 sequence, underlined-beginning of exon 2, lowercase-YFPF fusion) and GAA GTG GAA GGA TGG GGA AAA GGC AGG CCT GTT TTC CTC TCT CAC TTA CCA TAA TCC TGC Tcg agc cct taa tta acc gg (uppercase-Ntn5 sequence compliment of exon 6, lowercase-vector downstream of the FRT-Neo cassette). "
    [Show abstract] [Hide abstract]
    ABSTRACT: Boundary cap cells are a transient, neural-crest-derived population found at the motor exit point and dorsal root entry zone of the embryonic spinal cord. These cells contribute to the central/peripheral nervous system boundary, and in their absence neurons and glia from the CNS migrate into the PNS. We found Netrin5 (Ntn5), a previously unstudied member of the netrin gene family, to be robustly expressed in boundary cap cells. We generated Ntn5 knockout mice and examined neurodevelopmental and boundary-cap-cell-related phenotypes. No abnormalities in cranial nerve guidance, dorsal root organization, or sensory projections were found. However, Ntn5 mutant embryos did have ectopic motor neurons that migrated out of the ventral horn and into the motor roots. Previous studies have implicated semaphorin6A (Sema6A) in boundary cap cells signaling to plexinA2 (PlxnA2)/neuropilin2 (Nrp2) in motor neurons in restricting motor neuron cell bodies to the ventral horn, particularly in the caudal spinal cord. In Ntn5 mutants, ectopic motor neurons are likely to be a different population, as more ectopias were found rostrally. Furthermore, ectopic motor neurons in Ntn5 mutants were not immunoreactive for NRP2. The netrin receptor DCC is a potential receptor for NTN5 in motor neurons, as similar ectopic neurons were found in Dcc mutant mice, but not in mice deficient for other netrin receptors. Thus, Ntn5 is a novel netrin family member that is expressed in boundary cap cells, functioning to prevent motor neuron migration out of the CNS.
    Full-text · Article · Jan 2016 · Frontiers in Molecular Neuroscience
  • Source
    • "and obtained from Invitrogen. All recombineering experiments were performed according to protocols published previously (Lee et al., 2001; Warming et al., 2005; Yu et al., 2003). The eGFP-pSV40-Neo R reporter cassette, amplification protocols and primers were kindly provided by Dr Yvonne Fischer (Fischer et al., 2010). "
    [Show abstract] [Hide abstract]
    ABSTRACT: MicroRNAs (miRNAs) have been implicated in regulating multiple processes during brain development in various species. However, the function of miRNAs in human brain development remains largely unexplored. Here, we provide a comprehensive analysis of miRNA expression of regionalized neural progenitor cells derived from human embryonic stem cells and human foetal brain. We found miR-92b-3p and miR-130b-5p to be specifically associated with neural progenitors and several miRNAs that display both age-specific and region-specific expression patterns. Among these miRNAs, we identified miR-10 to be specifically expressed in the human hindbrain and spinal cord, while being absent from rostral regions. We found that miR-10 regulates a large number of genes enriched for functions including transcription, actin cytoskeleton and ephrin receptor signalling. When overexpressed, miR-10 influences caudalization of human neural progenitor cells. Together, these data confirm a role for miRNAs in establishing different human neural progenitor populations. This dataset also provides a comprehensive resource for future studies investigating the functional role of different miRNAs in human brain development.
    Full-text · Article · Sep 2015 · Development
  • Source
    • "loxP sequences contained in the pBACe3.6 backbone of RP23-352G18 BAC DNA were replaced via homologous recombination [25] by an ampicillin resistance gene cassette generated via PCR amplification of a PGEM-T-Easy vector template with the primer sets: 5 0 GATAAACTACCGCATTAAAGCTTATCGATGATAAGCTGTCAAACATGAG- AATTGATCCGGATATATGAGTAAACTTGGTCTGAC and 5 0 GTTAACCGGGCTGCATCCGATGCAAGTGTGTCGCTGTCGACGGTGACC- CTATAGTCGAGGCGGTATTTTCTCCTTACGCATC. The modified RP23- 352G18 BAC DNA was then purified and microinjected in its circular state into pronuclei of fertilized embryos of C57Bl/6J mice using standard methods [24]. "
    [Show abstract] [Hide abstract]
    ABSTRACT: Objective Available treatment for obesity and type 2 diabetes mellitus (T2DM) is suboptimal. Thus, identifying novel molecular target(s) exerting protective effects against these metabolic imbalances is of enormous medical significance. Sirt6 loss- and gain-of-function studies have generated confounding data regarding the role of this sirtuin on energy and glucose homeostasis, leaving unclear whether activation or inhibition of SIRT6 may be beneficial for the treatment of obesity and/or T2DM. Methods To address these issues, we developed and studied a novel mouse model designed to produce eutopic and physiological overexpression of SIRT6 (Sirt6BAC mice). These mutants and their controls underwent several metabolic analyses. These include whole-blood reverse phase high-performance liquid chromatography assay, glucose and pyruvate tolerance tests, hyperinsulinemic-euglycemic clamp assays, and assessment of basal and insulin-induced level of phosphorylated AKT (p-AKT)/AKT in gastrocnemius muscle. Results Sirt6BAC mice physiologically overexpress functionally competent SIRT6 protein. While Sirt6BAC mice have normal body weight and adiposity, they are protected from developing high-caloric-diet (HCD)-induced hyperglycemia and glucose intolerance. Also, Sirt6BAC mice display increased circulating level of the polyamine spermidine. The ability of insulin to suppress endogenous glucose production was significantly enhanced in Sirt6BAC mice compared to wild-type controls. Insulin-stimulated glucose uptake was increased in Sirt6BAC mice in both gastrocnemius and soleus muscle, but not in brain, interscapular brown adipose, or epididymal adipose tissue. Insulin-induced p-AKT/AKT ratio was increased in gastrocnemius muscle of Sirt6BAC mice compared to wild-type controls. Conclusions Our data indicate that moderate, physiological overexpression of SIRT6 enhances insulin sensitivity in skeletal muscle and liver, engendering protective actions against diet-induced T2DM. Hence, the present study provides support for the anti-T2DM effect of SIRT6 and suggests SIRT6 as a putative molecular target for anti-T2DM treatment.
    Full-text · Article · Sep 2015 · Molecular Metabolism
Show more