Article

Polymethoxy flavones are responsible for the anti-inflammatory activity of citrus fruit peel

Authors:
  • Yuanpei University of Medical Technology
To read the full-text of this research, you can request a copy directly from the authors.

Abstract

In traditional Chinese medicine, dried citrus fruit peels are widely used as remedies to alleviate some respiratory inflammatory syndromes and are considered as potential sources of anti-inflammatory components. Seven citrus fruits were selected for this study. We determined the inhibitory ability of citrus peel extracts on the production of pro-inflammatory mediators, prostaglandin E2 (PGE2) and nitric oxide (NO), in lipopolysaccharide (LPS)-activated RAW 264.7 cells. Among the tested citrus peels, Ponkan (Citrus reticulata Blanco) and Tonkan (Citrus tankan Hayata) deserve special attention due to their outstanding inhibitory effect on PGE2 and NO secretion. We have also examined the composition, flavanone glycosides and polymethoxy flavones. The polymethoxy flavone content, especially nobiletin, appears to correlate well with the anti-inflammatory activities of certain citrus peel extracts. Thus, our results suggest that polymethoxy flavones contribute crucially to the anti-inflammatory activity of citrus peels.

No full-text available

Request Full-text Paper PDF

To read the full-text of this research,
you can request a copy directly from the authors.

... reticulata Blanco) and Tonkan (C. tankan Hayata) peel extracts contained the total flavanone glycosides at a level of 106, 103, 68.4 and 63.7 mg/g, respectively (Huang & Ho, 2010). Orange peel contained a complex mixture of flavanones and included hesperetin (aglycone), hesperidin and neohesperidin, while tangerine peel contained hesperidin and neohesperidin (Londoño-Londoño et al., 2010). ...
... Hesperidin is the dominant flavanone glycoside in the methanol extracts of lemon, Ponkan and Tonkan (94.0, 65.5 and 58.5 mg/g, respectively) peels and naringin (98.0 mg/g) is the main flavanone glycoside identified in methanol peel extract of Grapefruit (Huang & Ho, 2010). ...
... paradisi contained lowest levels of PMFs (Green et al., 2007). Methanolic extract of Ponkan and Tonkan contained total PMF's at a level of 12.8 and 9.01 mg/g, respectively (Huang and Ho, 2010). The total content of PMF's was reported as 51.06% in PMF-rich extract of C. ...
Article
Citrus peel (CP) forms around 40-50% of the total fruit mass but is generally thought to be a waste. However, it is a substantial source of naturally occurring health enhancing compounds, particularly phenolic compounds and carotenoids. Phenolic compounds in CP mainly comprise phenolic acids (primarily caffeic, p-coumaric, ferulic and sinapic acid), flavanones (generally naringin and hesperidin) and polymethoxylated flavones (notably nobiletin and tangeretin). It has also been noted that CP’s contain more amounts of these compounds than corresponding edible parts of the fruits. Phenolic compounds present in CP act as antioxidants (by either donation of protons or electrons) and protect cells against free radical damage as well as help in reducing the risk of many chronic diseases. Owing to the more abundance of polyphenols in CP’s, their antioxidant activity is also higher than other edible fruit parts. Therefore, peels from citrus fruits can be used as sources of functional compounds and preservatives for the development of newer food products, that are not only safe but also have health-promoting activities. The present review provides in-depth knowledge about the phenolic composition, antioxidant potential and health benefits of CP.
... Citrus peels must be processed to keep those compounds unchanged for their usage in foods, cosmetics, and others. [2,3] Orange peel and its essential oil have been studied particularly due to their unique and specific aroma. [4] Characteristic aroma is formed by the presence of terpene hydrocarbons, esters, ketones, aldehydes, and alcohols. ...
... [7] Citrus peel is also rich in phenolic components, including flavonoids and phenolic acids. Phenolic components exhibit antioxidant, [8] anti-inflammatory, [3] anticarcinogenic, and antimicrobial activities, [9] which make them responsible for the biological activity of citrus peel. [3] However, depending on the extraction method and operating conditions, the biological activity and phenolic contents of the extract can vary. ...
... Phenolic components exhibit antioxidant, [8] anti-inflammatory, [3] anticarcinogenic, and antimicrobial activities, [9] which make them responsible for the biological activity of citrus peel. [3] However, depending on the extraction method and operating conditions, the biological activity and phenolic contents of the extract can vary. ...
Article
The orange peel (Citrus sinensis L.) from the variety Washington Navel was extracted by supercritical CO2 (SC-CO2) at different parameters. The extracts were analyzed by gas chromatography-mass spectrometry (GC-MS) and high-performance liquid chromatography (HPLC). Limonene predominance was found (up to 89%). The principal oxygenated monoterpenes were linalool, α-terpineol, decanal, and (E)-citral. Ultrasound-assisted extraction was performed on the remaining solid residue (after SC-CO2 extraction) to obtain the extracts rich in hesperidin. The influence of different extraction parameters on hesperidin content (3.3–23.0 µg/mL) was determined. The prediction performance in optimizing the extraction yield of dominant compounds was studied by response surface methodology and artificial neural network.
... account for their strong anti-inflammatory effects. Action mechanisms include inhibition of both pro-inflammatory mediators' production (such as prostaglandin E2 and nitric oxide) and cytokines production (as IL-1, IL-6, and TNF-α) which are released by macrophages and also via the suppression of T lymphocyte proliferation, as well as increased anti-inflammatory cytokines (IL-4 and IL-10) (Duan, Dou et al., 2017;Ho & Lin, 2008;Huang & Ho, 2010;Schneider, Batisti et al., 2020). How these flavonoids act synergistically in the mandarin matrix to mediate such effect has yet to be revealed? ...
... How these flavonoids act synergistically in the mandarin matrix to mediate such effect has yet to be revealed? This anti-inflammatory activity varies according to both structural-related factors like the number of methoxy groups (Duan, Dou et al., 2017;Huang & Ho, 2010), and external factors such as heat treatment. Interestingly, heating peels at 100 • C for 2 h significantly increased the release of poly methoxy flavones in a time-dependent manner concurrent with improved anti-inflammatory activity (Ho & Lin, 2008). ...
Article
Fruits are regarded as the richest dietary sources of polyphenols, carotenoids, terpenoids, and limonoids, making them highly desired prospects for the functional food industry. Citrus waste that remains after fruit processing is also regarded as a valuable source of value-added phytochemicals. A comprehensive analysis of mandarin composition as a determinant of fruit functional properties, health benefits, and valorization into useful products is represented together with the effect of different processes such as light, wax coating, auxin addition, ozone treatment, and ethylene degreening. Such reviewing evidence is an essential precondition for improving the selling market of mandarin and highlighting its waste valorization potential and its incorporation into useful products produced by pharmaceutical industries. In this study, the phytochemical and biological reports presented to emphasize the needed priority for agricultural techniques to provide a certain mandarin product or trait. In addition, the paper summarizes the optimum conditions applied for the updated extraction techniques for phenolic acids, flavonoids, and oils at a commercial scale from mandarin peels and to enhance its global marketing. A brief representation is given towards potential mandarin patents and the valorization of its bio-waste fruits into commercial products of added value. The review can guide researchers to produce future potentially marketed functional food enriched with mandarin extracts and/or bioactives.
... Many researchers around the world have reported their antioxidant potency and beneficial impacts on lipid metabolism. The biomedical importance of citrus fruits has been highlighted by considering their impacts on lowering the risk of various cancers (gastric, oesophageal, stomach, and colorectal) as well as reducing inflammation and tumour formation (Du and Chen 2010;Huang and Ho 2010;Tripoli et al. 2007). It has been reported by Knekt et al. (2002) that incidence of asthma is reduced in Finland by frequent consumption of the orange. ...
... It has been reported by Knekt et al. (2002) that incidence of asthma is reduced in Finland by frequent consumption of the orange. Beneficial health effects of citrus fruits are mainly attributed to the higher contents of polyphenolics, flavonoids, flavonols, ascorbic acid, dietary fibre, and trace elements (Huang and Ho 2010;Klimczak et al. 2007). One of the previous studies (Gey et al. 1993) reported that ascorbic acid and some trace elements (such as Mn, Fe, and Cu) can be used for the treatment and prevention of atherosclerosis. ...
Article
Full-text available
Fruits are important components of human diet, and their contamination by environmental pollutants is an emerging challenge nowadays. The present study is based on the measurement of selected essential and toxic trace metals including Na, K, Ca, Mg, Fe, Zn, Cu, Mn, Cr, Co, Sr, Li, Ni, Pb, and Cd in commercially available citrus fruits from Pakistan. The samples were digested in HNO3 and HCLO4 mixture, and the metal contents were quantified by flame atomic absorption spectrometry. Highest concentration was found for Ca (609.0–3596 mg/kg), followed by relatively higher levels of K (277.6–682.1 mg/kg), Mg (53.65–123.4 mg/kg), Na (1.173–52.14 mg/kg), and Fe (0.236–10.57 mg/kg), while Li, Ni, and Cd showed the lowest contributions in most of the samples. In addition, antioxidant activities such as DPPH radical scavenging assay, hydroxyl radical scavenging activity, ferrous chelating activity, ferric reducing antioxidant power assay, and phosphomolybdenum assay were also evaluated in the fruit samples. Considerably higher antioxidant activities were shown by grapefruit, mandarin, sweet lime, and tangerine. Most of the antioxidant assays were significantly correlated with Na, Mg, Fe, Mn, and Cu levels in the fruits. Human health risk was evaluated in terms of health risk index (HRI), target hazard quotient (THQ), and target cancer risk (TCR) which revealed insignificant health risks; thus, the consumption of these fruits can be considered as safe for human diet.
... The search for suitable antihyperglycemic agents from natural sources has been focused on plants applied in traditional medicines partly because they have lower side effects than the currently used conventional drugs [24]. Recently, there is an increased interest in the medical benefits of flavonoids because their supplementation seems to be accompanied by reduced risks for certain severe maladies and increased survival as stated by previous publications [25][26][27]. Citrus fruit peels, i.e., the outer layers of many fruits including lemons, oranges, mandarins, and grapefruits, have been demonstrated to be rich in flavonoid content [27][28][29][30]. Flavonoids found in citrus fruits were mainly allocated to three classes: flavanones, flavones, and flavonols [31]. ...
... Recently, there is an increased interest in the medical benefits of flavonoids because their supplementation seems to be accompanied by reduced risks for certain severe maladies and increased survival as stated by previous publications [25][26][27]. Citrus fruit peels, i.e., the outer layers of many fruits including lemons, oranges, mandarins, and grapefruits, have been demonstrated to be rich in flavonoid content [27][28][29][30]. Flavonoids found in citrus fruits were mainly allocated to three classes: flavanones, flavones, and flavonols [31]. ...
Article
Full-text available
This study is aimed at assessing the antihyperglycemic, antihyperlipidemic, and antioxidant effects of Citrus reticulata (C. reticulata) fruit peel hydroethanolic extract and two flavonoids, hesperidin and quercetin, in nicotinamide (NA)/streptozotocin- (STZ-) induced type 2 diabetic rats. In addition, GC-MS and HPLC-MS analyses of the extract were performed and the results indicated the presence of multiple flavonoids including hesperidin, quercetin, naringin, and polymethoxylated flavones (nobiletin and tangeretin). To achieve the aim of the study, diabetic rats with NA/STZ-induced T2DM were orally treated with C. reticulata fruit peel hydroethanolic extract, hesperidin, and quercetin at a dose of 100 mg/kg b.w./day for four weeks. The treatments with C. reticulata fruit peel extract, hesperidin, and quercetin significantly ameliorated the impaired oral glucose tolerance; the elevated serum fructosamine level; the diminished serum insulin and C-peptide levels; the altered HOMA-IR, HOMA-IS, and HOMA-β cell function; the decreased liver glycogen content; the increased liver glucose-6-phosphatase and glycogen phosphorylase activities; the deleteriously affected serum lipid profile; the elevated serum AST and ALT activities; and the raised serum creatinine and urea levels in the diabetic rats. The treatments also produced remarkable improvement in the antioxidant defense system manifested by a decrease in the elevated liver lipid peroxidation and an increase in the lowered glutathione content and GPx, GST, and SOD activities. Furthermore, the three treatments enhanced the mRNA expression of GLUT-4 and the insulin receptor β-subunit, but only quercetin produced a significant increase in the expression of adiponectin in adipose tissue of diabetic rats. In conclusion, C. reticulata fruit peel hydroethanolic extract, hesperidin, and quercetin have potent antidiabetic effects which may be mediated through their insulinotropic effects and insulin-sensitizing actions. In addition, the alleviation of the antioxidant defense system by the extract, hesperidin, and naringin may have an important action to enhance the antidiabetic actions and to improve liver and kidney functions in NA/STZ-induced diabetic rats.
... The search for suitable antihyperglycemic agents from natural sources has been focused on plants applied in traditional medicines partly because they have lower side effects than the currently used conventional drugs [24]. Recently, there is an increased interest in the medical benefits of flavonoids because their supplementation seems to be accompanied by reduced risks for certain severe maladies and increased survival as stated by previous publications [25][26][27]. Citrus fruit peels, i.e., the outer layers of many fruits including lemons, oranges, mandarins, and grapefruits, have been demonstrated to be rich in flavonoid content [27][28][29][30]. Flavonoids found in citrus fruits were mainly allocated to three classes: flavanones, flavones, and flavonols [31]. ...
... Recently, there is an increased interest in the medical benefits of flavonoids because their supplementation seems to be accompanied by reduced risks for certain severe maladies and increased survival as stated by previous publications [25][26][27]. Citrus fruit peels, i.e., the outer layers of many fruits including lemons, oranges, mandarins, and grapefruits, have been demonstrated to be rich in flavonoid content [27][28][29][30]. Flavonoids found in citrus fruits were mainly allocated to three classes: flavanones, flavones, and flavonols [31]. ...
Article
Full-text available
This study is aimed at assessing the antihyperglycemic, antihyperlipidemic, and antioxidant effects of Citrus reticulata (C. reticulata) fruit peel hydroethanolic extract and two flavonoids, hesperidin and quercetin, in nicotinamide (NA)/streptozotocin- (STZ-) induced type 2 diabetic rats. In addition, GC-MS and HPLC-MS analyses of the extract were performed and the results indicated the presence of multiple flavonoids including hesperidin, quercetin, naringin, and polymethoxylated flavones (nobiletin and tangeretin). To achieve the aim of the study, diabetic rats with NA/STZ-induced T2DM were orally treated with C. reticulata fruit peel hydroethanolic extract, hesperidin, and quercetin at a dose of 100 mg/kg b.w./day for four weeks. The treatments with C. reticulata fruit peel extract, hesperidin, and quercetin significantly ameliorated the impaired oral glucose tolerance; the elevated serum fructosamine level; the diminished serum insulin and C-peptide levels; the altered HOMA-IR, HOMA-IS, and HOMA-β cell function; the decreased liver glycogen content; the increased liver glucose-6-phosphatase and glycogen phosphorylase activities; the deleteriously affected serum lipid profile; the elevated serum AST and ALT activities; and the raised serum creatinine and urea levels in the diabetic rats. The treatments also produced remarkable improvement in the antioxidant defense system manifested by a decrease in the elevated liver lipid peroxidation and an increase in the lowered glutathione content and GPx, GST, and SOD activities. Furthermore, the three treatments enhanced the mRNA expression of GLUT-4 and the insulin receptor β-subunit, but only quercetin produced a significant increase in the expression of adiponectin in adipose tissue of diabetic rats. In conclusion, C. reticulata fruit peel hydroethanolic extract, hesperidin, and quercetin have potent antidiabetic effects which may be mediated through their insulinotropic effects and insulin-sensitizing actions. In addition, the alleviation of the antioxidant defense system by the extract, hesperidin, and naringin may have an important action to enhance the antidiabetic actions and to improve liver and kidney functions in NA/STZ-induced diabetic rats. 1. Introduction Diabetes mellitus (DM), one of the most common diseases in the world, results from impairments in insulin secretion and/or insulin action leading to disturbances in the metabolism of carbohydrates, lipids, and proteins [1, 2]. The American Diabetes Association (ADA) has classified DM into type 1 DM (T1DM), type 2 DM (T2DM), gestational DM (GDM), and many other specific types of diabetes [3]. T2DM is much more prevalent in humans than T1DM and is responsible for 90% of DM incidence [4, 5]. The main reasons for T2DM are impaired tissue insulin sensitivity and insulin resistance which was coupled to pancreatic β-cell dysfunction [6–8]. Many experimental animal models of T2DM were applied by several publications to validate the use of new therapies and to elucidate the underlying molecular mechanism(s) of action of the tested drugs [9, 10]. Nicotinamide (NA)/streptozotocin- (STZ-) induced DM is the most commonly used animal model of T2DM in rats. STZ, an antibiotic drug formed by Streptomyces achromogenes, has damaging effects on the β-cells in the islets of Langerhans [11–13]. Many reports stated that the damaging effect of STZ on β-cells of pancreatic islets is caused by the stimulation of oxidative stress and suppression of antioxidant defense [14–16]. Furthermore, the intracellular biotransformation of STZ results in the production of nitric oxide (NO) which speeds up the formation of DNA strand breaks, leading to β-cells’ necrosis [17]. NA injection before STZ in this DM-induced model, on the other hand, partially counteracts the destructive effect of STZ on β-cells, and it leads to the loss of the early phase of glucose stimulation of insulin secretion which is a feature of T2DM [18–20]. It was also proven by many investigators that in NA/STZ-induced DM, there are both impairment in insulin secretion and insulin resistance, which is a characteristic feature of T2DM [21–23]. The search for suitable antihyperglycemic agents from natural sources has been focused on plants applied in traditional medicines partly because they have lower side effects than the currently used conventional drugs [24]. Recently, there is an increased interest in the medical benefits of flavonoids because their supplementation seems to be accompanied by reduced risks for certain severe maladies and increased survival as stated by previous publications [25–27]. Citrus fruit peels, i.e., the outer layers of many fruits including lemons, oranges, mandarins, and grapefruits, have been demonstrated to be rich in flavonoid content [27–30]. Flavonoids found in citrus fruits were mainly allocated to three classes: flavanones, flavones, and flavonols [31]. Citrus reticulata (C. reticulata) or tangerine fruit peels have been shown to contain high concentrations of three flavanones: hesperidin, naringin, and narirutin [32]. Citrus peel also contains good quantities of flavonol and quercetin [33]. Hesperidin, a glycosylated flavanone of hesperetin, has been reported by Constantin et al. [34] and Parhiz et al. [35] to decrease intestinal glucose absorption and inhibit the gluconeogenic pathways, thereby leading to antihyperglycemic actions in diabetic human beings. Quercetin, a principal flavonol found in citrus fruits especially in fruit peels, was found to have antidiabetic actions in diabetic animal models at doses of 10, 25, and 50 mg/kilogram body weight (kg b.w.) [36]. It is a glycone of rutin, and it is a parent compound of a number of various flavonoids [37, 38]. Although the antidiabetic effects of hesperidin and quercetin were reported by some publications, the mechanisms of their antidiabetic actions are not fully elucidated. In addition, further investigations are needed to assess their comparative effects with the crude extract of C. reticulata fruit peel. Therefore, the present study was conducted to assess the comparative antihyperglycemic, antihyperlipidemic, and antioxidant effects of C. reticulata fruit peel hydroethanolic extract, hesperidin, and quercetin in NA/STZ-induced DM in Wistar rats and to suggest their mechanisms of action. 2. Materials and Methods 2.1. Experimental Animals Adult male rats of Wistar strain weighing about 130-150 g and aged 10-12 weeks were used in the present experimental research work. The animals were supplied from the animal house of the National Research Center (NRC), El-Tahrir Street, Dokki, Giza, Egypt. They were maintained under strict care for about 10 days before the start of the experiment to exclude any intercurrent infection. The rats were housed in clean polypropylene cages (six rats/cage) with a well-aerated standard stainless steel frame and wood mulch at the bottom of cage. The rats were maintained under normal controlled atmospheric temperature (), humidity (), and daily normal 12-hour (hr) light/dark cycle. Moreover, they had free access to water and were provided daily with standard pelleted chow diet ad libitum. All animal procedures were in accordance with the guidelines and recommendations of the Experimental Animal Ethics Committee for Use and Care of Animals, Faculty of Science, Beni-Suef University, Egypt (ethical approval number is BSU/FS/2015/14). All instructions were followed, and all precautions were considered to minimize discomfort, distress, and pain of rats under investigations. 2.2. Drugs and Chemicals STZ (2-deoxy-2-(3-methyl-3-nitrosoureido)-D-glycopyranoside), NA, hesperidin, and quercetin were obtained from Sigma-Aldrich Chemical Company, St. Louis, MO, USA. NA, hesperidin, and quercetin were kept at 2–4°C, while STZ was stored at -20°C. All other used chemicals were of analytical grade and were commercially obtained. 2.3. Extract Preparation of C. reticulata Fruit Peel C. reticulata or tangerine fruits were purchased from the local market at Beni-Suef Governorate, Egypt. The purchased fruits were manually flaked and were cleaned by washing with running water till completely clean. The washed peels were then dried in a good aerated area. Then, the dried peels were ground to a powder by an electric mortar. The finely obtained powder (0.5 kg) was drenched in 70% ethanol for 3 days. The mixture was filtered by using a Whatman No. 2 filter paper for removal of peel particles. The water and ethanol were vaporized by a Rotavapor to obtain a semisolid viscous mass which was stored in dark bottles in a deep freezer at -30°C pending its use for the treatment. 2.4. Gas Chromatography-Mass Spectrometry (GC-MS) Analysis Chemical analysis of C. reticulata peel hydroethanolic extract was performed in the Central Laboratory of the Faculty of Postgraduate Studies for Advanced Sciences, Beni-Suef University, Egypt, by using the Gas Chromatography (GC) System 7890A/5975C Inert Mass Spectrometry (MS) with a Triple Axis Detector, Agilent Technologies, Germany. The constituents were recognized by comparing their mass spectra with the spectra of derivatives in the Library Search Report (C:\Database\NIST11.L; C:\Database\demo.l) as well as in the NIST08s, WILEY8, and FAME libraries. 2.5. High-Performance Liquid Chromatography- (HPLC-) Mass Spectrometry (MS) Analysis HPLC-MS analysis of C. reticulata fruit peel hydroethanolic extract was performed in the Central Laboratory of the Faculty of Postgraduate Studies for Advanced Sciences, Beni-Suef University, Egypt, by using the HPLC-MS system, 1260 Infinity, Agilent Technologies, Germany coupled with a Diode Array Detector (DAD). Standards including gallic acid, naringin, quercetin, hesperidin, nobiletin, and tangeretin were used to identify their peaks in the HPLC-MS chromatogram. The C. reticulata fruit peel hydroethanolic extract was dissolved in water : methanol (80 : 20 /) at a concentration of 10 mg/3 ml and filtered with a 0.45 μm filter, before injection of 20 μl into the HPLC system. Spectral UV data from all peaks were collected in the range of 240-400 nm, and chromatograms were recorded at 340 and 270 nm according to the method of Negri et al. [39]. 2.6. Induction of T2DM Experimental T2DM was induced in male Wistar rats, fasted for 16 hours (hrs), by a single intraperitoneal (i.p.) injection of STZ at a dose level of 50 mg STZ/kg b.w. (dissolved in citrate buffer of pH 4.5), 15 minutes after the i.p. injection of 120 mg NA/kg b.w. [40]. Ten days after NA/STZ injection, overnight-fasted rats were orally supplemented with glucose (3 g/kg b.w.) by oral gavage. After 2 hrs of oral glucose administration, blood samples taken from the lateral tail vein were left to coagulate and then centrifuged. Thereafter, serum glucose level was detected. After screening of serum glucose levels, the rats which have serum glucose levels of 180-300 mg/dl after 2 hrs of oral glucose loading were considered mildly diabetic and were included in the experiment. Rats with serum glucose levels outside this range were excluded. 2.7. Experimental Design The rats included in the experiment were divided into five groups, each group comprising six rats as follows: (1)Group 1 was regarded as the normal control group and received the equivalent volume of the vehicle, 1% carboxymethyl cellulose (CMC), by oral gavage daily for four weeks(2)Group 2 was regarded as the diabetic control group and received the equivalent volume of 1% CMC by oral gavage daily for four weeks(3)Group 3 served as diabetic rats that were treated with C. reticulata fruit peel hydroethanolic extract at a dose level of 100 mg in 5 ml 1% CMC/kg b.w./day [41], by oral gavage, for four weeks(4)Group 4 served as diabetic rats that were treated with hesperidin (Sigma-Aldrich Chemical Company, MO, USA), at a dose level of 100 mg (dissolved in 5 ml 1% CMC)/kg b.w./day, by oral gavage, for four weeks [42].(5)Group 5 served as diabetic rats that were treated with quercetin (Sigma-Aldrich Chemical Company, MO, USA), at a dose level of 100 mg (dissolved in 5 ml 1% CMC)/kg b.w./day, by oral gavage, for four weeks [43]. Each week, the dose was adjusted according to the alterations in b.w. to stabilize the correct dose per kg b.w. of rats during the entire period of the experiment. 2.8. Blood and Tissue Sampling At the day before decapitation, an oral glucose tolerance test (OGTT) was performed for all individual rats. Blood samples were withdrawn from the lateral tail veins of overnight-fasted rats at 30, 60, 90, and 120 minutes following the oral glucose loading (3 g/kg b.w.), left to clot, and centrifuged at 4000 rounds per minute (rpm) for 15 minutes. After that, sera were quickly collected for the detection of serum glucose levels. A day following OGTT, the overnight-fasted animals were anaesthetized by diethyl ether inhalation anaesthesia and blood samples were obtained from the jugular vein. Then, after decapitation by cervical dislocation, rats were dissected and liver, visceral adipose tissue, and pancreas were excised and perfused in saline. The blood from each rat was collected in gel and clot activator tubes and centrifuged at 4000 rpm for 15 minutes. The obtained sera were stored in a deep freezer at -30°C until they were used for biochemical detection. The liver was kept in a deep freezer at -30°C pending its use for the determination of liver glycogen content and homogenization in saline (2% /). Pieces of visceral adipose tissue (3 mm³) were kept in a deep freezer at -70°C pending their use in RNA isolation and RT-PCR analysis. Pancreas from each rat was fixed in 10% neutral buffered formalin and transferred to the Pathology Department, National Cancer Institute (NCI), Cairo University, Cairo, Egypt, for processing, blocking in wax, sectioning, and staining with the trichrome PAS method. 2.9. Biochemical Assays Serum glucose level was determined based on the method of Trinder [44] by a reagent kit obtained from Randox Laboratories, United Kingdom (UK). Serum fructosamine level was determined according to the method of Baker et al. [45]. Serum insulin and C-peptide levels were determined by an ELISA kit obtained from Linco Research Inc., USA, according to the manufacturer’s instruction. Homeostasis model assessment of insulin resistance (HOMA-IR), homeostasis model assessment of insulin sensitivity (HOMA-IS), and homeostasis model assessment of β-cell function (HOMA-β cell function) were calculated according to the equations described by Mishra et al. [46] and Aref et al. [47]. The measurement of serum total cholesterol (TC) and HDL-cholesterol (HDL-C) levels was performed based on the publication of Allain et al. [48], using a reagent kit obtained from Randox Laboratories (UK). Serum triglyceride (TG) level was determined based on the method of Finley and Tietz [49]. Serum LDL-cholesterol (LDL-C) level was determined based on Friedewald et al.’s [50] formula (). Serum vLDL-cholesterol (vLDL-C) was calculated based on Norbert’s [51] formula (). FFA level in serum was estimated based on the publication of Duncombe [52]. Aspartate transaminase (AST) and alanine transaminase (ALT) activities in serum were measured, respectively, based on the publication of Gella et al. [53], by reagent kits delivered from Randox Laboratories (UK). Serum creatinine and urea levels were determined by using kits obtained from Biosystems S.A. (Spain) according to the methods of Fabiny and Ertingshausen [54] and Tabacco et al. [55], respectively. Liver glycogen content was estimated based on the procedure of Seifter et al. [56]. Glucose-6-phosphatase (G-6-Pase) and glycogen phosphorylase activities in liver homogenates were assayed based on the procedures of Kabir and Begum [57] and Stalmans and Hers [58], respectively. Liver lipid peroxidation (LPO) was estimated by malondialdehyde (MDA) detection based on the publication of Preuss et al. [59]. Liver glutathione (GSH) content was detected based on the publication of Beutler et al. [60]. Liver glutathione peroxidase (GPx) and glutathione-S-transferase (GST) activities were detected based on the procedures of Matkovics et al. [61] and Mannervik and Gutenberg [62], respectively. The enzyme SOD activity in liver was measured based to the procedure of Marklund and Marklund [63]. 2.10. Histological Investigation Pancreatic tissues fixed in 10% neutral buffered formalin were transferred to the Pathology Department, National Cancer Institute, Cairo University, Cairo, Egypt, for processing, which included embedding in paraffin wax, sectioning at 5 μm thickness, and staining with a modified aldehyde fuchsin stain method according to Bancroft and Stevens [64]. 2.11. RNA Isolation and RT-PCR Analysis The total RNA was isolated from visceral adipose tissue by the GeneJET RNA Purification Kit obtained from Thermo Scientific Verso 1-Step RT-PCR ReddyMix Kit, Thermo Fisher Scientific Inc., USA according to the publications of Chomzynski and Sacchi [65] and Boom et al. [66]. The levels of isolated RNA were determined and quantified using an ultraviolet (UV) spectrophotometer and taking the absorbances at optical densities (OD) of 260 nm and 280 nm. RNA was quantified and qualified based on Finley and Tietz’s [49] formula (). For each extracted RNA sample, the ratio was between OD at 260 nm and OD at 280 nm and the ratio ranged between 1.7 and 2.0 to ensure the high purity of extracted RNA. Thermo Scientific Verso 1-Step RT-PCR ReddyMix was applied for the synthesis of cloned DNA (cDNA) which, in turn, was amplified by using specific forward and reverse primers by 32 Techne thermal cyclers. The primer pair sequences are as follows: GLUT-4—forward: 5 GCTGTGCCATCTTGATGACGG 3 and reverse: 5 TGAAGAAGCCAAGCAGGAGGAC 3 [1]; insulin receptor β-subunit (IRβ)—forward: 5 CTGGAGAACTGCTCGGTCATT 3 and reverse: 5 GGCCATAGACACGGAAAAGAAG 3 [67]; adiponectin—forward: 5 AATCCTGCCCAGTCATGAAG 3 and reverse: 5 TCTCCAGGAGTGCCATCTCT 3 [68, 69]); and β-actin—forward: 5 TCACCCTGAAGTACCCCATGGAG 3 and reverse: 5 TTGGCCTTGGGGTTCAGGGGG 3 [70]). 2.12. Statistical Analysis The obtained individual data were statistically analyzed by one-way analysis of variance (ANOVA) using the PC-STAT program, University of Georgia, followed by the Least Significance Difference (LSD) test to compare various groups with each other [71]. -probability for the detected parameter represents the general effects between groups. All data are represented as , and significant changes were calculated at and for LSD and at , , and for -probabilities. 3. Results 3.1. GC-MS Analysis of C. reticulata Peel Hydroethanolic Extract The GC-MS analysis (Table 1 and Figure 1) indicated the presence multiple phytochemicals. The main constituents and groups which have a concentration of more than 1% of the total include 4H-pyran-4-one (a cyclic nucleus in the chemical structure of quercetin, naringin, hesperetin, nobiletin tangeretin, etc.), 2,3-dihydro-3,5-dihydroxy-6-methyl-; 5-hydroxymethylfurfural; 4-hexen-3-one, 4,5-dimethyl; phenol, 4-ethyl-; benzaldehyde, 4-hydroxy-; benzaldehyde, 2-hydroxy-; 3,3,4,5,5,7,8-heptamethoxyflavone; 4h-1-benzopyran-4-one, 2-(3,4-dimethoxyphenyl)-5,6,7-trimethoxy-; and β-D-glucopyranose, 4-O-β-D-galactopyranosyl-; n-hexadecanoic acid; tridecanoic acid; 9,12-octadecadienoic acid (Z,Z)-; (Z)6,(Z)9-pentadecadien-1-ol; 9,12,15-octadecatrien-1-ol, (Z,Z,Z)-; 9,12,15-octadecatrien-1-ol, (Z,Z,Z)-; 9-octadecenamide, (Z)-. Number Retention time Compound (from the central Library Search Report) Area % (higher than 1%) 1 15.282 (i) No matches in library 3.50% 2 16.556 (i) 4H-Pyran-4-one, 2,3-dihydro-3,5-dihydroxy-6-methyl- 3.55% 3 17.906 (i) No matches in library 1.13% 4 18.080 (i) No matches in library 2.14% 5 18.579 (i) 5-Hydroxymethylfurfural (ii) 4-Hexen-3-one, 4,5-dimethyl- 17.74% 6 18.981 (i) No matches in library 1.57% 7 19.803 (i) No matches in library 2.65% 8 20.241 (i) No matches in library 1.84% 9 21.329 (i) Phenol, 4-ethyl- (ii) Benzaldehyde, 4-hydroxy- (iii) Benzaldehyde, 2-hydroxy- 1.00% 10 27.047 (i) 3,3,4,5,5,7,8-heptamethoxyflavone 1.78% 11 27.356 (i) 4h-1-benzopyran-4-one, 2-(3,4-dimethoxyphenyl)-5,6,7-trimethoxy- (ii) β-D-Glucopyranose, 4-O-β-D-galactopyranosyl- 3.00 12 29.940 (i) Dodecane 1.29% 13 32.898 (i) n-Hexadecanoic acid (ii) Tridecanoic acid 2.88% 14 34.964 (i) 9,12-Octadecadienoic acid (Z,Z)- 2.37% 15 35.033 (i) 9,12,15-Octadecatrienoic acid, (Z,Z,Z)- (ii) (Z)6,(Z)9-Pentadecadien-1-ol (iii) 9,12,15-Octadecatrien-1-ol, (Z,Z,Z)- 2.46% 16 37.253 (i) 9-Octadecenamide, (Z)- 1.34%
... In Egypt, the sixth world producer of orange, there are a variety of citrus fruits in particular oranges (69% of citrus production) such as navel, Baladi, sweet and blood oranges, whose production has been dramatically increased to~4.27 million tons including 1.34 tons in exports (Omran et al., 2018). Approximately 20% of the total weight of citrus peels is wasted as by-products in conventional food processing, contributing to some environmental pollution (Huang and Ho, 2010). With increasing the industrial citrus waste to more than 40 million tons, many researchers have been trying to convert citrus wastes into valuable products to avoid severe pollution and destruction to the environment (Sharma et al., 2017). ...
... Rutaceae CH 3 OH LPS-induced inflammation in RAW 264.7 cells A significant, dose-dependent reduction in PGE2 and NO levels; a significant decrease in COX-2 and iNOS expression [85]. ...
Article
Full-text available
Natural plants various metabolites are widely utilized in a different kind of infections and inflammation as traditional medication. The inflammatory response is a reaction always effects in daily life and physical issue and activity of herbal complex act through of blood vessels. Inflammation is a pathologic issue that incorporates a wide scope of sicknesses, for example rheumatic, diabetes, cardiovascular accident and chronic kidney disease. We present a few herbal spices which their metabolites that have been assessed in clinical and test. The review includes number of various herbal plants with their families, parts utilized, k concentrate utilized, bioassay models and their usages in medicinal activities.
... Structurally, flavones correspond to a flavonoid subgroup that characterized by a 2-phenylchromogen-4-one backbone and have a double bond between C2 and C3. Flavones are commonly found in fruits and vegetables, such as carrots, parsley, mint, and red and chili peppers (Panche et al., 2016) and exhibit great health benefits such as anti-inflammatory (Huang and Ho, 2010), anticancer (Li-Weber, 2009), antioxidant (Škerget et al., 2005), hypoglycemic, and hypolipidemic activities (Sharma et al., 2008) and prevention of heart disease (Hirvonen et al., 2001). Apigenin, a common flavone, can be synthesized from naringenin catalyzed by FNS. ...
Article
Full-text available
Flavonoids are a class of secondary metabolites found in plant and fungus. They have been widely used in food, pharmaceutical, and nutraceutical industries owing to their significant biological activities, such as antiaging, antioxidant, anti-inflammatory, and anticancer. However, the traditional approaches for the production of flavonoids including chemical synthesis and plant extraction involved hazardous materials and complicated processes and also suffered from low product titer and yield. Microbial synthesis of flavonoids from renewable biomass such as glucose and xylose has been considered as a sustainable and environmentally friendly method for large-scale production of flavonoids. Recently, construction of microbial cell factories for efficient biosynthesis of flavonoids has gained much attention. In this article, we summarize the recent advances in microbial synthesis of flavonoids including flavanones, flavones, isoflavones, flavonols, flavanols, and anthocyanins. We put emphasis on developing pathway construction and optimization strategies to biosynthesize flavonoids and to improve their titer and yield. Then, we discuss the current challenges and future perspectives on successful strain development for large-scale production of flavonoids in an industrial level.
... These EOs contain bioactive compounds, such as limonene, up to 64%-90%, which are believed to have anti-inflammatory activity and low toxicity. 1,5,[7][8][9][10] According to the World Health Organization (WHO), plants are the best source for various types of drugs. The WHO estimates that around 3-4 billion people use herbal medicine and as many as 80% of individuals from developing countries use traditional medicines with basic ingredients from plants. ...
Article
Full-text available
Background: Several studies have shown anti-inflammatory, anti-microbial, antifungal, and antioxidant effects from Citrus limon-peel essential oil (Cl-PEO). Cl-PEO can be developed as topical drugs for oral ulceration because of its potential active components. There have been no studies on the topical application of Cl-PEO inducing type IV hypersensitivity reaction. Purpose: To investigate the potential of Cl-PEO from Batu City to induce type IV hypersensitivity reactions based on clinical changes, lymphocytes, macrophages, IFNγ, andIL10 expression. Methods: This study was adapted from a guinea pig maximization-test method in Indonesia and the guidance of ISO 10,993-10:2010, and conducted on 20 guinea pigs (Cavia cobaya) divided into a control group and a treatment group. The treatment group was given Cl-PEO and the control group CMC-Na. Clinical changes were observed, then tissue specimens taken for hematoxylin-eosin and immunohistochemistry staining. Results: There were no clinical changes after exposure. Lymphocyte and macrophage numbers and IFNγ and IL10 expression increased in the treatment group compared to the control group (p=0). Conclusion: Cl-PEO can induce type IV hypersensitivity reactions in guinea pigs based on cellular and molecular cytokines, but there are no clinical changes after topical application.
... It is widely consumed as processed citrus products, juice or fresh fruit to increase the beneficial intake of antioxidant flavonoids [1,2]. Citrus flavonoid has received considerable attention as a valuable resource due to their potential health benefits such as antioxidant, and anti-inflammatory activities [3,4]. The major categories of citrus flavonoids are flavanone, flavone, and flavonols, which are found as aglycones, glycosides and methylated derivatives [1]. ...
Article
Full-text available
Citrus peel, a primary byproduct of citrus fruits, contains a variety of flavonoids. Heat treatment is a favorable food processing for solid peel to release bioactive compounds from tissues and intensify nutritional effects. In this study, we explored alterations of flavonoids by thermal treatment of mandarin peel and their effects on lipid accumulation and intracellular levels during differentiation of 3T3-L1 cells to adipocytes. The heat-treated sample showed stronger inhibition on the formation of lipid droplets than the non-treated sample, along with enhanced intracellular levels of flavonoids. Overall flavonoids, especially flavonoid aglycones showing better efficacy, were found to increase in the peel after heat-treatment. Our findings indicate thermal processing could help release flavonoids from citrus peel and convert them into aglycone forms, leading to efficient cellular uptake and suppression of lipid accumulation in 3T3-L1 cells. This study provides useful information of heat-treated citrus peel as potential dietary supplements with anti-obesity-related effects. Keywords: Mandarin peel, Heat treatment, Flavonoid, 3T3-L1 cells
... Citrus fruits not only are a rich source of flavonoids, but also contain many health-promoting substances, including vitamin C, carotenoids, polyphenols, limonoids and dietary fiber. Because of their favorable flavor, hundreds of citrus varieties are cultivated worldwide, with an annual production of more than 100 million tons (Huang and Ho, 2010;Igual et al., 2013). Studies have been performed extensively to isolate and characterize the flavonoids of various citrus taxa; however, the detailed profiles of many varieties remain undisclosed (Barreca et al., 2011). ...
Article
Citrus fruits are a valuable functional food and their peel is used in East Asian folk medicine. In this study, the polar components of the fruit tissues of Citrus grandis Osbeck were analyzed using high-performance liquid chromatography-tandem mass spectrometry and compared with reported data. Among the 13 characterized compounds, eight flavonoids and one coumarin were identified for the first time in fruit tissues. The total amount of the identified components was the largest for the immature fruit peel, followed by mature fruit peel, mature fruit flesh, and immature fruit flesh. Naringin (2) and neohesperidin (3) were particularly rich in all samples. The antioxidant activity of the flavonoids extracted from fruit tissues increased in a dose-dependent manner. The activity of the fruit peels was significantly higher than that of the fruit flesh.
... reticulata and C. unshiu), Gómez-Mejía et al. (2019) reported a TF content of 1650 mg QE/100g DW in 'Clementine' (C. clementina) peels.In a study ofHuang and Ho (2010) a 193 and 478 mg rutin equivalent/g DW of TF were determined in 'Murcott' (C. reticulata x C. sinensis) and 'Ponkan' (C. ...
Article
Full-text available
Samples of tree hybrid mandarins (´Clemenvilla`, ´Ortanique` and ´Nadorcott`) were employed to determine the physicochemical properties (increase of conductivity, brix° and pH), bioactive compounds (total phenolic, flavonoid, ascorbic acid and carotenoids content) and antioxidant capacity (DPPH and TEAC) of peels. Mandarin peel extracts were prepared employing ultrasound assisted extraction (400 W, 80% v/v duty cycle, 40ºC). The results were compared to the values of control extraction method. Aqueous ethanol solution (50%, v/v) was used as solvent in solid-liquid ratio of 1:10 (w/v). A 5, 15 and 30 min were applied in both methods to stablish the most effective extraction time. The increase of conductivity enhances with the extraction during 30 min. No significant differences were observed in ºBrix values; in case of pH, these differences were observed according to the varieties analyzed. The total phenolics, flavonoids, carotenoids and ascorbic acid content enhance as the extraction time increased until 30 min with significant differences according to the mandarin variety. ´Clemenvilla` peels treated by 30 min had the highest amounts of total flavonoids (76.7 mg CE/100g) and ascorbic acid content (136 mg AA/100g). ´Ortanique` and ´Nadorcott` peels had the highest values of total phenolic content (1230 GAE/100g) and total carotenoids (8173 μg β-carotene/100g), respectively. Antioxidant capacity values were stronger influenced by flavonoids and ascorbic acid content in both assays applied (DPPH and TEAC). Results indicated that ´Clemenvilla` and ´Ortanique` peel extracts by USN were the samples with highest values by DPPH and TEAC assays respectively (average of 12.2 and 25.7 mmol TE/100g, respectively).
... Citrus flavonoids are known for inhibiting the synthesis of inflammatory mediators including arachidonic acid derivatives, PGE2 and F2 and thromboxane A2 (Benavente-García et al., 1997;Benavente-Garcia and Castillo, 2008). Interestingly the flavanones having polymethoxy substitution were reported to exhibit a significant anti-inflammatory action (Huang and Ho, 2010). Moreover, flavanones are also well known for reducing the oxidative stress via different mechanisms including 1) free radical scavenging, 2) increasing the level of declined antioxidant enzymes and 3) anti-inflammatory activity (Choi and Ahn, 2008). ...
Article
Cisplatin is used as a first line therapy in treating cancers. However, its use is often accompanied with the development of peripheral neuropathy. 6-Methoxyflavanone (6-MeOF) is a positive allosteric modulator at GABAA receptors and is known for attenuating diabetes-induced neuropathic pain. Neuropathy was induced in male Sprague-Dawley rats (150-250 g), via intraperitoneal injection of cisplatin (3 mg/kg) once a week for four consecutive weeks. 6-MeOF (25, 50 and 75 mg/kg, i.p) and gabapentin (75 mg/kg, i.p) were administered 30 min before each cisplatin injection. Static and dynamic allodynia were assessed using von Frey filaments and cotton buds. The anti-inflammatory activity was analyzed with plethysmometer. Body weights were also measured each week. The binding affinity of 6-MeOF with chloride channel, Cyclooxygenase-1 (COX-1) and Cyclooxygenase-2 (COX-2) was studied using docking approach. The in vitro COX-1 and COX-2 inhibitory effect of 6-MeOF was conducted with COX colorimetric assay. Administration of cisplatin for four consecutive weeks induced static (decreased paw withdrawal threshold; PWT) and dynamic allodynia (decreased paw withdrawal latency; PWL). Co-administration of 6-MeOF for four weeks significantly attenuated the cisplatin-induced expression of nocifensive behaviors observed as significant increase in PWT and PWL. Moreover, it also prevented the body weight loss induced by cisplatin administration. In silico studies depicted a good interaction of 6-MeOF with chloride ion channels and COX-1 and COX-2 enzymes. The in vitro study confirmed the inhibitory activity of 6-MeOF for COX-1 and COX-2.6-MeOF may be effective in attenuating cisplatin-induced allodynia, probably through interaction with GABAergic receptors and reducing inflammation.
... [33,37] Phytoconstituents such as phenolics, flavonoids, flavonols and proanthocyanidins may exert their antioxidant activity by directly scavenging reactive oxygen species, including hydroxyl, peroxyl and superoxide radicals to reduce the risks of several human health problems. [38][39] Present study showed that each extracts of MCB bark contain a significant amount of total phenolics, flavonoids, flavonols and proanthocyanidins ( Table 2) The reducing power of a compound could be used as an indicator of its potential antioxidant capacity, and the ability to reduce Fe 3+ to Fe 2+ is often assayed as an indicator of electrondonating activity. [28,40] All the extracts as well as AA presented linearly concentrationdependent increase in absorbance, and their reducing power followed the order of AA>MCBEE>MCBWE ( Figure 1B). ...
Article
Michelia champaca (MC), family Magnoliaceae, is a medicinally important plant. Different parts of this plant are used in various ailments in folk medicine. The present study was conducted to demonstrate antioxidant potentiality of Michelia champaca bark in two different solvents and evaluate their in vitro antidiabetic activity along with screening for their phytochemical composition. The dried coarse powder of Michelia champaca bark was exhaustively extracted with ethanol (MCBEE) and water (MCBWE). The antioxidant activity of resulted extracts was determined by several assays: total antioxidant capacity assay, DPPH, ABTS, lipid peroxidation, Nitric oxide and Superoxide scavenging assays. Quantitative analysis of phytochemicals such as total phenolics, flavonoids, flavonols and proanthocyanidins contents were also measured. In vitro anti-diabetic activity was determined in terms of DNSA and starch iodine colorimetric assay. All the extractives showed strong antioxidant activities related to the standard. The total antioxidant capacity of extracts in most of the cases was in the following order: MCBEE>MCBWE. In free radical scavenging assay, the percent scavenging value of the extracts were concentration dependent manner and ethanol extract showed the most potent inhibitory activity, which was significantly different (p< 0.05) from water extract. At the highest concentration, 51.59 and Khanam et al. World Journal of Pharmaceutical Research 41.94% of α-Amylase inhibition were observed in DNSA method by MCBEE and MCBWE respectively, where standard Acarbose exhibited 65.84% inhibition. Total phenolics content and total flavonoids content were strongly correlated (p< 0.01) with antioxidant activity. The present study suggests that ethanol extract of Michelia champaca bark possess significant in-vitro antioxidant and anti-diabetic activity. Bark of M. champaca may therefore be a good source for natural antioxidants and a possible pharmaceutical supplement.
... Therefore, citrus flavonoids can indicate the characteristic of each citrus species and variety [3]. Compounds found in mandarin peels, such as flavanone glycosides and polymethoxy flavones are recognized as the major contributors to the biological activity of peels [4], with hesperidin being the most abundant flavonoid and the main functional compound [5]. The studies have shown that it possesses hypoglycemic [6], antioxidant and cytotoxic effect against human cancer cell lines [7], anti-inflammatory [8] and antiproliferative activity [9]. ...
Article
Full-text available
The peels of Citrus reticulata Blanco mandarin cultivars of different Croatian varieties (Zorica rana, Chahara, Okitsu, Kuno) were extracted using 15 different choline chloride-based deep eutectic solvents (DESs) at 50 °C for 30 min and with 20% water addition. The extracts were analyzed by high performance liquid chromatography with diode array detection (HPLC-DAD) to determine the most suitable DES for the extraction of hesperidin in the samples. The screening results indicated that choline chloride: acetamide (1:2) provided the most efficient hesperidin extraction (112.14 mg/g of plant), while choline chloride:citric acid (1:1) solvent showed the lowest hesperidin yield (1.44 mg/g of plant). The Box–Behnken design was employed to optimize extraction parameters for each variety of mandarin peel, including extraction time, temperature and water content on hesperidin extraction. The results indicated that hesperidin content in mandarin peels was completely variety-dependent. Being a novel and efficient green media for hesperidin extraction, deep eutectic solvents could also serve as promising solvent systems for the production of extracts rich in bioactive compounds.
... 5 Di Cina, kulit jeruk dimanfaatkan sebagai bahan obat tradisional dengan cara dikeringkan lalu diseduh untuk mengobati asma, diabetes, dan melancarkan peredaran darah. 6 Kulit jeruk juga biasa dibuat menjadi permen atau manisan. Sementara itu, kulit semangka dimanfaatkan sebagai tanaman obat di Afrika 7 serta sebagai acar dan bahan dalam pembuatan roti. ...
Article
Latar Belakang: Kulit buah jeruk dan semangka mencakup hingga 20-30% dari berat total buah. Jumlah tersebut sering hanya dibuang dan tidak dimanfaatkan lebih lanjut terlepas dari kandungan serat yang tinggi. Kandungan serat tersebut dapat dimanfaatkan dengan penambahan kulit buah jeruk dan semangka ke dalam makanan seperti agar-agar sehingga dapat membantu meningkatkan konsumsi serat. Tujuan: Menganalisis daya terima warna, aroma, rasa, dan tekstur dari agar-agar dengan penambahan kulit semangka dan kulit jeruk dengan proporsi yang berbeda.Metode: Penelitian eksperimental dengan rancangan acak lengkap satu faktor yaitu variasi proporsi kulit semangka dan kulit jeruk dengan 3 taraf perlakuan (0:5, 80:20, 70:30). Penelitian dilakukan dengan uji hedonik terhadap warna, aroma, rasa, dan tekstur subjek penelitian. Uji hedonik dilakukan oleh 38 panelis tidak terlatih. Hasil uji hedonik kemudian dianalisis statistic dengan uji Friedman dan uji lanjut dengan uji Wilcoxon.Hasil: Perbedaan proporsi bahan berpengaruh terhadap daya terima agar-agar dengan penambahan kulit jeruk dan kulit semangka dari segi warna (p=0.000), aroma (p=0.037), dan rasa (p=0.005), tapi tidak berpengaruh terhadap tekstur (p=0.178).Simpulan: Perbedaan proporsi bahan berpengaruh terhadap daya terima agar-agar dengan penambahan kulit jeruk dan kulit semangka. Agar agar dengan penambahan kulit jeruk sebanyak 5% adalah agar-agar yang paling diterima oleh panelis karena memiliki hasil organoleptik yang baik
... In Egypt, the sixth world producer of orange, there are a variety of citrus fruits in particular oranges (69% of citrus production) such as navel, Baladi, sweet and blood oranges, whose production has been dramatically increased to~4.27 million tons including 1.34 tons in exports (Omran et al., 2018). Approximately 20% of the total weight of citrus peels is wasted as by-products in conventional food processing, contributing to some environmental pollution (Huang and Ho, 2010). With increasing the industrial citrus waste to more than 40 million tons, many researchers have been trying to convert citrus wastes into valuable products to avoid severe pollution and destruction to the environment (Sharma et al., 2017). ...
Article
Full-text available
With growing consumer awareness, exploitation of renewable resources is cost-effective and environment friendly. This work examines the potential of citrus peels as natural antioxidants and antimicrobials for food preservation. Extraction yield, total soluble phenols and flavonoids of various citrus peels (sweet orange, lemon, tangerine and grapefruit) were optimized by varying the solvent type. While the highest extract yield (∼16 g/100g) was obtained from the sweet orange peels in methanol, extraction with ethanol maximized the concentration of total phenols and flavonoids (∼80 mg catechol equivalents/100 g dry weight). In addition, sweet orange peel extract showed the highest DPPH, ABTS and hydroxyl radical scavenging values. UPLC-ESI-MS/MS analysis of aqueous and ethanolic extracts of sweet orange peels revealed more than 40 polyphenolic compounds including phenolic acids and flavonoids, some of which have not been previously reported. The predominant polyphenols were narirutin, naringin, hesperetin-7-O-rutinoside naringenin, quinic acid, hesperetin, datiscetin-3-O-rutinoside and sakuranetin. The incorporation of sweet orange peel extract into two vegetable oils enhanced their oxidative stability. In addition, all citrus peel extracts possessed high antimicrobial activity against several food-borne pathogens, and the activity was highest for the sweet orange peel extract. Overall results suggested the great potential of sweet orange peels as natural antioxidant and antimicrobials, which can be efficiently extracted using a simple and low-cost method, for enhancing the storage stability and safety of vegetable oils.
... These reasons underpin the importance of information on chemical composition and phytochemical concentration in different germplasm. Documenting the information of chemical concentration and phytochemical constituents can help in developing quality and processing standards for regulatory authorities, authentica-tion of variety, origin, and traceability (Du and Chen, 2010;Huang and Ho, 2010). ...
... The citrus fruits are well recognized for their various ethno-medicinal uses. These properties are attributed to their flavonoids and limonoids which are proven to possess anti-inflammatory and antitumor effects (Middleton Junior et al., 2000;Huang and Ho, 2010). The peels are rich in pectin which is known to possess blood sugar lowering and cholesterol lowering properties (Baker, 1994). ...
Article
Full-text available
The present study was conducted to evaluate the chemical composition, antioxidant activity and hypoglycemic effects of whole kumquat (Ku) powder in diabetic rats fed a high-fat-high-cholesterol (HFHC) diet. The antioxidant activities were evaluated using stable 1,1-diphenyl 2-picrylhydrazyl (DPPH) free radical scavenging method, 2,2´-azinobis (3-ethyl benzo thiazoline-6-sulphonic acid) radical cation (ABTS) and Ferric reducing antioxidant power (FRAP). Total phenolic content was (51.85 mg GAE/g) and total flavonoid content was (0.24 mg Cateachin Equivalent, CE/g). DPPH and ABTS values were 3.32 and 3.98 mg Trolox equivalent (TE)/g where FRAP value was 3.00 mM Fe2+/kg dry material. A total of 90 albino rats were used in the present study. Rats group were as follows: normal diet; normal treated (2, 4, and 6% Ku.), diabetic rats (non-treated), diabetic + HFHC diet (non-treated), HFHC (non-treated), Diabetic (treated), HFHC (treated) and Diabetic + HFHC (treated). The diets were followed for 8 weeks. Blood samples were collected at the end of the experiment. Serum glucose was recorded and thyroid hormones (T4, Thyroxine and T3, Triiodothyronine) were conducted. Diet supplemented with Kumquat at different concentrations have a hypoglycemic effect and improve the thyroid hormones of both diabetic rats and HFHC diabetic rats.
... It is encouraging to explore the active phytochemicals in C. sinensis peel, as reactive oxygen species play a main role in many diseases (Rafiq et al., 2016). Therefore, active phytochemicals in C. sinensis peel have a wide range of therapeutic properties including cardiovascular dysfunction, anti-inflammatory, antihypertensive, diuretic, analgesic, hypolipidemic, and antiviral, antifungal, and antibacterial activi-ties (Galati et al., 1994;Bocco et al., 1998;Ma et al., 2009;Huang & Ho, 2010;Rafiq et al., 2016;Osarumwense, 2017). These therapeutic virtues are all linked to their powerful system of protection against reactive oxygen species. ...
Article
Full-text available
Citrus fruits have long been qualified as veritable foods in view of the many therapeutic benefits they bring to the body. Several researchers have stud-ied the relationship between the bioactive compounds of Citrus and the health benefits and reduction of the risk of disease. Citrus sinensis, used in the food industry and its extracts have also been used in traditional medicine to activate vital energy, circulation, and weight loss, and appetite control. However, limited efforts have been made on collecting data on antioxidant potential of peels orange from the northern region of Algeria. Our study, therefore, focuses on the evaluation of total polyphenols compounds and in vitro assessment of their antioxidant potential of peels orange from the northern region of Algeria. The ethyl acetate and n-butanolic fractions from peels orange have been tested for their antioxidant activities and their lipid peroxidation inhibiting effects. The total phenolic and flavonoids content showed high levels. The preliminary phytochemical screening of tannins, phenolic compounds, flavonoids, coumarin, and alkaloids was also used. DPPH assay possesses strong potency to scavenge free radicals. The NO. radi-cal scavenging test exerts a good inhibitory effect. Furthermore, orange peels have been shown to suppress the lipid peroxidation of linoleic acid. Results further revealed a strong correlation between antioxidant effects and polyphenolic compounds. The high antioxidant activity of peel orange suggests that it could serve as a good natural antioxidant additive or food dietary supplement.
... TPC was expressed as mg of gallic acid/g of dry weight. TFC in the prickly pear extracts was determined with the colorimetric method of aluminum chloride, according to the procedure of Huang and Ho [38], with some modifications. Specifically, the extracts (0.5 mL) were mixed with 2 mL of distilled water and 150 µL of a 5% sodium nitrite solution. ...
Article
Full-text available
In the current study, prickly pear peel was advantageously recycled to preserve fruit quality. Specifically, the investigated by-products were transformed into powder and then loaded into an alginate-based solution to be applied as coating to peeled prickly pears, to give an example of sustainable minimally processed fruit. For comparison, uncoated fruit, and coated prickly pears without any powder were also prepared. During storage at refrigerated temperature, coated and uncoated samples were tested for weight loss, microbial and fungal proliferation, as well as for sensory quality acceptance. The results were interesting because great differences were found between coated and uncoated fruit, in that coating the fruit delayed weight loss and spoilage, compared to uncoated fruit. Between the simple coating and the coating with peel powder, slight differences were recorded in favor of the peel-enriched coating. In fact, it allowed the promotion of better fruit preservation, and sensory quality. Therefore, prickly pear peels, that represent abundant by-products during prickly pear processing, could be advantageously recycled to preserve fruit quality.
... For instance, naringenin and nobiletin showed 3.77 and 3.3 mg/g, respectively, in fresh Navelina peel and reached 8.05 and 5.53 mg g −1 in FD-Navelina peel ( Table 4). The comparison of results with the few data available in the literature were matched [87,96]. ...
Article
Full-text available
Orange peel by-products generated in the food industry are an important source of value-added compounds that can be potentially reused. In the current research, the effect of oven-drying (50-70 °C) and freeze-drying on the bioactive compounds and antioxidant potential from Navelina, Salustriana, and Sanguina peel waste was investigated using pressurized extraction (ASE). Sixty volatile components were identified by ASE-GC-MS. The levels of terpene derivatives (sesquitenenes, alcohols, aldehydes, hydrocarbons, and esters) remained practically unaffected among fresh and freeze-dried orange peels, whereas drying at 70 °C caused significative decreases in Navelina, Salustriana, and Sanguina peels. Hesperidin and narirutin were the main flavonoids quantified by HPLC-MS. Freeze-dried Sanguina peels showed the highest levels of total-polyphenols (113.3 mg GAE·g-1), total flavonoids (39.0 mg QE·g-1), outstanding values of hesperedin (187.6 µg·g-1), phenol acids (16.54 mg·g-1 DW), and the greatest antioxidant values (DPPH•, FRAP, and ABTS•+ assays) in comparison with oven-dried samples and the other varieties. Nanotechnology approaches allowed the formulation of antioxidant-loaded nanoemulsions, stabilized with lecithin, starting from orange peel extracts. Those provided 70-80% of protection against oxidative UV-radiation, also decreasing the ROS levels into the Caco-2 cells. Overall, pressurized extracts from freeze-drying orange peel can be considered a good source of natural antioxidants that could be exploited in food applications for the development of new products of commercial interest.
... Along with taste, texture and delightfulness, citrus juice is a source of phytoconstituents, including flavonoids and phenolics, significant for human nutrition (Kumar et al., 2013). Among them, phenolics and flavonoids are abundant in citrus fruits and have many biological effects, including antioxidative, anti-carcinogenic, cardiovascular and antiinflammatory (Huang & Ho, 2010). Although some studies have been conducted to evaluate the potential of citrus fruit parts as antioxidative and other activities, little is known as a comparative analysis of citrus juices among varieties. ...
Article
Full-text available
Comparative nutritional analysis of citrus varieties cultivated in Pakistan has not been reported. Citrus is consumed all over the world due to its taste and also has pharmacological components. The present investigation evaluated the antioxidant, reducing power, total flavonoids and phenolics, DPPH free radical scavenging, protein kinase inhibition, and the antimicrobial activities of eight Pakistani citrus varieties. Grapefruit showed maximum total antioxidant potential (77 µg AAE/100 mg), followed by Kinnow and Shakri. Khatai showed maximum reducing power potential (69.6 µg AAE/100 mg) while Shakri and Grapefruit trailed it. All the varieties showed significant DPPH free radical scavenging activity. Maximum total phenolics in citrus juice were found in Shakri and Kinnow; 26.2 and 25.9 µg GAE/100mg, respectively. Variation in total flavonoids content was observed as Kinnow>Grapefruit>Shakri>Khatai. All the citrus juices showed mild to moderate antibacterial activity, while Mosambi and Malta contained potent antifungal components. HPLC analysis of citrus juices revealed that catechin was present in all citrus genotypes except Kinnow. The study concludes that citrus juices contain strong antioxidative potential, bear protein kinase inhibitors and can be used as cancer chemoprevention and supportive nutrition.
... Furthermore, the presence of flavonoids in the study is in agreement with the report of He et al. [29] who reported the presence of flavonoids and the types of flavonoids present. Several studies have reported that flavonoids have natural potentials that positively affect human wellbeing as an ideal group of secondary metabolites in citrus products that may have natural potential and affect human wellbeing as antimicrobial, anti-inflammatory,anti-diabetic, anticholesterolemic, anti-inflammatory and anticarcinogenic [29][30][31][32][33]. ...
... We observed that the young people were less dependent on herbal recipes, which is most likely due to fast urbanization and the increased accessibility of modern medical facilities. In terms of level of education, it was observed that traditional (Cai et al., 2004;Li et al., 2003Li et al., , 2011Saini et al., 2008) (Campelo et al., 2011;Huang and Ho, 2010;Kirbaşlar et al., 2009;Miguel, 2010;Miyake et al., 1999Miyake et al., , 1997 (Gungor and Sengul, 2008;Khalid et al., 2011) terpenoids and tanins Murraya exotica L. (Kaya et al., 2008;Selvakkumar et al., 2007) salvadorin, 8-benzyl-6-[6-(6-ethyl-7-methyl-5,8-dihydro-2-naphthalenyl It also used in teeth sensitivity. Anti-oxidant, anti-fungal, (Battinelli et al., 2006;Hayes et al., 2011) lupeol, (Rauf et al., 2012;Ullah et al., 2015) vitamin C, essential oils and carotenes (Shinwari and Khan, 2000) Phoenix dactylifera L. (Elberry et al., 2011;Ishurd and Kennedy, 2005) flavonoids and phenolics (Sanghai et al., 2013) Seeds oil is used in toothpaste. ...
Article
Full-text available
Ethnopharmacological relevance: This is the first study of the indigenous knowledge in regard to the use of medicinal plants for the treatment of oral diseases in the Central Punjab, Pakistan region. The study aimed to document indigenous knowledge about the treatments of oral diseases using quantitative ethnobotanical indices, as well as highlighting important medicinal plant species by comparing the data obtained with previously published ethnobotanical and pharmacological data. Methods: The ethnomedicinal data was collected from local informants and Traditional Health Practitioners (THPs). The Relative Frequency of Citation (RFC) and Diseases Consensus Index (DCI) were calculated to analyse the documented data. The results were compared with those of the nine ethnobotanical studies highlighted in our literature review relating to oral disease, as well as many pharmacological studies evaluating the reported plants. Results: In total, 72 medicinal plants belonging to 38 families were reported by the 180 local informants and 17 THPs interviewed. The most commonly used family, life form and plant part used was Asteraceae (6 species), herbs (30 reports) and leaves (22 reports) respectively. The RFC ranged from 7.61% (Berberis lycium, Dodonea viscosa) to 51.78% (Abutilon indicum, Accacia nilotica, Cuscuta reflex and Solanum nigrum), while the DCI varied from 0.062 to 0.78 with the highest value of DCI for Zizyphus oxyphylla and the lowest for Abutilon indicum. The most prominent species based on quantitative indices in the present study and comparison with previous published data were Zizyphus oxyphylla, Pongamia pinnata, Launea nudicaulis, Acacia nilotica, Abutilon indicum, Salvadora persica and S. oleoides. Conclusion: This study has identified a range of medicinal plants traditionally used in Central Punjab, Pakistan for the treatment of oral diseases. This data can usefully inform the direction of future research and it is suggested that further detailed phyto-pharmacological, toxicological and clinical studies be conducted on the plant species documented in the study, especially those with the highest RFC and, DCI values.
Chapter
The biosurfactants derived from plants are bestowed with many charactestic features such as natural abundance, renewability, sustainability, lower cost, superior stability, biocompatibility, biodegradability, low environmental and human toxicity when compared with synthetic surfactants. In addition, their manufacture does not exhaust the inadequate petroleum reservoirs and they show a wide range of biological properties including, antidermatophytic activity. The present review provides a short description of the importance of plant saponin biosurfactants, their quantification and the applications of commonly used saponin yielding Indian plants. In India, most of the saponin containing plants belong to various families including, Sapindaceae (Sapindus sp), Fabaceae (Acacia concinna, Trigonella foenum-graecum, Vigna radiata, Cicer arietinum, Albizia lebbeck), Rutaceae (Citrus sp), Malvaceae (Hibiscus rosa sinensis), Phyllanathaceae (Phyllanthus emblica), Asphodelaceae (Aloe vera), Asteraceae (Eclipta alba), Asparagaceae (Agave sp), Dioscoreaceae (Dioscorea esculenta) etc. The various plant parts including, leaves, bark, stem tubers, fruits, fruit pericarp, seeds etc are utilized as bathing soap, washing detergent, utensil cleaner, hair cleanser, hair conditioner, shampoo, hair oil, hair dye etc. The utilization of herbal detergent and shampoo in pre-Harappan civilization indicates the advancement in health and hygienic practices in Indian civilization. Most of the plant saponins are used for treating various skin and hair problems. They are mild and natural; they serve natural conditioner and cleaners and do not deplete natural oils from skin and hair. Also, most plant saponins exhibit hair follicle strengthening, hair growth promotion and hair dyeing activities. The superior emulsifying action of natural saponins makes them ideal, ecofriendly, commercial, economical laundry detergents. Further studies are envisaged on bulk raw material production, isolation and purification of saponins and toxicological evaluation.
Article
Full-text available
Bacterial infections can cause many human diseases, which are closely related to people's health. Nowadays, antibiotics are mainly used to treat bacterial infections, but the widespread use of antibiotics can also lead to bacterial resistance. Therefore, effective treatment of bacterial infections is an urgent problem to be solved. In this article, a multifunctional therapeutic material with antibacterial properties was designed and synthesized. First, the porous media material ZIF‐8 was synthesized, and applied to load hesperidin. When the load is completed, a layer of hyaluronic acid (HA) is uniformly wrapped on surface of the material. Such materials have high stability and high drug‐carrying capacity, and can be slowly released in vivo. The HA coated on surface can also promote penetration of active ingredients into cells and give full play to antibacterial ability. Results of in vitro and in vivo antibacterial tests show that synergy between the materials enhances antibacterial activity which is related to dose. The material achieves high‐efficiency antibacterial effects by increasing the permeability of cell membranes and destroying the integrity of bacteria. At same time, the material does not show obvious side effects. Therefore, the material seems to be a promising antibacterial agent with good biocompatibility and strong antibacterial activity.
Article
Guided by 1H NMR spectroscopic experiments using the aromatic protons as probes, 11 macrocyclic diterpenes (1-11) were isolated from the aerial parts of Euphorbia helioscopia. Their full three-dimensional structures, including absolute configurations, were established unambiguously by spectroscopic analysis and single-crystal X-ray crystallographic experiments. Among the isolated compounds, compound 1 is the third member thus far of a rare class of Euphorbia diterpenes featuring an unusual 5/10 fused ring system, and 2-4 are new jatrophane diterpenes. Based on the NMR data of the jatrophane diterpenes obtained in this study as well as those with crystallographic structures reported in the literature, the correlations of the chemical shifts of the relevant carbons and the configurations of C-2, C-13, and C-14 of their flexible macrocyclic ring were considered. Moreover, the anti-inflammatory activities of 1-11 were investigated by monitoring their inhibitory effects on nitric oxide production in lipopolysaccharide-stimulated RAW 264.7 cells. Compound 1 showed an IC50 of 7.4 ± 0.6 μM, which might be related to the regulation of the NF-κB signaling pathway by suppressing the translocation of the p65 subunit and the consequent reduction of IL-6 and TNF-α secretions.
Article
In the present study, the fresh fruit peels of some species of the genus Citrus L. cultivated in Turkey were prepared with 80% methanol using maceration and accelerated solvent extraction. The obtained extracts were compared to spectrophotometric methods due to the total phenolic and flavonoid contents, DPPH radical scavenging activities, and tyrosinase inhibition properties. Moreover, the correlation between the phenolic/flavonoid contents and radical scavenging/anti-tyrosinase activities were evaluated. The fingerprint analysis of the extracts was evaluated by high-performance thin-layer chromatography (HPTLC). Radical scavenging and tyrosinase inhibition properties were also examined via HPTLC‒effect-directed analysis to assess the effective components of the extracts. The bioactive unknown zones were isolated from HPTLC plates and analyzed by mass spectrometry. In the extracts, naringin which is responsible for the anti-tyrosinase activity, hesperidin, and neoeriocitrin, which are responsible for the antioxidant activity, were identified tentatively.
Chapter
Full-text available
Horticultural crops, especially fruits and vegetables, are highly consumed as food and food products. These items are consumed either uncooked, partially cooked, or fully cooked, according to their nature and the cooking process. A large amount of waste is generated from fruit- and vegetable-based industries and household kitchens. According to the FAO, waste generated from fruits and vegetable processing is estimated by 25–30% of the total product. This waste is rich in active compounds and has high nutritional content. Utilization of this waste into beneficial by-products could represent an essential strategy for reducing significant dietary and economic loss as well as the negative environmental impacts. The most common wastes include pomace, peels, rind, and seeds are fabulously rich in valuable bioactive compounds such as carotenoids, enzymes, phenolics, essential oils, vitamins, and many other compounds. These bioactive compounds show their application in various industries, including food industries to develop edible films, health industries for probiotics, and other industries for valuable and natural products. The utilization of these low-cost waste for producing the high value-added product is a novel step in its sustainable utilization. Tangerine is commonly produced and consumed as fresh or processed worldwide. The Mediterranean area produces the best and high-quality tangerine in the world. It is a high vitamin C source and rich in nutrients and provides many medicinal and health benefits. According to the new information released by the FAO, considering the influences of the novel coronavirus (COVID-19), populations with extreme starvation in the world will perhaps increase. Consequently, countries should gain proficiencies and try to reduce trade-related costs, for example, by reducing food waste and losses. Therefore, the present chapter intends to summarize the different types of waste originating from Tangerine (Citrus reticula L.) and highlight their potential in developing edible films, probiotics, nanoparticles, carbon dots, microbial media, biochar, and biosorbents.KeywordsNobiletinTangeretinHesperidinFlavonoidsProbioticsNanoparticlesAnti-neuroinflammatoryEssential oilTangerine byproducts
Article
Dietary additive can effectively improve growth performance and stressor resistance of aquatic animals. Dietary inclusion effect of citrus peel by‐product (CPB) as an additive on the growth, body composition, and various stress resistance of juvenile abalone (Haliotis discus) was investigated, and compared to commercial antioxidant (ethoxyquin). A total of 2880 juvenile (initial weight of 3.3 g) abalone were randomly assigned into 24 net cages. Seven formulated diets supplemented with 0, 5, 10, 20, 30, and 50 g/kg CPB and 0.01 g/kg ethoxyquin were formulated, and referred to as the CPB0, CPB5, CPB10, CPB20, CPB30, CPB50, and EQ diets, respectively. Finally, dry Saccharina japonica was prepared to compare the formulated diets on growth of abalone. All experimental diets were assigned to triplicate groups of abalone. Abalone were daily fed to satiation for 16 weeks. After the 16-week feeding trial, sixty abalone from each cage were subjected to the 20-h air, 12-h low salinity at 25 psu, and 20-h high temperature at 30 °C exposure stressors, respectively, and then survival was monitored. Abalone fed all formulated diets produced superior weight gain, specific growth rate (SGR), shell growth to abalone fed the S. japonica. Dietary inclusion levels of CPB linearly improved weight gain of abalone. However, there was no difference in chemical composition of the soft body of abalone fed all experimental diets. Diets supplemented with CPB or EQ improved survival of abalone when subjected to the 20-h air and high temperature exposures. In conclusion, CPB was a very effective additive as growth enhancer as well as stress reducer in abalone diet. Abalone fed the CPB50 diet attained the highest weight gain, SGR, and stress resistance subjected to the 20-h air and high temperature exposures.
Article
Oxidative damage, chronic hyperglycemia, and the formation of advanced glycation end products (AGEs) are important risk factors associated closely with diabetes and its complications. In the present study, the antidiabetic potential of navel orange peel was explored for the first time by evaluating the antioxidant, α-glucosidase inhibition, and antiglycation activities of its extracts and individual flavonoids. In total, seventeen flavonoids were identified from the peel extract, of which 5-hydroxy-6,7,3′,4′-tetramethoxyflavone, didymin and sinensetin were the most potent antioxidant, α-glucosidase inhibitor, and glycation inhibitor, respectively. In addition, the structure-activity relationship (SAR) studies of these flavonoids were performed in detail. Moreover, the most potent antidiabetic extract of navel orange peel was quantitatively analyzed by HPLC. The present results support the potent application of orange peel as a nutraceutical resource for diabetes management, and might be beneficial to the orange juice industry by providing useful information on the valorization of orange peel.
Article
Full-text available
The therapeutic effects from Citrus reticulata on painful inflammatory ailments are associated to its flavonoids constituent and phytochemical studies with Citrus genus affirm that the peels have important amounts of it. These bioactive compounds have been a considerable therapeutic source and evaluate potential application of the peel extract is significant. This research aims to investigate the influence of ethanolic crude extract from the peels of Citrus reticulata and its possible mechanism of action in different animal models of pain. The extract reduced hyperalgesia in the second phase of formalin test (vehicle: 501.5 ± 40.0 s; C. reticulata extract 300 mg/kg: 161.8 ± 41.1 s), in the carrageenan model (vehicle at 4th h: 82.5 ± 9.6 %; C. reticulata extract 300 mg/kg at 4th h: 47.5 ± 6.5 %) and in Complete Freund’s Adjuvant model (vehicle: 501.5 ± 40.0 s; C. reticulata extract 300 mg/kg: 161.8 ± 41.1 s). The possible contribution of opioidergic and adenosinergic systems in the anti-hyperalgesic effect of C. reticulata extract was observed after treatment, with non-selective antagonists for both systems, which produced reversal effects. In conclusion, these properties of C. reticulata extract suggest a potential therapeutic benefit in treating painful conditions.
Chapter
India has been blessed with a wide variety of wild and cultivated edible tropical fruits with unique taste and aroma/flavours. Fruits and vegetables are a rich reserve of nutritive fibres, vitamins, macronutrients and minerals, in addition to several phytochemicals. The Indian tropical fruits belong to diverse botanical groups, and some of the important edible fruits include mango, banana, papaya, citrus, guava, pineapple, litchi, sapota and pomegranate. Several minor and underutilized wild edible tropical fruits are also found throughout the country. Phenolic bioactive compounds, such as catechin, ellagic acid, epicatechin, epigallocatechin, anthocyanins, gallotannins, ellagitannins, gallic acid, sinapic acid, quercetin, resveratrol and kaempferol have been isolated from Indian tropical fruits, and these compounds are proven with medicinal and health-promoting properties. As a result, consumption of these fruits can be strongly allied to curtailed risk of various human diseases, including coronary heart diseases, diabetes and cancers. Antiproliferative activities, protection of cellular damage by free radicals, apoptosis and anti-inflammatory action are the main mechanisms by which fruits and vegetables are known to exhibit their chemoprevention and promote health.
Chapter
Citrus fruits are among the most spread fruits in the world and in the Mediterranean region particularly. Different trees that belong to the Citrus family produce lemon, lime, grapefruit, oranges, mandarins/tangerines, and sour oranges. The Mediterranean region is producing more than 20% of Citrus fruits worldwide production. Globally, the production of Citrus fruits exceeds 120 million tons yearly. Therefore, an important part of these fruits is transformed into juices and marmalades, and to yield likewise a significant amount of waste. All Citrus fruits contain diversity and high amounts of various bioactive molecules, and so do the wastes. These bioactive molecules belong to different families: terpenes, carotenoids, limonoids, polyphenols, phenolic acids, flavonoids, polymethoxy flavones, pectin, fibers, etc. Several studies revealed the multiple biological activities of these chemical components: antioxidant, anti-inflammatory, anti-diabetic, anti-Alzheimer, and anti-tumor against several cell lines. Also, functional properties have been associated with the chemical compounds as health promoters and disease-preventing agents for human beings. The obtained extracts from Citrus fruits bio-wastes can be used in food products, additives to food products, nutraceuticals, functional food, and pharmaceuticals. The generated wastes are also exploitable as feed and raw material for energy recovery. This chapter aims to provide an overview of the different Citrus bio-wastes components and their chemical composition, their bioactive compounds, their biological activities and functional properties, and their food, non-food, and industrial applications.KeywordsCitrus fruitsBy-productWastesFunctional foodIndustrial applications
Article
Full-text available
During the last decade, there has been a continuous rise in the consumption of fresh easy-to-peel mandarins. However, the majority of the knowledge comes from other citrus fruit, like orange, while there are relatively few studies about mandarins and no comprehensive research on literature data about them. One of the most important steps in the analytical process is sample preparation. Its value is evident in analyzing the samples with complex matrices, such as in mandarin fruit. In addition, mandarin contains hundreds to thousands of various compounds and metabo-lites, some of them present in extremely low concentrations, that interfere with the detection of one another. Hence, mandarin samples are commonly pretreated by extraction to facilitate analysis of bioactive compounds, improve accuracy and quantification levels. There is an abundance of extraction techniques available, depending on the group of compounds of interest. Finally, modern analytical techniques, have been applied to cope with numerous bioactive compounds in mandarins. Considering all the above, this review aims to (i) list the most valuable procedures of sample preparation, (ii) highlight the most important techniques for extraction of bioactive compounds from mandarin fruit, and (iii) summarize current trends in the identification and determination of bioactive compounds in mandarin.
Article
Distiller’s grains are a waste product in the Baijiu brewing that contains many bioactive ingredients. However, few studies on the active ingredients and biological in distillers' grains. Therefore, it is promising to study the utilization of bioactive substances in distiller's grains. In our present study, an ultrasonic‐assisted method was applied to extract antioxidative components from distiller's grains. Four factors: ethanol concentration, liquid‐solid ratio, extraction temperature and ultrasonic power were selected, and multiple responses were studied using response surface methodology (RSM). The effects of factors and the correlation between all responses (flavonoids content, DPPH assay, OH‐ assay) were investigated. The regression model indicated that all factors have significant effects on all responses. The model predicted a flavonoid yield of 6.53 mg/g, DPPH‐RSC of 90.00%, and OH‐RSC of 55.03% at an ethanol concentration of 69%, a liquid‐solid ratio of 35 mL/g, an extraction temperature of 61°C, and a power of 300 W. The confirmation test showed the closeness of the predicted results with those of experimental values. The distiller's grains was separated by LH20 glucan gel, and total flavonoid content of 79.4% was obtained. LC‐HRMS analyzed the compounds, and 24 compounds, including 7 flavonoids, were identified successfully.
Article
In this study a fortified pancake with all parts of pomegranate as juice and by‐products, added in the formulation, was designed. The influence of pomegranate addition on nutritional and sensory quality of pancake, as well as on its shelf‐life was assessed. As one would expect, the enrichment significantly improved the pancake polyphenolic content as compared to the control sample. Surprisingly, pomegranate addition did not affect its sensory quality. In fact, the enriched pancake was greatly appreciated from the sensory point of view. Results also suggested that the addition of pomegranate improved the glycemic index (GI). In fact, while a value of GI equal to 100 was obtained for the control sample, a GI of 71 was measured for the fortified sample. In terms of shelf‐life, 30 days were obtained for the enriched pancake, whereas, the control sample remained acceptable for about 26 days.
Article
This paper introduces the extraction and purification of some polymethoxylated flavones from Ageratum conyzoides L., (Family-Asteraceae), growing in Can Tho city. Different extraction methods were used to study on the aerial part of the herb. From 1% HCl in water extracts, three polymethoxylated flavones have been isolated and identified. They were O‑methyl apigenin, sinensetin, and scutellareintetramethyl ether. Structures of isolated compounds were elucidated according to their 1H-NMR, 13C-NMR, HSQC, HMBC, MS spectra as well as referring to published article.
Chapter
Cancer is an insidious disease affecting mankind in every country. The progression of cancer cells from one part of the body to another (metastasis) is one of the biggest problems in curing cancer. The present study brings new hope of future therapies to fight cancer. Designing an appropriate food to maintain proper health has become a necessity worldwide. Due to this, the food industries in many countries are modifying their products as a response to consumer demands. In recent years, many of the natural products are gaining popularity as nutraceuticals.
Preprint
Full-text available
Context: The use of traditional Arabic medicine (TAM) has spread to treat various diseases in Syria since ancient time. They are cost-effective with fewer side effects and are more suitable for long-term use compared with chemically synthesized medicines. Objective: We conducted ethnobotanical and ethno-medicine research on plants traditionally used as adjuvant therapy for COVID-19 symptoms in Syria. Methods: Information was collected in the period of (September 1st, 2020 to December 21st, 2020), from Southern Region (Damascus, As Suwayda, Dar'a), Northern region (especially Aleppo), Central region (Himis, Hamah), Western coastal region (Latakia, Tartus) Eastern Region (Dayr az Zawr, Al Hasakah) in Syria. 150 informants were divided into two group one of them is pharmacists who interested in herbal remedies 73.34% (63.64% female and 36.36% male of them), and the other is herbalists 26.66% who are called "attarin" traditional healers and bee therapists. Medicinal plants being mentioned by the Informants were recorded with local names and photographed. Each reported medicinal plant species was gathered, compressed, dehydrated, and identified. Results: In this research we listed a total of 26 medicinal species relating to 15 botanical families were generally utilized by pharmacists and herbalists in the prevention and treatment of COVID 19. The calculated results of medicinal use-value MUV showed that Pimpinella anisum L. was ranked first (MUV=0.933) followed by Zingiber officinale Roscoe. (MUV=0.920), then Thymus syriacus Boiss. (MUV=0.9). Conclusion: There may be some effective Syrian traditional herbal remedies in preventing and treating COVID-19 symptoms for some people, but the lack of information on the mechanism of effect, the appropriate dosage, side effects, toxicity and drug interactions makes them questionable, as they need more research and study.
Chapter
Biosurfactants are natural surface-active materials created by microorganisms. Biosurfactants can contribute several properties including antibacterial, antioxidant, emulsifying, and antiadhesive activities to the food in which they are incorporated. Biosurfactants have been employed in food formulations to enhance viscosity, extending the shelf life of the products, improving texture and flavor, as well as lowering the calorie value by substituting fat. This chapter summarizes the activities of biosurfactants as antioxidants in food, as well as the features of biosurfactants in boosting food quality and the variables impacting biosurfactant synthesis.
Article
Citrus is one of the main fruits processed worldwide, producing a lot of industrial by-products. As the main part of citrus “residue”, citrus peels have a wide application prospect. They could not only be directly used to produce various food products, but also be used as promising biofuels to produce ethanol and methane. Additionally, functional components (flavonoids, limonoids, alkaloids, essential oils and pectin) extracted from citrus peels have been related to the improvement of human health against active oxygen, inflammatory, cancer and metabolic disorders. Therefore, it is clear that the citrus peels have great potential to be developed into useful functional foods, medicines and biofuels. This review systematically summarizes the recent advances in current uses, processing, bioactive components and biological properties of citrus peels. A better understanding of citrus peels may provide reference for making full use of it.
Article
Full-text available
Several plants have traditionally been used since antiquity to treat various gastroenteritis and respiratory symptoms similar to COVID-19 outcomes. The common symptoms of COVID-19 include fever or chills, cold, cough, flu, headache, diarrhoea, tiredness/fatigue, sore throat, loss of taste or smell, asthma, shortness of breath, or difficulty breathing, etc. This study aims to find out the plants and plant-derived products which are being used by the COVID-19 infected patients in Bangladesh and how those plants are being used for the management of COVID-19 symptoms. In this study, online and partially in-person survey interviews were carried out among Bangladeshi respondents. We selected Bangladeshi COVID-19 patients who were detected Coronavirus positive (+) by RT-PCR nucleic acid test and later recovered. Furthermore, identified plant species from the surveys were thoroughly investigated for safety and efficacy based on the previous ethnomedicinal usage reports. Based on the published data, they were also reviewed for their significant potentialities as antiviral, anti-inflammatory, and immunomodulatory agents. We explored comprehensive information about a total of 26 plant species, belonging to 23 genera and 17 different botanical families, used in COVID-19 treatment as home remedies by the respondents. Most of the plants and plant-derived products were collected directly from the local marketplace. According to our survey results, greatly top 5 cited plant species measured as per the highest RFC value are Camellia sinensis (1.0) > Allium sativum (0.984) > Azadirachta indica (0.966) > Zingiber officinale (0.966) > Syzygium aromaticum (0.943). Previously published ethnomedicinal usage reports, antiviral, anti-inflammatory, and immunomodulatory activity of the concerned plant species also support our results. Thus, the survey and review analysis simultaneously reveals that these reported plants and plant-derived products might be promising candidates for the treatment of COVID-19. Moreover, this study clarifies the reported plants for their safety during COVID-19 management and thereby supporting them to include in any future pre-clinical and clinical investigation for developing herbal COVID-19 therapeutics.
Article
Full-text available
Indigenous communities throughout the globe respond to COVID-19 by their traditional medicinal systems as primary health care. Our lab was part of an international study that discusses the outcomes of a rapid response, preliminary survey during the first phase of the pandemic among social and community contacts in five metropolises heavily affected by the COVID-19 health crisis (Wuhan, Milan, Madrid, New York, and Rio de Janeiro) and in twelve rural areas or countries initially less affected by the pandemic (Appalachia, and South Africa). Primarily, people have relied on teas and spices ("food-medicines") to prevent and mitigate its symptoms. Urban diasporas and rural households seem to have repurposed homemade plant-based remedies that they use on daily basis to treat the flu and other respiratory problems and hence consider among the healthy foods. The most remarkable shift in many areas has been increased in the consumption of ginger and garlic, followed by onion, turmeric, lemon, chamomile, black tea, nettle, chili pepper, and apple. This study serves as a baseline for future systematic ethnobotanical studies countering COVID-19 and other vicious types of viruses. It aims to inspire in-depth research on how use patterns of plant-based foods and beverages, both "traditional" and "new," are changing during and after the COVID-19 pandemic. Our reflections in this study call attention to the importance of ethnobiology, ethnomedicine, and ethno-gastronomy research into domestic health care strategies for improving community health. Some of these economically important plants are suggested to be extensively analyzed experimentally, for active ingredients, phytochemicals, and the precursor of vaccines and probable remedy of SARS including COVID-19.
Chapter
Over the years, the food technology has emerged in tandem with changes in dietary trends. New technologies have arisen that not only improve the flavor and shelf life of food goods, but also contain effective additives that are same for customers’ health and provide nutraceutical benefits. As a result, the adoption of natural alternatives to replace synthetic additives is increasing in ongoing research. Biosurfactants have evolved as natural alternatives that can employed as an emulsifying agent in the food processing industry. Biosurfactants of the lipopeptide, glycolipid, glycoprotein, glycolipopeptide types can emulsify a wide range of vegetable oils and fats in food processing with high emulsification index. This biomolecule has a beneficial impact on texture profile analysis and sensory attributes such as color, aroma, and taste evolution in baked goods. The research in this field is still in the lab, and additional research is needed before this natural alternative, biosurfactants, may be used in large industrial sectors.
Article
Full-text available
Epidemiological studies have shown an inverse relationship between dietary flavonoid intakes and cardiovascular diseases. Citrus fruits are the main winter fruits consumed in the Mediterranean diet, so they are the main source of dietary flavonoids. The possible beneficial effects are due, not only to the high amounts of vitamins and minerals, but also to the antioxidant properties of their flavonoids. Dietary flavonoids may help to supplement the body antioxidant defences against free radicals. These compounds’ possible beneficial effects are due to their antioxidant activity, which is related to the development of atherosclerosis and cancer, and to anti-inflammatory and antimicrobial activity. The present review summarizes the existing bibliography on biological and pharmacological studies of Citrus flavonoids, both in vitro and in vivo.
Article
Full-text available
The goal of this investigation was to evaluate the antioxidant properties of some citrus fruits. The contents of dietary fibre, total polyphenols, essential phenolics, ascorbic acid and some trace elements of lemons, oranges and grapefruits were determined and compared with their total radical-trapping antioxidative potential (TRAP). There were no significant differences in the contents of total, soluble and insoluble dietary fibre in the studied peeled fruits or their peels. The contents of total, soluble and insoluble dietary fibre in peels were significantly higher than in peeled fruits (P< 0.05 in all cases). The peeled lemons, oranges and grapefruits contain 164±10.3; 154±10.2 and 135±10.1 and their peels 190±10.6; 179±10.5 and 155±10.3 mg/100 g of total polyphenols, respectively. The content of total polyphenols in peeled lemons and their peels was significantly higher than in peeled oranges and grapefruits and their peels, respectively. The content of total polyphenols in the peels was significantly higher than in peeled fruits (P< 0.05 in all cases). The same results were obtained in the investigation of essential phenolics and ascorbic acid. The content of Fe in peeled lemons and their peels was significantly higher than in peeled oranges and grapefruits and their peels, respectively. Also the TRAP was significantly higher in peeled lemons and their peels than in peeled oranges and grapefruits and their peels, respectively. In all three fruits, the TRAP was significantly higher in peels than in peeled fruits (P< 0.05). In conclusion, lemons possess the highest antioxidant potential among the studied citrus fruits and are preferable for dietary prevention of cardiovascular and other diseases. The peels of all citrus fruits are rich in dietary fibres and phenolic compounds and suitable for industrial processing.
Article
Full-text available
Cyclooxygenase (COX) converts arachidonic acid to prostaglandin H2, which is further metabolized to prostanoids. Two isoforms of COX exist: a constitutive (COX-1) and an inducible (COX-2) enzyme. Nitric oxide is derived from L-arginine by isoforms of nitric-oxide synthase (NOS; EC 1.14.13.39): constitutive (cNOS; calcium-dependent) and inducible (iNOS; calcium-independent). Here we have investigated inducible isoforms of COX and NOS in the acute, chronic, and resolving stages of a murine air pouch model of granulomatous inflammation. COX and NOS activities were measured in skin samples in the acute phase, up to 24 h. Activities in granulomatous tissue were measured at 3, 5, 7, 14, and 21 days for the chronic and resolving stages of inflammation. COX-1 and COX-2 proteins were assessed by Western blot. COX activity in the skin increased over the first 24 h and continued to rise up to day 14. COX-2 protein rose progressively, also peaking at day 14. COX-1 protein remained unaltered throughout. The iNOS activity increased over the first 24 h in the skin, with a further major increase in the granulomatous tissue between days 3 and 7, followed by a decrease at day 14 and a further increase at day 21. The rise in COX and NOS activities in the skin during the acute phase reinforces the proinflammatory role for prostanoids and suggests one also for nitric oxide. However, in the chronic and resolving stages, a dissociation of COX and NOS activity occurred. Thus, there may be differential regulation of these enzymes, perhaps due to the changing pattern of cytokines during the inflammatory response.
Article
Full-text available
Previous data have shown that a citrus flavanone, hesperidin possesses chemopreventive efficacies. We designed to investigate the inhibitory effect of hesperidin on lipopolysaccharide (LPS)-induced over-expression of cyclooxygenase-2 (COX-2), inducible nitric oxide synthase (iNOS) proteins, over-production of prostaglandin E2 (PGE2) and nitric oxide (NO) using mouse macrophage cells. Treatment with hesperidin suppressed production of PGE2, nitrogen dioxide (NO2), and expression of iNOS protein. In the case of COX-2, hesperidin did not affect the protein level. Our data indicate hesperidin as a COX-2 and iNOS inhibitor, which might be related to the anti-inflammatory and anti-tumorigenic efficacies.
Article
Full-text available
An HPLC analysis was performed on the concentrations of flavonoids in 42 species and cultivars of the Citrus genus and those of two Fortunella and one Poncirus species according to the classification system established by Tanaka. The composition of 8 flavanones and 9 flavone/ols for these species was determined in the albedo, flavedo, segment epidermis and juice vesicle tissues, and those in the fruit and peel tissues were calculated from the composition data of the tissues. A principal component analysis showed that such neohesperidosyl flavonoids as neoeriocitrin, naringin, neohesperidin, and rhoifolin had large factor loading values in the first principal component for each tissue. The flavonoid composition of citrus fruits was approximately the same within each section of Tanaka's system, except for the species in the Aurantium section and those with a peculiar flavonoid composition such as Bergamot (C. bergamia), Marsh grapefruit (C. paradisi), Sour orange (C. aurantium), and Shunkokan (C. shunkokan). The Aurantium section included both naringin-rich and hesperidin-rich species.
Article
Full-text available
Flavonoids-enriched tissues of citrus such as peel, immature fruit and flower are consumed as culinary seasonings, tea ingredients in China for centuries. This HPLC quantitative study on the five citrus flavonoids, naringin, hesperidin, neohesperidin, sinensetin and nobiletin on a wide range of Chinese citrus fruits and several Traditional Chinese Medicinal food ingredients in East China, revealed a great diversity in flavonoid composition. Huyou peel (C. paradisi cv. Changshanhuyou) was found to be the best naringin (3.25%) and neohesperidin (2.76%) source; C. aurantium, a major ingredient of several citrus-related TCM, is also a suitable source of naringin and neohesperidin, and a good juice source for flavanone glycosides; the peel of Wenzhoumiju (C. unshiu) is one of the richest local species in hesperidin (up to 6.25%); Zaoju (C. subcompressa) has the highest content of nobiletin (0.59%), a polymethoxylated flavone. LC-ES-MS analysis of Zanthoxylum genus for flavonoids revealed for the first time the presence of significant amounts (0.74%) of hesperidin in the root of Liangmianzhen (Z. nitidum (Roxb.) DC), a relative of Sichuan pepper, which is a spice widely used in China.
Article
Full-text available
Estimating flavonoid intake is a first step toward documenting the protective effects of flavonoids against risk of chronic diseases. Although flavonoids are important dietary sources of antioxidants, insufficient data on the comprehensive food composition of flavonoids have delayed the assessment of dietary intake in a population. We aimed to estimate the dietary flavonoid intake in U.S. adults and its sociodemographic subgroups and to document major dietary sources of flavonoids. We expanded the recently released USDA Flavonoid Database to increase its correspondence with the 24-h dietary recall (DR) of the NHANES 1999-2002. We systematically assigned a particular food code to all foods that were prepared or processed similarly. This expanded database included 87% of fruits and fruit juices, 86% of vegetables, 75% of legumes, and, overall, 45% of all foods reported by the 24-h DR of the NHANES 1999-2002. Estimated mean daily total flavonoid intake, 189.7 mg/d, was mainly from flavan-3-ols (83.5%), followed by flavanones (7.6%), flavonols (6.8%), anthocyanidins (1.6%), flavones (0.8%), and isoflavones (0.6%). The flavonoid density of diets increased with age (P < 0.001) and income (P < 0.05). It was higher in women (P < 0.001), Caucasians (P < 0.001), and vitamin supplement users (P < 0.001) and lower in adults with high levels of nonleisure time physical activity (P < 0.01) compared with their counterparts. The greatest daily mean intake of flavonoids was from the following foods: tea (157 mg), citrus fruit juices (8 mg), wine (4 mg), and citrus fruits (3 mg). The proposed relation between flavonoid intake and the prevention of chronic diseases needs further investigation using the estimates introduced in this study.
Article
Estimating flavonoid intake is a first step toward documenting the protective effects of flavonoids against risk of chronic diseases. Although flavonoids are important dietary sources of antioxidants, insufficient data on the comprehensive food composition of flavonoids have delayed the assessment of dietary intake in a population. We aimed to estimate the dietary flavonoid intake in U.S. adults and its sociodemographic subgroups and to document major dietary sources of flavonoids. We expanded the recently released USDA Flavonoid Database to increase its correspondence with the 24-h dietary recall (DR) of the NHANES 1999–2002. We systematically assigned a particular food code to all foods that were prepared or processed similarly. This expanded database included 87% of fruits and fruit juices, 86% of vegetables, 75% of legumes, and, overall, 45% of all foods reported by the 24-h DR of the NHANES 1999–2002. Estimated mean daily total flavonoid intake, 189.7 mg/d, was mainly from flavan-3-ols (83.5%), followed by flavanones (7.6%), flavonols (6.8%), anthocyanidins (1.6%), flavones (0.8%), and isoflavones (0.6%). The flavonoid density of diets increased with age (P < 0.001) and income (P < 0.05). It was higher in women (P < 0.001), Caucasians (P < 0.001), and vitamin supplement users (P < 0.001) and lower in adults with high levels of nonleisure time physical activity (P < 0.01) compared with their counterparts. The greatest daily mean intake of flavonoids was from the following foods: tea (157 mg), citrus fruit juices (8 mg), wine (4 mg), and citrus fruits (3 mg). The proposed relation between flavonoid intake and the prevention of chronic diseases needs further investigation using the estimates introduced in this study.
Article
The flavonoid, carotenoid and pectin composition in peels of eight varieties of citrus {Ponkan (Citrus reticulata Blanco), Tonkan (C. tankan Hayata), Murcott (C. reticulate×C. sinensis), Wendun (C. grandis Osbeck), Peiyou (C. grandis Osbeck CV), Kumquat (C. microcarpa), Liucheng [C. sinensis (L.) Osbeck], and Lemon [C. limon (L.) Bur]} cultivated in Taiwan was determined. The total flavonoid content exceeded the total carotenoid content. Ponkan (C. reticulata Blanco) peel had the highest total carotenoid content (2.04±0.036mg/gdb) and Wendun (C. grandis Osbeck) and Peiyou (C. grandis Osbeck CV) peels, the lowest (0.036±0.0006 and 0.021±0.0004mg/gdb, respectively). Naringin was abundant in Peiyou (C. grandis Osbeck CV) and Wendun (C. grandis Osbeck) peels (29.8±0.20 and 23.9±0.32mg/gdb, respectively) and hesperidin was aboundant in Ponkan (C. reticulata Blanco), Tonkan (C. tankan Hayata), and Liucheng [C. sinensis (L.) Osbeck] peels (29.5±0.32, 23.4±0.25, 20.7±0.38mg/gdb, respectively). Kumquat (C. microcarpa) peel contained the most diosmin (1.12±0.03mg/gdb) and quercetin (0.78±0.003mg/gdb). Levels of caffeic acid (3.06±0.03–80.8±3.72μg/gdb) were much lower than that of chlorgenic acid, ferulic acid, sinapic acid and ρ-coumaric acid. Ponkan (C. reticulata Blanco), Kumquat (C. microcarpa) and Liucheng [C. sinensis (L.) Osbeck] peels contained the most total amounts of lutein, zeaxanthin, β-cryptoxanthin, and β-carotene (114, 113, and 108mg/gdb, respectively). The total pectin content ranged from 36.0±1.46 to 86.4±3.36mg/gdb.
Article
A possible way to valorize citrus peels and seeds, which are byproducts of the juice extraction industry, is to use them as natural antioxidants. The antioxidant activity of several citrus peel and seed extracts obtained either by methanol extraction (free phenolic compounds) or by alkaline hydrolysis (bound phenolic compounds) was tested in a model system based on accelerated citronellal oxidation. Generally, seeds possessed greater antioxidant activity than peels. The composition of all tested samples was studied by HPLC:  methanol extracts are rich in flavones and glycosylated flavanones, whereas hydrolyzed extracts contain mainly phenolic acids and flavonols. The phenolic composition of some citrus peels and seeds was described for the first time. No clear relationship could be shown between the antioxidant activity and the phenolic composition of the extracts. Keywords: Citrus fruits; byproducts; antioxidant activity; flavanones; phenolic acids
Article
Flavonoids are a widely distributed group of polyphenolic compounds with health-related properties, which are based in their antioxidant activity. These properties have been found to include anticancer, antiviral, antiinflammatory activities, effects on capillary fragility, and an ability to inhibit human platelet aggregation. The antioxidant capacity of any flavonoid will be determined by a combination of the O-dihydroxy structure in the B-ring, the 2,3-double bond in conjugation with a 4-oxo function and the presence of both hydroxyl groups in positions 3 and 5. Flavanones, flavones, and flavonols are the flavonoids present in Citrus, and although flavones and flavonols have been found in low concentrations in Citrus tissues, in relationship to flavanones, these types of compounds have been show to be powerful antioxidants and free radical scavengers. Some Citrus flavonoids can be used directly as repellents or toxins or be used in plant improvement programs to obtain more resistant crops. In addition, some Citrus flavonoids and their derivates, in the field of food technology, are principally known for their ability to provide a bitter or sweet taste and as bitterness inhibitor. Keywords: Free radicals, antioxidant; anticarcinogenic; antiinflammatory; platelet aggregation; antiallergic; analgesic; antimicrobial; food additives
Article
Citrus fruit intake is known to be associated with a reduction of cancer incidence. Free radicals, including superoxide (O−2) and nitric oxide (NO), are involved in some epithelial carcinogenesis processes. In the present study, we screened thirty-one citrus fruits for their suppressive activities toward three lines of free radical generating systems: 1) O−2 generation by the xanthine (XA)-xanthine oxidase (XOD) system; 2) O−2 generation induced by 12-O-tetradecanoylphorbol-13-acetate (TPA) in differentiated human promyelocytic HL-60 cells; and 3) NO generation in murine macrophage RAW264.7 cells stimulated with lipopolysaccharide (LPS) and interferon (IFN)-. As a result, the inhibitory activities of peel parts were largely found to be higher than those of the corresponding juice sac parts. In particular, the peel portion of Dancy tangerine (Citrus tangerina) showed marked anti-oxidative activities in these systems. In addition, nobiletin, a polymethoxyflavonoid isolated from C. nobilis, showed a higher anti-inflammatory activity than indomethacin in a TPA-induced edema formation test in mouse ears. These results indicate that citrus fruits could be notable sources of anti-oxidative, anti-inflammatory, and cancer preventive compounds.
Article
In Taiwan, folk remedies containing dried kumquats (Fortunella margarita Swingle) are used to cure inflammatory respiratory disorders. The induction of inducible nitric oxide (NO) synthase in inflammatory cells and increased airway production of NO and peroxynitrite, its derivative, are key events in such disorders. Although heat is known to affect the antioxidant activity of citrus peels, the effects of dehydration and heating on NO suppression and on the interception of peroxynitrite are unclear. We determined the NO-suppressing activities of freeze-dried, oven-dried, and heat-treated kumquat extracts by measuring their inhibition of NO production in lipopolysaccharide-activated RAW 264.7 macrophages. Furthermore, we evaluated the attenuation of peroxynitrite-mediated nitrotyrosine formation in albumin. Heating, but not oven drying, enhanced the ability of kumquat peels to suppress NO and intercept peroxynitrite, as compared with freeze drying. However, heat treatment and oven drying of kumquat flesh attenuated these activities; these effects were at least partially attributed to heat-susceptible ascorbate. Copyright © 2007 Elsevier Ltd. All rights reserved.
Article
There is a rapidly growing body of literature covering the role of plant secondary metabolites in food and their potential effects on human health. Furthermore, consumers are increasingly aware of diet related health problems, therefore demanding natural ingredients which are expected to be safe and health-promoting. By-products of plant food processing represent a major disposal problem for the industry concerned, but they are also promising sources of compounds which may be used because of their favourable technological or nutritional properties. The purpose of this review is to highlight the potential of selected by-products as a source of functional compounds.
Article
In traditional Chinese medicine, dried citrus fruit peels are widely used as remedies to alleviate coughs and reduce phlegm in the respiratory tract. Induction of inducible nitric oxide synthase (iNOS) in inflammatory cells and increased airway production of nitric oxide (NO) are well recognized as key events in inflammation-related respiratory tract diseases. Despite the fact that the enhancing effect of heat treatment on the antioxidant activity of citrus fruit peels has been well documented, the impact of heat treatment on citrus peel beneficial activities regarding anti-inflammation is unclear. To address this issue, we determined the anti-inflammatory activities of heat-treated citrus peel extracts by measuring their inhibitory effect upon NO production by lipopolysaccharide-activated RAW 264.7 macrophages. Results showed that the anti-inflammatory activity of citrus peel was significantly elevated after 100 degrees C heat treatment in a time-dependent fashion during a period from 0 to 120 min. Inhibition of iNOS gene expression was the major NO-suppressing mechanism of the citrus peel extract. Additionally, the anti-inflammatory activity of citrus peel extract highly correlated with the content of nobiletin and tangeretin. Conclusively, proper and reasonable heat treatment helped to release nobiletin and tangeretin, which were responsible for the increased anti-inflammatory activity of heat-treated citrus peels.
Article
Nitric oxide (NO) can act as a vasorelaxant, a modulator of neurotransmission and a defence against pathogens. However, under certain conditions, NO can also have damaging effects to cells. Whether NO is useful or harmful depends on its chemical fate, and on the rate and location of its production. Here, we discuss progress in NO chemistry and the enzymology of NO synthases, and we will also attempt to explain its actions in the cardiovascular, nervous and immune systems.
Article
Citrus fruits contain high concentrations of several classes of phenols, including numerous hydroxycinnamates, flavonoid glycosides, and polymethoxylated flavones. The latter group of compounds occurs without glycosidic linkages and has been shown to inhibit the proliferation of a number of cancer cell lines. This antiproliferative property was further demonstrated against additional human cancer cell lines, and the antiproliferative actions of a series of synthetic methoxylated flavones were also studied. Similar to the naturally occurring compounds, the synthetic compounds exhibited strong antiproliferative activities. In many cases the IC(50) values occurred below 10 microm. Other hydroxylated flavone and flavanone aglycons also exhibited antiproliferative activities against the cancer cell lines, with the flavones showing greater activities than the flavanones. Glycosylation of these compounds removed their activity. The strong antiproliferative activities of the polymethoxylated flavones suggest that they may have use as anticancer agents in humans.