Dual-Mode Modulation of Smad Signaling by Smad-Interacting Protein Sip1 Is Required for Myelination in the Central Nervous System

Department of Developmental Biology and Kent Waldrep Foundation Center for Basic Neuroscience Research on Nerve Growth and Regeneration, University of Texas Southwestern Medical Center, Dallas, TX 75390, USA.
Neuron (Impact Factor: 15.05). 02/2012; 73(4):713-28. DOI: 10.1016/j.neuron.2011.12.021
Source: PubMed
ABSTRACT
Myelination by oligodendrocytes in the central nervous system (CNS) is essential for proper brain function, yet the molecular determinants that control this process remain poorly understood. The basic helix-loop-helix transcription factors Olig1 and Olig2 promote myelination, whereas bone morphogenetic protein (BMP) and Wnt/β-catenin signaling inhibit myelination. Here we show that these opposing regulators of myelination are functionally linked by the Olig1/2 common target Smad-interacting protein-1 (Sip1). We demonstrate that Sip1 is an essential modulator of CNS myelination. Sip1 represses differentiation inhibitory signals by antagonizing BMP receptor-activated Smad activity while activating crucial oligodendrocyte-promoting factors. Importantly, a key Sip1-activated target, Smad7, is required for oligodendrocyte differentiation and partially rescues differentiation defects caused by Sip1 loss. Smad7 promotes myelination by blocking the BMP- and β-catenin-negative regulatory pathways. Thus, our findings reveal that Sip1-mediated antagonism of inhibitory signaling is critical for promoting CNS myelination and point to new mediators for myelin repair.

Full-text

Available from: Eve Seuntjens
Neuron
Article
Dual-Mode Modulation of Smad Signaling
by Smad-Interacting Protein Sip1 Is Required
for Myelination in the Central Nervous System
Qinjie Weng,
1,2,10
Ying Chen,
1,10
Haibo Wang,
1
Xiaomei Xu,
1
Bo Yang,
2
Qiaojun He,
2
Weinian Shou,
3
Yan Chen,
4
Yujiro Higashi,
5
Veronique van den Berghe,
6,7
Eve Seuntjens,
6,7
Steven G. Kernie,
8
Polina Bukshpun,
9
Elliott H. Sherr,
9
Danny Huylebroeck,
6,7
and Q. Richard Lu
1,
*
1
Department of Developmental Biology and Kent Waldrep Foundation Center for Basic Neuroscience Research on Nerve Growth and
Regeneration, University of Texas Southwestern Medical Center, Dallas, TX 75390, USA
2
Laboratory of Tumor and Endocrine Pharmacology, Institute of Pharmacology & Toxicology and Biochemical Pharmaceutics,
College of Pharmaceutical Sciences, Zhejiang University, Hangzhou, Zhejiang, China 310058
3
Riley Heart Research Center, Herman B Wells Center for Pediatric Research, Department of Biochemistry and Molecular Biology,
Indiana University School of Medicine, Indianapolis, IN 46202, USA
4
Institute for Nutritional Sciences, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031, China
5
Department of Perinatology, Institute for Developmental Research, Aichi Human Service Center, Kasugai, Aichi 480-0392, Japan
6
Laboratory of Molecular Biology (Celgen), Centre for Human Genetics, Katholieke Universiteit Leuven, 3000 Leuven, Belgium
7
Department of Molecular and Developmental Genetics (VIB11), Flanders Institute for Biotechnology, 3000 Leuven, Belgium
8
Departments of Pediatrics and Pathology and Cell Biology, Columbia University College of Physicians and Surgeons, New York,
NY 10032, USA
9
Department of Neurology, University of California San Francisco, San Francisco, CA 94143-0114, USA
10
These authors contributed equally to this work
*Correspondence: qrichard.lu@utsouthwestern.edu
DOI 10.1016/j.neuron.2011.12.021
SUMMARY
Myelination by oligodendrocytes in the central
nervous system (CNS) is essential for proper brain
function, yet the molecular determinants that control
this process remain poorly understood. The basic
helix-loop-helix transcription factors Olig1 and Olig2
promote myelination, whereas bone morphogenetic
protein (BMP) and Wnt/b-catenin signaling inhibit
myelination. Here we show that these opposing regu-
lators of myelination are functionally linked by the
Olig1/2 common target Smad-interacting protein-1
(Sip1). We demonstrate that Sip1 is an essential
modulator of CNS myelination. Sip1 represses dif-
ferentiation inhibitory signals by antagonizing BMP
receptor-activated Smad activity while activating
crucial oligodendrocyte-promoting factors. Impor-
tantly, a key Sip1-activated target, Smad7, is required
for oligodendrocyte differentiation and partially re-
scues differentiation defects caused by Sip1 loss.
Smad7 promotes myelination by blocking the BMP-
and b-catenin-negative regulatory pathways. Thus,
our findings reveal that Sip1-mediated antagonism of
inhibitory signaling is critical for promoting CNS mye-
lination and point to new mediators for myelin repair.
INTRODUCTION
Myelination in the vertebrate central nervous system (CNS) by
the unique, compact myelin sheaths produced by oligodendro-
cytes is required for maximizing the conduction velocity of nerve
impulses (Zalc and Colman, 2000) and is essential for normal
brain function. Demyelinating injury or disease combined with
failure of myelin repair impairs rapid propagation of action poten-
tial along nerve fibers, leading to nerve degeneration, and is
associated with acquired and inherited disorders, including dev-
astating multiple sclerosis (MS) and leukodystrophies (Franklin,
2002; Mar and Noetzel, 2010; Trapp et al., 1998). The observa-
tion that oligodendrocyte precursor cells (OPCs) are present
within demyelinating MS lesions, but fail to differentiate into
myelinating oligodendrocytes, suggests that the remyelination
process is inhibited at the stage of premyelinating precursors
(Chang et al., 2002; Franklin and Ffrench-Constant, 2008).
A major limitation to successful myelin regeneration arises
from negative regulatory pathways that operate in the demyelin-
ating environment, such as bone morphogenetic protein (BMP),
Wnt, and Notch signaling (Emery, 2010; Franklin, 2002; Li et al.,
2009). BMPs, which are members of the transforming growth
factor b (TGF-b) family, bind to heteromeric complexes of BMP
type I (mainly BMPR-Ia or b) and type II (e.g., BMPR-II) serine/
threonine kinase receptors (Massague
´
et al., 2005) and activate
downstream gene expression, including oligodendrocyte differ-
entiation inhibitors Id2 and Id4 mainly through BMP receptor-
activated Smads (Smad1/5/8) (Cheng et al., 2007; Samanta
and Kessler, 2004). Signaling by BMPs such as BMP4 was
shown to block OPC maturation and regulate the timing of mye-
lination (Cheng et al., 2007; Hall and Miller, 2004; Samanta and
Kessler, 2004; See et al., 2004). Recently, activation of canonical
Wnt signaling by b-catenin stabilization was also found to inhibit
oligodendrocyte myelination and remyelination (Fancy et al.,
2009; Ye et al., 2009). Finally, Notch signaling activation by its
downstream effectors (e.g., Hes1 and Hes5) was shown to inhibit
Neuron 73, 713–728, February 23, 2012 ª2012 Elsevier Inc. 713
Page 1
the transition of OPCs to mature oligodendrocytes and remyeli-
nation (Wang et al., 1998; Wu et al., 2003; Zhang et al., 2009).
As a potential mechanism to counter extrinsic suppressive
signaling, a series of cell intrinsic factors, such as the basic
helix-loop-helix transcription factors Olig1 and Olig2, have been
identified to positively regulate differentiation of oligodendrocytes
(Emery et al., 2009; He et al., 2007; Howng et al., 2010; Li et al.,
2009; Wegner, 2008; Ye et al., 2009). Olig2 directs early OPC
specification and differentiation (Lu et al., 2002; Yue et al.,
2006; Zhou and Anderson, 2002); similarly, Olig1, whose expres-
sion is elevated during OPC differentiation, promotes oligoden-
drocyte maturation and is required for repair of demyelinated
lesions (Arnett et al., 2004; Li et al., 2007; Xin et al., 2005). This
suggests that Olig1 and Olig2 have an overlapping function in
regulating myelination in the CNS. However, the underlying
mechanisms that balance and coordinate extrinsic with intrinsic
inhibitory cues to drive oligodendrocyte myelination are not fully
understood.
We hypothesized that the downstream effectors regulated by
both Olig1 and Olig2 may function to coordinate the inhibitory
pathways to promote myelination. By performing whole-genome
chromatin immunoprecipitation (ChIP) sequencing and gene
profiling analysis, we identified a common target gene of Olig1
and Olig2 encoding Smad-interacting protein-1 (Sip1; also
named zinc finger homeobox protein 1b [Zfhx1b] or Zeb2). Our
present studies reveal a critical role of the transcription factor
Sip1 in governing CNS myelination. Sip1 inhibits BMP-Smad
negative regulatory pathways while activating the expression
of crucial myelination-promoting factors. In addition, we identify
Smad7, a member of inhibitory Smads (I-Smads) in the Smad
pathway, as a key target induced by Sip1. We show that
Smad7 is required for oligodendrocyte differentiation and pro-
motes myelination by blocking BMP and Wnt/b-catenin inhibi-
tory pathways. Thus, by antagonizing activated BMP-Smads
while inducing the I-Smad gene Smad7, Sip1 exerts dual-
mode regulation of Smad signaling to control oligodendrocyte
maturation. Our findings reveal a previously unrecognized role for
Sip1 in governing myelination and, in addition, its direct modula-
tion of two Smad pathways, pointing to Sip1 as a nodal point that
integrates extrinsic signals and intrinsic regulators to control the
myelinogenic program in the CNS.
RESULTS
Identification of the Oligodendrocyte-Enriched
Transcription Factor Sip1 as a Common Target
of Olig1 and Olig2
To identify the target genes directly regulated by Olig2, we
carried out whole-genome ChIP sequencing using purified rat
oligodendrocytes. Due to the lack of ChIP-grade anti-Olig1 anti-
body, gene-chip microarray transcriptome analysis was used, in
this case, to screen for Olig1-regulated genes. ChIP-sequencing
data revealed 5,439 genes carrying candidate Olig2 binding sites
with 4-fold enrichment over control (Figure S1A available online).
We compared these candidates with Olig1-regulated genes that
are downregulated in the optic nerve of Olig1 null mutants (Chen
et al., 2009a) and identified 398 genes (Figure S1A) as common
candidate targets of Olig2 and Olig1 (Table S1). The majority of
them are involved in biological processes that connect to myeli-
nation (Figure S1B). By focusing on oligodendrocyte-enriched
transcriptional regulators regulated by both Olig1 and Olig2,
we identified the zinc finger homeobox transcription factor
Sip1/Zfhx1b. Olig2 was found to bind strongly to multiple sites
around and within the Sip1 gene that are highly conserved in
vertebrates (Figure S1C). The Sip1 transcript is highly enriched
in the spinal white matter, and substantially downregulated in
Olig2 and Olig1 null mice at embryonic day (E) E18.5 and post-
natal day (P) P14, respectively (Figures 1A and 1B). In addition,
overexpression of Olig1 and Olig2, individually or in combination,
was found to activate Sip1 expression in adult rat hippocampus-
derived early oligodendrocyte progenitor cells (Figure 1C) (Chen
et al., 2009a; Hsieh et al., 2004). Collectively, these data suggest
that the Sip1 gene is a common downstream target regulated by
both Olig1 and Olig2.
To identify Sip1-expressing cell types, we performed immuno-
histochemistry analysis of Sip1 and costained for the oligoden-
drocyte lineage marker Olig2. Sip1 was detected in the majority,
if not all, of Olig2-positive (+) cells in the white matter of the spinal
cord at P14 (Figure 1D). We determined the developmental state
of Sip1+ cells in the oligodendrocyte lineage by colabeling Sip1
with the stage-specific markers for differentiated oligodendro-
cytes (CC-1 monoclonal antibody, which recognizes the adeno-
matous polyposis coli protein [CC1]+ or myelin basic protein
[MBP]+) or their precursors (platelet-derived growth factor
receptor a [PDGFRa]+)
in the spinal cord and in cultured oligo-
dendrocytes. High Sip1 protein levels were detected in mature
oligodendrocytes, in contrast to low levels in OPCs (Figures
1E–1G). In addition, the majority of Sip1+ cells in the oligo-
dendrocyte lineage were differentiated oligodendrocytes in the
corpus callosum, cortex, and spinal cord (Figure 1H). The pro-
portions of CC1+ and Olig2+ cells among the Sip1+ cells in the
spinal white matter at P14 are 82.5% ± 5.8% and 96.0% ±
4.0%, respectively (>500 cell count; n = 3). We did not observe
Sip1 expression in glial fibrillary acidic protein (GFAP)+ astro-
cytes in white matter tracts of the CNS (data not shown). These
observations suggest that Sip1 is largely confined to oligoden-
drocytes in the developing white matter.
Sip1 Is Required for Oligodendrocyte Maturation
and Myelination
To assess the functional role of Sip1 in oligodendrocyte develop-
ment in vivo, we generated oligodendrocyte-lineage specific
Sip1 knockout (KO) mice. Conditional Sip1
flox/flox
mice (Higashi
et al., 2002) were bred with an Olig1-Cre line, in which Cre
recombinase is produced in the oligodendrocyte lineage (Xin
et al., 2005; Ye et al., 2009)(Figure 2A). We observed that all
resulting mutant Sip1
flox/flox
;Olig1
Cre+/
mice (referred to as
Sip1cKO), but not their control littermates, developed general-
ized tremors, hindlimb paralysis, and seizures from postnatal
week 2 (Figure 2B, upper panel), although they were born at
a normal Mendelian ratio. Sip1cKO mice exhibited the pheno-
types reminiscent of myelin-deficient mice (Nave, 1994) and
died around postnatal week 3, in contrast to the normal lifespan
of wild-type (WT) and Sip1 conditional heterozygous control
(Sip1
flox/+
;Olig1
Cre+/
) mice (Figure 2C). The optic nerve, a well-
characterized CNS white matter tract, from Sip1cKO mice was
Neuron
Sip1 Governs Myelination in the Mammalian CNS
714 Neuron 73, 713–728, February 23, 2012 ª2012 Elsevier Inc.
Page 2
translucent compared to the control (Figure 2B, lower panels),
which is a sign of severe deficiency in myelin formation.
To confirm the myelin-deficient phenotypes, we examined
myelin gene expression in Sip1cKO mice. In contrast to robust
expression in control mice, expression of myelin genes such as
Mbp (myelin basic protein) and Plp1 (proteolipid protein) is
essentially undetectable in the forebrain, spinal cord, and cere-
bellum of mutant mice at P14 (Figures 2D and 2F). In light of
our data demonstrating that expression of mature oligodendro-
cyte markers was absent in Sip1cKO mice, we further examined
myelin sheath assembly in the CNS of these mutants by electron
microscopy. In contrast to a large number of myelinated axons
that are observed in control mice at P14 (Figures 2G and 2H,
upper panels), they were completely absent in the optic nerve
and spinal cord of Sip1cKO mutants (Figures 2G and 2H, lower
panels), indicating that myelin ensheathment has not begun in
these animals. These results suggest that Sip1 is required for
myelinogenesis in the CNS.
Normal Oligodendrocyte Precursor Development
in Sip1 Mutant Mice
Despite the deficiency in myelin gene expression, the OPC
marker PDGFRa was detected in the brain and the spinal cord
in the mutant mice (Figures 3 A and 3B). The number of OPCs
and their proliferation rate (percentage of Ki67+ proliferating
OPCs) in Sip1 mutants were comparable to control mice (Figures
3C and 3D). We did not detect any significant cell death in the
brain and spinal cord of Sip1cKO mice at P7 and P14 based
on TUNEL assay and staining for the active form of caspase-3
(n = 3; data not shown). In addition, oligodendrocyte lineage-
specific Sip1 inactivation did not lead to obvious alterations of
astrocytes and neurons marked by GFAP and NeuN, respec-
tively, in the brain of Sip1cKO mice (Figure S2). Our data indicate
that OPCs are able to form in the CNS of Sip1cKO mice.
To investigate whether the differentiation capacity of OPCs
in the absence of Sip1 in vitro is blocked, we carried out Cre-
mediated Sip1 excision in cultures of purified OPCs. OPCs
from the neonatal cortex of Sip1
flox/flox
mice were transduced
with lentivirus expressing green fluorescent protein (lenti-GFP)
and lenti-CreGFP. Two days posttransduction, OPC cultures
were switched to oligodendrocyte differentiation medium to
promote oligodendrocyte maturation. In lenti-GFP-transduced
Sip1
flox/flox
cells, we observed an increase of mature MBP+
oligodendrocytes typically bearing a complex morphology dur-
ing differentiation (Figures 3E and 3F). In contrast, under such
differentiation conditions, no MBP+ oligodendrocytes were
detected in lenti-CreGFP-infected Sip1
flox/flox
cells (Figures 3E
and 3F). All Sip1
flox/flox
cells transduced with lenti-CreGFP
remained as PDGFRa+ OPCs (Figures 3E and 3F). As a control,
infection of WT OPCs with lenti-CreGFP did not affect OPC
differentiation (data not shown). These observations indicate
that the ablation of Sip1 in the oligodendrocyte lineage in vivo
and in vitro even under the differentiation-promoting condition
prevents OPCs from further differentiation, suggesting that
Figure 1. Identificat ion of Olig1/2-R egulated Oligodendrocyte-Enriched Transcription Factor Sip1
(A–B) Expression of Sip1 was examined in spinal cord of control and E18.5 Olig2 null (A) and P14 Olig1 null (B) mice by in situ hybridization. Arrows indicate the
labeled cells.
(C) qRT-PCR analysis of Sip1 in neural progenitor cells transfected with pCS2MT-nls-Olig1, Olig2, both Olig1/2, or control vector. The fold change was present
from cells transfected with Olig1 or/and Olig2 versus control. Data represent the mean ± SEM (n = 3). **p < 0.01, ***p < 0.001 (Student’s t test).
(D–F) The spinal cord of WT mice at P14 was immunostained for Sip1, Olig2, CC1, and PDGFRa, respectively. A high magnification of (E) is shown in (F). Arrows
indicate colabeled cells. Arrowhead indicates a PDGFRa+OPC.
(G) Primary rat OPCs and differentiated oligodendrocytes (OL) were immunostained for Sip1, MBP, and PDGFRa. Arrows indicate the colabeled cells.
(H) Quantification of the percentage of CC1 or PDGFRa+ cells among Sip1+ cells in the cerebral white matter (WM), cortex (CTX), and spinal cord (SC) from P14
WT mice (n = 3). Error bars, ± SEM. Scale bars: 50 mm (A, D, and E), 100 mm (B), 30 mm (F–G).
See also Figure S1 and Table S1.
Neuron
Sip1 Governs Myelination in the Mammalian CNS
Neuron 73, 713–728, February 23, 2012 ª2012 Elsevier Inc. 715
Page 3
Sip1 is a key component of the intracellular machinery that is
essential for OPC maturation.
Sip1 Promotes OPC Differentiation by Modulating
Critical Differentiation Regulators
Given the essential role of Sip1 in oligodendrocyte maturation
in vivo, we then asked whether Sip1 is sufficient to promote
OPC differentiation. For this, we isolated OPCs from the neonatal
rat brain and cultured these cells in oligodendrocyte growth
medium containing the mitogen PDGF-AA, and then transfected
these cells with expression vectors carrying a GFP-control and/
or Sip1 cDNA, and immunostained for the differentiated oligo-
dendrocyte marker RIP (Friedman et al., 1989) 4 days after trans-
fection. In the control group, spontaneous OPC differentiation
Figure 2. Sip1 Is Required for Oligodendroc yte Myelination
(A) Schematic diagram shows that excision of the floxed Sip1 exon 7, which encodes a majority of protein sequence, is mediated by Olig1-Cre.
(B) Sip1cKO (Sip1
lox/lox
;Olig1Cre
+/
) mice developed tremors and hindlimb paralysis starting around P10. Upper images: a control mouse (Ctrl,
Sip1
lox/+
;Olig1Cre
+/
) in comparison to a cKO sibling at P14. Lower images: optic nerves from control and Sip1cKO littermates at P14.
(C) Survival curve of control and Sip1cKO mice, which died around postnatal week 3 (n R 32).
(D–F) Expression of Mbp and Plp1 in the cortex (Ctx), spinal cord (SC), and cerebellum (CB) from control (Ctrl) and Sip1cKO mice at P14 by in situ hybridization.
Arrows indicate MBP+ and Plp1+ cells in the white matter.
(G–H) Electron micrographs of the optic nerve (G) and spinal cord (H) of control and Sip1cKO mice at P14. High-power images (right panels) showing that
multilamellar myelin sheaths are apparent around many axons in control mice, whereas all axons in Sip1cKO mice are essentially unmyelinated. Scale bars:
100 mm (D and F), 5 mm (G and H, left panels), 1 mm (G and H, right panels).
See also Figures S2 and S3.
Neuron
Sip1 Governs Myelination in the Mammalian CNS
716 Neuron 73, 713–728, February 23, 2012 ª2012 Elsevier Inc.
Page 4
detected as RIP+ cells was less than 3% (Figure 4 A, left panel,
and Figure 4B) in the presence of PDGF-AA mitogen. In contrast,
Sip1 overexpression led to a drastic increase of RIP+ mature
oligodendrocytes that harbored complex processes (Figure 4A
right panel, and Figure 4 B), while displaying a concomitant
reduction of PDGFRa+ OPCs (Figure 4C). Similarly, there was
a significant increase of galactocerebroside O1+ differentiated
oligodendrocytes with Sip1 transfection (Figures 4D and 4E).
The extent of process outgrowth measured by average circum-
ference of O1+ oligodendrocytes with transfected Sip1 vector
is significantly greater than that of spontaneous differentiated
cells with control vector (179 mm±42mm versus 119 m
18 mm, p < 0.01). These results indicate that high levels of Sip1
promote OPC maturation.
To further examine Sip1 as a key regulator for oligodendrocyte
differentiation, we performed quantitative RT-PCR (qRT-PCR)
analysis of oligodendroglial gene alteration after Sip1 vector
transfection. Our data revealed a significant upregulation of
myelin genes such as Cnp, Cgt, and Mbp, and of the genes en-
coding crucial differentiation activators such as Sox10, MRF,
and Olig2 in Sip1-transfected cells compared to the control (Fig-
ure 4F). Conversely, we observed significant downregulation of
steady-sate levels of transcripts for negative regulators of differ-
entiation, including Id2, Id4, Hes1, Hes5, and BMPR1a (Fig-
ure 4G). These results suggest that Sip1 promotes oligoden-
drocyte differentiation by activating positive regulators while
repressing negative regulators of oligodendrocyte differentiation.
Sip1 Antagonizes the Inhibitory Effect of Receptor-
Activated BMP-Smad Signaling on the Oligodendrocyte
Differentiation Program
In the presence of BMP4, expression of myelin genes Mbp and
Mag in differentiating oligodendrocyte precursors was inhibited
(Figure 5A). However, overexpression of Sip1 was able to re-
verse BMP4-induced suppression of these myelin genes (Fig-
ure 5A). To investigate a possible link between the function of
Sip1, which has been identified as a Smad-interacting transcrip-
tional repressor (Remacle et al., 1999; Verschueren et al., 1999),
and BMP-Smad transcriptional activity in regulating oligoden-
drocyte differentiation, we examined the promoter activity of
myelination-associated genes in the presence of Sip1 and acti-
vated BMP receptor signaling, which was shown to inhibit
Figure 3. Normal Oligodendrocyte Precursor Development in Sip1cKO Mice
(A) Expression of PDGFRa was examined by in situ hybridization in the P12 cortex (Ctx) and P7 spinal cord at the cervical level (SC) of control and Sip1c KO mice.
(B) Histogram depicts the number of PDGFRa+ OPCs per area (0.04 mm
2
) in the spinal cord and cortex at indicated stages (n = 3). Data represent the
mean ± SEM.
(C) Immunocytochemistry using antibodies to Ki67 and PDGFRa on the cortices of control and Sip1cKO mice at P14. Arrows indicate Ki67+/PDGFRa+ cells.
(D) Histogram depicts the percentage of Ki67-expressing cells among PDGFRa+ OPCs (n = 3). Data represent the mean ± SEM.
(E) Primary OPCs isolated from the neonat al cortex of Sip1
lox/lox
mice at P1 were transduced with lentiviruses expressing control GFP or Cre-GFP. Expression of
MBP and PDGFRa was assessed by immunostaining 7 days after switching to the oligodendrocyte differentiation medium.
(F) A higher magnification of E showing mature (MBP+) and immature (PDGFRa+) oligodendrocytes derived from lenti-GFP and lenti-CreGFP infected Sip1
lox/lox
OPCs. Arrows indicate the lentivirus-infected cells. Scale bars: 100 mm (A), 25 mm (C and E).
Neuron
Sip1 Governs Myelination in the Mammalian CNS
Neuron 73, 713–728, February 23, 2012 ª2012 Elsevier Inc. 717
Page 5
oligodendrocyte differentiation (Cheng et al., 2007; Hall and
Miller, 2004). Expression of Smad1 and its subsequent activation
by phosphorylation (p-Smad1) was achieved by cotransfection
of expression vectors carrying Smad1 and constitutively acti-
vated BMP receptor 1b (mutant Q203D) (BMPR
CA
), the latter
obviating the need to stimulate the cells with ligand but recapit-
ulating faithfully receptor-mediated Smad activation (Skillington
et al., 2002). This combination was found to significantly repress
Mbp reporter activity (Ye et al., 2009), in a BMPR
CA
-dependent
fashion, in the oligodendrocyte cell line Oli-Neu (Kadi et al.,
2006). On the other hand, BMPR
CA
-activated Smad1 signifi-
cantly enhanced reporter activities directed by the promoter of
differentiation inhibitory genes Id2 and Id4, acknowledged
downstream target genes of BMPR-Smad signaling (Samanta
and Kessler, 2004), as well as of Hes1, an effector of activated
Notch signaling (Ogata et al., 2010; Wu et al., 2003). Addition
of p300/CBP, a coactivator of p-Smad1 (Nakashima et al.,
1999; Pearson et al., 1999), further reduced the Mbp promoter
activity and enhanced Hes1, Id2, and Id4 reporter activities
(Figures 5B–5E). In contrast, overexpression of Sip1 antagonized
the inhibitory effects mediated by BMPR
CA
/Smad1/p300 ex-
pression on the Mbp promoter activity while repressing the
promoter activity of Id2, Id4, and Hes1 activated by BMP-Smad
signaling (Figures 5B–5E). These results suggest that Sip1
blocks p-Smad1/p300 complex mediated transcriptional activa-
tion of oligodendrocyte differentiation inhibitors.
To determine whether Sip1 would interfere with p-Smad/p300
complexes and physically interact with p-Smad1, we introduced
Smad4, the co-Smad of Smad1, and BMPR
CA
individually or in
combination with Sip1, and performed coimmunoprecipita-
tion assays. In the absence of BMPR
CA
, Sip1 interacted weakly
with p-Smad1 as long as Smad4 was present (Figure 5F). This
interaction increased dramatically when BMPR
CA
was intro-
duced (Figure 5F), suggesting that Sip1 is associated with
Figure 4. Sip1 Promotes OPC Differentiation by Modulating Oligodendrocyte Differentiation Regulators
(A and D) Isolated rat OPCs were transfected with GFP-expressing control and Sip1 expressing vector and cultured in the presence of PDGF-AA for 4 days. Cells
are stained for differentiated oligodendrocyte marker RIP (A) and O1 (D). Scale bar, 25 mm.
(B, C, and E) Quantification of the percentage of RIP+ (B) and O1+ (E) cells with complex processes and PDGFRa+ cells (C) among transfected cells (n = 3).
Error bars, ± SEM.
(F–G) qRT-PCR was carried out to analyze myelin-associated genes and positive differentiation regulators (F) and negative regulators (G) from mRNA after 24 hr
transfection. Data represent the mean ± SEM (n = 3). *p < 0.01, **p < 0.001; Student’s t test.
Neuron
Sip1 Governs Myelination in the Mammalian CNS
718 Neuron 73, 713–728, February 23, 2012 ª2012 Elsevier Inc.
Page 6
receptor-activated Smad1, likely in a complex with Smad4. To
verify the Sip1-pSmad interaction at the endogenous protein
level, we carried out coimmunoprecipitation assays using mouse
brain tissues at different stages. Sip1 was found to interact with
p-Smad in cortical tissues at P0, P7, P14, and P60 (Figure 5G).
The decrease of p-Smad pulled down by Sip1 with ages might
reflect a reduction of activated BMPR-Smads when OPCs
differentiate into mature oligodendrocytes (Cheng et al., 2007).
To further demonstrate this interaction during oligodendrocyte
differentiation, we performed a coimmunoprecipitation assay
in differentiating oligodendrocytes using an antibody against
p300, which was previously shown to interact with p-Smad
and bridge the p-Smad transcriptional activity (Nakashima
et al., 1999). Sip1 was detected in the complex of p-Smad
together with p300 (Figure 5H). Given that p-Smad is observed
in CC1+ differentiating oligodendrocytes in the developing spinal
cord at P7 (Figure 5I), the physical interaction Sip1 with p-Smad
suggests that Sip1 inhibits the p-Smad/p300-mediated negative
regulatory activity during oligodendrocyte maturation.
Furthermore, endogenous Sip1 was found to bind to the
Sip1-consensus binding sites of promoter regions of Id2 and
Hes1 in OPCs and Id4 in differentiating oligodendrocytes (Fig-
ure 5J) by ChIP assays, suggesting that Sip1 targets directly
the promoter of the genes for these differentiation inhibitors.
Together, these observations suggest that Sip1 interacts with
activated p-Smad and directly regulates the expression of a
set of genes encoding differentiation inhibitors, thereby blocking
the inhibitory effects of BMPR-Smad-p300 signaling on oligo-
dendrocyte differentiation (Figure 5K).
Smad7 Is a Downstream Target Gene Induced by Sip1
in Oligodendrocyte Lineage Cells
As an unbiased approach to determine the downstream genes
of Sip1 that regulate oligodendrocyte differentiation, we also
carried out messenger RNA (mRNA) microarray profiling analysis
in the spinal cord of control and Sip1cKO mice at P14. Con-
sistent with our in situ hybridization analysis (Figure 2), myelina-
tion-associated genes including myelin genes for mature oligo-
dendrocytes and critical differentiation regulatory genes (such
as MRF and Sox10) were found remarkably downregulated in
the spinal cord of Sip1 mutants (Table S2; Figure S3).
In addition to previously known transcriptional regulators
for myelination, the clustering analysis of the transcriptome for
myelin genes revealed that Smad7 was drastically downregu-
lated in Sip1 mutants (Figure 6A; Table S2). Smad7, a member
of I-Smads, is a negative feedback regulator of signaling by
liganded TGF-b and BMP receptor complexes (Massague
´
et al., 2005). Smad7 expression appeared in the ventral spinal
cord at P0, increased strongly in the spinal white matter at peri-
natal stages, and persisted into adulthood (Figure 6A). Consis-
tent with the Sip1 expression pattern, intense Smad7 protein
staining (Figures 6B and 6C) and RNA levels (Figure 6A) were
predominantly detected in differentiated oligodendrocytes but
not in OPCs in developing spinal cord and primary oligodendro-
cyte culture (Figure 6D).
Analysis of the expression pattern of Sip1 and Smad7 in the
spinal cord at early developmental stages indicates that Sip1
mRNA was detected as early as E16.5, while Smad7 was initially
det
ectedat P0 in the developing white matter (Figure S4), suggest-
ing that expression of Sip1 precedes that of Smad7 in the oligo-
dendrocyte lineage. In addition, we identified Sip1 consensus
binding sites (Remacle et al., 1999) in the highly conserved
Smad7 promoter (Figure 6E). To determine whether Smad7 is a
direct target gene of Sip1, we performed ChIP on the chromatin
isolated from OPCs and differentiated oligodendrocytes. Sip1
was recruited to the Smad7 promoter region that carries Sip1
consensus binding sites in differentiating oligodendrocytes, but
this enrichment was barely detectable in proliferating OPCs (Fig-
ure 6E). In addition, overexpression of Sip1 in OPCs significantly
promoted Smad7 mRNA expression assayed by qRT-PCR (Fig-
ure 6F). Collectively, these data suggest that Smad7 is a direct
Sip1-induced target gene in the oligodendrocyte lineage.
Smad7 Overexpression Rescues the Differentiation
Defect of Sip1-Deficient OPCs and Targets Inhibitory
Signaling Pathways
If Smad7 is a critical target gene of Sip1 in myelination, intro-
ducing and overexpressing Smad7 should rescue the defect
caused by Sip1 deletion. OPCs were isolated from cortices of
control and Sip1cKO pups at P1 and transduced with GFP
control or HA-tagged Smad7 encoding lentivirus. Under differen-
tiation condition, robust MBP expression was detected in the
culture derived from control OPCs; in contrast, no MBP+ oligo-
dendrocytes were observed in Sip1 mutant OPCs (Figure 7A).
When Sip1 mutant OPCs were transduced with Smad7 express-
ing lentivirus, a significant increase in MBP+ oligodendrocyte
formation was detected (Figures 7A–7C). Mature oligodendro-
cytes formed after Smad7 transduction of Sip1cKO cells were
confirmed by the detection of the HA-epitope tag on Smad7 (Fig-
ure 7B). These observations suggest that Smad7 rescues, at
least partially, the differentiation defect of OPCs in the absence
of Sip1. In addition, Smad7 transduction in developing chick
neural tube was able to promote ectopic expression of the
OPC marker PDGFRa and a differentiated oligodendrocyte
marker Sox10 (Figure S5), indicating that Smad7 is capable of
inducing oligodendrocyte differentiation in vivo.
Smad7 can negatively regulate TGF- b/BMP signaling in vari-
ous ways, including via forming a complex with Smurf proteins
or other E3 ubiquitin ligases. The Smad7-Smurf complex was
shown to target and degrade TGF-b/BMP receptors by ubiq-
uitination, thereby attenuating TGF-b/BMP signaling at the
receptor level (Kavsak et al., 2000; Suzuki et al., 2002). Smad7
was also reported to negatively regulate Wnt/b-catenin signaling
(Han et al., 2006; Millar, 2006), while b-catenin stabilization
inhibits oligodendrocyte myelination (Fancy et al., 2009;
Ye
et al., 2009). To investigate the effects of Smad7 and its
cofactor E3 ubiquitin ligase Smurf1 on BMPR/Smad and Wnt/
b-catenin signaling, we expressed Smad7 and Smurf1 in-
dividually or in combination in rat OPCs. Smad7 alone could
slightly decrease BMPR1a and b-catenin protein levels. When
cotransfected with Smurf1, Smad7 substantially downregulated
BMPR1a and b-catenin steady-state protein levels (Figure 7D).
Similarly, the level of p-Smad is also reduced (Figure 7D), indi-
cating that a decrease of BMP-Smad signaling parallels with
downregulation of the BMPR1a level, possibly underlying a
reduced sensitivity to BMPs ( Figure 7D).
Neuron
Sip1 Governs Myelination in the Mammalian CNS
Neuron 73, 713–728, February 23, 2012 ª2012 Elsevier Inc. 719
Page 7
Figure 5. Sip1 Antagonizes the Inhibition of BMPR-Smad Signaling in Oligodendrocyte Maturation
(A) qRT-PCR analysis of Mbpand Mag in OPC culture treated with BMP4 and/or transfected with pCIG-Sip1 for 48 hr as indicated. Data representmean ± SEM (n = 3).
(B–E) Oli-Neu cells were transfected with luciferase reporters driven by Mbp, Id2, Id4,orHes1 promoter together with expression vectors carrying Smad1 and
BMPR
CA
, p300 with/without Sip1 as indicated. Values represent the average of three independent experiments (n = 3). Error bars, ± SEM. *p < 0.05, **p < 0.01,
***p < 0.001, one-way analysis of variance analysis.
(F) Expression vector carrying Smad1 was cotransfected with Smad4, BMPR
CA
, and Sip1, respectively, as indicated. Coimmunoprecipitation with an antibody to
Myc tagged Sip1 was carried out from cell lysates after 48 hr transfection and western-blotted with antibodies to p-Smad1, Flag, and Myc-tags as indicated.
IP, immunoprecipitation; GAPDH, loading control.
(G) Coimmunoprecipitation was carried out with anti-Sip1 using cortices at P0, P7, P14, and P60 or with IgG using P7 cortex. Immunoprecipitated complexes
were assayed for p-Smad and Sip1. b-Tubulin was used as the loading control.
Neuron
Sip1 Governs Myelination in the Mammalian CNS
720 Neuron 73, 713–728, February 23, 2012 ª2012 Elsevier Inc.
Page 8
Consistently, expression of Smad7 together with Smurf1 was
found to reverse the inhibition of expression of myelin genes
Mbp, Mag, and Plp in rat OPC culture exposed to BMP4 (Fig-
ure 7E). In addition, Smad7/Smurf1 expression antagonized
the inhibitory effects mediated by BMPR
CA
-Smad1/p300 ex-
pression on the Mbp promoter activity while repressing the
Hes1 promoter activity ( Figure 7F). These data agree fully with
other biochemical studies in the TGF-b field that inhibitory
Smads negatively regulate receptor-activated Smad signaling
in BMP-stimulated cells (Massague
´
et al., 2005). Collectively,
our observations suggest that Smad7 is a critical downstream
target of Sip1 and promotes oligodendrocyte differentiation indi-
rectly by inhibiting BMP-Smad signaling and perhaps b-catenin-
mediated negative regulatory pathways.
Smad7 Is Required for Oligodendrocyte Differentiation
To further determine whether Smad7 is required for oligoden-
drocyte development, we generated and analyzed conditional
Smad7 knockout mice, with the Smad7 allele deleted in the
oligodendrocyte lineage by Olig1-Cre (Chen et al., 2009b)(Fig-
ure 8A). Conventional Smad7 null embryos die in utero due to
multiple defects in cardiovascular development (Chen et al.,
2009b). Although Smad7cKO (Smad7
flox/flox
;Olig1
Cre+/
) mice
are viable, they developed tremors at postnatal week 2. To
determine the role of Smad7 in oligodendrocyte develop-
ment, we examined expression of the markers for mature oligo-
dendrocytes and their precursors in the CNS of Smad7cKO
animals at P7. In the brains and spinal cord of Smad7cKO
mice, the expression of the myelin genes Mbp and Plp1 was
(H) Oligodendrocytes derived from purified rat OPCs cultured in differentiation medium for 3 days were immunoprecipitated with an antibody against p300.
Immunoprecipitated complexes were western-blotted with antibodies against p-Smad and Sip1.
(I) Immunostaining of p-Smad with an oligodendrocyte marker CC1 in P7 WT spinal cord. Arrows indicate the colabeling cells.
(J) Left: diagram shows the promoter of Id2, Hes1, and Id4 carrying the consensus Sip1 binding sites [CACCT(G)] (red dot). Right: Sip1-ChIP assay for the
promoter region with consensus binding sites from proliferating OPCs and differentiating oligodendrocytes (OL) after 3 days’ exposure to the differentiation
medium. Input DNA was used as positive control. NA; no antibody IP control.
(K) Schematic diagram shows that receptor-activated Smad1 forms a complex with Smad4/p300 to activate expression of differentiation inhibitors Id2/4 and
Hes1 (upper panel). Sip1 is upregulated during oligodendrocyte differentiation and interacts directly with Smad1/p300 to block BMP-Smad activation of
differentiation inhibitor expression (lower panel).
Figure 6. Smad7 Is an Oligodendrocyte-Specific Downstream Target of Sip1
(A) In situ hybridization using a probe to Smad7 in WT spinal cord at P0, P7, P14, P23, and P60 (adult), and Sip1cKO spinal cord at P14 as indicated.
(B) Immunostaining of Smad7 with CC1 and PDGFRa in the WT spinal cord at P14. Arrows and arrowhead indicate the CC1/Smad7 and PDGFRa/Smad7
colabeling cells, respectively.
(C) Primary rat OPCs and differentiated oligodendrocytes were immunostained with Sip1 or Smad7 together with MBP and PDGFRa. Arrows indicate the
colabeling cells.
(D) Quantification of the percentage of CC1+ and PDGFRa+ cells among Smad7+ cells in P14 WT spinal cord (n = 3). Error bars, ± SEM.
(E) Left: the conserved map of the endogenous Smad7 promoter containing consensus Sip1 binding sites (red dot) among vertebrates. Right: ChIP assay for Sip1
recruitment to the Smad7 promoter with and without Sip1 binding sites in OPCs and differentiating oligodendrocytes (OL), respectively. Input DNA was used as
a positive control.
(F) qRT-PCR was performed to measure expression of Smad7 in OPCs transfected with control and Sip1-expressing vectors. Data represent the mean ± SEM
from at least three independent experiments. **p < 0.01 (Student’s t test). Scale bars: 50 mm (A), 25 mm (B), 30 mm (C).
See also Figure S4 and Table S2.
Neuron
Sip1 Governs Myelination in the Mammalian CNS
Neuron 73, 713–728, February 23, 2012 ª2012 Elsevier Inc. 721
Page 9
Figure 7. Smad7 Overexpression Rescues OPC Differentiation Defects Caused by Sip1 Loss
(A) Primary OPCs isolated from the cortices of control and Sip1cKO pups at P1 were transduced with control (lenti-GFP) and Smad7 expressing (lenti-HA-Smad7)
lentiviruses and then cultured in the differentiation medium for 5 days. Immunostaining was performed with antibodies to MBP and HA-tag. Arrows indicate
MBP+/HA+ colabeled cells.
(B) The white box region of the Smad7 transduced cells in panel A was shown at a high magnification.
(C) Histogram depicts the number of MBP-positive or MBP and HA double-positive cells after lentiviral infection. Data from three independent experiments
represent the mean ± SEM. ***p < 0.001 (Student’s t test).
(D) Expression vectors encoding Smad7 and/or Smurf1 were cotransfected in OPCs under the growth condition containing PDGF-AA. Western blotting with
indicated antibodies was carried out from cell lysates after 48 hr transfection. GAPDH was included as a loading control.
(E) Rat OPC cultures were treated with BMP4 and transfected with control vector or vectors expressing Smad7 and Smurf1. Myelin-associated genes Mbp, Mag,
and Plp from cell lysates were analyzed by qRT-PCR 48 hr after transfection. Fold change over control vector transfected cells was present. Data represent the
mean ± SEM (n = 3). **p < 0.01 (Student’s t test).
(F) Expression vectors carrying BMPR
CA
, Smad1, and p300 with or without expression vectors or Smad7 and Smurf1 were transfected into Oli-Neu cells with the
luciferase reporter driven by the Mbp or Hes1 promoter. Fold changes over control-transfected cells were presented. Data represent the mean ± SEM (n = 3).
**p < 0.01 (Student’s t test). Scale bar: 30 mm (A).
See also Figure S5.
Neuron
Sip1 Governs Myelination in the Mammalian CNS
722 Neuron 73, 713–728, February 23, 2012 ª2012 Elsevier Inc.
Page 10
diminished in the white matter in contrast to robust expres-
sion in control mice (Figure 8B). In contrast, the OPC marker
PDGFRa was detected throughout the spinal cord and the
number of positive cells was comparable to that of control
littermates (Figure 8B). We did not detect any significant alter-
ation of astrocytic GFAP expression in the spinal cord of
Smad7 mutant mice (data not shown). The severe down-
regulation of myelin gene expression in Smad7cKO mice sug-
gests that Smad7 is critically required for oligodendrocyte
differentiation.
Figure 8. Smad7 Is Required for Oligodendrocyte Differentiation
(A) Schematic diagram shows excision of the floxed exon encoding MH2 domain of Smad7 in the oligodendrocte lineage by Olig1-Cre.
(B) In situ hybridization using probes to Mbp and PDGFRa in P8 brain (Brn) and spinal cord (SC) from control (Ctrl; Olig1Cre
+/
;Smad7
lox/+
) and Smad7cKO
(Olig1Cre
+/
;Smad7
lox/lox
) mice. Arrows indicate the labeled cells. Scale bar: 50 mm.
(C) Diagram illustrating Sip1 as a nexus that integrates extrinsic signals and intrinsic regulators to control CNS myelination. In OPCs with low Sip1 expression,
activation of negative regulatory pathways such as BMP and b-catenin signaling inhibits OPC differentiation. During oligodendrocyte (OL) differentiation, elevated
expression of Olig1 coordinates with Olig2 to activate Sip1 production. Sip1 promotes myelination at least in part by physically antagonizing BMP-Smad activity
and by activating critical OL activators and the I-Smad effector Smad7. Smad7 promotes oligodendrocyte differentiation directly or indirectly by blocking BMP
and b-catenin signaling pathways. Thus, Sip1 may represent a novel molecular node of the regulatory network that coordinates extrinsic signaling pathways and
transcriptional regulators to promote myelination in the CNS.
See also Figures S6 and S7.
Neuron
Sip1 Governs Myelination in the Mammalian CNS
Neuron 73, 713–728, February 23, 2012 ª2012 Elsevier Inc. 723
Page 11
DISCUSSION
BMP, Wnt, and Notch signaling activation is a major obstacle
for remyelination by oligodendrocytes in acute and subacute
demyelinating lesions, as these pathways inhibit oligodendro-
cyte precursor differentiation (Fancy et al., 2010; Franklin and
Ffrench-Constant, 2008; Kotter et al., 2011). However, how
these myelination-inhibitory pathways are regulated at the level
of receptor activation, their intracellular signal transduction,
and their feedback components during oligodendrocyte myeli-
nation is not fully understood. In this study, we identify Sip1 as
a common downstream target gene of Olig1 and Olig2. Overex-
pression or upregulation of Olig1 and Olig2 can activate Sip1
expression. Sip1 appears to bridge Olig activities to balance
the signaling pathways mediated by BMP/Smad and Wnt/
b-catenin to control the timing of oligodendrocyte myelination.
Our findings point to Sip1 as a master regulator that coordinates
opposing signaling pathways to promote myelination and a
nexus that connects extracellular signaling pathways to intracel-
lular transcriptional programs for myelination in the CNS.
Sip1 Controls the Transition from OPCs to Myelinating
Oligodendrocytes by Regulating the BMP-Smad
Pathway
The severe myelination defect but preservation of OPCs in the
CNS of Sip1 mutants suggests that Sip1 is a key regulator for
the transition from immature to mature myelinating oligodendro-
cytes. Sip1 is robustly upregulated during OPC differentiation
in vitro and in the postnatal CNS, consistent with the requirement
for Sip1 in oligodendrocyte maturation. However, low levels of
Sip1 in OPCs may still regulate early steps of differentiation
[e.g., by targeting negative regulatory genes Id2 and Hes1 in
OPCs (Figure 5)], which may in turn lead to more Sip1 accumu-
lation in a positive feedback loop.
Interaction of Sip1 with Smad1/Smad4/p300 complexes was
found here to block BMP-Smad-activated expression of differ-
entiation inhibitors, leading to derepression of myelin gene ex-
pression. In addition to Smad1, we expect similar outcome of
Sip1 action on the activity of other closely related Smads (i.e.,
the other BMP-Smads, Smad5 and Smad8) by blocking the
activity of p-Smads. In addition to interacting physically with
p-Smads, Sip1 also antagonizes BMP signaling by activating
at the transcriptional level an I-Smad, Smad7, which in turn
downregulates BMP receptor signaling. Recently, Sip1 was
also found to inhibit expression of BMP ligands, like the BMP4
gene (van Grunsven et al., 2007). Given that inhibition of BMP
signaling (e.g., by ablating BMPR1a or by adding BMP antago-
nists) was shown to increase the number of mature oligodendro-
cytes and promote remyelination (Sabo et al., 2011; Samanta
et al., 2007), the findings from our present studies and others
suggest that Sip1 inhibits the BMP signaling pathway at multiple
levels including the BMP ligand, its receptor, and its intracellular
effectors to promote oligodendrocyte myelination.
The modulation of various differentiation regulators by Sip1
appears to be stage-dependent. For instance, Sip1 binds the
Smad7 promoter when OPCs begin to differentiate, while being
recruited to Id2 and Hes1 promoters in OPCs and the Id4 pro-
moter in differentiating oligodendrocytes, respectively, suggest-
ing that stage-specific cofactors may direct the binding of Sip1
to different targets to modulate their expression. This temporal
specificity and the dual effect of Sip1-mediated promotion and
repression of positive and negative regulators of myelination,
respectively, may eventually promote and reinforce the process
of myelination. Sip1 is a multidomain zinc-finger E-box-binding
homeobox transcription factor that may also interact with many
distinct protein complexes other than p-Smads, such as CtBP
(Postigo et al., 2003) and the NuRD chromatin remodeling
complex (Verstappen et al., 2008), to regulate the oligodendro-
cyte differentiation program. Whether these effects converge
or exist in parallel at different stages during oligodendrocyte
development, and whether Sip1 also regulates other signaling
pathways as seen in different contexts (Goossens et al., 2011;
Miquelajauregui et al., 2007; Seuntjens et al., 2009), are com-
pelling new questions for future investigation. We show
here that during oligodendrocyte differentiation, Sip1 inhibits
BMP-Smad signaling activity by interacting directly with the
receptor-activated Smad complex while activating expression
of Smad7, encoding a negative feedback regulator of TGF-b/
BMP signaling. These two action modes via Sip1 work in concert
to inhibit negative BMP-Smad signaling activity on expression
of myelin genes and therefore indirectly promote myelination
(Figure 8C). Other potential Sip1 downstream components such
as these encoded by MRF and Sox10
may coordinate with
Smad
7 to regulate myelin gene expression. Thus, Sip1 may act,
even within the same cell, both as repressor and activator in
a context-dependent manner, probably depending on the tran-
scriptional coregulators with which it cooperates at a specific
time during oligodendrocyte differentiation. In either case, our
findings suggest that Sip1 exerts a dualistic function via control-
ling the activity of distinct Smad effectors and functionally coordi-
nate the positive and negative regulatory cues to establish the
program that promotes myelination (Figure 8C).
Inhibitory Smad Signaling Promotes Oligodendrocyte
Differentiation
Although BMP-Smad signaling has been reported to block oligo-
dendrocyte maturation (Cheng et al., 2007; Miller et al., 2004;
See et al., 2004), the function of negative feedback Smad effec-
tors in the regulation of oligodendrocyte differentiation is not
known. The identification of the Smad7 gene as a direct target
of Sip1 suggests that Sip1 exerts its function in oligodendrocyte
myelination at least in part by activating I-Smad gene expres-
sion. Of particular interest, Smad7 is found uniquely and highly
elevated in oligodendrocytes both in vivo and in vitro, in contrast
to the second I-Smad gene, Smad6, whose mRNA is hardly
detectable in oligodendrocytes by in situ hybridization, although
Smad6 overexpression in OPCs downregulates BMP sig-
naling (data not shown). This suggests that Sip1 regulation of
oligodendrocyte-specific Smad7 is a unique and novel aspect
of Smad feedback regulation in the blocking of BMP/TGF-b
receptor signaling during oligodendrocyte differentiation, and
which may also apply to other cell types where Sip1 regulates
differentiation. Our unprecedented observations of Sip1-Smad7
regulatory cascade for OPC differentiation by antagonizing
BMP signaling fit in a general picture where the BMP pathway is
regulated by various mechanisms, including synexpression and
Neuron
Sip1 Governs Myelination in the Mammalian CNS
724 Neuron 73, 713–728, February 23, 2012 ª2012 Elsevier Inc.
Page 12
negative feedback mechanisms. In our case, forced expression
of Smad7 not only inhibits BMP signaling in OPCs, but also leads
to downregulation of b-catenin levels through a mechanism
involving Smad7 and its cognate E3 ubiquitin ligase Smurf1, sug-
gesting that Smad7 can block both BMP and b-catenin negative
regulatory pathways for oligodendrocyte differentiation.
Importantly, we show that Smad7 overexpression is able
to promote differentiation of OPCs even in the absence of
Sip1 and induce oligodendrocyte formation from their precur-
sors in ovo (Figure S5), suggesting that Smad7 acts downstream
of Sip1 as a potent positive regulator for oligodendrocyte differ-
entiation. These findings reveal a previously unrecognized
pivotal role of Smad7 in promoting myelination at least in part
through antagonizing BMP and b-catenin negative regulatory
pathways.
SIP1/ZFHX1B in Human Diseases
Human mutations in SIP1/ZFHX1B cause Mowat-Wilson syn-
drome (MWS), which is characterized by the combination of
defects with variable penetrance, including severe mental
retardation, white matter defects such as corpus callosum agen-
esis, Hirschsprung disease, and variable congenital malforma-
tions such as heart and craniofacial defects (Dastot-Le Moal
et al., 2007; Garavelli and Mainardi, 2007; Zweier et al., 2005).
This single-gene disorder also leads to delayed motor develop-
ment, seizures, and epilepsy in many MWS patients. Although
Sip1 is critical for neurogenesis in the embryonic cortex (Seunt-
jens et al., 2009), the critical role of Sip1 in CNS myelina-
tion discovered here through oligodendrocyte lineage-specific
mutagenesis suggests that mutations in SIP1/ZFHX1B may
contribute to delayed myelination and white matter defects
seen in patients with MWS (Figure S6)(Schell-Apacik et al.,
2008; Sztriha et al., 2003). In addition, by using a lysolecithin-
induced demyelination/remyelination animal model, we found
that Sip1 was substantially upregulated in oligodendrocyte
lineage cells in the lesion during remyelination (Figure S7), point-
ing to a potential important role of Sip1 in the remyelination
process. As an integral component of the Smad regulatory
circuitry, Sip1 may represent a novel molecular node of the
regulatory network that integrates and balances negative
signaling pathways and transcriptional signals to govern CNS
myelinogenesis, and perhaps other neurological aspects. Modu-
lation of the Smad signaling pathway may provide a future
effective means to promote brain repair in patients with devas-
tating demyelinating diseases and other neurological disorders
of the CNS.
EXPERIMENTAL PROCEDURES
Animals
Sip1
lox/lox
mice were crossed with Olig1-Cre heterozygous mice to generate
Olig1Cre
+/
; Sip1
lox/+
mice, which were then bred with Sip1
lox/lox
mice to
produce control (Sip1
lox/+
;Olig1Cre
+/
) and Sip1cKO offspring (Sip1
lox/lox
;
Olig1Cre
+/
). Sip1
lox/+
;Olig1Cre
+/
mice were used as control mice since
they developed and behaved the same as WT. A similar mating strategy was
used for generating Smad7 control (Smad7
lox/+
;Olig1Cre
+/
) and conditional
knockout (Smad7
lox/lox
;Olig1Cre
+/
) mice. All animal use and studies were
approved by the Institutional Animal Care and Use Committee of the University
of Texas Southwestern Medical Center at Dallas.
Human Participants
Patients with MWS were enrolled in a clinical, imaging and genetics study
of individuals with callosal disorders approved by the Committee on Human
Research at the University of California, San Franc isco.
ChIP Sequencing, Gene-Chip Microarray, and Quantitative RT-PCR
Differentiating oligodendrocytes (1 3 10
7
cells) were harvested from purified
rat OPCs cultured in the oligodendrocyte differentiation medium for 3 days.
Chromatin preparation, ChIP, DNA purification, and library preparation for
Illumina sequencing were performed using a ChIP sequencing DNA Prep kit
(Illumina) according to the manufacturer’s instructions. ChIP sequencing
was performed using a rabbit Olig2 antibody (Abcam) and control immuno-
globulin G (IgG) on differentiating oligodendrocytes. Sequencing was done
on an Illumina high-throughput sequencer. For gene-chip microarray, RNAs
from the myelinating optic nerve or spinal cord of control and Olig1 or Sip1
mutant mice at P14 were labeled for microarray analysis (Affymetrix gene-
chip, ST1.0). qRT-PCR was carried out using the ABI Prism 7700 Sequence
Detector System. The PCR primer sequences are available upon request.
Tissue and Histology
The brain, spinal cord, and optic nerve of mice at defined ages were dissected
and fixed overnight in 4% paraformaldehyde and processed for vibratome-
and cryo-sections. Sections with lysolecithin-induced demyelinating/remyeli-
nating lesion in the adult rat spinal cord were kindly provided by Dr. Akiko
Nishiyama. For immunostaining, we used antibodies to Olig2 (gift of C. Stiles),
Sip1 (gift of D. Huylebroeck and Santa Cruz Biotechnology), PDGFRa (BD
Bioscience, 558774), CC1 (Oncogene Research, OP80), O1 (gift of A. Gow),
MBP (Covance, SMI-94R), p-Smad (Cell Signaling), and Smad7 (Santa Cruz
Biotechnology, SC-11392). Monoclonal antibody to RIP was obtained from
the Developmental Studies Hybridoma Bank at the University of Iowa. RNA
in situ hybridization was performed using digoxigenin-labeled riboprobes as
described previously (Lu et al., 2002). The probes used were: murine PDGFRa,
Plp1/Dm-20, Mbp, Smad7, and chick Pdgfra and Sox10. Detailed protocols
are available upon request. Electron microscopy was performed as previously
described (Xin et al., 2005).
Primary Oligodendroglial Cell Culture
Primary rat OPCs were isolated from cortices of pups at P2 using a differential
detachment procedure as previously described (Chen et al., 2007). Isolated rat
OPCs were grown in the OPC Growth Medium (Sato medium-supplemented
mitogens 10 ng/ml PDGF-AA and 20 ng/ml basic fibroblast growth factor),
and differentiated in Oligodendrocyte Differentiation Medium (Sato medium
supplemented with 15 nM thyroid hormone T3 and 10 ng/ml ciliary neurotro-
phic factor). A similar differential detachment method was used for mouse
OPC isolation using P1 neocortices. Briefly, the cortices of mouse pups
were dissociated in a Dulbecco’s modified Eagle’s medium (DMEM) medium
containing 10% fetal bovine serum and 1% penicillin-streptomycin by gently
triturating through 18G, 21G, and 23G needles 3 times each. Cells collected
through a sterile 70 mm filter were plated onto poly-D-lysine-coated 75 cm
2
flasks in the above medium. The medium was changed every other day until
cells became 50%–60% confluent. The medium was then switched to
a serum-free B104 conditional medium (DMEM/F12 medium containing 15%
B104 CM, 13 N2, and 50 mm/ml insulin) to enrich OPC production (Chen
et al., 2007). After removing microglia and astrocytes through shaking the
mixed glia-culture and differential attachment, the isolated mouse OPCs
(approximately 80% pure) were cultured in the OPC Proliferation Medium
plus B27, 1 ng/ml NT3, and 5 mM forskolin (Emery et al., 2009). OPCs were
transduced with lentivirus or transfected with expressing vectors using Amaxa
electroporator according to the manufacturer’s protocol and assayed for
immunocytochemistry and qRT-PCR analysis. The extent of oligodendrocyte
process outgrowth was measured by the area surrounding the nuclei including
the outermost tips occupied by processes using Image J.
ChIP Assays
ChIP assay was performed as previously described (Chen et al., 2009a)
using genomic DNAs from OPCs, and differentiating oligodendrocytes (after
T3/CNTF treatment of OPCs) were immunoprecipitated with anti-Sip1
Neuron
Sip1 Governs Myelination in the Mammalian CNS
Neuron 73, 713–728, February 23, 2012 ª2012 Elsevier Inc. 725
Page 13
antibody. Briefly, primary OPCs isolated from rat neonatal pups or oligoden-
drocytes were fixed in 1% formaldehyde for 10 min and stop fixing by 2.5 M
glycine for 5 min at room temperature. Cells were washed in PBS, resuspended
in a cell lysis solution containing 150 mM NaCl, 10% glycerol, 50 mM HEPES,
1 mM EDTA, 0.5% Nonidet P-40, and 0.25% Triton X-100, and homogenized.
Lysates were sonicated with a Bioruptor sonicator (Diagenode) into frag-
mented DNAs around 300 bp in a sonication buffer containing 1 mM EDTA,
0.5 mM EGTA, 10 mM Tris, and 0.1% SDS. Sonicated chromatin (100 mg
DNA) was used for immunoprecipitation by incubation with 2 mg of anti-Sip1
antibody. Primers used for ChIP analysis on promoters were as follows
Smad7(I) forward, gtcacctgtagcctggtttagc, Smad7, reverse, gcatcggcactgt
attctcac; Smad7(forward, gtcacctgtagcctggtttagc, Smad7 reverse, gcatcg
gcactgtattctcac; Id4 forward, cgcagcagtatttgtagagcc, Id4 reverse, gcgttga
cggaatggagtgt; Id2 forward, acagacccgcttggagttgc, Id2 reverse, gtcacgg
gcggaatggacac; Hes1 forward, tacctttagccacatcttcatcag, Hes1 reverse,
gactcagcatatttcaaccacctc.
Lentivirus Generation
Sip1 and HA-tagged Smad7 were cloned into a lentiviral expressing vector
(lenti-CSCsp-pw-ires-GFP, a gift from Dr. Jenny Hsieh). Lentiviruses were
prepared by cotransfected lentiviral expressing vectors with packaging
vectors pMD2.G and psPAX2 (Addgene) into 293T cells using Polyjet transfec-
tion reagents (SignaGen labs) or CaCl2 transfection methods. Forty-eight hr
after transfection, viral supernatants were collected and filtered through
a 0.45 mm filter, then concentrated by ultracentrifuging at 19,400 rpm for
2hrat4
C. OPCs were infected at multiplicity of infection (MOI) of 50 (MOI
was determined in human 293T cells). The infection rate was >90% in these
cultures.
Transient Transfection, Luciferase Assays,
and Coimmunoprecipitation
The mouse oligodendrocyte precursor cell line Oli-neu (Jung et al., 1995) was
a kind gift from Dr. P. Wright (University of Arkansas). The Oli-neu cells were
maintained in growth medium consisting of DMEM supplemented with N2
and 1% horse serum. Oli-neu cells were transfected with luciferase reporters
and assayed 24 hr posttransfection for luciferase activities by using a Promega
luciferase assay kit according to the manufacturer’s instructions. For immuno-
precipitation, whole-cell lysates were prepared from brain tissues and cells
using 13 Passive lysis buffer (Promega) supplemented with a protease
inhibitor cocktail (1:200, Sigma). A total of 300 mg of cell lysate proteins were
incubated with 2 mg antibody . Phosphatase inhibitors used for immunoprecip-
itation are 5 mM microcystin, 2 mM imidazole, 1.15 mM sodium molybdate, and
0.184 mg/ml sodium orthovahedate. Western blotting was performed using
chemiluminescence with the ECL kit (Pierce) according to the manufacturer’s
instructions. Chick embryo in ovo electroporation in developing the neural tube
was conducted as previously described (Ye et al., 2009).
Statistic Analysis
Quantifications were performed from at least three independent experimental
groups. Data are presented as mean ± SEM in the graphs; p values are from
Student’s two-tailed t test to compare two sets of data. For multiple compar-
isons, which were done using one-way analysis of variance analysis, p < 0.05
was considered statistically significant.
SUPPLEMENTAL INFORMATION
Supplemental Information includes seven figures and two tables and can be
found with this article online at doi:10.1016/j.neuron.2 011.12.021.
ACKNOWLEDGMENTS
The authors would like to thank Y. Yu, A. Nishiyama, B. Kim, W. Liu, L. Liu, C.
Shen, Melinda K. Duncan, and A. Francis and A. Conidi for technical support.
We thank C. Stiles, J. Svaren, S. Yoon, E. Olson, J. Johnson, J. Li, E. Hurlock,
N. Ma, and O. Barca-Mayo for critical comments and suggestions. This study
was funded in part by grants from the National Institutes of Health
(R01NS072427) and the National Multiple Sclerosis Society (RG3978)
(to Q.R.L.) and the Research Council of Katholieke Universiteit Leuven
(OT-09/053 and GOA-11/012), FWO-V (G.0954.11N to D.H. and E.S.), the
Queen Elisabeth Medical Foundation (GSKE 1113) and Interuniversity Attrac-
tion Poles (IUAP 6/20), and the type 3 large-infrastructure support InfraMouse
by the Hercules Foundation (to D.H.).
Accepted: December 1, 2011
Published: February 22, 2012
REFERENCES
Arnett, H.A., Fancy, S.P., Alberta, J.A., Zhao, C., Plant, S.R., Kaing, S., Raine,
C.S., Rowitch, D.H., Franklin, R.J., and Stiles, C.D. (2004). bHLH transcription
factor Olig1 is required to repair demyelinated lesions in the CNS. Science 306,
2111–2115.
Chang, A., Tourtellotte, W.W., Rudick, R., and Trapp, B.D. (2002).
Premyelinating oligodendrocytes in chronic lesions of multiple sclerosis.
N. Engl. J. Med. 346, 165–173.
Chen, Y., Balasubramaniyan, V., Peng, J., Hurlock, E.C., Tallquist, M., Li, J.,
and Lu, Q.R. (2007). Isolation and culture of rat and mouse oligodendrocyte
precursor cells. Nat. Protoc. 2, 1044–1051.
Chen, Y., Wu, H., Wang, S., Koito, H., Li, J., Ye, F., Hoang, J., Escobar, S.S.,
Gow, A., Arnett, H.A., et al. (2009a). The oligodendrocyte-specific G protein-
coupled receptor GPR17 is a cell-intrinsic timer of myelination. Nat.
Neurosci. 12, 1398–1406.
Chen, Q., Chen, H., Zheng, D., Kuang, C., Fang, H., Zou, B., Zhu, W., Bu, G.,
Jin, T., Wang, Z., et al. (2 009b). Smad7 is required for the developme nt and
function of the heart. J. Biol. Chem. 284, 292–300.
Cheng, X., Wang, Y., He, Q., Qiu, M., Whittemore, S.R., and Cao, Q. (2007).
Bone morphogenetic protein signaling and olig1/2 interact to regulate the
differentiation and maturation of adult oligodendrocyte precursor cells. Stem
Cells 25, 3204–3214.
Dastot-Le Moal, F., Wilson, M., Mowat, D., Collot, N., Niel, F., and Goossens,
M. (2007). ZFHX1B mutations in patients with Mowat-Wilson syndrome. Hum.
Mutat. 28, 313–321.
Emery, B. (2010). Regulation of oligodendrocyte differentiation and myelina-
tion. Science 330, 779–782.
Emery, B., Agalliu, D., Cahoy, J.D., Watkins, T.A., Dugas, J.C., Mulinyawe,
S.B., Ibrahim, A., Ligon, K.L., Rowitch, D.H., and Barres, B.A. (2009). Myelin
gene regulatory factor is a critical transcriptional regulator required for CNS
myelination. Cell 138, 172–185.
Fancy, S.P., Baranzini, S.E., Zhao, C., Yuk, D.I., Irvine, K.A., Kaing, S., Sanai,
N., Franklin, R.J., and Rowitch, D.H. (2009). Dysregulation of the Wnt pathway
inhibits timely myelination and remyelination in the mammalian CNS. Genes
Dev. 23, 1571–1585.
Fancy, S.P., Kotter, M.R., Harrington, E.P., Huang, J.K., Zhao, C., Rowitch,
D.H., and Franklin, R.J. (2010). Overcoming remyelination failure in multiple
sclerosis and other myelin disorders. Exp. Neurol. 225, 18–23.
Franklin, R.J. (2002). Why does remyelination fail in multiple sclerosis? Nat.
Rev. Neurosci. 3, 705–714.
Franklin, R.J., and Ffre nch-Constant, C. (2008). Remyelination in the CNS:
from biology to therapy. Nat. Rev. Neurosci. 9, 839–855.
Friedman, B., Hockfield, S., Black, J.A., Woodruff, K.A., and Waxman, S.G.
(1989). In situ demonstration of mature oligodendrocytes and their processes:
an immunocytochemical study with a new monoclonal antibody, rip. Glia 2,
380–390.
Garavelli, L., and Mainardi, P.C. (2007). Mowat-Wilson syndrome. Orphanet J.
Rare Dis. 2,
42.
Goossens, S., Janzen, V., Bartunkova, S., Yokomizo, T., Drogat, B., Crisan, M.,
Haigh, K., Seuntjens, E., Umans, L., Riedt, T., et al. (2011). The EMT regulator
Zeb2/Sip1 is essential for murine embryonic hematopoietic stem/progenitor
cell differentiation and mobilization. Blood 117, 5620–56 30.
Neuron
Sip1 Governs Myelination in the Mammalian CNS
726 Neuron 73, 713–728, February 23, 2012 ª2012 Elsevier Inc.
Page 14
Hall, A.K., and Miller, R.H. (2004). Emerging roles for bone morphogenetic
proteins in central nervous system glial biology. J. Neurosci. Res. 76, 1–8.
Han, G., Li, A.G., Liang, Y.Y., Owens, P., He, W., Lu, S., Yoshimatsu, Y., Wang,
D., Ten Dijke, P., Lin, X., and Wang, X.J. (2006). Smad7-induced beta-catenin
degradation alters epidermal appendage development. Dev. Cell 11, 301–312.
He, Y., Dupree, J., Wang, J., Sandoval, J., Li, J., Liu, H., Shi, Y., Nave, K.A., and
Casaccia-Bonnefil, P. (2007). The transcription factor Yin Yang 1 is essential
for oligodendrocyte progenitor differentiation. Neuron 55, 217–230.
Higashi, Y., Maruhashi, M., Nelles, L., Van de Putte, T., Verschueren, K.,
Miyoshi, T., Yoshimoto, A., Kondoh, H., and Huylebroeck, D. (2002).
Generation of the floxed allele of the SIP1 (Smad-interacting protein 1) gene
for Cre-mediated conditional knockout in the mouse. Genesis 32, 82–84.
Howng, S.Y., Avila, R.L., Emery, B., Traka, M., Lin, W., Watkins, T., Cook, S.,
Bronson, R., Davisson, M., Barres, B.A., and Popko, B. (2010). ZFP191 is
required by oligodendrocytes for CNS myelination. Genes Dev. 24, 301–311.
Hsieh, J., Aimone, J.B., Kaspar, B.K., Kuwabara, T., Nakashima, K., and Gage,
F.H. (2004). IGF-I instructs multipotent adult neural progenitor cells to become
oligodendrocytes. J. Cell Biol. 164, 111–122.
Jung, M., Kra
¨
mer, E., Grzenkowski, M., Tang, K., Blakemore, W., Aguzzi, A.,
Khazaie, K., Chlichlia, K., von Blankenfeld, G., Kettenmann, H., et al. (1995).
Lines of murine oligodendroglial precursor cells immortalized by an activated
neu tyrosine kinase show distinct degrees of interaction with axons in vitro and
in vivo. Eur. J. Neurosci. 7, 1245–1265.
Kadi, L., Selvaraju, R., de Lys, P., Proudfoot, A.E., Wells, T.N., and Boschert, U.
(2006). Differential effects of chemokines on oligodendrocyte precursor
proliferation and myelin formation in vitro. J. Neuroimmunol. 174, 133–146.
Kavsak, P., Rasmussen, R.K., Causing, C.G., Bonni, S., Zhu, H., Thomsen,
G.H., and Wrana, J.L. (2000). Smad7 binds to Smurf2 to form an E3 ubiquitin
ligase that targets the TGF beta receptor for degradation. Mol. Cell 6, 1365–
1375.
Kotter, M.R., Stadelmann, C., and Hartung, H.P. (2011). Enhancing remyelina-
tion in disease–can we wrap it up? Brain 134, 1882–1900.
Li, H., Lu, Y., Smith, H.K., and Richardson, W.D. (2007). Olig1 and Sox10
interact synergistically to drive myelin basic protein transcription in oligoden-
drocytes. J. Neurosci. 27, 14375–14382.
Li, H., He, Y., Richardson, W.D., and Casaccia, P. (2009). Two-tier transcrip-
tional control of oligodendrocyte differentiation. Curr. Opin. Neurobiol. 19,
479–485.
Lu, Q.R., Sun, T., Zhu, Z., Ma, N., Garcia, M., Stiles, C.D., and Rowitch, D.H.
(2002). Common developmental requirement for Olig function indicates
a motor neuron/oligodendrocyte connection. Cell 109, 75–86.
Mar, S., and Noetzel, M. (2010). Axonal damage in leukodystrophies. Pediatr.
Neurol. 42, 239–242.
Massague
´
, J., Seoane, J., and Wotton, D. (2005). Smad transcription factors.
Genes Dev. 19, 2783–2810.
Millar, S.E. (2006). Smad7: licensed to kill beta-catenin. Dev. Cell 11, 274–276.
Miller, R.H., Dinsio, K., Wang, R., Geertman, R., Maier, C.E., and Hall, A.K.
(2004). Patterning of spinal cord oligodendrocyte development by dorsally
derived BMP4. J. Neurosci. Res. 76, 9–19.
Miquelajauregui, A., Van de Putte, T., Polyakov, A., Nityanandam, A.,
Boppana, S., Seuntjens, E., Karabinos, A., Higashi, Y., Huylebroeck, D., and
Tarabykin, V. (2007). Smad-interacting protein-1 (Zfhx1b) acts upstream of
Wnt signaling in the mouse hippocampus and contro ls its formation. Proc.
Natl. Acad. Sci. USA 104, 12919–12924.
Nakashima, K., Yanagisawa, M., Arakawa, H., Kimura, N., Hisatsune, T.,
Kawabata, M., Miyazono, K., and Taga, T. (1999). Synergistic signaling in fetal
brain by STAT3-Smad1 complex bridged by p300. Science 284, 479–482.
Nave, K.A. (1994). Neurological mouse mutants and the genes of myelin.
J. Neurosci. Res. 38, 607–612.
Ogata, T., Ueno, T., Hoshikawa, S., Ito, J., Okazaki, R., Hayakawa, K.,
Morioka, K., Yamamoto, S., Nakamura, K., Tanaka, S., and Akai, M. (2010).
Hes1 functions downstream of growth factors to maintain oligodendrocyte
lineage cells in the early progenitor stage. Neuroscience 176, 132–141.
Pearson, K.L., Hunter, T., and Janknecht, R. (1999). Activation of Smad1-
mediated transcription by p300/CBP. Biochim. Biophys. Acta 1489, 354–364.
Postigo, A.A., Depp, J.L., Taylor, J.J., and Kroll, K.L. (2003). Regulation of
Smad signaling through a differential recruitment of coactivators and core-
pressors by ZEB proteins. EMBO J. 22, 2453–2462.
Remacle, J.E., Kraft, H., Lerchner, W., Wuytens, G., Collart, C., Verschueren,
K.,
Smith, J.C., and Huylebroeck, D. (1999). New mode of DNA binding of
multi-zinc finger transcription factors: deltaEF1 family members bind with
two hands to two target sit es. EMBO J. 18, 5073–5084.
Sabo, J.K., Aumann, T.D., Merlo, D., Kilpatrick, T.J., and Cate, H.S. (2011).
Remyelination is altered by bone morphogenic protein signaling in demyeli-
nated lesions. J. Neurosci. 31, 4504–4510.
Samanta, J., and Kessler, J.A. (2004). Interactions between ID and OLIG
proteins mediate the inhibitory effects of BMP4 on oligodendroglial differenti-
ation. Development 131, 4131–4142.
Samanta, J., Burke, G.M., McGuire, T., Pisarek, A.J., Mukhopadhyay, A.,
Mishina, Y., and Kessler, J.A. (2007). BMPR1a signaling determines numbers
of oligodendrocytes and calbindin-expressing interneurons in the cortex.
J. Neurosci. 27, 7397–7407.
Schell-Apacik, C.C., Wagner, K., Bihler, M., Ertl-Wagner, B., Heinrich, U.,
Klopocki, E., Kalscheuer, V.M., Muenke, M., and von Voss, H. (2008).
Agenesis and dysgenesis of the corpus callosum: clinical, genetic and neuro-
imaging findings in a series of 41 patients. Am. J. Med. Genet. A. 146A, 2501–
2511.
See, J., Zhang, X., Eraydin, N., Mun, S.B., Mamontov, P., Golden, J.A., and
Grinspan, J.B. (2004). Oligodendrocyte maturation is inhibited by bone
morphogenetic protein. Mol. Cell. Neurosci. 26, 481–492.
Seuntjens, E., Nityanandam, A., Miquelajauregui, A., Debruyn, J., Stryjewska,
A., Goebbels, S., Nave, K.A., Huylebroeck, D., and Tarabykin, V. (2009). Sip1
regulates sequential fate decisions by feedback signaling from postmitotic
neurons to progenitors. Nat. Neurosci. 12, 1373–1380.
Skillington, J., Choy, L., and Derynck, R. (2002). Bone morphogenetic protein
and retinoic acid signaling cooperate to induce osteoblast differentiation of
preadipocytes. J. Cell Biol. 159, 135–146.
Suzuki, C., Murakami, G., Fukuchi, M., Shimanuki, T., Shikauchi, Y., Imamura,
T., and Miyazono, K. (2002). Smurf1 regulates the inhibitory activity of Smad7
by targeting Smad7 to the plasma membrane. J. Biol. Chem. 277, 39919–
39925.
Sztriha, L., Espinosa-Parrilla, Y., Gururaj, A., Amiel, J., Lyonnet, S., Gerami, S.,
and Johansen, J.G. (2003). Frameshift mutation of the zinc finger homeo box 1
B gene in syndromic corpus callosum agenesis (Mowat-Wilson syndrome).
Neuropediatrics 34, 322–325.
Trapp, B.D., Peterson, J., Ransohoff, R.M., Rudick, R., Mo
¨
rk, S., and Bo
¨
,L.
(1998). Axonal transection in the lesions of multiple sclerosis. N. Engl. J.
Med. 338, 278–285.
van Grunsven, L.A., Taelman, V., Michiels, C., Verstappen, G., Souopgui, J.,
Nichane, M., Moens, E., Opdecamp, K., Vanhomwegen, J., Kricha, S., et al.
(2007). XSip1 neuralizing activity involves the co-repressor CtBP and occurs
through BMP dependent and independent mechanisms. Dev. Biol. 306,
34–49.
Verschueren, K., Remacle, J.E., Collart, C., Kraft, H., Baker, B.S., Tylzanowski,
P., Nelles, L., Wuytens, G., Su, M.T., Bodmer, R., et al. (1999). SIP1, a novel
zinc finger/homeodomain repressor, interacts with Smad proteins and binds
to 5
0
-CACCT sequences in candidate target genes. J. Biol. Chem. 274,
20489–20498.
Verstappen, G., van Grunsven, L.A., Michiels, C., Van de Putte, T., Souopgui,
J., Van Damme, J., Bellefroid, E., Vandekerckhove, J., and Huylebroeck, D.
(2008). Atypical Mowat-Wilson patient confirms the importance of the novel
association between ZFHX1B/SIP1 and NuRD corepressor complex. Hum.
Mol. Genet. 17, 1175–1183.
Neuron
Sip1 Governs Myelination in the Mammalian CNS
Neuron 73, 713–728, February 23, 2012 ª2012 Elsevier Inc. 727
Page 15
Wang, S., Sdrulla, A.D., diSibio, G., Bush, G., Nofziger, D., Hicks, C.,
Weinmaster, G., and Barres, B.A. (1998). Notch receptor activation inhibits
oligodendrocyte differentiation. Neuron 21, 63–75.
Wegner, M. (2008). A matter of identity: transcriptional control in oligodendro-
cytes. J. Mol. Neurosci. 35, 3–12.
Wu, Y., Liu, Y., Levine, E.M., and Rao, M.S. (2003). Hes1 but not Hes5
regulates an astrocyte versus oligodendrocyte fate choice in glial restricted
precursors. Dev. Dyn. 226, 675–689.
Xin, M., Yue, T., Ma, Z., Wu, F.F., Gow, A., and Lu, Q.R. (2005). Myelinogenesis
and axonal recognition by oligodendrocytes in brain are uncoupled in
Olig1-null mice. J. Neurosci. 25, 1354–1365.
Ye, F., Chen, Y., Hoang, T., Montgomery, R.L., Zhao, X.H., Bu, H., Hu, T.,
Taketo, M.M., van Es, J.H., Clevers, H., et al. (2009). HDAC1 and HDAC2
regulate oligodendrocyte differentiation by disrupting the beta-catenin-TCF
interaction. Nat. Neurosci. 12, 829–838.
Yue, T., Xian, K., Hurlock, E., Xin, M., Kernie, S.G., Parada, L.F., and Lu, Q.R.
(2006). A critical role for dorsal progenitors in cortical myelination. J. Neurosci.
26, 1275–1280.
Zalc, B., and Colman, D.R. (2000). Origins of vertebrate success. Science 288,
271–272.
Zhang, Y., Argaw, A.T., Gurfein, B.T., Zameer, A., Snyder, B.J., Ge, C., Lu,
Q.R., Rowit ch, D.H., Raine, C.S., Brosnan, C.F., and John, G.R. (2009).
Notch1 signaling plays a role in regulating precursor differentiation during
CNS remyelination. Proc. Natl. Acad. Sci. USA 106, 19162–19167.
Zhou, Q., and Anderson, D.J. (2002). The bHLH transcription factors OLIG2
and OLIG1 couple neuronal and glial subtype specification. Cell 109, 61–73.
Zweier, C., Thiel, C.T., Dufke, A., Crow, Y.J., Meinecke, P., Suri, M., Ala-Mello,
S., Beemer, F., Bernasconi, S., Bianchi, P., et al. (2005). Clinical and mutational
spectrum of Mowat -Wilson syndrome. Eur. J. Med. Genet. 48, 97–111.
Neuron
Sip1 Governs Myelination in the Mammalian CNS
728 Neuron 73, 713–728, February 23, 2012 ª2012 Elsevier Inc.
Page 16
  • Source
    • "In addition to this, Van de reported adrenomedullary developmental defects in these mice, suggesting that autonomic dysfunction may also occur in MWS patients. The CNS myelination deficits observed in oligodendrocyte lineagespecific Zeb2 mutants may underlie the white matter defects in MWS patients, such as corpus callosum agenesis (Weng et al., 2012), although corpus callosum defects have been reported in other conditional Zeb2 mutants (Miquelajauregui et al., 2007; Srivatsa et al., 2015 ). Furthermore, these oligodendrocyte lineagespecific Zeb2 conditional mutant mice displayed seizures (Weng et al., 2012), suggesting that disruption to Zeb2-controlled myelinogenesis may underpin the seizures observed in MWS patients. "
    [Show abstract] [Hide abstract] ABSTRACT: Zinc finger E-box binding homeobox (Zeb) 2 is a transcription factor, identified due its ability to bind Smad proteins, and consists of multiple functional domains which interact with a variety of transcriptional co-effectors. The complex nature of the Zeb2, both at its genetic and protein levels, underlie its multifunctional properties, with Zeb2 capable of acting individually or as part of a transcriptional complex to repress, and occasionally activate, target gene expression. This review introduces Zeb2 as an essential regulator of nervous system development. Zeb2 is expressed in the nervous system throughout its development, indicating its importance in neurogenic and gliogenic processes. Indeed, mutation of Zeb2 has dramatic neurological consequences both in animal models, and in humans with Mowat-Wilson syndrome, which results from heterozygous ZEB2 mutations. The mechanisms by which Zeb2 regulates the induction of the neuroectoderm (CNS primordium) and the neural crest (PNS primordium) are reviewed herein. We then describe how Zeb2 acts to direct the formation, delamination, migration and specification of neural crest cells. Zeb2 regulation of the development of a number of cerebral regions, including the neocortex and hippocampus, are then described. The diverse molecular mechanisms mediating Zeb2-directed development of various neuronal and glial populations are reviewed. The role of Zeb2 in spinal cord and enteric nervous system development is outlined, while its essential function in CNS myelination is also described. Finally, this review discusses how the neurodevelopmental defects of Zeb2 mutant mice delineate the developmental dysfunctions underpinning the multiple neurological defects observed in Mowat-Wilson syndrome patients. Copyright © 2015. Published by Elsevier Ltd.
    Full-text · Article · Sep 2015 · Progress in Neurobiology
  • Source
    • "One factor that might contribute to this response is decreased expression of Smad-interacting protein-1 (now known as ZEB2), which suppresses neuronal expression of FGF9 during cortical development (Seuntjens et al., 2009). Intriguingly, this transcription factor is expressed by oligodendrocytes and plays an essential role in CNS myelination (Weng et al., 2012), an observation that raises the possibility ZEB2 may also influence oligodendroglial expression of FGF9. Analysis of the effects of FGF9 in vitro revealed it not only inhibited myelination/remyelination, but also induced expression of the pro-inflammatory chemokines Ccl2 and Ccl7. "
    [Show abstract] [Hide abstract] ABSTRACT: Remyelination failure plays an important role in the pathophysiology of multiple sclerosis, but the underlying cellular and molecular mechanisms remain poorly understood. We now report actively demyelinating lesions in patients with multiple sclerosis are associated with increased glial expression of fibroblast growth factor 9 (FGF9), which we demonstrate inhibits myelination and remyelination in vitro. This inhibitory activity is associated with the appearance of multi-branched 'pre-myelinating' MBP(+)/PLP(+) oligodendrocytes that interact with axons but fail to assemble myelin sheaths; an oligodendrocyte phenotype described previously in chronically demyelinated multiple sclerosis lesions. This inhibitory activity is not due to a direct effect of FGF9 on cells of the oligodendrocyte lineage but is mediated by factors secreted by astrocytes. Transcriptional profiling and functional validation studies demonstrate that these include effects dependent on increased expression of tissue inhibitor of metalloproteinase-sensitive proteases, enzymes more commonly associated with extracellular matrix remodelling. Further, we found that FGF9 induces expression of Ccl2 and Ccl7, two pro-inflammatory chemokines that contribute to recruitment of microglia and macrophages into multiple sclerosis lesions. These data indicate glial expression of FGF9 can initiate a complex astrocyte-dependent response that contributes to two distinct pathogenic pathways involved in the development of multiple sclerosis lesions. Namely, induction of a pro-inflammatory environment and failure of remyelination; a combination of effects predicted to exacerbate axonal injury and loss in patients. © The Author (2015). Published by Oxford University Press on behalf of the Guarantors of Brain. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
    Full-text · Article · Apr 2015 · Brain
  • Source
    • "Briefly, OLIG1 regulates the expression of several genes involved in oligodendroglial maturation, including MBP, myelin oligodendrocytic glycoprotein, myelin proteolipid protein, and zinc finger protein 488 (Arnett et al., 2004; Xin et al., 2005; Guo et al., 2010). Additionally, OLIG2 has been found to play several critical roles in oligodendrocyte differentiation including enhancing the expression of Sox10 and Sip 1, proteins that enhance oligodendrogial activity and maturation of NG2-OPCs ( Kuspert et al., 2011; Weng et al., 2012; Yu et al., 2013). However, OLIG2 also has been identified as a transcription repressor for several targets and consequently has been implicated in human glioma (Lee et al., 2005; Ligon et al., 2007; Mehta et al., 2011). "
    Full-text · Dataset · Apr 2015
Show more