BrpA Is Involved in Regulation of Cell Envelope Stress Responses in Streptococcus mutans

Department of Oral and Craniofacial Biology, School of Dentistry, Louisiana, USA.
Applied and Environmental Microbiology (Impact Factor: 3.67). 02/2012; 78(8):2914-22. DOI: 10.1128/AEM.07823-11
Source: PubMed
ABSTRACT
Previous studies have shown that BrpA plays a major role in acid and oxidative stress tolerance and biofilm formation by Streptococcus mutans. Mutant strains lacking BrpA also display increased autolysis and decreased viability, suggesting a role for BrpA in cell
envelope integrity. In this study, we examined the impact of BrpA deficiency on cell envelope stresses induced by envelope-active
antimicrobials. Compared to the wild-type strain UA159, the BrpA-deficient mutant (TW14D) was significantly more susceptible
to antimicrobial agents, especially lipid II inhibitors. Several genes involved in peptidoglycan synthesis were identified
by DNA microarray analysis as downregulated in TW14D. Luciferase reporter gene fusion assays also revealed that expression
of brpA is regulated in response to environmental conditions and stresses induced by exposure to subinhibitory concentrations of
cell envelope antimicrobials. In a Galleria mellonella (wax worm) model, BrpA deficiency was shown to diminish the virulence of S. mutans OMZ175, which, unlike S. mutans UA159, efficiently kills the worms. Collectively, these results suggest that BrpA plays a role in the regulation of cell
envelope integrity and that deficiency of BrpA adversely affects the fitness and diminishes the virulence of OMZ175, a highly
invasive strain of S. mutans.

Full-text

Available from: L. Jeannine Brady
BrpA Is Involved in Regulation of Cell Envelope Stress Responses in
Streptococcus mutans
J. P. Bitoun,
a
S. Liao,
a
X. Yao,
a
S.-J. Ahn,
b
R. Isoda,
b
A. H. Nguyen,
a
L. J. Brady,
b
R. A. Burne,
b
J. Abranches,
c
and Z. T. Wen
a,d
Department of Oral and Craniofacial Biology, School of Dentistry, Louisiana State University Health Sciences Center, New Orleans, Louisiana, USA
a
; Department of Oral
Biology, College of Dentistry, University of Florida, Gainesville, Florida, USA
b
; Center for Oral Biology, University of Rochester School of Medicine and Dentistry, Rochester,
New York, USA
c
; and Department of Microbiology, Immunology, and Parasitology, School of Medicine, Louisiana State University Health Sciences Center, New Orleans,
Louisiana, USA
d
Previous studies have shown that BrpA plays a major role in acid and oxidative stress tolerance and biofilm formation by Strep-
tococcus mutans. Mutant strains lacking BrpA also display increased autolysis and decreased viability, suggesting a role for BrpA
in cell envelope integrity. In this study, we examined the impact of BrpA deficiency on cell envelope stresses induced by enve-
lope-active antimicrobials. Compared to the wild-type strain UA159, the BrpA-deficient mutant (TW14D) was significantly more
susceptible to antimicrobial agents, especially lipid II inhibitors. Several genes involved in peptidoglycan synthesis were identi-
fied by DNA microarray analysis as downregulated in TW14D. Luciferase reporter gene fusion assays also revealed that expres-
sion of brpA is regulated in response to environmental conditions and stresses induced by exposure to subinhibitory concentra-
tions of cell envelope antimicrobials. In a Galleria mellonella (wax worm) model, BrpA deficiency was shown to diminish the
virulence of S. mutans OMZ175, which, unlike S. mutans UA159, efficiently kills the worms. Collectively, these results suggest
that BrpA plays a role in the regulation of cell envelope integrity and that deficiency of BrpA adversely affects the fitness and di-
minishes the virulence of OMZ175, a highly invasive strain of S. mutans.
T
he oral cavity is a dynamic environment in which frequent and
often rapid fluctuations in pH and the concentrations of anti-
microbial agents and other stressors occur. Dental care products,
such as toothpastes and mouth rinses, contain a variety of anti-
bacterial compounds, including hydrogen peroxide, sodium lau-
ryl sulfate, and chlorhexidine. Many bacteria in the highly com-
plex oral flora can produce hydrogen peroxide and antibacterial
peptides, better known as bacteriocins, allowing the producers to
ensure their presence in the community by killing competing or-
ganisms (24). To survive in the relatively hostile environment of
oral biofilms, bacteria must be able to sense, respond to, and cope
with these insults. The cell envelope plays a vital role during these
processes, as it protects the cell from the environment, maintains
cell shape, acts as a molecular sieve, and provides a platform for
components of the cell involved in sensing and transmission of
environmental signals. Ensuring envelope integrity is therefore
crucial for bacterial cells to survive.
Streptococcus mutans, a primary causative agent of human den-
tal caries, lives almost exclusively in biofilms on the tooth surface.
This bacterium is known for its ability to survive and adapt to
environmental insults, including mounting protective responses
in reaction to various stimuli (10, 28). Multiple pathways are uti-
lized by S. mutans to modulate its capacity to cope with stresses,
but certain two-component signal transduction systems (TCS),
including CiaHR, VicRK, and LiaSR, play integral roles in survival
and adaptation to low pH, reactive oxygen species (ROS), and cell
envelope stress induced by antimicrobial agents (5, 6, 11, 38, 40).
For example, mutants lacking LiaSR in S. mutans displayed in-
creased susceptibility to lipid II cycle-interfering antibiotics and
chemicals that perturb cell membrane integrity (40). In addition,
BrpA (for biofilm regulatory protein A) is involved in acid and
oxidative stress tolerance responses and biofilm development by
S. mutans (42, 43). Relative to the parent strain, S. mutans strains
lacking BrpA had a limited ability to grow and accumulate on a
surface and displayed enhanced sensitivity to low pH and hydro-
gen peroxide.
A predicted surface-associated protein, BrpA contains a region
homologous to the LytR-CpsA-Psr (LCP) domain of the LCP
family of proteins. The LCP family of proteins is widely distrib-
uted among Gram-positive bacteria, and its members are gener-
ally annotated as cell wall-associated transcriptional regulators
(17). Originally, the LytR protein of Bacillus subtilis was identified
as an autogenous transcriptional attenuator that also regulated the
promoter of the divergently transcribed lytABC operon, which
encodes a lipoprotein (LytA), an N-acetylmuramoyl-
L-alanine
amidase (autolysin, LytC), and a modifier protein of LytC (LytB)
(26). The LytR paralogue CpsA of Streptococcus agalactiae was
subsequently shown to function as a transcriptional activator of
the capsule operon (14, 16). Recently, LytR in Streptococcus pneu-
moniae was reported to be essential for normal septum formation
(20), with the mutant displaying variability in size and shape. The
lytR mutants were also found to form multiple asymmetrical
septa. Similar functions were also observed with MsrR, a Psr-like
protein in Staphylococcus aureus (36). A mutant lacking MsrR was
reported to have a 4-fold decrease in MIC against oxacillin and a
2-fold reduction in MIC against teicoplanin compared to those of
the parental strain.
Previously, we showed that BrpA deficiency in S. mutans causes
major defects in biofilm formation and acid and oxidative stress
Received 9 December 2011 Accepted 27 January 2012
Published ahead of print 10 February 2012
Address correspondence to Z. T. Wen, zwen@lsuhsc.edu.
Supplemental material for this article may be found at http://aem.asm.org/.
Copyright © 2012, American Society for Microbiology. All Rights Reserved.
doi:10.1128/AEM.07823-11
2914 aem.asm.org 0099-2240/12/$12.00 Applied and Environmental Microbiology p. 2914 –2922
Page 1
responses (42, 43). Relative to the parent strain, the deficient mu-
tant also had an increased rate of autolysis and a decreased viabil-
ity, suggesting compromise in cell envelope biogenesis/homeosta-
sis. In this study, we used reporter gene fusion and antibacterial
susceptibility assays to further characterize S. mutans strains lack-
ing BrpA. Results showed that S. mutans strains lacking BrpA were
more susceptible to cell envelope-targeting antimicrobials and
that cell envelope and environmental stresses enhanced the ex-
pression of BrpA. In addition, we show that BrpA is required for
optimal binding to salivary agglutinin. These results extend pre-
vious studies showing that BrpA plays a critical role in cell enve-
lope biogenesis and cell envelope stress responses in S. mutans.
MATERIALS AND METHODS
Plasmids, bacterial strains, cell lines, and growth conditions. Bacterial
strains and plasmids used in this study are listed in Table 1. S. mutans
strains were maintained on brain heart infusion (BHI) medium. For bio-
film formation, S. mutans was grown in modified biofilm medium (BM)
with glucose (18 mM) and sucrose (2 mM) as supplemental carbon and
energy sources (BMGS) (29, 42, 43). All solid media were prepared simi-
larly, with inclusion of Bacto agar (Difco Laboratories, Franklin Lakes,
NJ) at the level of 1.5% (wt/vol). When needed, erythromycin (10
g/ml),
kanamycin (1 mg/ml), and/or spectinomycin (1 mg/ml) was added. Un-
less otherwise stated, cells were grown at 37°C in an aerobic environment
with 5% CO
2
. All Escherichia coli strains were grown aerobically in Luria-
Bertani medium at 37°C with or without inclusion of kanamycin (40
g/ml), ampicillin (100
g/ml), spectinomycin (100
g/ml), and/or
erythromycin (300
g/ml). Human coronary artery endothelial cells
(HCAEC) were grown and maintained in endothelial cell basal medium 2
(EBM-2; Lonza) (2, 31).
DNA manipulation, transcriptional initiation site mapping, and
construction of reporter fusions. Standard recombinant DNA proce-
dures were used (12, 37). All restriction and modifying enzymes were
purchased from Invitrogen (Carlsbad, CA) or New England BioLabs (Ip-
swich, MA) and used as recommended by the suppliers. All primers (Ta-
ble 1) were synthesized by Integrated DNA Technologies, Inc. (Iowa City,
IA). RNA ligase-mediated rapid amplification of cDNA ends (RLM-
TABLE 1 Bacterial strains, plasmids, and primers used in the study
Strain, plasmid, or primer Major properties or DNA sequence(s) (5= to 3=)
a
Reference, source, or
application
Strains
S. mutans UA159 Wild type, serotype c
S. mutans OMZ175 Wild type, serotype f 2
S. mutans TW14 UA159 derivative, brpA deficient, erythromycin resistant 43
S. mutans TW14D UA159 derivative, brpA deficient, erythromycin resistant 42
S. mutans TW14K UA159 derivative, brpA deficient, kanamycin resistant This study
S. mutans TW230 OMZ175 derivative, brpA deficient, erythromycin resistant This study
E. coli DH10B Cloning host; mcrA mcrBC mrr hsd Invitrogen, Inc.
Plasmid
pFW5-luc Integration vector containing a promoterless luciferase gene and a spectinomycin
resistance marker
22
Primers
5= RACE Adapter GCUGAUGGCGAUGAAUGAACACUGCGUUUGCUGGCUUUGAUGAAA 5= RACE
5= RACE Outer GCTGATGGCGATGAATGAACACTG 5= RACE
5= RACE Inner CGCGGATCCGAACACTGCGTTTGCTGGCTTTGATG 5= RACE
RACE brpA Rev GTCAACTCCCATTAAGAGGATAC 5= RACE
brpA check Fw GTTTACCTTAGGAGGAAACTGA 5= RACE
brpA SP1 ACCTTTGGCAATTCCTTTTGTCA Sequencing
brpA SP2 AACTGACTTGACAGATAAAAACT Sequencing
PbrpA TTATGATGCTAGCAAGTCTCAAAGACA (forward), TCAGTTTCCTCCTCGAGTA
AACATC (reverse)
Promoter-reporter fusion
SMU.409-brpA AAGGCTGCCACTTTATCATTTGGATG (forward), AATCTTAATATCAAGCATAT
CCTGAA (reverse)
RT-PCR
brpA:erm AGCTCAGATAAGGCTGAGCTCCTA (forward), AAACCGTCTTTCATGCCCATGT
GCAT (reverse)
brpA:erm amplification
SMU.409P5 TACAGCTAACTCTTCTGCAACACCATC (forward), ATTCGATAGGGATCCAAAT
GATAAAGTG (reverse)
5= fragment for polar insertion
SMU.409P3 CACTTTATCATTTGGATCCCTATCGAAT (forward), ACGATACTTGCTGACACT
GTCTAAAGCT (reverse)
3= fragment for polar insertion
SMU.246 TCCTTCTTATGATTGGTGTT (forward), CTACTACTTCTTGACGGTAAT (reverse) SMU.246 fragment, 135 bp
SMU.549 GCAGTCTCTTACGATTATGG (forward), GCTACAACAGGAGGAACT (reverse) SMU.549 fragment, 84 bp
SMU.599 GTGCGACTACTATTCCTCAA (forward), TCTTCAACTTCTGCCAACT (reverse) SMU.599 fragment, 82 bp
SMU.1677 CTCATTATGGAAGTCTCAA (forward), AAGTAGGATGTTCAATCG (reverse) SMU.1677 fragment, 121 bp
SecA GTGCTTCCATTACCTATCA (forward), ATTCCTCTTCTTCTGTCTTC (reverse) secA fragment, 87 bp
SecY CAGGAAGTGTGGTTGTAA (forward), GCTTGAACGGATATTGAC (reverse) secY fragment, 155 bp
BrpA CGTGAGGTCATCAGCAAGGTC (forward), CGCTGTACCCCAAAAGTTTAGG
(reverse)
brpA fragment, 148 bp
a
Nucleotides underlined are restriction sites engineered for cloning.
Cell Envelope Stress Response in Streptococcus mutans
April 2012 Volume 78 Number 8 aem.asm.org 2915
Page 2
RACE) (Ambion, Inc., Foster City, CA) was used to map the transcription
initiation site (TIS) of brpA. Briefly, total RNA was prepared from early-
(optical density at 600 nm [OD
600
] 0.2) and late-exponential-phase
(OD
600
0.8) cultures grown in BHI using hot phenol (1, 42). The prep
-
arations were then treated with RNase-free DNase I (Ambion, Inc.), and
RNA was retrieved using the Qiagen RNeasy purification kit (Qiagen, Inc.,
Valencia, CA). For cDNA synthesis, total RNA was treated with calf intes-
tinal phosphatase and with tobacco acid pyrophosphatase by following
the supplier’s recommendations and then ligated to the supplied 5= RACE
adapter. cDNA was synthesized using iScript reverse transcriptase III (In-
vitrogen) and followed by a nested PCR using either the 5= RACE outer
primer or the 5= RACE inner primer (Ambion, Inc.) and a brpA-specific
reverse primer. The transcription initiation site (TIS) was determined by
sequencing the resulting PCR amplicon.
To analyze the regulation of brpA expression, a promoterless luciferase
gene (luc) was used as a reporter (23, 35). Briefly, the cognate brpA pro-
moter region was amplified by PCR with primers PbrpA forward and
PbrpA reverse. Following proper restriction digestions, the amplicon was
cloned directly in front of the promoterless luc gene in the integration
vector pFW11-luc (22), which also contains a Shine-Dalgarno sequence
optimized for group A streptococci (35). Following confirmation of the
correct sequence of the cloned element, the resulting construct, pFW11::
pbrpA::luc, was introduced into S. mutans UA159 and TW14D and main-
tained on BHI agar containing 1 mg/ml spectinomycin. The expression of
BrpA under different environmental conditions and cell envelope stres-
sors was analyzed using a luciferase assay by following the protocol of
Podbielski et al. (22, 35).
DNA microarray and real-time PCR analysis. For DNA microarray
analysis, total RNAs were extracted from early-exponential-phase
(OD
600
0.3) cultures, treated with DNase I (Ambion, Inc.) to remove all
DNA, and then retrieved with the RNeasy purification kit (Qiagen, Inc.)
(42). Array analysis was performed by using the whole-genome S. mutans
microarrays (version 2) that were obtained from The J. Craig Venter In-
stitute (JCVI; http://pfgrc.jcvi.org) by following the protocols recom-
mended by JCVI as described elsewhere (1, 42). Expression levels of se-
lected genes identified by DNA microarray analysis were confirmed by
real-time PCR procedures detailed elsewhere (Table 1) (5, 42).
Cell envelope antimicrobial susceptibility assays. The susceptibility
of S. mutans strains to antimicrobial agents was analyzed using microtiter
plate-based assays as described previously (30, 40). Cell envelope antimi-
crobial agents tested included the antibiotics vancomycin (Sigma, St.
Louis, MO), bacitracin (Sigma), and the
-lactam antibiotic penicillin G
(Sigma), the bacteriocin nisin (Sigma), and the cell envelope active com-
pounds sodium dodecyl sulfate (SDS) and chlorhexidine (Sigma). Briefly,
100
l of properly diluted mid-exponential-phase cultures was added to
96-well plates containing BHI medium supplemented with 2-fold serial
dilutions of the cell envelope antimicrobial agents. After 48 h, bacterial
growth was measured spectrophotometrically using a Synergy 2 plate
reader (BioTek, Inc.), and relative cell density percentages ([OD
490
of
cultures with antimicrobial agents/OD
490
of the untreated cultures]
100) were calculated. The MIC was defined as the lowest concentration at
which the cultures did not grow to over 10% of the relative cell density.
Minimal bactericidal concentration (MBC) assays were carried out using
the MIC test plates. The MBC was determined as the lowest concentration
for which fewer than 5 CFU were observed after 48 h when 20
lofthe
cultures was plated on nonselective medium.
Biofilm formation and BIAcore assays. Biofilm formation on 96-well
plates precoated with salivary agglutinin was carried out as previously
described (4, 42, 43). Interactions of S. mutans whole cells with salivary
agglutinin were analyzed using BIAcore assays in which the receptor was
immobilized on Pioneer F1 sensor chips (32).
Preparation of protein fractions and Western blot analysis. Various
fractions of proteins were prepared from BHI-grown early-exponen-
tial-phase (OD
600
0.3) cultures of S. mutans (3, 41, 45). Briefly,
whole-cell lysates were obtained by glass bead beating in SDS boiling
buffer (60 mM Tris [pH 6.8], 10% glycerol, and 5% SDS). For surface-
associated fractions, cells from 500-ml cultures were suspended in 25
ml of 0.2% N-dodecyl- N,N-dimethyl-3-ammonio-1-propanesulfon-
ate (Zwittergent; Sigma) and incubated at 28°C with shaking at 80 rpm
for 1 h. Following centrifugation, the supernatants were further con-
centrated using Amicon Ultra centrifugal filters (Millipore, Billerica,
MA). In other cases, bacterial cells were suspended in 4% SDS and
incubated at room temperature for 30 min. For cell-free fractions,
cultural supernatants were precipitated by ammonium sulfate. For
Western blot analysis, proteins (10
g total) were separated using
7.5% SDS-PAGE, blotted onto Immobilon-FL membranes, and then
probed with anti-P1 monoclonal antibodies (8, 41).
Bacterial invasion assay. The impact of BrpA deficiency on the ability
of S. mutans to invade host tissues was analyzed using primary human
coronary artery endothelial cells as described elsewhere (2, 31). Briefly,
overnight cultures were harvested by centrifugation at 14,000 g for 5
min, and pellets were washed twice with phosphate-buffered saline (pH
7.2) and resuspended in endothelial cell basal medium 2 (EBM-2; Lonza).
Aliquots (1 ml) of bacterial cells (with 5 10
7
CFU/ml) were mixed
with HCAEC monolayers in 24-well plates for 2 hours. Following proper
washes and additional incubation with gentamicin and penicillin G to
eliminate extracellular bacterial cells, HCAE cells were lysed by osmotic
shock, and serial dilutions of the lysates and bacterial cells released were
plated on BHI agar in triplicate. The percentage of intracellular bacteria
relative to the initial inoculum was calculated.
Wax worm infection model. Galleria mellonella killing assays were
performed by following the procedures described previously (21). Briefly,
groups of 20 larvae, ranging from 200 to 300 mg in weight and with no
signs of melanization, were randomly assigned. A 5-
l aliquot of properly
diluted mid-exponential-phase (OD
600
0.5) cultures of wild-type S.
mutans or the BrpA-deficient mutant was injected into the hemocoel us-
ing a 10-
l Hamilton syringe (Hamilton Co., Reno, NV). Groups receiv-
ing heat-inactivated (10 min at 75°C) wild-type S. mutans or saline were
used as controls. After injection, larvae were incubated at 37°C, and ap-
pearance (signs of melanization) and survival were recorded at selected
intervals. Kaplan-Meier killing curves were plotted, and estimates of dif-
ferences in survival were compared using a log rank test. A P value of
0.05 was considered significant. All data were analyzed with GraphPad
Prism, version 4.0.
Microarray data accession number. Microarray data have been de-
posited in NCBI (accession number GSE35349).
RESULTS
BrpA deficiency affects binding to immobilized salivary agglu-
tinin. Binding to salivary agglutinin and other glycoproteins, pri-
marily through the multifunctional adhesin P1 (also called anti-
gen I/II, PAc, or SpaP), is considered to be a major mechanism
used by S. mutans to colonize the tooth surface (15, 19, 25, 27). On
96-well plates precoated with whole saliva and purified salivary
agglutinin (4), wild-type S. mutans UA159 formed robust biofilms
after 24 h, consistent with previous findings (4). Relative to
UA159, however, biofilm accumulation by the BrpA-deficient
mutant TW14D was significantly lower (P 0.05) (Fig. 1A). We
also used BIAcore assays to analyze the impact of BrpA deficiency
on P1-mediated adherence and biofilm formation. Affinity-puri-
fied, high-molecular-weight salivary glycoprotein agglutinin was
immobilized on a Pioneer F1 sensor chip, and interaction of S.
mutans with immobilized agglutinin was measured by BIAcore, a
proven technique for assessment of salivary-agglutinin-mediated
adherence (32). Compared to the wild type, the capacity of sali-
vary-agglutinin-mediated whole-cell-receptor interactions in the
mutant lacking BrpA was decreased by more than 57%, with the
average resonance signal at 938.95 (102.45) resonance units
Bitoun et al.
2916 aem.asm.org Applied and Environmental Microbiology
Page 3
(RU) for the wild-type UA159 strain and 413.6 (186.7) RU for
the mutant TW14D strain (P 0.01) (Fig. 1B).
Western blot analysis was then carried out to further examine
the levels of P1 in whole-cell lysates, cell-free fractions, and sur-
face-associated fractions from UA159 and TW14D using mono-
clonal antibodies (MAbs) against P1 as probes (3, 8, 41, 45). When
probed with MAb 6-8C, which reacts to the C terminus of P1 (8),
a single band with a molecular mass of around 200 kDa was ap-
parent in the surface-associated fractions of both UA159 and
TW14D (Fig. 2A). In comparison, however, the density of this
reactive band in TW14D was over 2-fold higher than that of the
one in UA159. A similar band was also detected in the whole-cell
lysate of TW14D but was not detectable in UA159. When probed
with MAb 4-10A, which recognizes the A-P stalk, one major band
with a molecular mass of around 200 kDa was apparent in both
TW14 and UA159 (Fig. 2B), with the density of the band in
TW14D being more than 4-fold higher than that of the band
found in UA159. Besides these, multiple bands with molecular
masses of around 150 kDa were apparent in the whole-cell lysates,
but again these bands were more than 9-fold denser in TW14D
than those in UA159. With MAb 3-8D, which recognizes the A
region of the P1, used as a probe, multiple bands with similar
molecular masses of around 100 kDa were identified in the whole-
cell lysates of both UA159 and TW14D (Fig. 2C). In a comparison,
the densities of these bands were about 6-fold higher in the mutant
than in the wild type. Multiple bands reactive to MAb 3-8D were
also seen in the surface-associated fractions, but unlike those from
the whole-cell lysates, these bands were mostly around 75 kDa.
BrpA-deficient mutants are more sensitive to cell envelope-
active antimicrobials. Previously, it was shown that BrpA defi-
ciency in S. mutans caused elevations in autolysis and reductions
in viability, with more dead cells and cell debris in biofilms in the
mutant than in the wild-type strain (13, 42). To analyze whether
BrpA in S. mutans affects cell envelope integrity, the MIC and
MBC against several cell envelope antibacterial agents were mea-
sured using microtiter plate-based assays. As shown in Table 2, the
BrpA-deficient mutant had a decreased ability to survive the treat-
ment of several different antimicrobial agents compared to that of
the wild-type strain under the same conditions. TW14D had 1.8-
and 2-fold reductions in MICs to nisin and bacitracin, respec-
tively, compared to those of the wild type. Similar trends were also
detected with vancomycin, penicillin G,
D-cycloserine, SDS, and
triclosan, although the differences between these two strains were
not statistically significant. When MBCs were analyzed, the defi-
cient mutant had 1.5-fold reductions in sensitivity to nisin,
FIG 1 Biofilm formation (A) and BIAcore assays (B). (A) S. mutans UA159 and TW14D were grown on 96-well plates that were precoated with unstimulated
whole saliva (WS) or affinity-purified salivary agglutinin (AG). Data show the average densities ( standard deviations [error bars]) of 24-hour biofilms from
more than three independent sets of experiments, with an asterisk indicating a significant difference between UA159 and TW14D under the conditions specified
(P 0.05). (B) P1-mediated S. mutans whole-cell interactions with salivary agglutinin were measured using BIAcore assays. Salivary agglutinin was immobilized
on an F1 chip surface. S. mutans UA159 and the BrpA-deficient mutant TW14D were injected for 60 s. S. mutans UA159 yielded an average resonance signal of
938.95 resonance units (RU), while TW14D had an average resonance signal of 413.6 RU. Results indicate that BrpA deficiency affects P1-mediated whole-cell
adhesin-receptor interactions. The panel shows representatives of two independent experiments.
FIG 2 Western blot (A to C) and SDS-PAGE (D) analysis of P1 in wild-type S.
mutans UA159 (lanes 1 and 3) and the BrpA-deficient mutant TW14D (lanes
2 and 4). Proteins (10
g total) of whole-cell lysates (lanes 1 and 2) and surface-
associated fractions (lanes 3 and 4) were separated using 7.5% SDS-PAGE (D),
blotted onto a polyvinylidene fluoride (PVDF) nitrocellulose membrane, and
then probed with anti-P1 monoclonal antibodies (MAbs). Panel A shows re-
sults when probed with MAb 6-8C, which recognizes the C terminus of P1. A
single band with a molecular mass of around 200 kDa was apparent, and the
density of this band in TW14D was more than 2-fold higher than that of the
one in UA159. Panels B and C show results when probed with MAb 4-10A and
MAB 3-8D, which recognize the A-P stalk and the alanine-rich region of P1,
respectively, but both are shown to react to truncated peptides (8). Multiple
bands with molecular masses of around 150 (B) and 100 (C) kDa were identi-
fied in both UA159 and TW14D, but the densities of these bands were signif-
icantly higher in TW14D than in UA159. M, molecular weight markers.
Cell Envelope Stress Response in Streptococcus mutans
April 2012 Volume 78 Number 8 aem.asm.org 2917
Page 4
chlorhexidine, and SDS compared to those of the wild type. Slight,
but not statistically significant, decreases were also seen with bac-
itracin, vancomycin, and triclosan.
BrpA deficiency affects virulence in a Galleria mellonella
model. Recent studies have shown that certain strains of S. mu-
tans, such as OMZ175 (serotype f), are highly invasive and conse-
quently may play a significant role in development of certain sys-
temic diseases, such as infective endocarditis (2, 31). In contrast,
UA159, a commonly used laboratory strain, possesses only limited
capacity to invade endothelial cell lines (2). To create a BrpA-
deficient mutant of OMZ175, PCRs were conducted with genomic
DNA from TW14D as the template (Table 1) (42). The resulting
amplicon, containing DNA fragments flanking brpA and an eryth-
romycin resistance element (Erm
r
), was used to replace the brpA-
coding sequence in S. mutans OMZ175, and mutants were se-
lected on BHI with erythromycin and further confirmed by DNA
sequencing. When analyzed by invasion assays using human cor-
onary artery endothelial cells (HCAEC) (2), the BrpA-deficient
mutant TW230 had a slightly reduced invasion efficiency com-
pared to that of OMZ175, with average invasion rates of 0.18% for
TW230 and 0.49% for OMZ175 (P 0.089). When tested in the
G. mellonella (wax worm) virulence model (21), the survival rate
of worms receiving the BrpA-deficient mutants was significantly
(P 0.01) higher than that of those receiving strain OMZ175 (Fig.
3). Not surprisingly, considering the poor virulence of strain
UA159 in this model, no major differences (P 0.05) were ob-
served when TW14D and UA159 were compared in the wax
worms (data not shown).
brpA is cotranscribed with SMU.409. The brpA gene
(SMU.410) in S. mutans is flanked by downstream SMU.411
and upstream SMU.409 (Fig. 4), which encode a streptococcus-
specific hypothetical protein and a putative bacterial ATPase/
GTPase (www.oralgen.lanl.gov), respectively. The open read-
ing frames in SMU.409 and brpA are arranged in the same
orientation, while SMU.411 and brpA are transcribed in oppo-
site directions. To map the promoter region of brpA, the TIS
was examined using 5= RACE with total RNA extracted from
BHI-grown cultures. Results of the 5= RACE PCR showed that
multiple brpA transcripts existed (data not shown). Sequence
analysis of the major cDNA product revealed that the major
TIS of brpA was 774 bp upstream of the translational start
codon ATG (Fig. 4), suggesting that SMU.409 and brpA are
cotranscribed under the conditions studied. Reverse transcrip-
tion-PCR (RT-PCR) with total RNA extracted from BHI-
grown planktonic cultures and 3-day-old biofilms grown on
BMGS confirmed that brpA was cotranscribed with the up-
stream gene SMU.409 (Fig. 5A) under both of the conditions
tested. Insertion of a polar kanamycin resistance element,
Km (34), at SMU.409 also caused a reduction in brpA tran-
scription of more than 25-fold, as shown by real-time PCR with
total RNA preparations of early-exponential-phase (OD
600
0.25) cultures of the insertional mutant and its parent strain
UA159 (data not shown). Similar results were also obtained
with Western blot analysis (data not shown).
Expression of BrpA is regulated in response to environmen-
tal conditions. In cultures grown in BHI broth, luciferase expres-
sion from the full brpA promoter (a 1,119-bp fragment) was mea-
sured at its maximum during early exponential phase (OD
600
0.3) (Fig. 5B), consistent with our earlier study with Northern
blotting (44). Considering the fact that mutants lacking BrpA had
significant defects in their abilities to survive low pH and hydro-
gen peroxide challenge (42), cells of early-exponential-phase cul-
tures carrying the reporter fusion were treated with hydrogen per-
oxide and methyl viologen (Paraquat; Sigma) in the growth
medium for 90 min. Results showed that, relative to the untreated
controls, the level of luciferase activity in cells treated with hydro-
gen peroxide and methyl viologen was increased significantly (Ta-
ble 3). Such increases appeared to be concentration dependent
when the amount used was within a certain threshold (see Fig. S1
in the supplemental material). However, beyond the threshold,
luciferase activity was decreased when more hydrogen peroxide
and methyl viologen were used. Similar results were also obtained
TABLE 2 Effect of BrpA deficiency on susceptibility to cell envelope antimicrobials
a
Strain
MIC and MBC (
g/ml) for each antimicrobial
Lipid II inhibitors Non-lipid II inhibitors Cell membrane-disrupting agents
Van Nis Bac Pen
D-Cyc Chl SDS Tri
MIC MBC MIC MBC MIC MBC MIC MBC MIC MBC MIC MBC MIC MBC MIC MBC
UA159 0.75 1.25 17.5 27.5 100 1,600 0.04 0.075 300 11,000 1.5 6 40 60 60 75
TW14D 0.50 1 10
b
15
b
50
c
1,400 0.03 0.075 250 11,000 1.5 3
c
30 40
b
50 70
a
Van, vancomycin; Nis, nisin; Bac, bacitracin; Pen, penicillin G; D-Cyc, D-Cycloserine; Chl, chlorhexidine; SDS, sodium dodecyl sulfate; Tri, triclosan.
b
Reduction in MIC and/or MBC of more than 1.5-fold compared to UA159.
c
Reduction in MIC and/or MBC of more than 2-fold compared to UA159.
FIG 3 Killing of G. mellonella larvae infected with wild-type S. mutans and the
corresponding BrpA-deficient mutants at 37°C. Survival (Kaplan-Meier) plots
of S. mutans OMZ175 (solid squares) and the BrpA-deficient mutant TW230
(open circles), injected at 1 10
7
CFU/larva, are shown. There was no killing
of larvae injected with saline and minimum killing of larvae injected with
heat-killed S. mutans UA159 cells (data not shown). The experiments were
repeated three times, and the data presented here are results representative of
a typical experiment. Compared to the wild-type parent strain, OMZ175, the
BrpA-deficient mutant TW230 showed attenuated virulence (P 0.01). No
significant differences were measured between UA159 and TW14D (data not
shown).
Bitoun et al.
2918 aem.asm.org Applied and Environmental Microbiology
Page 5
with cells treated with various cell envelope antimicrobials at sub-
inhibitory concentrations (Tables 2 and 3), with the most signifi-
cant impact measured with chlorhexidine, a chemical commonly
used in dental care products and in prevention of tooth decay.
Efforts were also made to evaluate the impact of pH on BrpA
expression by incubating the cells carrying the reporter fusion in
BHI broth adjusted to different pH values, but the results were
inconclusive, probably due to the impact of low pH on the lucif-
erase enzyme (data not shown). To circumvent this problem, a
study is under way using chloramphenicol acetyltransferase as a
reporter under controlled conditions in a chemostat.
BrpA deficiency causes substantial alterations in the tran-
scriptional profiles of the deficient mutant. In consideration of
the fact that BrpA expression is at its maximum during early ex-
ponential phase, as shown by Northern blotting (44) and reporter
gene fusion assays, we carried out another DNA microarray anal-
FIG 4 Schematic diagram of the brpA-flanking region (A) and analysis of the brpA promoter region (B). Panel A shows the genetic organization of the regions flanking
brpA, with locus name and size labeled under and above the arrows, respectively. Approximate positions of the primers used for RT-PCR are shown with solid arrows
above SMU.409 and under brpA. Panel B highlights the promoter region of brpA, which includes the coding sequence of SMU.409, with the translation initiation sites
indicated by arrows above the start codons of SMU.409 and brpA, respectively. As determined by 5= RACE, the transcription initiation site (TIS, underlined) of brpA was
774 bp upstream of its translation start site, which overlaps the translation start site of SMU.409 as annotated by NCBI (www.oralgen.lanl.gov). Computer-based analysis
using BPROM, a bacterial sigma70 promoter recognition program, revealed two sets of putative 35 and 10 sites (boxed) and binding sites for putative transcriptional
regulators (underlined). Further analysis using Virtual Footprint, a program especially designed to analyze transcription factor binding sites, also identified sequences
with high similarity to binding sites for transcriptional factors GltC, TnrA, and Fnr (underlined).
FIG 5 RT-PCR analysis (A) and luciferase activity assays (B). (A) RT-PCR analysis was carried out using total RNA isolated from mid-exponential-phase
(OD
600
0.5) cultures. Lanes M, 1, 2, and 3 contain DNA markers, RT-PCR products, controls with no reverse transcriptase, and PCR products with genomic
DNA as the template, respectively. Similar results were obtained with total RNA extracted from 3-day-old biofilms (data not shown). (B) For the reporter gene
fusion study, the full-length brpA promoter region was cloned in front of a promoterless firefly luciferase gene, and the resulting promoter-reporter fusion was
integrated into the S. mutans genome. Cells carrying the reporter fusion were collected at different times during growth and assayed for luciferase activity by
mixing 200
l of whole cells with 50
lof1mMD-luciferin (pH 6.0). Data show reporter luciferase activity (open squares) in relative light units (RLU) calibrated
with the optical density (OD
600
) of the cultures (solid circles) at each time point.
Cell Envelope Stress Response in Streptococcus mutans
April 2012 Volume 78 Number 8 aem.asm.org 2919
Page 6
ysis using total RNA from early-exponential-phase cultures
(OD
600
0.3). It was found that 92 genes were upregulated and 90
downregulated by a factor of at least 1.5-fold in TW14D (P
0.001) (see Tables S1 and S2 in the supplemental material). At a P
level of 0.01, 176 additional genes were found to be differentially
expressed in TW14D, with 77 genes upregulated and 90 down-
regulated (data not shown). Based on the descriptions and puta-
tive functions of the genes identified at the significance level of a P
value of 0.001, BrpA deficiency affects almost every aspect of
cellular physiology as well as virulence properties, including
amino acid biosynthesis (10), carbohydrates and energy metabo-
lism (18), nucleic acids and DNA metabolism (10), transcrip-
tional regulation (9), ABC transporters (29), molecular chaper-
ones and other cellular processes (13), and hypothetical and
conserved hypothetical proteins (50). The breadth of impact of
BrpA deficiency on the transcriptional profile of the deficient mu-
tant is similar to what was observed previously with mid-expo-
nential-phase cells (42). However, comparison of the two tran-
scriptional profiles revealed that only a small number of genes,
which include recA (for recombinant protein RecA), gtfD (for glu-
cosyltransferase D), wapA (for surface-associated protein WapA),
groEL (for molecular chaperone GroEL), and sod (for Mn-depen-
dent superoxide dismutase [SOD]), were consistently up- or
downregulated in both early- and mid-exponential-phase cul-
tures (see Tables S1 and S2 in the supplemental material) (42). In
addition, the magnitude of alterations in gene expression was
more dramatic in cells of the early exponential phase than in the
mid-exponential-phase cultures.
DISCUSSION
The cell envelope is of essential importance for growth, cell divi-
sion, interaction with the environment, and antimicrobial resis-
tance. Previous studies have shown that BrpA, a paralogue of the
LCP family of cell wall-associated transcriptional attenuators,
strongly influences S. mutans biofilm formation and survival
against low pH and reactive oxygen species (42, 43). Strains lack-
ing BrpA also displayed increased autolysis rates and decreased
viability, suggesting a role for BrpA in regulation of cell envelope
biogenesis or homeostasis (13, 42, 43). In this study, BrpA defi-
ciency was shown to significantly weaken the ability of S. mutans
to survive cell envelope stresses induced by cell envelope-targeting
antimicrobials (Table 2). Among the antimicrobial agents tested,
the most significant influences on MIC were measured with nisin
and bacitracin, two antibiotics that interfere with lipid II cycling,
blocking peptidoglycan and cell wall biosynthesis (9). The most
significant impacts on MBC were seen with chlorhexidine and
SDS, two chemicals commonly used in oral health care prod-
ucts that compromise membrane integrity. These results pro-
vide further support for a role for BrpA in regulation of cell
envelope biogenesis or maintenance by S. mutans, consistent
with the roles of certain LCP paralogues in other bacterial spe-
cies (18, 20, 33, 36, 39).
The bacterial cell wall is a repeating, three-dimensional poly-
mer known as peptidoglycan or murein that consists of a linear,
alternating N-acetylmuramic acid (MurNAc) and N-acetyl-
glucosamine (GlcNAc) motif, cross-linked via peptides appended
to MurNAc. Of the genes altered as a result of BrpA deficiency in
TW14D, several were found to encode proteins with potential
roles in peptidoglycan biosynthesis (Table 4). Among them are
SMU.246 for a phospho-MurNAc-pentapeptide transferase
(RgpG), SMU.549 for an undecaprenyl-PP-MurNAc-pentapep-
tide-UDP-GlcNAc transferase (MurG), SMU.599 for a
D-alanine-
D-alanine ligase (DdlA), and SMU.1677 for a UDP-MurNAc-tri-
peptide synthetase (MurE). While the exact role of these gene
products in S. mutans cellular physiology awaits further investiga-
tion, downregulation of genes involved in peptidoglycan synthesis
would have an impact on cell envelope biogenesis, likely leading to
TABLE 3 Luciferase expression in response to oxidative stress and cell
envelope-active antimicrobial agents
Stimulus or stressor (concn) Luciferase activity ratio (RLU)
a
Hydrogen peroxide (0.4 mM) 2.09 0.33
d
Methyl viologen (10 mM) 2.07 0.55
c
SDS (8
g/ml) 2.51 0.50
d
Chlorhexidine (1.5
g/ml) 3.03 0.42
d
Vancomycin (0.75
g/ml) 1.41 0.03
b
Bacitracin (20
g/ml) 2.24 0.13
b
Nisin (10
g/ml) 2.25 0.47
c
D-Cycloserine (20
g/ml) 1.62 0.31
c
Penicillin G (0.04
g/ml) 1.66 0.35
b
a
Data are the ratios (average standard deviation) of the luciferase activity (in RLU)
at the conditions specified to that of controls that received an equal amount of solvent
instead of the stressor indicated.
b
Difference between the groups at the significance level of P 0.05.
c
Difference between the groups at the significance level of P 0.01.
d
Difference between the groups at the significance level of P 0.001.
TABLE 4 Selected genes identified by DNA microarray analysis
Unique ID
a
Description/putative function
b
Array ratio
c
qPCR ratio
c
P value
SMU.246 Glycosyltransferase N-acetylglucosaminyltransferase, RgpG 2.6 4.0 5.9E-3
SMU.549 Undecaprenyl-PP-MurNAc-pentapeptide-UDPGlcNAc GlcNAc transferase, MurG 2.7 2.0 3.6E-3
SMU.599 D-Alanine-D-alanine ligase, DdlA 1.8 3.2 7.1E-3
SMU.1677 UDP-N-acetylmuramoylananine-D-glutamate-2,6-diaminopimelate ligase, UDP-
MurNac-tripeptide synthetase, MurE
13.1 2.7 3.6E-3
SMU.1689 D-Alanyl carrier protein, DltC 3.4 ND 6.9E-3
SMU.1691 D-Alanine-D-alanyl carrier protein ligase, DltA 3.4 ND 3.7E-5
SMU.1838 Preprotein translocase subunit SecA 1.9 2.0 6.6E-3
SMU.1948 Preprotein translocase subunit SecE 2.8 ND 2.1E-3
SMU.2006 Preprotein translocase SecY protein 3.9 1.9 1.6E-5
a
ID, identification.
b
Descriptions and putative functions of the identified genes are based upon the published S. mutans database.
c
Levels of expression in the BrpA-deficient mutant relative to those of the wild type, as shown by DNA microarray analysis (array ratio) and real-time PCR (quantitative PCR
[qPCR]), with negative numbers indicating downregulation. ND, not done.
Bitoun et al.
2920 aem.asm.org Applied and Environmental Microbiology
Page 7
defects in wall integrity. Such a defect would be consistent with the
weakened resistance to cell envelope antimicrobials, reduced via-
bility, and increased autolysis observed for BrpA-deficient mu-
tants (13, 43). In support of a role in cell envelope biogenesis, the
expression of a luciferase reporter fusion under the direction of a
brpA promoter was also upregulated in response to cell envelope
stresses induced by exposure to subinhibitory concentrations of
antimicrobial agents that target the cell envelope (Table 3). De-
fects in cell envelope integrity would likely result in vulnerability
of the bacterial cells to environmental insults and therefore can
partly explain the weakened acid and oxidative stress responses of
the BrpA-deficient mutants (42).
P1, a cell wall-anchored adhesin, is considered a key contribu-
tor to S. mutans colonization of the tooth surface (7, 15). P1 me-
diates the adherence through interactions with high-molecular-
weight salivary agglutinin in the enamel pellicle. Both biofilm
formation assays and BIAcore analysis showed that BrpA affects
the ability of S. mutans to interact with salivary agglutinin (Fig. 1).
As shown by Western blotting, however, the level of P1 expression
was increased by more than 2-fold as a result of BrpA deficiency
(Fig. 2A). When analyzed by DNA microarrays, several genes en-
coding components of the Sec translocase were also found altered
in TW14D. These included secA, secE, and secY, encoding the
ATP-dependent motor of the translocation machinery, SecA, and
the translocon pore components SecE and SecY, respectively.
Both secA and secE were downregulated by more than 2-fold, while
secY was upregulated by more than 2-fold (Table 4). The Sec se-
cretion system participates in translocation of polypeptides
across, or integration into, the cytoplasmic membrane (46). Alter-
ation in expression of individual members of the Sec translocon
complex, as well as global defects in cell envelope integrity, will
likely influence the function of the translocation/secretion ma-
chinery. As a result of altered Sec function, the P1 adhesin may be
compromised in conformation, stability, and/or distribution on
the surface. Therefore, the increased expression could be a com-
pensatory response to such a compromise, but the underlying
mechanism awaits further investigation. In addition, the dispro-
portional increases in density of the lower-molecular-mass bands
in TW14D that were reactive to MAbs 3-8D and 4-10A, which are
shown to recognize truncated peptides (8), suggest that the stabil-
ity of P1 may be reduced in the brpA mutant (Fig. 2B and C).
Therefore, decreased stability and/or misfolding of P1 may under-
lie the reduced binding to salivary agglutinin by strain TW14D.
These in vitro results also suggest that BrpA deficiency may affect
bacterial adherence and biofilm initiation by S. mutans in the oral
cavity as well.
Previously, Northern blotting showed that transcription of
brpA was maximal during early exponential phase (OD
600
0.3)
and that deficiency of LuxS dramatically decreased brpA tran-
scription, indicating that expression of brpA is regulated in re-
sponse to environmental conditions and by LuxS-mediated quo-
rum sensing (44). In this study, we used luciferase reporter gene
fusion assays to show that the expression of BrpA is strongly de-
pendent on growth phase, with maximal activity measured during
early exponential phase (Fig. 5B). These results again suggest that
environmental conditions and cell density play an important role
in the regulation of BrpA expression. Differences in environmen-
tal conditions, such as pH and concentration of ROS, and cell
density may, in part, account for some of the discrepancies ob-
served between the two transcriptional profiles for the early- and
mid-exponential-phase cultures (see Tables S1 and S2 in the sup-
plemental material) (42). However, whether BrpA affects different
group of genes in response to environmental stimuli awaits fur-
ther investigation.
Both 5= RACE and RT-PCR showed that under the conditions
studied, the major transcript was a product of cotranscription of
brpA with its upstream locus SMU.409 (Fig. 4 and 5). Consis-
tently, both real-time PCR and Western blot analysis (data not
shown) showed that a polar insertion at SMU.409 resulted in a
dramatic reduction of BrpA expression. However, we have previ-
ously shown that possession in trans of the brpA-coding sequence
plus a 344-bp fragment upstream of its start codon was able to
partially complement the deficient mutant TW14 in an acid toler-
ance response (42). The luciferase reporter fusion with a fragment
of 683 bp upstream of brpA also showed promoter activity in this
intergenic region, although it is much weaker than the full-length
(1,119-bp) promoter (data not shown). Computer-based analysis
of this intergenic region using BPROM, a bacterial sigma70 pro-
moter recognition program, and Virtual Footprint, a program
especially designed to analyze transcription factor binding sites,
also revealed putative 10 (TATAAc) and 35 (TTGAgA) sites
and regions with high similarity to binding sites for several puta-
tive transcriptional regulators (Fig. 4). These results further sug-
gest that transcription of brpA may be initiated at different sites
under different environmental conditions. A study is under way to
dissect the underlying mechanisms, including the cis- and trans-
acting elements involved in regulation of brpA expression.
SMU.409 encodes a putative ATPase/GTPase. While the exact role
of SMU.409 in regulation of S. mutans cellular physiology and
brpA expression is still under investigation, the close association of
this gene with brpA suggests its likely involvement in BrpA-regu-
lated cell envelope biogenesis/homeostasis.
In summary, the results presented here further support that S.
mutans BrpA is involved in the regulation of cell envelope biogen-
esis/maintenance and that deficiency of BrpA affects the fitness of
the deficient mutants and decreases the virulence of OMZ175, a
highly invasive strain in a wax worm model. Current efforts are
directed to further investigation of the underlying mechanisms.
ACKNOWLEDGMENTS
This work was supported by NIDCR grant DE19452 to Z.T.W. and in part
by the South Louisiana Institute of Infectious Disease Research.
We thank Fengxia (Felicia) Qi at the University of Oklahoma Health
Sciences Center for her kind gift of the integration vector pFW11-luc and
James H. Miller for his assistance with invasion and wax worm infection
assays.
REFERENCES
1. Abranches J, Candella M, Wen TZ, Baker HV, Burne RA. 2006. Differ-
ent roles of EIIAB
Man
and EII
Glc
in the regulation of energy metabolism,
biofilm development, and competence in Streptococcus mutans. J. Bacte-
riol. 188:3748 –3756.
2. Abranches J, et al. 2009. Invasion of human coronary artery endothelial
cells by Streptococcus mutans OMZ175. Oral Microbiol. Immunol. 24:
141–145.
3. Ahn SJ, Burne RA. 2006. The atlA operon of Streptococcus mutans: role in
autolysin maturation and cell surface biogenesis. J. Bacteriol. 188:6877–
6888.
4. Ahn SJ, Wen ZT, Brady LJ, Burne RA. 2008. Characteristics of biofilm
formation by Streptococcus mutans in the presence of saliva. Infect.
Immun. 76:4259 4268.
5. Ahn SJ, Wen ZT, Burne RA. 2006. Multilevel control of competence
Cell Envelope Stress Response in Streptococcus mutans
April 2012 Volume 78 Number 8 aem.asm.org 2921
Page 8
development and stress tolerance in Streptococcus mutans UA159. Infect.
Immun. 74:1631–1642.
6. Biswas I, Drake L, Erkina D, Biswas S. 2008. Involvement of sensor
kinases in the stress tolerance response of Streptococcus mutans. J. Bacte-
riol. 190:68 –77.
7. Brady LJ, et al. 2010. The changing faces of Streptococcus antigen I/II
polypeptide family adhesins. Mol. Microbiol. 77:276 –286.
8. Brady LJ, Piacentini DA, Crowley PJ, Bleiweis AS. 1991. Identification
of monoclonal antibody-binding domains within antigen P1 of Strepto-
coccus mutans and cross-reactivity with related surface antigens of oral
streptococci. Infect. Immun. 59:4425– 4435.
9. Breukink E, de Kruijff B. 2006. Lipid II as a target for antibiotics. Nat.
Rev. Drug Discov. 5:321–332.
10. Burne RA. 1998. Oral streptococci. . . products of their environment. J.
Dent. Res. 77:445– 452.
11. Burne RA, et al. 2011. Functional genomics of Streptococcus mutans,p
185–204. In Kolenbrander PE (ed), Oral microbial communities: genomic
inquires and interspecies communication. ASM Press, Washington, DC.
12. Burne RA, Wen ZT, Chen YM, Penders JEC. 1999. Regulation of ex-
pression of the fructan hydrolase gene of Streptococcus mutans GS-5 by
induction and carbon catabolite repression. J. Bacteriol. 181:2863–2871.
13. Chatfield CH, Koo H, Quivey RG, Jr. 2005. The putative autolysin
regulator LytR in Streptococcus mutans plays a role in cell division and is
growth-phase regulated. Microbiology 151:625– 631.
14. Cieslewicz MJ, Kasper DL, Wang Y, Wessels MR. 2001. Functional
analysis in type Ia group B Streptococcus of a cluster of genes involved in
extracellular polysaccharide production by diverse species of streptococci.
J. Biol. Chem. 276:139 –146.
15. Crowley PJ, Brady LJ, Michalek SM, Bleiweis AS. 1999. Virulence of a
spaP mutant of Streptococcus mutans in a gnotobiotic rat model. Infect.
Immun. 67:1201–1206.
16. Hanson BR, Lowe BA, Neely MN. 2011. Membrane topology and DNA-
binding ability of the streptococcal CpsA protein. J. Bacteriol. 193:411–
420.
17. Hubscher J, Luthy L, Berger-Bachi B, Stutzmann Meier P. 2008. Phy-
logenetic distribution and membrane topology of the LytR-CpsA-Psr pro-
tein family. BMC Genomics 9:617.
18. Hubscher J, et al. 2009. MsrR contributes to cell surface characteristics
and virulence in Staphylococcus aureus. FEMS Microbiol. Lett. 295:251–
260.
19. Jenkinson HF, Lamont RJ. 2005. Oral microbial communities in sickness
and in health. Trends Microbiol. 13:589 –595.
20. Johnsborg O, Havarstein LS. 2009. Pneumococcal LytR, a protein from
the LytR-CpsA-Psr family, is essential for normal septum formation in
Streptococcus pneumoniae. J. Bacteriol. 191:5859 –5864.
21. Kajfasz JK, et al. 2010. Two Spx proteins modulate stress tolerance,
survival, and virulence in Streptococcus mutans. J. Bacteriol. 192:2546
2556.
22. Kreth J, Merritt J, Shi W, Qi F. 2005. Co-ordinated bacteriocin produc-
tion and competence development: a possible mechanism for taking up
DNA from neighbouring species. Mol. Microbiol. 57:392– 404.
23. Kreth J, Merritt J, Shi W, Qi F. 2005. Competition and coexistence
between Streptococcus mutans and Streptococcus sanguinis in the dental
biofilm. J. Bacteriol. 187:7193–7203.
24. Kuramitsu HK, He X, Lux R, Anderson MH, Shi W. 2007. Interspecies
interactions within oral microbial communities. Microbiol. Mol. Biol.
Rev. 71:653– 670.
25. Lamont RJ, Demuth DR, Davis CA, Malamud D, Rosan B. 1991.
Salivary-agglutinin-mediated adherence of Streptococcus mutans to early
plaque bacteria. Infect. Immun. 59:3446 –3450.
26. Lazarevic V, Margot P, Soldo B, Karamata D. 1992. Sequencing and
analysis of the Bacillus subtilis lytRABC divergon: a regulatory unit encom-
passing the structural genes of the N-acetylmuramoyl-L-alanine amidase
and its modifier. J. Gen. Microbiol. 138:1949 –1961.
27. Lee SF, Progulske-Fox A, Bleiweis AS. 1988. Molecular cloning and
expression of a Streptococcus mutans major surface protein antigen, P1
(I/II), in Escherichia coli. Infect. Immun. 56:2114 –2119.
28. Lemos JA, Burne RA. 2008. A model of efficiency: stress tolerance by
Streptococcus mutans. Microbiology 154:3247–3255.
29. Loo CY, Corliss DA, Ganeshkumar N. 2000. Streptococcus gordonii bio-
film formation: identification of genes that code for biofilm phenotypes. J.
Bacteriol. 182:1374 –1382.
30. McBain AJ, Ledder RG, Sreenivasan P, Gilbert P. 2004. Selection for
high-level resistance by chronic triclosan exposure is not universal. J. An-
timicrob. Chemother. 53:772–777.
31. Nakano K, Fujita K, Nishimura K, Nomura R, Ooshima T. 2005.
Contribution of biofilm regulatory protein A of Streptococcus mutans to
systemic virulence. Microbes Infect. 7:1246 –1255.
32. Oli MW, McArthur WP, Brady LJ. 2006. A whole cell BIAcore assay to
evaluate P1-mediated adherence of Streptococcus mutans to human sali-
vary agglutinin and inhibition by specific antibodies. J. Microbiol. Meth-
ods 65:503–511.
33. Over B, et al. 2011. LytR-CpsA-Psr proteins in Staphylococcus aureus
display partial functional redundancy and the deletion of all three severely
impairs septum placement and cell separation. FEMS Microbiol. Lett.
320:142–151.
34. Perez-Casal J, Caparon MG, Scott JR. 1991. Mry, a trans-acting positive
regulator of the M protein gene of Streptococcus pyogenes with similarity to
the receptor proteins of two-component regulatory systems. J. Bacteriol.
173:2617–2624.
35. Podbielski A, Woischnik M, Leonard BA, Schmidt KH. 1999. Charac-
terization of nra, a global negative regulator gene in group A streptococci.
Mol. Microbiol. 31:1051–1064.
36. Rossi J, Bischoff M, Wada A, Berger-Bachi B. 2003. MsrR, a putative cell
envelope-associated element involved in Staphylococcus aureus sarA atten-
uation. Antimicrob. Agents Chemother. 47:2558 –2564.
37. Sambrook J, Fritsch EF, Maniatis T. 1989. Molecular cloning: a labora-
tory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Har-
bor, NY.
38. Senadheera D, et al. 2009. Inactivation of VicK affects acid production
and acid survival of Streptococcus mutans. J. Bacteriol. 191:6415– 6424.
39. Steidl R, et al. 2008. Staphylococcus aureus cell wall stress stimulon gene-
lacZ fusion strains: potential for use in screening for cell wall-active anti-
microbials. Antimicrob. Agents Chemother. 52:2923–2925.
40. Suntharalingam P, Senadheera MD, Mair RW, Levesque CM, Cvitko-
vitch DG. 2009. The LiaFSR system regulates the cell envelope stress
response in Streptococcus mutans. J. Bacteriol. 191:2973–2984.
41. Wen TZ, Suntharaligham P, Cvitkovitch DG, Burne RA. 2005. Trigger
factor in Streptococcus mutans is involved in stress tolerance, competence
development, and biofilm formation. Infect. Immun. 73:219 –225.
42. Wen ZT, Baker HV, Burne RA. 2006. Influence of BrpA on critical
virulence attributes of Streptococcus mutans. J. Bacteriol. 188:2983–2992.
43. Wen ZT, Burne RA. 2002. Functional genomics approach to identifying
genes required for biofilm development by Streptococcus mutans. Appl.
Environ. Microbiol. 68:1196 –1203.
44. Wen ZT, Burne RA. 2004. LuxS-mediated signaling in Streptococcus mu-
tans is involved in regulation of acid and oxidative stress tolerance and
biofilm formation. J. Bacteriol. 186:2682–2691.
45. Wilkins JC, Beighton D, Homer KA. 2003. Effect of acidic pH on expres-
sion of surface-associated proteins of Streptococcus oralis. Appl. Environ.
Microbiol. 69:5290 –5296.
46. Zimmer J, Nam Y, Rapoport TA. 2008. Structure of a complex of the
ATPase SecA and the protein-translocation channel. Nature 455:936 –943.
Bitoun et al.
2922 aem.asm.org Applied and Environmental Microbiology
Page 9
  • Source
    • "Like other Gram-positive bacteria, S. mutans possesses a thick layer of peptidoglycan whose homeostasis is known to be crucial in pathophysiology including cell division and growth, stress tolerance, and biofilm formation. Recent studies have shown that biofilm regulatory protein BrpA, a member of the LytR-CpsA-Psr family of proteins widespread in Gram-positive bacteria, plays a major role in cell envelope homeostasis, influencing cell envelope stress response and biofilm formation [35, 40, 41] . Like BrpA, penicillin-binding protein PBP1a possesses a C-terminal region with rich serine residues that appear to be unique to S. mutans [27]. "
    [Show abstract] [Hide abstract] ABSTRACT: Streptococcus mutans, a key etiological agent of human dental caries, lives almost exclusively on the tooth surface in plaque biofilms and is known for its ability to survive and respond to various environmental insults, including low pH, and antimicrobial agents from other microbes and oral care products. In this study, a penicillin-binding protein (PBP1a)- deficient mutant, strain JB467, was generated by allelic replacement mutagenesis and analyzed for the effects of such a deficiency on S. mutans' stress tolerance response and biofilm formation. Our results so far have shown that PBP1a-deficiency in S. mutans affects growth of the deficient mutant, especially at acidic and alkaline pHs. As compared to the wild-type, UA159, the PBP1a-deficient mutant, JB467, had a reduced growth rate at pH 6.2 and did not grow at all at pH 8.2. Unlike the wild-type, the inclusion of paraquat in growth medium, especially at 2 mM or above, significantly reduced the growth rate of the mutant. Acid killing assays showed that the mutant was 15-fold more sensitive to pH 2.8 than the wild-type after 30 minutes. In a hydrogen peroxide killing assay, the mutant was 16-fold more susceptible to hydrogen peroxide (0.2%, w/v) after 90 minutes than the wild-type. Relative to the wild-type, the mutant also had an aberrant autolysis rate, indicative of compromises in cell envelope integrity. As analyzed using on 96-well plate model and spectrophotometry, biofilm formation by the mutant was decreased significantly, as compared to the wild-type. Consistently, Field Emission-SEM analysis also showed that the PBP1a-deficient mutant had limited capacity to form biofilms. TEM analysis showed that PBP1a mutant existed primarily in long rod-like cells and cells with multiple septa, as compared to the coccal wild-type. The results presented here highlight the importance of pbp1a in cell morphology, stress tolerance, and biofilm formation in S. mutans.
    Full-text · Article · Apr 2015 · PLoS ONE
  • Source
    • "In S. mutans, in particular, 13 more TCSTSs have been identified with 4 (ComDE, CiaRH, VicRK and LiaSR) being already known and shown to play a prominent role in regulating stress response. In fact, liaSR deficient mutants showed to be two to fourfold more sensitive to cell envelope biosynthesis target antimicrobials than the wild type (Bitoun, 2012; Dong, 2012; Suntharalingam, 2009). "
    Full-text · Chapter · Jan 2015
  • Source
    • "Highly conserved in Gram-positive bacteria, LCP proteins are widely considered as cell wall-associated transcriptional regulators (Hübscher et al., 2008), although there is recent evidence suggesting that LCP proteins are responsible for covalent attachment of anionic cell wall polymers, such as teichoic acid and capsular polysaccharides, to peptidoglycan (Eberhardt et al., 2012; Kawai et al., 2011). BrpA and several other LCP paralogues have been shown to play a major role in cell envelope biogenesis (Bitoun et al., 2012aBitoun et al., , 2013 Eberhardt et al., 2012; Johnsborg & Håvarstein, 2009; Kawai et al., 2011; Over et al., 2011; Wen et al., 2006). This highly conserved genetic linkage, along with the characteristic phenotypes of the BrpB-deficient mutants, all support a role for BrpB and its streptococcal homologues in cell wall biogenesis/homeostasis. "
    [Show abstract] [Hide abstract] ABSTRACT: Streptococcus mutans, the primary etiological agent of dental caries, possesses an YjeE-like protein that is encoded in locus SMU.409, herein designated brpB. In this study, a BrpB-deficient mutant, JB409, and a double mutant deficient of BrpB and BrpA (a paralogue of the LytR-CpsA-Psr family of cell wall-associated proteins), JB819, were constructed and characterized using function assays and microscopic analysis. Both JB409 and JB819 displayed extended lag phases and drastically slowed growth rates during growth in BHI as compared to the wild-type, UA159. Relative to UA159, JB409 and JB819 were more than 60- and 10-fold more susceptible to acid killing at pH 2.8, and more than 1- and 2-log more susceptible to hydrogen peroxide, respectively. Complementation of the deficient mutants with a wild-type copy of the respective gene(s) partly restored the acid and oxidative stress responses to a level similar to the wild-type. As compared to UA159, biofilm formation by JB409 and JB819 was drastically reduced (P<0.001), especially during growth in medium containing sucrose. Under SEM, JB409 had significantly more giant cells with an elongated, rod-like morphology, and JB819 formed marble-like super cells with apparent defects in cell division. As revealed by TEM analysis, BrpB-deficiency in both JB409 and JB819 resulted in the development of low electron density patches and formation of loose nucleoid structure. Taken together, these results suggest that BrpB likely functions in concerto with BrpA in regulating cell envelope biogenesis /homeostasis in S. mutans. Further study is underway to elucidate the mechanism that underlies the BrpA and BrpB-mediated regulation.
    Preview · Article · Nov 2013 · Microbiology
Show more