Article

Programmed cell death induced by high levels of cytokinin in Arabidopsis cultured cells is mediated by the cytokinin receptor CRE1/AHK4

Dipartimento di Biologia, Università Degli Studi di Padova, Padua, Italy.
Journal of Experimental Botany (Impact Factor: 5.53). 02/2012; 63(7):2825-32. DOI: 10.1093/jxb/ers008
Source: PubMed

ABSTRACT

High levels of cytokinins (CKs) induce programmed cell death (PCD) both in animals and plant cells. High levels of the CK
benzylaminopurine (BA) induce PCD in cultured cells of Arabidopsis thaliana by accelerating a senescence process characterized by DNA laddering and expression of a specific senescence marker. In this
report, the question has been addressed whether members of the small family of Arabidopsis CK receptors (AHK2, AHK3, CRE1/AHK4) are required for BA-induced PCD. In this respect, suspension cell cultures were produced
from selected receptor mutants. Cell growth and proliferation of all receptor mutant and wild-type cell cultures were similar,
showing that the CK receptors are not required for these processes in cultured cells. The analysis of CK metabolites instead
revealed differences between wild-type and receptor mutant lines, and indicated that all three receptors are redundantly involved
in the regulation of the steady-state levels of isopentenyladenine- and trans-zeatin-type CKs. By contrast, the levels of cis-zeatin-type CKs were controlled mainly by AHK2 and AHK3. To study the role of CK receptors in the BA-induced PCD pathway,
cultured cells were analysed for their behaviour in the presence of high levels of BA. The results show that CRE1/AHK4, the strongest expressed CK receptor gene of this family in cultured cells, is required for PCD, thus linking this process
to the known CK signalling pathway.

Full-text

Available from: Ondrej Novak
Journal of Experimental Botany, Vol. 63, No. 7, pp. 2825–2832, 2012
doi:10.1093/jxb/ers008 Advance Access publication 6 February, 2012
This paper is available online free of all access charges (see http://jxb.oxfordjournals.org/open_access.html for further details)
RESEARCH PAPER
Programmed cell death induced by high levels of cytokinin in
Arabidopsis cultured cells is mediated by the cytokinin
receptor CRE1/AHK4
Marco Vescovi
1
, Michael Riefler
2
, Micael Gessuti
1
, Ondr
ˇ
ej Nova
´
k
3
, Thomas Schmu¨ lling
2
and
Fiorella Lo Schiavo
1,
*
1
Dipartimento di Biologia, Universita
`
Degli Studi di Padova, Via G. Colombo 3, I-35121 Padua, Italy
2
Institute of Biology/Applied Genetics, Dahlem Centre of Plant Sciences, Freie Universita
¨
t Berlin, D-14195 Berlin, Germany
3
Laboratory of Growth Regulators, Palacky
´
University and Institute of Experimental Botany, Academy of Sciences of the Czech
Republic, CZ-78371 Olomouc, Czech Republic
* To whom correspondence should be addressed. E-mail: fiorella.loschiavo@unipd.it
Received 1 July 2011; Revised 2 January 2012; Accepted 8 January 2012
Abstract
High levels of cytokinins (CKs) induce programmed cell death (PCD) both in animals and plant cells. High levels of
the CK benzylaminopurine (BA) induce PCD in cultured cells of Arabidopsis thaliana by accelerating a senescence
process characterized by DNA laddering and expression of a specific senescence marker. In this report, the
question has been addressed whether members of the small family of Arabidopsis CK receptors (AHK2, AHK3,
CRE1/AHK4) are required for BA-induced PCD. In this respect, suspension cell cultures were produced from
selected receptor mutants. Cell growth and proliferation of all receptor mutant and wild-type cell cultures were
similar, showing that the CK receptors are not required for these processes in cultured cells. The analysis of CK
metabolites instead revealed differences between wild-type and receptor mutant lines, and indicated that all three
receptors are redundantly involved in the regulation of the steady-state levels of isopentenyladenine- and trans-
zeatin-type CKs. By contrast, the levels of cis-zeatin-type CKs were controlled mainly by AHK2 and AHK3. To study
the role of CK receptors in the BA-induced PCD pathway, cultured cells were analysed for their behaviour in the
presence of high levels of BA. The results show that CRE1/AHK4, the strongest expressed CK receptor gene of this
family in cultured cells, is required for PCD, thus linking this process to the known CK signalling pathway.
Key words: Arabidopsis cultured cells, cytokinin, histidine kinase cytokinin receptors, programmed cell death.
Introduction
Cytokinins (CKs) play a crucial role in regulating the
proliferation and differentiation of plant cells. They are
involved in many aspects of plant growth and development,
such as seed germination, de-etiolation, chloroplast differ-
entiation, apical dominance, plant–pathogen interactions,
flower and fruit development, and senescence (Sakakibara,
2006; Argueso et al., 2009; Werner and Schmu
¨
lling, 2009).
It has been demonstrated recently that high levels of CKs
induce programmed cell death (PCD) in both animal and
plant cells (Ishii et al.,2002; Mlejnek and Prochazka, 2002;
Carimi et al., 2003), revealing an unexpected role for this
central plant hormone. When 6-benzylaminopurine (BA)
was added at high doses to proliferating suspension cell
cultures of several plant species (including Arabidopsis
thaliana, Daucus carota,andMedicago truncatula), cell
growth was reduced and cell death induced (Carimi et al.,
2004, 2005; Zottini et al., 2006). The analysis of a number
of hallmarks (DNA laddering, nuclear chromatin condensa-
tion, and the release of cytochrome c from mitochondria)
revealed the programmed nature of the induced cell death
(Carimi et al., 2003). By characterizing PCD events, two
observations of particular interest were made. The first was
ª 2012 The Author(s).
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-
nc/3.0), which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Page 1
that cell cultures treated at different times during a sub-
culture cycle showed different sensitivities to BA. Since
dividing cells were more responsive than resting cells, this
suggested that some sort of competence was required to
undergo PCD (Carimi et al., 2003). The second observation
was that high levels of BA induced PCD by accelerating
a senescence-like process. When Arabidopsis cells were
treated with high levels of BA during the exponential
growth phase, the percentage of cell death rapidly increased
and the appearance of DNA laddering was detected
concomitantly with the expression of the senescence-specific
marker SAG12 (Carimi et al., 2004).
The first CK receptor was identified in Arabidopsis
thaliana 10 years ago (Inoue et al., 2001; Suzuki et al.,
2001). Three CK receptor genes have been isolated since
then, namely AHK2, AHK3, and CRE1/AHK4, all encoding
histidine kinase (HK) sensors (see review by Heyl et al.,
2011). Single, double and triple receptor mutants have been
isolated and the ahk2 ahk3 cre1 triple mutant, in particular,
showed a severe but not lethal phenotype (Nishimura et al.,
2004; Higuchi et al., 2004; Riefler et al., 2006). Analysis of
these loss-of-function mutants revealed the implication of
these receptor genes in regulating numerous aspects of plant
growth and development, including root and shoot growth,
leaf senescence, seed size, and germination (Nishimura
et al., 2004; Higuchi et al., 2004; Riefler et al., 2006).
In this study, the question whether PCD induced by high
levels of BA in cultured cells depends on one or several of
these CK receptors was approached. To this end, cultured
cell lines from seedlings of different CK receptor mutants
were produced and characterized. The analyses revealed cell
growth parameters comparable with wild-type cell line, but
differences in the response to high levels of BA. The results
pinpointed a central role of CRE1/AHK4 in mediating the
BA-induced PCD.
Materials and methods
Plant material, culture conditions, and treatments
The plants were grown in a phytotron at 22 C under long-day
conditions (16/8 h light/dark) and exposed to white light (;75 lE).
Seeds were surface-sterilized and vernalized at 4 C for 3 d in the
dark for RNA extraction from seedlings grown in vitro . Then, the
seeds were exposed to white light and allowed to germinate and
grow at 22 C for 6 d on horizontal plates containing half-strength
MS liquid medium, 0.1% sucrose, and 0.5 g l
1
MES. The pH of
the media was adjusted to 6.060.1 with 0.5 M KOH before
autoclaving at 121 C for 20 min.
Cell lines from wild-type Arabidopsis thaliana ecotype Columbia
(Col-0) and the CK receptor mutants cre1-2, ahk2-5 ahk3-7, and
ahk2-5 ahk3-7 cre1-2 (Riefler et al., 2006) were generated from
cotyledons of 12-d-old seedlings. Briefly, isolated cotyledons were
incubated on modified Murashige and Skoog (1962) solid medium
[0.8% (w/v) plant agar] [MSR2: 2.70 mM KH
2
PO
4
,40lM
nicotinic acid, 33 lM thiamine hydrochloride, 60 lM pyridoxal
hydrochloride, 0.8% (w/v) plant agar] supplemented with 0.5 g l
1
malt extract, 30 g l
1
sucrose, 9 lM BA, and 4.5 lM 2,4-
dichlorophenoxyacetic acid (2,4-D) for 3 weeks in order to induce
callus formation. Subsequently, callus produced from explants was
transferred to liquid medium and a suspension cell culture
produced. The pH of the solid and liquid media was adjusted to
5.760.1 with 0.5 M NaOH before autoclaving at 121 C for
20 min. Cells were routinely subcultured every 7 d. The addition of
BA was not required to maintain cell growth, but strongly reduced
the formation of cell clumps in the culture. For subculture cycles,
1.5 ml of packed cell volume was placed in 250 ml Erlenmeyer
flasks containing 50 ml of liquid medium. Cells were subcultured in
fresh medium at 7 d intervals and maintained in a climate chamber
on a horizontal rotary shaker (80 rpm) at 2561 C at a 16/8 h
light/dark cycle. Three-day-old wild-type and mutant cells were
incubated with 44 lM BA and collected 4 d later to determine the
effect of BA.
Cell viability and analysis of nuclear morphology
Cell growth was determined by measuring the cell dry weight of
the cell cultures at different times of the subculture cycle. To
determine dry weight, cells were separated from the culture
medium and cell debris using a vacuum filtration unit (Sartorius,
Florence, Italy). The collected cells were dried overnight at 60 C.
Cell death was determined by spectrophotometric measurements
of cell uptake of Evan’s blue, as described by Shigaki and
Bhattacharyya (1999).
Nuclei were visualized by staining with 4#,6-diamidino-2-phenyl-
indole (DAPI, Alexis Biochemicals, Florence, Italy) as described
by Traas et al. (1992), with some modifications. An aliquot of 500 ll
of suspension culture was added to an equal volume of fixation
solution [4% (w/v) paraformaldehyde in PEM buffer (100 mM
HEPES, pH 6.9, 10 mM EGTA, and 10 mM MgSO
4
)]. After
30 min, cells were washed three times in PEM buffer and re-
suspended in 500 ll of PEM buffer. An aliquot of 200 lloffixed
cells was then added to an equal volume of PEM buffer containing
0.2% (w/v) Triton X-100 and 1 lgml
1
DAPI. Stained cells were
laid on a glass slide treated with poly-L-Lys, and nuclei were
visualized with a fluorescence microscope (Leica, Milan, Italy) with
an excitation filter of 330–380 nm and a barrier filter of 410 nm
(De Michele et al., 2009).
Identification and quantification of endogenous cytokinins
Three-day-old cultured cells were harvested, frozen in liquid N
2
,
and stored at –80 C. Three independent biological samples, each
of ;1 g, were collected for each cell line. The procedure used for
CK purification was a modification of the method described by
Faiss et al. (1997). Deuterium-labelled CK internal standards
(Olchemim Ltd., Czech Republic) were added, each at 1 pmol per
sample, to check the recovery during purification and to validate
the determination (Nova
´
k et al., 2008). The samples were purified
using a combined cation (SCX-cartridge) and anion (DEAE-
Sephadex-C18-cartridge) exchanger and immunoaffinity chroma-
tography (IAC) based on wide-range specific monoclonal
antibodies against CKs (Nova
´
k et al., 2003). The metabolic eluates
from the IAC columns were evaporated to dryness, dissolved in
30 ll of the mobile phase, and finally analysed by ultra-performance
liquid chromatograph-electrospray ionization tandem mass spec-
trometry. Quantification was obtained by multiple reaction
monitoring of [M+H]
+
and the appropriate product ion. Optimal
conditions, dwell time, cone voltage, and collision energy in the
collision cell, corresponding to the exact diagnostic transition,
were optimized for each CK for selective MRM experiments
(Nova
´
k et al.,2008). Quantification was performed by Masslynx
software using a standard isotope dilution method (Nova
´
k et al.,
2003).
RNA isolation and cDNA synthesis
Cells and seedlings were harvested, frozen in liquid N
2
, and stored
at –80 C. RNA was isolated with the TRIzol method, as described
by Riefler et al. (2006). Then the total RNA was purified using
an RNeasy kit, including DNase digestion (Quiagen, Hilden,
2826 | Vescovi et al.
Page 2
Germany). cDNA was synthesized by SuperscriptIII (Invitrogen,
Karlsruhe, Germany) from 1 lg of purified RNA.
DNA primer
The quantitative real-time RT-PCR expression analysis of CK
receptors genes was performed using the following primers: CRE1-F
(GGCACTCAACAATCATCAAG) and CRE1-R (TCTTTCTCG-
GCTTTTCTGAC) for the expression analysis of the CRE1/AHK4
gene; AHK2-F (GAGCTTTTTGACATCGGG) and AHK2-R
(TTCTCACTCAACCAGACGAG) for the expression analysis of
the AHK2 gene; AHK3-F (GTGACCAGGCCAAGAACTTA) and
AHK3-R (CTTCCCTGTCCAAAGCAA) for the expression analysis
of the AHK3 gene; ARR4-F (CCGTTGACTATCTCGCCT) and
ARR4-R (CGACGTCAACACGTCATC) for the expression analy-
sis of the ARR4 gene; ARR5-F (CTACTCGCAGCTAAAACGC)
and ARR5-R (GCCGAAAGAATCAGGACA) for the expression
analysis of the ARR5 gene; ARR6-F (GAGCTCTCCGATG-
CAAAT) and ARR6-R (GAAAAAGGCCATAGGGGT) for the
expression analysis of the ARR6 gene; and finally, EF-1a -F (TGAG-
CACGCTCTTCTTGCTTTCA) and EF-1a-R (GGTGGTGGCA-
TCCATCTTGTTACA) for the expression analysis of the elongation
factor-1a (EF-1 a)gene.
RNA analysis
Quantitative real-time RT-PCR using FAST SYBR Green I
technology was performed on an ABI PRISM 7500 sequence
detection system (Applied Biosystems, Darmstadt, Germany) using
the following cycling conditions: initial denaturation at 95 C for
15 min, 40 cycles of 30 s at 95 C, 15 s at 55 C, and 10 s at 72 C,
followed by melt curve stage analysis to check for specificity of the
amplification.
The reactions contained SYBR Green Master Mix (Applied
Biosystems), 300 nM of gene-specific forward and reverse primers
and 1 ll of the diluted cDNA in a 20 ll reaction. The negative
controls contained 1 ll RNase free water instead of the cDNA.
The primer efficiencies were calculated as E¼10
–1/slope
on a stan-
dard curve generated using a 4-fold or a 2-fold dilution series over
at least five dilution points of cDNA (Cortleven et al., 2009). The
expression analysis of CK receptor and ARR genes was performed
by the Pfaffl method, using EF-1a as the reference gene (Pfaffl,
2001; Remans et al., 2008).
Statistical analysis
All data are representative of at least three independent biological
replicates. Values are expressed as mean 6SD. The statistical
significance of differences was evaluated by Student’s t test and
one-way analysis of variance (ANOVA).
Results
Expression analysis of CK receptor genes in plants and
cultured cells of wild-type Arabidopsis thaliana
In order to evaluate the relevance of CK receptors in
mediating the BA effect on PCD, firstly, appropriate CK
receptor mutants had to be selected for the production of
cultured cell lines. To this end, the expression levels of the
three CK receptor genes AHK2, AHK3,andCRE1/AHK4
were evaluated by quantitative real-time RT-PCR analysis,
both in wild-type Arabidopsis seedlings and a cultured cell
line. In seedlings, the most strongly expressed gene was
AHK2; AHK3 waslessexpressedthanAHK2, and CRE1/
AHK4 was expressed at an even lower level (Fig. 1). In
wild-type cultured cells, the expression levels of AHK2 and
AHK3 receptor genes were lower than in seedlings, while
CRE1/AHK4 was expressed at approximately the same
level. The most strongly expressed gene was CRE1/AHK4,
while expression of AHK2 was almost undetectable, and
AHK3 was expressed at a low level (Fig. 1). Taking the high
expression of CRE1/AHK4 as an indication for putative
functional relevance, three mutants were selected to produce
cultured cells: the single mutant cre1-2 to analyse the
behaviour of the cultured cells in the absence of CRE1/
AHK4; the double mutant ahk2-5 ahk3-7 to evaluate only
the CRE1/AHK4 function; and the triple mutant ahk2-5
ahk3-7 cre1-2 to evaluate BA effects in the absence of all
three CK receptors. These cell lines are named in the
following cre1, ahk2 ahk3, and ahk2 ahk3 cre1, respectively.
Establishment and characterization of receptor mutant
cell lines
Young seedlings of the selected mutants and wild-type
Arabidopsis were used as starting material to induce de-
differentiation and callus formation. For each of these lines,
callus cultures were easily produced and, successively,
suspension cell cultures were obtained by transferring callus
cultures into liquid medium (Fig. 2A). After stable cell
cultures were established, cell growth (Fig. 2B) and cell
viability (Fig. 2C) were determined. No major differences in
growth kinetics were noted among the four lines, and the
maximum dry weight was reached at about the same time
(Fig. 2B). The only notable difference observed in the triple
mutant line was a greenish phenotype, corresponding
indeed to a doubled chlorophyll content compared with the
other three lines (data not shown), and a delay in entering
the senescence phase (Fig. 2C). In the triple mutant cell
population, the greenish phenotype corresponded to a lower
level of cell death at 21 d after culture initiation (24.862% )
Fig. 1. Quantitative real-time RT-PCR expression analysis of CK
receptor genes in Arabidopsis wild-type seedlings and cultured
cells. The relative expression values for all genes are related to the
expression level of AHK3, which was set to 1. Values represent
mean 6SD of the RQ value of three experiments performed by
using templates from three independent biological samples.
Asterisks indicate expression levels that are significantly different
from those found in seedlings as calculated by Student’s t test
(*P <0.01).
CRE1/AHK4 is involved in BA-induced PCD in Arabidopsis cultured cells | 2827
Page 3
when compared with the level of cell death measured in the
other cell lines (in the range of 54-63%) (Fig. 2C).
The expression levels of the three CK receptor genes were
measured in the mutant cell cultures and compared with their
expression in the wild-type cell line (Fig. 3). The steady-state
transcript levels of AHK3 were similar in wild-type and cre1
cell lines while the expression of AHK2 was enhanced in the
cre1 mutant. Unexpectedly, the expression level of CRE1/
AHK4 was reduced in the ahk2 ahk3 mutant. None of the
receptor genes was expressed in the triple mutant.
Free and conjugated CKs in wild-type and mutant cell
cultures
Because the concentrations of several CKs were increased in
CK receptor mutant plants (Riefler et al., 2006), the
concentrations of free and conjugated CKs were determined
in the different cell cultures (Table 1). Several differences
were observed. The levels of most CK metabolites increased
to a different extent in the CK receptor mutant lines.
Among the iP-type CKs, the riboside iPR was most strongly
enhanced, whereas only a moderate increase in iP and even
a decrease in iP9G concentration was measured. The free
base tZ and the conjugate tZOG were detectable only in
mutant lines and a significant increase in tZR content was
observed in the double and triple mutant cell lines. The
concentrations of various cZ-type CKs, which are synthe-
sized via a different pathway (Miyawaki et al., 2006;
Sakakibara, 2006), were also significantly higher in CK
receptor mutant lines. In particular, the concentrations of
the riboside cZR and the nucleotide cZR5’MP were
strongly increased in the double and triple mutant lines.
The strong increase of cZ-type metabolites was also found
in the receptor mutant lines treated by BA as is described
below (data not shown). Taken together, all three receptors
seem to have a function in regulating the steady-state levels
of iP-, tZ-type, and/or cZ-type CKs.
Effects of high levels of BA on Arabidopsis receptor
mutant cell lines
Once the receptor mutant cell lines were established and
characterized, experiments to detect the effects of high
concentrations of BA were performed. Three-day-old
Fig. 2. Arabidopsis plants and cultured cells of wild-type, cre1,
ahk2 ahk3, and ahk2 ahk3 cre1 receptor mutants. From top to
bottom: (A) Plants, callus cultures, suspension cell cultures; (B) cell
dry weight at different times after culture initiation; (C) cell viability
(Evan’s blue staining) at different times after culture initiation. Cell
dry weight and cell death were measured from 0–21 d after culture
initiation. Values represent mean 6SD of three independent
experiments.
Fig. 3. Quantitative real-time RT-PCR expression analysis of CK
receptor genes in wild-type, cre1, ahk2 ahk3, and ahk2 ahk3 cre1
cultured cell lines. The relative expression values for all CK
receptor genes are related to the expression level of AHK3 (set
to 1) in the wild-type cell line. Values represent mean 6 SD of the
RQ value of three experiments performed by using templates from
three independent biological samples. ND, not detected. Asterisks
indicate expression levels that are significantly different from
those found in wild-type cell line as calculated by Student’s t test
(*P <0.01, **P <0.05).
2828 | Vescovi et al.
Page 4
proliferating cell cultures were incubated with and without
44 lM BA. Expression of known CK primary response
genes, namely ARR4, ARR5, and ARR6, were tested to
evaluate whether this treatment activated the CK signalling
pathway (D’Agostino et al., 2000). The results showed
a clear induction of all three genes after 2 h BA treatment
in wild-type cells although the induction levels for the three
genes differed (Fig. 4). Differences in the cytokinin response
of the reporter genes were also noted in the mutant lines.
Low but reproducible ARR gene induction was found in
those cell lines retaining one or two of the receptors while
no induction was detected in the triple mutant. The weaker
response of the mutant cell lines compared with the wild
type may, in part, be explained by reduced expression levels
of the receptor genes (e.g. of CRE1/AHK4 in the ahk2 ahk3
mutant; see Fig. 3) and/or a reduction of downstream
components in the signalling chain. Notably, a very low
expression level of ARR genes has also been reported for
CK receptor mutant seedlings (Nishimura et al., 2004).
The cell dry weight and cell death (Evan’s blue staining)
of 4-d-treated cells were measured to evaluate the effects of
BA on growing cells. Treatment of wild-type cells with BA
at the beginning of the exponential growth phase induced
PCD: cell dry weight was significantly reduced (30%)
(Fig. 5A) and the percentage of cell death doubled after 4 d
of treatment (Fig. 5B). The double mutant cell line ahk2
ahk3 was affected by BA treatment to a similar extent as the
wild-type. By contrast, the same treatment did not affect
cell growth and viability either in the cell line derived from
the cre1 mutant, or in the triple mutant cell line (Fig. 5A,
B). To test whether the cell death was due to PCD, the
nuclear morphology was investigated using DAPI staining
and analysis by fluorescence microscopy (Fig. 5C, lower
panel). A strong increase in the percentage of stretched
nuclei (Fig. 5C, upper panel) was detected in wild-type and
double mutant cultures, but not in single cre1 and triple
mutant cell lines. This confirmed the programmed nature of
cell death induced by high levels of BA.
Discussion
It has been shown previously that high levels of CKs, and
BA in particular, induced PCD in proliferating suspension
cell cultures of several plant species including Arabidopsis.
This PCD was shown by analysing senescence-associated
markers to be an accelerated senescence process. In plants,
the presence of high concentrations of BA induced more
rapid leaf yellowing and precocious DNA fragmentation,
Table 1. Cytokinin content of Arabidopsis wild-type and receptor mutant cultured cells
One gram of 3-d-old Arabidopsis cultured cells per sample was collected, and three independent biological samples were taken for each
genotype. Data shown are pmol g
1
fresh weight 6SD. tZ, trans-zeatin; cZ, cis-zeatin; iP, N
6
-(D
2
isopentenyl)adenine; tZOG, trans-zeatin
O-glucoside; cZROG, c-zeatin riboside O-glucoside; tZR, trans-zeatin riboside; cZR, c-zeatin riboside; iPR, N
6
-(D
2
isopentenyl)adenosine; iP9G,
N
6
-(D
2
isopentenyl)adenine 9-glucoside; and iPR5’MP, N
6
-(D
2
isopentenyl)adenosine 5’-monophospate. ND, not detectable. Bold letters mark
concentrations of CKs in mutants that are significantly different from those of the wild type tested by ANOVA analysis. *, **, and *** correspond
to P-values of 0.05>P>0.01, 0.01>P>0.001, and 0.001>P, respectively.
Line/CK metabolite iP iPR iP9G tZ tZR
Wild-type 0.1860.06 0.3160.11 3.0360.20 ND 0.0460.01
cre1 0.6360.21* 1.2860.19** 0.2960.05*** 4.4461.24 0.0360.01
ahk2 ahk3 0.6860.28* 1.7260.62* 0.1860.02*** 3.9261.51 0.1060.03*
ahk2 ahk3 cre1 0.6360.10** 9.0361.11*** 0.3660.04*** 1.1260.31 0.2060.05**
tZOG cZ cZR cZROG cZR5’MP
Wild-type ND 0.0860.02 5.9760.73 1.7460.49 5.2161.71
cre1 0.6660.15 0.1560.04 3.5860.33** 1.0660.29 3.0461.10
ahk2 ahk3 1.1560.38 0.1960.06* 12.1363.09* 2.4660.80 34.3164.86***
ahk2 ahk3 cre1 2.4760.55 0.3360.04*** 47.42614.61** 8.0462.10* 73.08618.55**
Fig. 4. Quantitative real-time RT-PCR expression analysis of
ARR4, ARR5, and ARR6 genes in wild-type, cre1, ahk2 ahk3, and
ahk2 ahk3 cre1 cultured cell lines after incubation with 44 lMBA
for 2 h. The relative expression values of ARR genes are related to
the expression level in untreated cells (set to 1). Values represent
mean 6SD of the RQ value of three experiments performed by
using templates from three independent biological samples.
Asterisks indicate expression levels that are significantly different
from those found in untreated cell lines as calculated by Student’s
t test (*P <0.01, **P <0.05).
CRE1/AHK4 is involved in BA-induced PCD in Arabidopsis cultured cells | 2829
Page 5
both in carrot and Arabidopsis (Carimi et al., 2004).
Recently a classification of PCD in plants mainly based on
cell morphology has been proposed (van Doorn et al. , 2011;
van Doorn, 2011), distinguishing between two major
classes: ‘autolytic’ and ‘non-autolytic’. The BA-induced
PCD seems to belong to the first one, being a slow process
and showing similarities to the senescence process. How-
ever, detailed morphological analyses will precisely define to
which PCD class the BA-process belongs.
In this report, the question as to whether PCD induced
by high levels of CK depends on one or several members of
the Arabidopsis CK receptor family has been addressed. To
this purpose, cultured cell lines from selected receptor
mutants were produced focusing on CRE1/AHK4, as it was
the highest expressed CK receptor gene in cell cultures. The
relatively high expression of CRE1/AHK4 was not com-
pletely unexpected, as cell cultures are enriched in pro-
liferating cells. Different expression analyses have
previously shown that the CRE1/A HK4 gene is particularly
strongly expressed in proliferating tissue, including the root
tip, the shoot apical meristem (SAM), and during nodule
formation in Medicago truncatula. By contrast, the AHK2
and AHK3 genes are expressed more strongly in non-
dividing leaf cells (Nishimura et al., 2004; Frugier et al.,
2008; Gordon et al., 2009; Stolz et al., 2011).
The fact that all receptor mutant cell lines proliferated
well and were comparable to the wild-type cell line showed
that CK was not needed to induce cell division and the CK
receptors were not involved in the control of cell cycle
progression in these cultures. This observation was con-
firmed in another independent triple mutant cell line
harbouring a different allele combination (ahk2-2 ahk3 -3
cre1-12; Higuchi et al., 2004; data not shown). This result is
interesting as it is generally thought that CK is required for
plant cell division. However, it is known that cytokinin-
independent growing cells can be selected during the
establishment of the cell culture (Binns and Meins, 1973). It
may also be that a separate cell-autonomous CK response
system may function in cultured cells and maintain cell
division independently of CK receptors. Cell cycle phase-
specific sharp peaks in the levels of CK were identified in
cytokinin-autonomous tobacco BY-2 cell cultures and it
was suggested that CK may act through modulation of the
activity of cell cycle-regulating kinases (Redig et al., 1996).
In fact, CK inhibition of cyclin-dependent kinases is well
known from mammalian cell cultures (Vesely
´
et al., 1994).
The analysis of the CK content showed a strong increase
of different metabolites in the CK receptor mutant cell
cultures. In general, an increase in the steady-state levels of
iP- and tZ-type CKs was observed in all mutant cells,
indicating a negative regulation of the synthesis pathway by
its product through all three receptors. This confirms an
earlier observation made in CK receptor mutant seedlings
(Riefler et al., 2006). Considering cZ-type CKs, an increase
in cZ, cZR, and cZR5’MP levels was noted only in the ahk2
ahk3 double mutant and triple receptor mutant cell lines
and not in the cre1 line. In Arabidopsis, cZ-type CKs are
synthesized through a distinct pathway, the tRNA pathway,
with two tRNA-IPT enzymes catalysing the initial step
(Miyawaki et al., 2006; Sakakibara, 2006). Our result
indicates that biosynthesis of cZ-type CKs is also under the
negative control of CK receptors, in this case mainly of only
AHK2 and AHK3. This negative feedback control may
Fig. 5. Effects of BA treatment on PCD parameters of wild-type
and CK receptor mutant cultured cells. Arabidopsis cells were
treated 3 d after subculturing with 44 lM BA for 4 d. (A) Cell dry
weight of Arabidopsis cultured cells measured 4 d after BA
addition. (B) Cell death measured by Evan’s blue staining 4 d after
BA addition. (C) Lower panel: nuclei of treated and untreated cells,
stained with DAPI; upper panel: percentage of stretched nuclei
after BA addition; white arrows indicate stretched nuclei; bar¼20
lm. Values represent mean 6SD of three independent experi-
ments. Asterisks indicate values that are significantly different from
those of untreated cells by Student’s t test (*P <0.01, **P <0.05).
2830 | Vescovi et al.
Page 6
indicate a biological relevance of cZ-type CKs which is still
debated (Dobra
´
et al., 2010; Gajdos
ˇ
ova
´
et al., 2011).
Furthermore, the result shows that AHK2 and AHK3 are
active in these cell cultures, despite the low expression levels
of the corresponding genes.
BA treatment of the cell cultures induced PCD only in
the presence of CRE1/AHK4. It caused a severe decrease of
dry weight and cell viability in wild-type and in ahk2 ahk3
mutant lines, but did not affect the growth and cell viability
of cre1 mutant and ahk2 ahk3 cre1 mutant lines. The same
result was obtained with a different receptor mutant allele
combination (ahk2-2 ahk3-3 cre1-12; data not shown). The
dependence on CRE1/AHK4 may also explain why high
amounts of BA are required to induce PCD, as CRE1/
AHK4 has only a low affinity to BA (Spı
´
chal et al., 2004;
Romanov et al.,2006). It is interesting to note that AHK2
and AHK3 were incapable of coupling the BA signal to the
downstream response leading to cell death, although BA
induced, in heterologous systems, a stronger cytokinin
response through AHK2 and AHK3 than through CRE1/
AHK4 (Spı
´
chal et al., 2004; Romanov et al., 2006), and
despite a similar capacity of all three receptors to interact
with phosphotransmitter proteins acting immediately down-
stream in the signalling chain (Dortay et al.,2006).
In this report, by using a gentic approach, the involvement
of CRE1/AHK4 in causing PCD has been shown in cultured
cells treated with high levels of BA. The reason for the
specificity of the action of CRE1/AHK4 in this pathway
needs to be explored further. Similarly, it will be interesting to
identify additional components of this specific response and
reveal in which context the pathway is activated in planta.
Acknowledgements
We thank Dr Alex Costa for critical reading of the
manuscript. This work was supported by the ‘Ministero
dell’Istruzione e della Ricerca, fondi PRIN’ to FLS and
a grant from the FU Berlin to TS for a research stay by
MV. ON was supported by Internal Grant Agency of
Palacky University (PrF_2011_026).
References
Argueso CT, Ferreira FJ, Kieber JJ. 2009. Environmental
perception avenues: the interaction of cytokinin and environmental
response pathways. Plant, Cell and Environment 32, 1147–1160.
Binns A, Meins F. 1973. Habituation of tobacco pith cells for factors
promoting cell division is heritable and potentially reversible. Proceedings
of the National Academy of Sciences, USA 70, 2660–2662.
Carimi F, Zottini M, Formentin E, Terzi M, Lo Schiavo F. 2003.
Cytokinins: new apoptotic inducers in plants. Planta 216, 413–421.
Carimi F, Terzi M, De Michele R, Zottini M, Lo Schiavo F. 2004.
High levels of the cytokinin BAP induce PCD by accelerating
senescence. Plant Science 166, 963–969.
Carimi F, Zottini M, Costa A, Cattelan I, De Michele R, Terzi M,
Lo Schiavo F. 2005. NO signalling in cytokinin-induced programmed
cell death. Plant, Cell and Environment 28, 1171–1178.
Cortleven A, Remans T, Brenner WG, Valcke R. 2009. Selection of
plastid- and nuclear-encoded reference genes to study the effect of
altered endogenous cytokinin content on photosynthesis genes in
Nicotiana tabacum. Photosynthesis Research 102, 21–29.
D’Agostino IB, Deruere J, Kieber JJ. 2000. Characterization of the
response of the Arabidopsis response regulator gene family to
cytokinin. Plant Physiology 124, 1706–1717.
De Michele R, Vurro E, Rigo C, Costa A, Elviri L, Di Valentin M,
Careri M, Zottini M, Sanita
`
di Toppi L, Lo Schiavo F. 2009. Nitric
oxide is involved in cadmium-induced programmed cell death in
Arabidopsis suspension cultures. Plant Physiology 150, 217–228.
Dobra
´
J, Motyka V, Dobrev P, Malbeck J, Pra
´
s
ˇ
il IT, Haisel D,
Gaudinova
´
A, Havlova
´
M, Gubis J, Vankova
´
R. 2010. Comparison
of hormonal responses to heat, drought and combined stress in
tobacco plants with elevated proline content. 2010. Journal of Plant
Physiology 167, 1360–1370.
Dortay H, Mehnert N, Bu¨ rkle L, Schmu¨ lling T, Heyl A. 2006.
Analysis of protein interactions within the cytokinin-signaling pathway
of Arabidopsis thaliana. FEBS Journal 273, 4631–4644.
Faiss M, Zalubı
`
lova
´
J, Strnad M, Schmu¨ lling T. 1997. Conditional
transgenic expression of the ipt gene indicates a function of cytokinins
in paracrine signaling in whole tobacco plants. The Plant Journal 12,
401–415.
Frugier F, Kosuta S, Murray JD, Crespi M, Szczyglowski K.
2008. Cytokinin: secret agent of symbiosis. Trends in Plant Science
13, 115–120.
Gajdos
ˇ
ova
´
S, Spı
´
chal L, Kamı
´
nek M, et al. 2011. Distribution,
biological activities, metabolism, and the conceivable function of cis-
zeatin-type cytokinins in plants. Journal of Experimental Botany 62,
2827–2840.
Gordon SP, Chickarmane VS, Ohno C, Meyerowitz EM. 2009.
Multiple feedback loops through cytokinin signalling control stem cell
number within the Arabidopsis shoot meristem. Proceedings of the
National Academy of Sciences, USA 38, 16529–16534.
Heyl A, Riefler M, Romanov GA, Schmu¨ lling T. 2011. Properties,
functions and evolution of cytokinin receptors. European Journal of
Cell Biology doi:10.1016/j.ejcb.2011.02.009.
Higuchi M, Pischke MS, Ma
¨
ho
¨
nen AP, et al. 2004. In planta
functions of the Arabidopsis cytokinin receptor family. Proceedings of
the National Academy of Sciences, USA 101, 8821–8826.
Inoue T , Higuchi M, Hashimoto Y, Seki M, Kobayashi M,
Kato T, Tabata S, Shinozaki K, Kakimoto T. 2001. Identification
of CRE1 as a cytokinin receptor from Arabidopsis. Nature 409,
1060–1063.
Ishii Y, Hori Y, Sakai S, Honma Y. 2002. Control of differentiation
and apoptosis of human myeloid leukemia cells by cytokinins and
cytokinin nucleosides, plant differentiation-inducing hormones. Cell
Growth and Differentiation 13, 19–26.
Miyawaki K, Tarkowski P, Matsumoto-Kitano M, Kato T, Sato S,
Tarkowska
´
D, Tabata S, Sandberg G, Kakimoto T. 2006. Roles of
Arabidopsis ATP/ADP isopentenyltransferases and tRNA
CRE1/AHK4 is involved in BA-induced PCD in Arabidopsis cultured cells | 2831
Page 7
isopentenyltransferases in cytokinin biosynthesis. Proceedings of the
National Academy of Sciences, USA 103, 16598–16603.
Mlejnek P, Procha
´
zka S. 2002. Activation of caspase-like proteases
and induction of apoptosis by isopentenyladenosine in tobacco BY-2
cells. Planta 215, 158–166.
Murashige T, Skoog F. 1962. A revised medium for rapid growth
and bioassays with tobacco tissue cultures. Physiologia Plantarum 15,
473–497.
Nishimura C, Ohashi Y, Sato S, Kato T, Tabata S, Ueguchi C.
2004. Histidine kinase homologs that act as cytokinin receptors
possess overlapping functions in the regulation of shoot and root
growth in Arabidopsis. The Plant Cell 16, 1365–1377.
Nova
´
k O, Hauserova
´
E, Amakorova
´
P, Dolez
ˇ
al K, Strnad M.
2008. Cytokinin profiling in plant tissues using ultra-performance liquid
chromatography–electrospray tandem mass spectrometry.
Phytochemistry 69, 2214–2224.
Nova
´
k O, Tarkowski P, Tarkowska
´
D, Dolez
ˇ
al K, Lenobel R,
Strnad M. 2003. Quantitative analysis of cytokinins in plants by liquid
chromatography-single-quadrupole mass-spectrometry. Analytica
Chimica Acta 480, 207–218.
Pfaffl MW. 2001. A new mathematical model for relative quantification
in real-time RT-PCR. Nucleic Acid Research 29, e45.
Redig P, Shaul O, Inze
´
D, Van Montagu M, Van Onckelen H.
1996. Levels of endogenous cytokinins, indole-3-acetic acid and
abscisic acid during the cell cycle of synchronized tobacco BY-2 cells.
FEBS Letters 391, 175–180.
Remans T, Smeets K, Opdenakker K, Mathijsen D,
Vangronsveld J, Cuypers A. 2008. Normalisation of real-time RT-
PCR gene expression measurements in Arabidopsis thaliana exposed
to increased metal concentrations. Planta 227, 1343–1349.
Riefler M, Nova
´
k O, Strnad M, Schmu¨ lling T. 2006. Arabidopsis
cytokinin receptor mutants reveal functions in shoot growth, leaf
senescence, seed size, germination, root development, and cytokinin
metabolism. The Plant Cell 18, 40–54.
Romanov GA, Lomin SN, Schmu¨ lling T. 2006. Biochemical
characteristics and ligand-binding properties of Arabidopsis cytokinin
receptor AHK3 compared to CRE1/AHK4 as revealed by a direct
binding assay. Journal of Experimental Botany 57, 4051–4058.
Sakakibara H. 2006. Cytokinins: activity, biosynthesis, and
translocation. Annual Review of Plant Biology 57, 431–449.
Shigaki T, Bhattacharyya MK. 1999. Color coding the cell death
status of plant suspension cells. Biotechniques 26, 1060–1062.
Spı
´
chal L, Rakova NY, Riefler M, Mizuno T, Romanov GA,
Strnad M, Schmu¨ lling T. 2004. Two cytokinin receptors of
Arabidopsis thaliana, CRE1/AHK4 and AHK3, differ in their
specificity in a bacterial assay. Plant and Cell Physiology 45,
1299–1305.
Stolz A, Riefler M, Lomin S, Achazi K, Romanov GA,
Schmu¨ lling T. 2011. The specificity of cytokinin signalling in
Arabidopsis thaliana is mediated by differing ligand affinities
and expression profiles of the receptors. The Plant Journal 67,
157–168.
Suzuki T, Terada K, Takei K, Ishikawa K, Miwa K, Yamashino T,
Mizuno T. 2001. The Arabidopsis AHK4 histidine kinase is
a cytokinin-binding receptor that transduces cytokinin signals across
the membrane. Plant and Cell Physiology 42, 1017–1023.
Traas JA, Beven AF, Doonan JH, Cordewener J, Shaw PJ. 1992.
Cell-cycle dependent changes in labelling of specific phosphoproteins
by the monoclonal antibody MPM-2 in plant cells. The Plant Journal 2,
723–732.
van Doorn WG. 2011. Classes of programmed cell death in plants,
compared to those in animals. Journal of Experimental Botany 62,
4749–4761.
van Doorn WG, Beers EP, Dangl JL, et al. 2011. Morphological
classification of plant cell deaths. Cell Death and Differentiation 18,
1241–1246.
Vesely
´
J, Havlic
ˇ
ek L, Strnad M, Blow JJ, Donella-Deana A,
Pinna L, Letham DS, Kato J, Detivaud L, Leclerc S. 1994.
Inhibition of cyclin-dependent kinases by purine analogues. European
Journal of Biochemistry 224, 771–786.
Werner T, Schmu¨ lling T. 2009. Cytokinin action in plant
development. Current Opinion in Plant Biology 12, 527–538.
Zottini M, Barizza E, Bastianelli F, Carimi F, Lo Schiavo F. 2006.
Growth and senescence of Medicago truncatula cultured cells are
associated with characteristic mitochondrial morphology. New
Phytologist 172, 239–247.
2832 | Vescovi et al.
Page 8
  • Source
    • "There are CK receptors acting as HK, CK HP and CK RR that create a specific system of reception and transduction of CK signals named multi-step phosphorelay system (Ferreira and Kieber 2005). Some results indicate that one of the A. thaliana CK receptors (AHK4) is engaged in CK-stimulated induction of PCD (Vescovi et al. 2012) This discovery confirmed a central role of AHK4 and excluded participation of two other AHKs named AHK2 and AHK3 in mediating CK (BAP)-induced PCD. Moreover, it has been explained why such a high level of CKs is necessary to induced PCD. "
    [Show abstract] [Hide abstract] ABSTRACT: Cytokinins (CKs) are a large group of plant hormones which play a crucial role in many physiological processes in plants. One of the interesting functions of CKs is the control of programmed cell death (PCD). It seems that all CKs-dependent phenomena including PCD are accompanied by special multi-step phosphorelay signaling pathway. This pathway consists of three elements: histidine kinase receptors (HKs), histidine phosphotransfer proteins (HPs) and response regulators (RRs). This review shows the résumé of the latest knowledge about CKs signaling pathways in many physiological processes in plants with special attention paid to PCD process.
    Full-text · Article · Apr 2013 · Plant Cell Reports
  • [Show abstract] [Hide abstract] ABSTRACT: Cucumber fruit is susceptible to chilling injury (CI) which could be accelerated significantly with subsequent shelf-life. This type of CI culminates in deterioration of organs and led to cell death eventually. In this study, evidence of programmed cell death (PCD) involving in cell death induced by cold stress was investigated in cucumber. Harvested cucumber (Cucumis sativus L. cv. Zhexiu-1) fruits were stored at 2°C for 3, 6 and 9 days respectively and transferred to 20°C for 2 days subsequently. Significant cell death acceleration was observed upon reconditioning after 9 days' cold stress when the hallmark of PCD, DNA laddering, was clearly observed. The further evidence of nuclear DNA cleavage was confirmed by the in situ TdT-mediated dUTP nick end labelling (TUNEL) assay. Chromatin condensation and nucleus distortion were observed by nuclear staining of DAPI. However, PCD evidences were not observed during continuous cold stress though chilling injury appeared. Ethylene burst was observed upon reconditioning after 9 days consecutive cold stress. The features of PCD process involves in cell death induced by reconditioning after cold stress in cucumber fruit and which may be mainly attributed to ethylene burst.
    No preview · Article · May 2014 · Journal of the Science of Food and Agriculture
  • Source
    [Show abstract] [Hide abstract] ABSTRACT: Leaf senescence is an important biological process that contributes to grain yield in crops. To study the molecular mechanisms underlying natural leaf senescence, we harvested three different developmental ear leaves of maize, mature leaves (ML), early senescent leaves (ESL), and later senescent leaves (LSL), and analyzed transcriptional changes using RNA-sequencing. Three sets of data, ESL vs. ML, LSL vs. ML, and LSL vs. ESL, were compared, respectively. In total, 4,552 genes were identified as differentially expressed. Functional classification placed these genes into 18 categories including protein metabolism, transporters, and signal transduction. At the early stage of leaf senescence, genes involved in aromatic amino acids (AAAs) biosynthetic process and transport, cellular polysaccharide biosynthetic process, and the cell wall macromolecule catabolic process, were up-regulated. Whereas, genes involved in amino acid metabolism, transport, apoptosis, and response to stimulus were up-regulated at the late stage of leaf senescence. Further analyses reveals that the transport-related genes at the early stage of leaf senescence potentially take part in enzyme and amino acid transport and the genes upregulated at the late stage are involved in sugar transport, indicating nutrient recycling mainly takes place at the late stage of leaf senescence. Comparison between the data of natural leaf senescence in this study and previously reported data for Arabidopsis implies that the mechanisms of leaf senescence in maize are basically similar to those in Arabidopsis. A comparison of natural and induced leaf senescence in maize was performed. Athough many basic biological processes involved in senescence occur in both types of leaf senescence, 78.07% of differentially expressed genes in natural leaf senescence were not identifiable in induced leaf senescence, suggesting that differences in gene regulatory network may exist between these two leaf senescence programs. Thus, this study provides important information for understanding the mechanism of leaf senescence in maize.
    Full-text · Article · Dec 2014 · PLoS ONE
Show more