IncP-1ε Plasmids are Important Vectors of Antibiotic Resistance Genes in Agricultural Systems: Diversification Driven by Class 1 Integron Gene Cassettes

Article (PDF Available)inFrontiers in Microbiology 3:2 · January 2012with47 Reads
DOI: 10.3389/fmicb.2012.00002 · Source: PubMed
Abstract
The role of broad-host range IncP-1ε plasmids in the dissemination of antibiotic resistance in agricultural systems has not yet been investigated. These plasmids were detected in total DNA from all of 16 manure samples and in arable soil based on a novel 5'-nuclease assay for real-time PCR. A correlation between IncP-1ε plasmid abundance and antibiotic usage was revealed. In a soil microcosm experiment the abundance of IncP-1ε plasmids was significantly increased even 127 days after application of manure containing the antibiotic compound sulfadiazine, compared to soil receiving only manure, only sulfadiazine, or water. Fifty IncP-1ε plasmids that were captured in E. coli CV601gfp from bacterial communities of manure and arable soil were characterized by PCR and hybridization. All plasmids carried class 1 integrons with highly varying sizes of the gene cassette region and the sul1 gene. Three IncP-1ε plasmids captured from soil bacteria and one from manure were completely sequenced. The backbones were nearly identical to that of the previously described IncP-1ε plasmid pKJK5. The plasmids differed mainly in the composition of a Tn402-like transposon carrying a class 1 integron with varying gene cassettes, IS1326, and in three of the plasmids the tetracycline resistance transposon Tn1721 with various truncations. Diverse Beta- and Gammaproteobacteria were revealed as hosts of one of the IncP-1ε plasmids in soil microcosms. Our data suggest that IncP-1ε plasmids are important vectors for horizontal transfer of antibiotic resistance in agricultural systems.
ORIGINAL RESEARCH ARTICLE
published: 18 January 2012
doi: 10.3389/fmicb.2012.00002
IncP-1ε plasmids are important vectors of antibiotic
resistance genes in agricultural systems: diversification
driven by class 1 integron gene cassettes
Holger Heuer
1
, ChuT. T. Binh
1
, Sven Jechalke
1
, Christoph Kopmann
1
, Ute Zimmerling
1
,
Ellen Krögerrecklenfort
1
,Thomas Ledger
2
, Bernardo González
2
,EvaTop
3
and Kornelia Smalla
1
*
1
Federal Research Centre for Cultivated Plants, Institute for Epidemiology and Pathogen Diagnostics, Julius Kühn-Institut, Braunschweig, Germany
2
Department de Ciencias Biológicas, Universidad Adolfo Ibañez, Santiago, Chile
3
Department of Biological Sciences, Institute for Bioinformatics and Evolutionary Studies, University of Idaho, Moscow, ID, USA
Edited by:
Rustam I. Aminov, University of
Aberdeen, UK
Reviewed by:
Henning Sørum, Norwegian School of
Veterinary Science, Norway
Yixin Shi, Arizona State University,
USA
Peter Norberg , University of
Gothenburg, Sweden
*Correspondence:
Kornelia Smalla, Julius Kühn-Institut,
Institute for Epidemiology and
Pathogen Diagnostics, Messeweg
11-12, D-38104 Braunschweig,
Germany.
e-mail: kornelia.smalla@jki.bund.de
Present address:
Chu T. T. Binh, Department of Biology,
Loyola University Chicago, 1032 West
Sheridan Road, Chicago, IL 60660,
USA.
The role of broad-host range IncP-1ε plasmids in the dissemination of antibiotic resistance in
agricultural systems has not yet been investigated. These plasmids were detected in total
DNA from all of 16 manure samples and in arable soil based on a novel 5
-nuclease assay
for real-time PCR. A correlation between IncP-1ε plasmid abundance and antibiotic usage
was revealed. In a soil microcosm experiment the abundance of IncP-1ε plasmids was
significantly increased even 127 days after application of manure containing the antibiotic
compound sulfadiazine, compared to soil receiving only manure, only sulfadiazine, or water.
Fifty IncP-1ε plasmids that were captured in E. coli CV601gfp from bacterial communities
of manure and arable soil were characterized by PCR and hybridization. All plasmids carried
class 1 integrons with highly varying sizes of the gene cassette region and the sul1 gene.
Three IncP-1ε plasmids captured from soil bacteria and one from manure were completely
sequenced.The backbones were nearly identical to that of the previously described IncP-1ε
plasmid pKJK5.The plasmids differed mainly in the composition of a Tn402-like transposon
carrying a class 1 integron with varying gene cassettes, IS1326, and in three of the plas-
mids the tetracycline resistance transposonTn1721 with various truncations. Diverse Beta-
and Gammaproteobacteria were revealed as hosts of one of the IncP-1ε plasmids in soil
microcosms. Our data suggest that IncP-1ε plasmids are important vectors for horizontal
transfer of antibiotic resistance in agricultural systems.
Keywords: IncP-1ε plasmid, exogenous isolation, complete sequence, gene cassette, qPCR, arable soil, pig manure
INTRODUCTION
Spreading manure on agricultural soils was recently shown to pro-
mote spreading of transferable antibiotic resistances and residual
veterinary medicines in agricultural soils (reviewed in Schauss
et al., 2009; Heuer et al., 2011). Frequencies at which sulfadi-
azine (SDZ) resistance plasmids were captured from soil bacteria
into E. coli were found to be higher for soils treated with manure
than for soils that did not receive manure (Heuer and Smalla,
2007). Treatment of soil with manure spiked with SDZ resulted in
significantly higher transfer frequencies compared to non-spiked
manure (Heuer and Smalla, 2007). A survey of field-scale manure
slurries used for soil fertilization revealed that antibiotic resistance
plasmids could easily be captured into E. coli from the different
manures (Binh et al., 2008). A large proportion of the plasmids
could be assigned to known plasmid groups by DNA-hybridization
and PCR. Remarkably, 13 of the plasmids captured gave a strong
PCR product with primers targeting the trfA gene of IncP-1 plas-
mids (Götz et al., 1996) but did not hybridize with the probes
derived from the two reference plasmids RK2 (IncP-1α) and R751
(IncP-1β). The trfA PCR products were cloned and sequenced and
shown to be almost identical to the recently sequenced IncP-1ε
plasmid pKJK5 (Binh et al., 2008).
Plasmids of the IncP-1 group are considered as one of the
best studied plasmid groups. For decades, plasmids belonging to
this incompatibility group have attracted the attention of molec-
ular biologists and ecologists because of their efficient conjugative
transfer to and their stable replication in a wide range of Gram-
negative bacteria (Thomas, 2000). IncP-1 plasmids were originally
designated as clinical plasmidsbecause the prototype IncP-1α plas-
mid RK2 and the IncP-1β plasmid R751 were originally isolated
from clinical strains (Pansegrau et al., 1994; Thorsted et al., 1998).
The complete sequences of these two plasmids enabled the devel-
opment of a PCR-based plasmid detection system (Götz et al.,
1996) that virtually replaced the older hybridization method using
incompatibility group-specific probes (Couturier et al., 1988).
This greatly facilitated the detection of IncP-1 specific sequences
not only in isolated strains and plasmids but also in microbial
community DNA directly extracted from diverse environments.
While earlier characterization of a few catabolic IncP-1 plasmids
had already shown that IncP-1 plasmids occur in environmental as
well as clinical isolates, only PCR-based detection in combination
with Southern blot hybridization revealed that these plasmids were
certainly not confined to the clinical environment but instead were
frequently found in various environments such as soil, sediments,
www.frontiersin.org January 2012 | Volume 3 | Article 2 | 1
Heuer et al. IncP-1ε plasmids in agricultural systems
sewage, or manure (Götz et al., 1996; Heuer et al., 2002). Often the
abundance of populations carrying these plasmids seemed to be
related to pollution (Smalla et al., 2000, 2006). Based on compara-
tivegenomics,the basic structure of the first set of described IncP-1
plasmids has been confirmed for many others by now (Schlüter
et al., 2007; Sen et al., 2011). Besides their backbone functions
for vegetative replication, stable maintenance, and transfer the
accessory genes, that are typically found in between the blocks of
backbone functions at up tothree regions of insertion, confer resis-
tances to nearly all clinically important classes of antimicrobial
drugs, quaternary ammonium compounds, and mercury resis-
tances or encode degradation of man-made compounds. However,
the increasing number of completely sequenced IncP-1 plasmids
also showed that there are additional groups of IncP-1 plasmids
that clearly differ in their backbone from the IncP-1α and the
IncP-1β plasmids. Thus novel subgroups often represented by one
plasmid at the time have been proposed (Vedler et al., 2004; Haines
et al., 2006; Bahl et al., 2007). Since these plasmids were too diver-
gent in genome sequence from the IncP-1α and IncP-1β plasmids
to be detected by means of the primer systems developed by Götz
et al. (1996), new primer systems for detection of IncP-1 plas-
mids were published by Bahl et al. (2009) to encompass at least
the known diversity of IncP-1 plasmids. The environmental dis-
tribution of the recently discovered IncP-1 subgroups is not well
explored yet.
In the present study we aimed to explore the abundance of
IncP-1ε plasmids and their role in dissemination of antibiotic
resistance genes in the agro-ecosystem. A real-time PCR system
was established to provide quantitative data on the abundance
of populations carrying IncP-1ε plasmids in manure slurries
and in agricultural soils, and how this correlates with selective
pressure by antibiotics. We report on the characterization of
50 plasmids exogenously captured from manure, bulk, and rhi-
zosphere soil samples of independent micro-, and mesocosms
and field experiments that were assigned to the IncP-1ε group.
The host range of one of the plasmids was determined in a
soil microcosm experiment. The complete genome sequences of
four IncP-1ε plasmids were analyzed and compared to the pro-
totype pKJK5. As all four IncP-1ε plasmids contained class 1
integrons we hypothesized that antibiotic resistance gene cas-
settes might drive the diversification of IncP-1ε plasmids. To
prove this hypothesis all exogenously captured plasmids assigned
to the IncP-1ε group were analyzed for the presence of class
1 integron gene cassettes and the size of the gene cassettes
integrated.
MATERIALS AND METHODS
SAMPLES AND PLASMID CAPTURE
Soil microcosm experiments were set up to investigate the effects
of manure and SDZ on the abundance of antibiotic resistance
plasmids. For each microcosm, 2 kg of top soil from an arable field
near Kaldenkirchen, Germany [Gleyic Cambisol, 3.6% clay, 23.1%
silt, 73.3% sand, pH (CaCl
2
) 5.5, organic C 1.7%, maximal water
holding capacity 27%] was mixed either with 80 g manure slurry
or water (both either with or without addition of 16 mg SDZ and
16 mg acetyl-SDZ), and adjusted to 30% of the maximum water
holding capacity. For each of these four treatments, four replicate
microcosms per sampling time (29, 57, 127 days after treatment)
were prepared and incubated at 10˚C in the dark. The agricultural
soils (silty sand; sandy loam; silt) that were not fertilized with
manure for more than 10 years, originated from an experimental
plot in Großbeeren (Germany).
The plasmids analyzed in the present study were obtained from
manure (Heuer et al., 2002; Binh et al., 2008) and soil from an
independent microcosm (Heuer and Smalla, 2007), mesocosm,
and field experiments. Capture of plasmids from soil bacteria in
the plasmid-free rifampicin resistant E. coli CV601 gfp recipient
was done as previously described (Binh et al., 2007). Briefly, soil
was shaken with glass beads for 2 h in 1:10 diluted Tryptic Soy
Broth (BD Diagnostic Systems,Heidelberg, Germany) at 20˚C, and
mixed with E. coli cells. Coarse particles were settled out,cells from
supernatants were pelleted and transferred to a membrane filter
on Plate Count Agar (PCA; Merck, Darmstadt, Germany). After
overnight incubation at 28˚C, the suspended mating mixtures were
spread plated on Mueller–Hinton agar NCCLS (Merck) supple-
mented with SDZ and rifampicin to select for transconjugants
that captured a sulfonamide resistance plasmid. Plasmid pKS77
was obtained from pig manure as previously described (Heuer
et al., 2002). Plasmid pKJK5 was kindly provided by the group of
S. Sørensen, University of Copenhagen.
PLASMID ISOLATION AND CHARACTERIZATION BY PCR AND
SOUTHERN BLOT ANALYSIS
Plasmid DNA was isolated from cell pellets harvested from
colonies freshly grown on PCA using the Qiagen plasmid isola-
tion kit. Restriction enzyme digestion of plasmid DNA, Southern
blotting, and hybridization were done as described by Binh et al.
(2008). The digoxigenin-labeled trfA probe was generated from
PCR products obtained with the primers described by Bahl et al.
(2009) from pKJK5. The intI1 gene derived probes were generated
by digoxigenin labeling of PCR products obtained from Salmonella
enterica AM237806. Primers targeting intI1, and PCR conditions
were as described by Moura et al. (2010).TheaadA probe used was
a mixed probe generated from aadA1, aadA2, aadA9, and aadA13
(Binh et al., 2009). The plasmid DNA was analyzed for the pres-
ence of the sul1 gene (Heuer and Smalla, 2007) and of IncP-1ε trfA
(this study) by real-time PCR.
HOST RANGE STUDY
The host range of the IncP-1ε plasmids pHH3414 in rhizosphere
soil was determined by introducing E. coli CV601gfp pHH3414
(1 × 10
6
colony forming units per gram of soil) into soil micro-
cosms planted with Acacia caven. The soil was previously treated
with manure. After 4 weeks, serial 10-fold dilutions of rhizos-
phere and bulk soil in sterile saline were plated onto Mueller–
Hinton agar NCCLS (Merck) supplemented with cycloheximide
(100 mg l
1
),tetracycline (5 mg l
1
),SDZ (100 mg l
1
),and strep-
tomycin (50 mg l
1
) for selection of putative transconjugants
(recipients of plasmid pHH3414). Gfp negative colonies grown
on selective media for transconjugants were picked, re-streaked,
and cell lysates were screened by IncP-1ε PCR. The genomic and
plasmid DNA extracted from transconjugants (IncP-1ε PCR pos-
itive colonies) were further characterized by BOX-PCR and SphI
Frontiers in Microbiology | Antimicrobials, Resistance and Chemotherapy January 2012 | Volume 3 | Article 2 | 2
Heuer et al. IncP-1ε plasmids in agricultural systems
plasmid restriction digests, respectively, as previously described
(Smalla et al., 2006).
TOTAL COMMUNITY DNA
The total DNA from manure was the same as used by Binh et al.
(2008, 2009). Total DNA from soil samples (soils sieved through
a 2 mm mesh size) was extracted using the FastPrep FP120 bead
beating system for cell lysis in conjunction with the FastDNA SPIN
Kit for Soil, and the GeneClean Spin Kit for purification of the
extracted DNA (Qbiogene, Carlsbad, CA, USA).
QUANTITATIVE PCR TARGETING IncP-1ε PLASMIDS OR 16S rRNA
GENES
Ribosomal gene targets in total DNA were quantified by
5
-nuclease assays in real-time PCR as previously described
(Suzuki et al., 2000; Heuer and Smalla, 2007). Analogously,
the trfA gene copies of IncP-1ε plasmids were determined,
using primers trfAε941f (ACGAAGAAATGGTTGTCCTGTTC),
trfAε1014r (CGTCAGCTTGCGGTACTTCTC), and the Taqman
probe trfAε965tp (FAM-CCGGCGACCATTACAGCAAGTTCAT
TT-TAMRA). Standard dilutions were generated from a gel-
purified PCR product of the 281 bp trfA fragment amplified from
plasmid pHH3408 using previously described primers (Bahl et al.,
2009). Quantitative PCR was performed in a CFX96 real-time
PCR detection system (Bio-Rad, Munich, Germany). PCR reac-
tions contained standard or environmental DNA, 1.25 U TrueStart
Taq DNA polymerase and buffer (Fermentas, St. Leon-Rot, Ger-
many), 0.2 mM of each deoxynucleoside triphosphate, 2.5 mM
MgCl
2
, 0.1 mg ml
1
BSA, and 0.3 μM of primers and probe in
50 μl. Thermocycles were 5 min 95˚C, and 40 cycles consisting of
15 s 95˚C and 60 s 60˚C. Effects of manure and SDZ on the relative
abundance of IncP-1ε plasmids in soil were analyzed by ANOVA
using the procedure MIXED for repeated-measures comparison
included in the statistical software package SAS 9.2 (SAS Institute,
Cary, NC, USA).
SEQUENCE ANALYSIS
Sequencing of shotgun libraries from the plasmids, sequence
assembly, and gap closure by primer walking were performed by
the U.S. Department of Energy Joint Genome Institute (Walnut
Creek, CA, USA). Automatic annotation was carried out by the
J. Craig Venter Institute Annotation Service
1
followed by man-
ual annotation. Similarities of the plasmid sequences to other
plasmids, transposons, IS elements, and integrons were found by
BLASTN searches of GenBank
2
. Putative open reading frames in
the complete nucleotide sequences were compared by BLASTN
searches to GenBank sequences. Additional searches for genes,
operons, promoters, and terminators were done using FGENESB,
BPROM, and FindTerm at www.softberry.com (Softberry, Mount
Kisco, NY, USA). The sequence data have been submitted to
the DDBJ/EMBL/GenBank databases under accession numbers
JQ004406–JQ004409.
RESULTS
ABUNDANCE OF IncP-1ε PLASMIDS IN BACTERIAL COMMUNITIES OF
MANURE AND SOIL
To quantify IncP-1ε plasmids in total community DNA from
manure and soil samples, a 5
-nuclease assay for real-time PCR
specifically targeting the replication initiation gene trfA of these
plasmids (trfAε) was developed and applied. The abundance of
the trfAε gene in total DNA from manure relative to the rrn copy
number varied from 10
1
to 10
5
(Tab le 1). A higher relative
abundance of the trfAε gene was observed in total DNA from
manure obtained from pig producing facilities with large num-
bers of pigs, high-throughput piglet production, or documented
usage of several antibiotic compounds (Tab le 1 ). In these farms,
a high antibiotic usage is typical because of metaphylactic appli-
cation in large herds and prophylactic application at weaning of
1
http://www.jcvi.org/cms/research/projects/annotation-service/overview/
2
http://ncbi.nlm.nih.gov
Table 1 | Abundance of IncP-1ε plasmids in field-scale manures from different pig production facilities.
No. Farm size and type of pig production Antibiotic usage IncP-1ε plasmids
log[copies trfAε/rrn]
9 2000 pigs, 30–120 kg, 700 g/day increase, slatted floor High (amoxicillin, doxycycline): large herd 0.8
1 250 sows, 5250 piglets/year High: frequent weaning 1. 3
8 300 sows, 6900 piglets/year, slatted floor High: frequent weaning 1. 3
15 1800 pigs, 25–123 kg, 660 g/day increase, slatted floor High (tylosin, penicillin): large herd 1. 4
3 80 sows, 1520 piglets/year High (amoxicillin, penicillin, neomycin, tylosin, enrofloxacin,
apramycin): weaning
1. 5
10 1300 pigs, 30–125 kg, 700 g/day increase, slatted floor Medium (amoxicillin, enrofloxacin) 2.1
7 600 pigs, 30–125 kg, 750 g/day increase, partly slatted floor Medium (gentamicin, tylosin, tetracycline, lincomycin):
prophylactic for new piglets
2.2
6 1800 pigs, 8–140 kg, 800 g/day increase Medium (amoxicillin, tetracycline): large herd, long life cycle 2.6
12 Meat-production pigs, 30–120 kg, 650 g/day increase Unknown 2.8
4 80 sows, 1600 piglets/year Medium (tulathromycin, streptomycin, tetracycline,
enrofloxacin)
3.2
5 800 pigs, 25–120 kg, 700 g/day increase Low (tetracycline): small herd 3.7
14 400 pigs 30–120 kg, 650 g/day increase, partly slatted floor Low: small herd 4.4
13 550 pigs, 32–110 kg , 550 g/day increase, partly slatted floor No antibiotics used 5.2
www.frontiersin.org January 2012 | Volume 3 | Article 2 | 3
Heuer et al. IncP-1ε plasmids in agricultural systems
piglets. In contrast, manure from small pig producing facilities
had up to four orders of magnitude lower abundances of IncP-1ε
plasmids, especially farm no. 13 which did not apply any antibiotic
compounds recently. The correlation of plasmid abundance with
antibiotic usage suggested that these plasmids from manure typ-
ically carry accessory antibiotic resistance genes. We investigated
whether manure application on agricultural soil could increase the
abundance of resistance plasmids in the environment.
In a microcosm experiment, addition of antibiotic-free manure
or the antibiotic SDZ to arable soil did not increase the level of
IncP-1ε plasmids compared to untreated soil (Figure 1). However,
when manure was added to soil that was spiked with SDZ at a con-
centration typical for manure from SDZ-treated pigs, the abun-
dance of IncP-1ε plasmids was significantly increased compared to
the other treatments (two-way ANOVA, P = 0.025). This indicated
a synergistic effect of manure and SDZ causing an enrichment
of bacteria that carry sulfonamide resistance conferring IncP-1ε
plasmids within the soil community. An accumulation of these
plasmids due to the repeated treatment was not observed. In three
different agricultural soils from an experimental plot that had only
received mineral fertilizer for more than 10 years, the abundance
of the trfAε gene relative to the rrn copy number varied around
10
5
(data not shown).
CAPTURING IncP-1ε PLASMIDS FROM MANURE TREATED SOIL
Fifty conjugative plasmids that were exogenously captured from
manure, bulk soil, and rhizosphere bacteria into E. coli CV601gfp
based on the acquired SDZ resistance were assigned to IncP-1ε
based on DNA-hybridization with a pKJK5 derived trfA probe or
by means of the IncP-1ε specific real-time PCR. The isolation of
IncP-1ε plasmids from independent microcosms, mesocosms, and
field experiments indicated a widespread dissemination of IncP-1ε
FIGURE 1 | Copy numbers of trfA (replication initiation gene) of IncP-1ε
plasmids relative to 16S rRNA gene copies (rrn) in manure and in soil,
which was treated either with the antibiotic compound sulfadiazine
(SDZ), with manure without antibiotics, with manure containing SDZ,
or with water (untreated). Sampling of the soil microcosms was repeated
three times. Error bars indicate SD ( n = 4). Differing letters show a
significant effect of the treatment (ANOVA with repeated measures).
plasmids in agricultural soils. In all IncP-1ε plasmids the SDZ resis-
tance gene sul1 and the integrase gene intI1 of class 1 integrons
were detected (Tabl e 2). PCR amplification with primers targeting
the regions flanking class 1 integrons revealed that three plasmids
carried empty integrons (size of the fragment 300 bp) while all
others carried gene cassettes of different sizes ranging from 500 to
4000 bp (Ta b l e 2). Southern blot hybridization of PCR amplified
gene cassettes showed that 30 IncP-1ε carried the aadA gene. The
complete sequence of four of the plasmids was determined.
HOST RANGE
To investigate the host range of IncP-1ε plasmids, E. coli CV601gfp
carrying pHH3414 was introduced into soil microcosms planted
with A. caven. PCR screening of 30 gfp negative bacteria from the
rhizosphere of A. caven grown on selective media for resistances
conferred by pHH3414 resulted in six IncP-1ε positive isolates.
BOX-PCR revealed that the transconjugants exhibited four differ-
ent BOX patterns that were clearly distinct from BOX patterns of
the donor E. coli CV601gfp pHH3414. The SphI restriction pat-
terns of plasmid DNA isolated from putative transconjugants were
identical to the restriction patterns of plasmid pHH3414. Partial
sequencing of the 16S rRNA gene of the transconjugants showed
that they were affiliated to Beta- and Gammaproteobacteria.Three
isolates displayed the highest sequence similarity to Enterobacter
amnigenus (758/759). The 16S rRNA gene sequence of the other
isolates had the highest sequence similarity to Xanthomonas codi-
aei (618/621), Cupriavidus campinensis (789/789), and Alcaligenes
sp. (793/797).
COMPLETE SEQUENCE OF IncP-1ε PLASMIDS
The complete genome sequences of four IncP-1ε plasmids that
conferred sulfonamide resistance (pKS77, pHH3414, pHH128,
and pHH3408) were obtained and analyzed. Plasmids pHH128,
pHH3408, and pHH3414 originated from an arable field soil near
Kaldenkirchen (Germany), and were captured 8, 57, or 85 days
after manure application, respectively. Plasmid pKS77 was exoge-
nously isolated from pig manure. The backbone of all four plas-
mids was 99.9% identical to that of pKJK5, the first published
complete sequence of the IncP-1ε plasmids (Figure 2). It com-
prised genetic modules for replication, partitioning and regula-
tion, mating pair formation and conjugative transfer, and a region
with genes of unknown function. In all four plasmids two acces-
sory regions were inserted into the 5
part of parA, which was
partially deleted and may not be functional. The identity of back-
bones and insertion sites among the plasmids suggested a very
recent spread from a common ancestor. One of the insertions in
all the plasmids is similar to the IS-element ISPa17 (Figure 3). The
flanking 25 bp inverted repeats are the targets for the transposase
tnpA, and the 6 bp direct repeats generated during transposition
are still present in all the plasmids. The second insertion site in
parA contains a Tn402-related transposon that carries the IS-
element IS1326 and a class 1 integron. The plasmids differ in
the gene cassettes that were captured into the attachment site of
the integron. They harbor aadA (pHH3414), aadB (pKS77), or
aadA1b, dfrA1b, and two copies of catB (pHH128), or were devoid
of any gene cassette (pHH3408). The sul1 gene in the 3
con-
served segment of the integrons conferred sulfonamide resistance.
Frontiers in Microbiology | Antimicrobials, Resistance and Chemotherapy January 2012 | Volume 3 | Article 2 | 4
Heuer et al. IncP-1ε plasmids in agricultural systems
Table 2 | Characterization of exogenously isolated IncP-1ε plasmids
from agro-ecosystems.
Plasmid Source PCR product with primers
targeting 5
/3
CS of
integron (kbp)
Hybridization
with aadA
2-S2 Manure 2 1.0 +
2-S5 Manure 2 1.5 +
3-S1 Manure 3 1.0 +
4-T4 Manure 4 2.0 +
6-S1 Manure 6 1.0
7-S Manure 7 1.0 +
9-T4 Manure 9 1.3
11-S2 Manure 11 1.0 +
1-83 Soil microcosm 1.0 +
1-91 Soil microcosm 5
1-111 Soil microcosm 1.6 +
1-115 Soil microcosm 3
1-127 Soil microcosm 1.3
1-131 Soil microcosm 1.7/2.3 +
1-135 Soil microcosm 5
1-146 Soil microcosm 5
1-153 Soil microcosm 5
1-163 Soil microcosm 2.0/4 +
1-167 Soil microcosm 5
1-168 Soil microcosm 5
2-238 Soil microcosm 5
3-385 Soil microcosm 5
3-407 Soil microcosm 3
3-409 Soil microcosm 1.0 +
3-420 Soil microcosm 2.1 +
3-422 Soil microcosm 2.1 +
3-423 Soil microcosm 2.1 +
3-425 Soil microcosm 2.1 +
3-426 Soil microcosm 2.1 +
3-427 Soil microcosm 2.1 +
3-428 Soil microcosm 2.1 +
C 66 Soil mesocosm 1.8
C 120 Soil mesocosm 2.1 +
C 126 Soil mesocosm 2.3 +
C 129 Soil mesocosm 5
C 131 Soil mesocosm 3.0/2.1 +
C 132 Soil mesocosm 2.1 +
C 159 Soil mesocosm 5
144 Field soil 1.4/2.9/3.5 +
253 Field soil 1.3
260 Field soil 5
263 Field soil 1.4/2.9/3.5 +
267 Field soil 2.1 +
268 Field soil 1.4/2.1/2.9 +
269 Field soil 5
858 Field soil 1.2 +
972 Field soil 1.1 +
The transposition modules tniABQC (Rådström et al., 1994)
of the Tn402-like transposons were 3
truncated to a different
FIGURE 2 | The common plasmid backbone of the completely
sequenced IncP-1ε plasmids pHH128, pKJK5, pKS77, pHH3414, and
pHH3408. The two insertion sites of accessory elements within the gene
parA are indicated.
extent, and replaced by a more or less truncated derivative of
the tetracycline resistance transposon Tn1721, except for plasmid
pHH3408 (Figure 3). All Tn402-related transposons were flanked
by inverted and direct repeats. Interestingly, a fragment of the
IncP-1α oriV was found in plasmid pHH128 and pKS77 adjacent
to IS1326, suggesting recombination between these incompatible
plasmids.
DISCUSSION
Independent isolations of IncP-1ε plasmids and their detection in
total community DNA by quantitative PCR showed that these plas-
mids are widely distributed in agricultural soils and pig manure.
Previous attempts to detect IncP-1 plasmids in total community
DNA from various environments must have missed this plasmid
group as the trfA sequence of IncP-1ε plasmids shared less than
75% sequence identity in the region used for probes generated
from RP4 or R751 (Götz et al., 1996). The present study adds 50
novel plasmids to this subgroup which was previously proposed
by Bahl et al. (2009) based on two representatives. Very recently,
three other IncP-1ε plasmids exogenously isolated from Norwe-
gian agricultural soils were completely sequenced(Sen et al., 2011).
In contrast to the completely sequenced plasmids of our study,
the backbone genes of the Norwegian plasmids were considerably
divergent from those of the reference plasmid pKJK5. They did
not carry integrons, while on all exogenously isolated plasmids of
the present study class 1 integron components (intI1, sul1,gene
cassettes) were detected. With the exception of plasmid pKS77, all
plasmids were captured based on the SDZ resistance conferred to
www.frontiersin.org January 2012 | Volume 3 | Article 2 | 5
Heuer et al. IncP-1ε plasmids in agricultural systems
FIGURE 3 | Accessory regions of the completely sequenced IncP-1ε plasmids pHH128, pKJK5, pKS77, pHH3414, and pHH3408. Homologous regions are
indicated by framed areas. Inverted repeats of the transposable elements are indicated by rectangles, target site duplications (direct repeats) are indicated by
closed ovals.
E. coli CV601gfp. Therefore the finding that all IncP-1ε plasmids
carried a class 1 integron might be not too surprising as these inte-
grons often carry a sul1 gene. In contrast, the Norwegian plasmids
were captured based on the mercury resistance that they confer to
the recipient (Sen et al., 2011).
Although restriction analysis of plasmid DNA indicated a
remarkable diversity of the plasmids captured in our study, the
complete sequence determined for four of the plasmids showed
that the backbones comprising modules for replication, parti-
tioning and regulation, mating pair formation and conjugative
transfer, and a region of unknown function were almost identical
with the backbone sequence of the reference plasmid pKJK5. The
identity of the backbone and of insertion sites suggested a very
recent spread from a common ancestor. As previously reported
for pKJK5, a fragment of the IncP-1α oriV was found in plasmid
pHH128 and pKS77 adjacent to IS1326, indicating recombina-
tion between incompatible plasmids. This finding is in agreement
with other evidence in IncP-1 genome sequences that recombina-
tion between IncP-1 plasmids is occurring despite incompatibility
(Schlüter et al., 2003; Norberg et al., 2011).
One of the drawbacks of exogenous isolation directly from soil
bacteria is that the original hosts remain unknown. Therefore, E.
coli CV601gfp carrying plasmid pHH3414 was introduced into soil
planted with A. caven. The soil was amended with manure to stim-
ulate plasmid transfer processes. Plasmid pHH3414 was chosen as
the level of soil bacteria resistant toward tetracycline and SDZ
was relatively low. After 4 weeks the numbers of the gfp-tagged E.
coli significantly dropped and gfp negative colonies with Tc and
SDZ phenotype could be picked. Although only cultivable hosts of
IncP-1ε plasmids can be identified using this strategy stable repli-
cation is a prerequisite for detection. The host range determined
in the rhizosphere of A. caven for pHH3414 was mainly confined
to Beta- and Gammaproteobacteria and thus confirms the host
range suggested for IncP-1 plasmids by analyzing the genomic sig-
natures for host identification (Suzuki et al., 2010; Norberg et al.,
2011). Several other strategies were previously used to determine
the host range of plasmid pKJK5. Tagging of both the donor and
the plasmids allowed a cultivation-independent quantification of
donors and transconjugants (Mølbak et al., 2003). In another
study by Mølbak et al. (2007) transconjugants mainly belonged
to the family Enterobacteriaceae or the genus Pseudomonas.In
order to determine the host range of pKJK5 in the rhizosphere
of barley, Musovic et al. (2006) inoculated Pseudomonas putida
harboring lacI
q
with a gfp-tagged pKJK5. Transconjugants were
obtained after sorting by flow cytometry. The identity of puta-
tive transconjugants was determined by cloning and sequencing,
and for the first time conjugal transfer of IncP-1ε plasmids to
Gram-positive bacteria was documented (Arthrobacter). As the
transconjugants have not been cultured, the potential of IncP-1ε
plasmids to replicate in Arthrobacter still needs to be confirmed.
Differences in the spectrum of hosts reported for IncP-1ε plas-
mids might be explained by differences in bacterial community
composition, but the detection methods are also assumed to have
an effect. While homologous recombination might play an impor-
tant role in the adaptation to different host backgrounds, class 1
integron gene cassettes seem to be important drivers of diversifi-
cation to selective pressure posed by antibiotics. This assumption
is further supported by the recent report by Guerin et al. (2009) on
the induction of SOS response by antibiotic exposure, and a 340
times increase of gene cassette excision and integration might be of
great importance. Several studies recently showed that class 1 inte-
gron gene cassettes were introduced via manure bacteria into soil
(Binh et al., 2009; Byrne-Bailey et al., 2009, 2010). The localization
of class 1 integrons on the broad-host range plasmids belonging
to the IncP-1ε group further emphasizes their mobility potential.
Interestingly, several of the gene cassettes previously reported from
manure or manure treated soil, such as aadA, aadB,ororfD (Heuer
and Smalla, 2007; Binh et al., 2009) were also found on IncP-1ε
plasmids. But in contrast to the total community DNA analysis
the size of the amplified gene cassettes was larger than 1.6 kb.
Frontiers in Microbiology | Antimicrobials, Resistance and Chemotherapy January 2012 | Volume 3 | Article 2 | 6
Heuer et al. IncP-1ε plasmids in agricultural systems
This might indicate a bias of the PCR-based amplification of class
1 integron gene cassettes from total community DNA approach
toward smaller fragments.
Plasmids belonging to the IncP-1ε group were captured into
E. coli from soil bacteria in independent experiments. Although
the relative abundance of IncP-1ε plasmids as determined by real-
time quantitative PCR is relatively low and thus would not be
accessible by metagenomic approaches, the ability of these plas-
mids to efficiently transfer allowed their capture by exogenous
plasmid isolation. Furthermore, the novel trfA based quantita-
tive PCR system provided a tool to quantify IncP-1ε plasmid
abundance in total community DNA which showed a correlation
between plasmid abundance and antibiotic selective pressure. In
piggery manures, the relative abundance of IncP-1ε was found to
be high and seemed to be correlated with the size and antibiotic
usage of the pig producing facility. Interestingly the lowest abun-
dance of plasmids belonging to the IncP-1ε group was found in
manure from a pig producing facility that never used antibiotics.
The remarkable diversity of antibiotic resistance gene cassettes
reported in the present study, the ability to efficiently transfer
under soil conditions and the wide host range of IncP-1ε plas-
mids strongly suggest that these plasmids are important vectors
for spreading antibiotic resistances in the agro-ecosystem.
ACKNOWLEDGMENTS
This work was supported by the DFG, in the frame of the
project “Veterinary Medicines in Soils (Forschergruppe 566),
and by grant EF-0627988 from the NSF Microbial Genome
Sequencing Program to Eva Top. We are grateful to the US
Department of Energy Joint Genome Institute for providing the
draft plasmid genome sequences (with special thanks to Brian
Foster, Alla Lapidus, and Kerry Barrie). Their work was sup-
ported by the Office of Science of the US Department of Energy
under Contract No. DE-AC02-05CH11231. We also thank Celeste
Brown for Bioinformatics support and Linda Rogers for technical
assistance.
REFERENCES
Bahl, M. I., Burmolle, M., Meisner,
A., Hansen, L. H., and Sorensen,
S. J. (2009). All IncP-1 plas-
mid subgroups, including the novel
epsilon subgroup, are prevalent in
the influent of a Danish waste-
water treatment plant. Plasmid 62,
134–139.
Bahl, M. I., Hansen, L. H., Goesmann,
A., and Sorensen, S. J. (2007). The
multiple antibiotic resistance IncP-
1 plasmid pKJK5 isolated from a
soil environment is phylogenetically
divergent from members of the pre-
viously established alpha, beta and
delta sub-groups. Plasmid 58, 31–43.
Binh, C. T. T., Heuer, H., Gomes, N. C.
M., Kotzerke, A., Fulle, M., Wilke,
B. M., Schloter, M., and Smalla, K.
(2007). Short-term effects of amox-
icillin on bacterial communities in
manured soil. FEMS Microbiol. Ecol.
62, 290–302.
Binh, C. T. T., Heuer, H., Kaupenjo-
hann, M., and Smalla, K. (2008).
Piggery manure used for soil fertil-
ization is a reservoir for transferable
antibiotic resistance plasmids. FEMS
Microbiol. Ecol. 66, 25–37.
Binh, C. T. T., Heuer, H., Kaupenjo-
hann, M., and Smalla, K. (2009).
Diverse aadA gene cassettes on class
1 integrons introduced into soil via
spread manure. Res. Microbiol. 160,
427–433.
Byrne-Bailey, K. G., Gaze, W. H., Kay,
P., Boxall, A. B., Hawkey, P. M.,
and Wellington, E. M. H. (2009).
Prevalence of sulfonamide resis-
tance genes in bacterial isolates
from manured agricultural soils and
pig slurry in the United Kingdom.
Antimic rob. Agents Chemother. 53,
696–702.
Byrne-Bailey, K. G.,Gaze, W. H., Zhang,
L., Kay, P., Boxall, A. B., Hawkey, P.
M., and Wellington, E. M. H. (2010).
Integron prevalence and diversity in
manured soil. Appl. Environ. Micro-
biol. 77, 684–687.
Couturier, M., Bex, F., Bergquist, P.
L., and Maas, W. K. (1988). Iden-
tification and classification of bac-
terial plasmids. Microbiol. Rev. 52,
375–395.
Götz, A., Pukall, R., Smit, E., Tietze, E.,
Prager, R., Tschäpe, H., van Elsas,
J. D., and Smalla, K. (1996). Detec-
tion and characterization of broad-
host-range plasmids in environmen-
tal bacteria by PCR. Appl. Environ.
Microbiol. 62, 2621–2628.
Guerin, É., Cambray, G., Sanchez-
Alberola, N., Campoy, S., Erill, I., Da
Re, S., Gonzalez-Zorn, B., Barbé, J.,
Ploy, M. C., and Mazel, D. (2009).
The SOS response controls integron
recombination. Science 324, 1034.
Haines, A. S., Akhtar, P., Stephens, E. R.,
Jones, K., Thomas, C. M., Perkins,
C. D., Williams, J. R., Day, M. J.,
and Fry, J. C. (2006). Plasmids from
freshwater environments capable of
lncQ retrotransfer are diverse and
include pQKH54, a new lncP-1 sub-
group archetype. Microbiology 152,
2689–2701.
Heuer, H., Krögerrecklenfort, E.,
Wellington, E. M. H., Egan, S.,
van Elsas, J. D., van Overbeek, L.
S., Collard, J. M., Guillaume, G.,
Karagouni, A. D., Nikolakopoulou,
T. L., and Smalla, K. (2002).
Gentamicin resistance genes in
environmental bacteria: prevalence
and transfer. FEMS Microbiol. Ecol.
42, 289–302.
Heuer, H., Schmitt, H., and Smalla, K.
(2011). Antibiotic resistance gene
spread due to manure application
on agricultural fields. Curr. Opin.
Microbiol. 14, 236–243.
Heuer, H., and Smalla, K. (2007).
Manure and sulfadiazine synergis-
tically increased bacterial antibi-
otic resistance in soil over at least
two months. Environ. Microbiol. 9,
657–666.
Mølbak, L., Licht, T. R., Kvist, T., Kroer,
N., and Andersen, S. R. (2003).
Plasmid transfer from Pseudomonas
putida to the indigenous bacte-
ria on alfalfa sprouts: character-
ization, direct quantification, and
in situ location of transconjugant
cells. Appl. Environ. Microbiol. 69,
5536–5542.
Mølbak, L., Molin, S., and Kroer, N.
(2007). Root growth and exudate
production define the frequency of
horizontal plasmid transfer in the
rhizosphere. FEMS Microbiol. Ecol.
59, 167–176.
Moura,A.,Henriques, I., Smalla, K., and
Correia, A. (2010). Wastewater bac-
terial communities bring together
broad-host range plasmids, inte-
grons and a wide diversity of unchar-
acterized gene cassettes. Res. Micro-
biol. 161, 58–66.
Musovic, S., Oregaard,G.,Kroer, N., and
Sorensen, S. J. (2006). Cultivation-
independent examination of hori-
zontal transfer and host range of
an IncP-1 plasmid among Gram-
positive and Gram-negative bacte-
ria indigenous to the barley rhizos-
phere. Appl. Environ. Microbiol. 72,
6687–6692.
Norberg, P., Bergström, M., Jethava, V.,
Dubhashi, D., and Hermansson, M.
(2011). The IncP-1 plasmid back-
bone adapts to different host bac-
terial species and evolves through
homologous recombination. Nat.
Commun. 2, 268.
Pansegrau, W., Lanka, E., Barth, P.
T., Figurski, D. H., Guiney, D. G.,
Haas, D., Helinski, D. R., Schwab,
H., Stanisich, V. A., and Thomas,
C. M. (1994). Complete nucleotide
sequence of Birmingham IncP-alpha
plasmids compilation and com-
parative analysis. J. Mol. Biol. 239,
623–663.
Rådström, P., Sköld, O., Swedberg,
G., Flensburg, J., Roy, P. H., and
Sundström, L. (1994). Transposon
Tn5090 of plasmid R751, which car-
ries an integron, is related to Tn7,
Mu, and the retroelements. J. Bacte-
riol. 176, 3257–3268.
Schauss, K., Focks, A., Heuer, H.,
Kotzerke, A., Schmitt, H., Thiele-
Bruhn, S., Smalla, K., Wilke, B.
M., Matthies, M., Amelung, W.,
Klasmeier, J., and Schloter, M.
(2009). Analysis, fate and effects of
the antibiotic sulfadiazine in soil
ecosystems. Trends Anal. Chem. 28,
612–618.
Schlüter, A., Heuer, H., Szczepanowski,
R., Forney, L. J., Thomas, C. M.,
Pühler, A., and Top, E. M. (2003).
The 64508 bp IncP-1β antibiotic
multiresistance plasmid pB10 iso-
lated from a waste-water treatment
plant provides evidence for recom-
bination between members of differ-
ent branches of the IncP-1β group.
Microbiology 149, 3139–3153.
Schlüter, A., Szczepanowski, R., Pühler,
A., and Top, E. M. (2007). Genomics
of IncP-1 antibiotic resistance plas-
mids isolated from wastewater treat-
ment plants provides evidence for
a widely accessible drug resistance
gene pool. FEMS Microbiol. Rev. 31,
449–477.
www.frontiersin.org January 2012 | Volume 3 | Article 2 | 7
Heuer et al. IncP-1ε plasmids in agricultural systems
Sen,D.,Van der Auwera,G. A., Rogers, L.
M., Thomas, C. M., Brown, C. J., and
Top, E. M. (2011). Broad-host-range
plasmids from agricultural soils have
IncP-1 backbones with diverseacces-
sory genes. Appl. Environ. Microbiol.
77, 7975–7983.
Smalla, K., Haines, A. S., Jones, K.,
Krögerrecklenfort, E., Heuer, H.,
Schloter, M., and Thomas, C. M.
(2006). Increased abundance of
IncP-1β plasmids and mercury
resistance genes in mercury-
polluted river sediments: first
discovery of IncP-1β plasmids
with a complex mer transposon
as the sole accessory element.
Appl. Environ. Microbiol. 72,
7253–7259.
Smalla, K., Krögerrecklenfort, E., Heuer,
H., Dejonghe, W., Top, E., Osborn,
M., Niewint, J., Tebbe, C., Barr, M.,
Bailey, M., Greated, A., Thomas,
C., Turner, S., Young, P., Niko-
lakopoulou, D., Karagouni, A.,
Wolters, A., van Elsas, J. D., Dronen,
K., Sandaa, R., Borin, S., Brabhu,
J., Grohmann, E., and Sobecky,
P. (2000). PCR-based detection of
mobile genetic elements in total
community DNA. Microbiology 146,
1256–1257.
Suzuki, H., Yano, H., Brown, C. J.,
and Top, E. M. (2010). Predict-
ing plasmid promiscuity based on
genomic signature. J. Bacteriol. 192,
6045–6055.
Suzuki, M. T., Taylor, L. T., and
Delong, E. F. (2000). Quanti-
tative analysis of small-subunit
rRNA genes in mixed micro-
bial populations via 5
-nuclease
assays. Appl. Environ. Microbiol. 66,
4605–4614.
Thomas, C. M. (2000). Paradigms of
plasmid organization. Mol. Micro-
biol. 37, 485–491.
Thorsted,P. A., Macartney, D. P., Akhtar,
P., Haines, A. S., Ali, N., David-
son, P., Stafford, T., Pocklington, M.
J., Pansegrau, W., Wilkins, B. M.,
Lanka, E., and Thomas,C. N. (1998).
Complete sequence of the IncP
beta plasmid R751: implications for
evolution and organisation of the
IncP backbone. J. Mol. Biol. 282,
969–990.
Vedler, E., Vahter, M., and Heinaru, A.
(2004). The completely sequenced
plasmid pEST4011 contains a novel
IncP1 backbone and a catabolic
transposon harboring tfd genes
for 2,4-dichlorophenoxyacetic
acid degradation. J. Bacteriol. 186,
7161–7174.
Conflict of Interest Statement: The
authors declare that the research was
conducted in the absence of any com-
mercial or financial relationships that
could be construed as a potential con-
flict of interest.
Received: 15 November 2011; paper
pending published: 18 December 2011;
accepted: 02 January 2012; published
online: 18 January 2012.
Citation: Heuer H, Binh CTT, Jechalke
S, Kopmann C, Zimmerling U, Kröger-
recklenfort E, Ledger T, González B, Top
E and Smalla K (2012) IncP-1ε plas-
mids are important vectors of antibiotic
resistance genes in agricultural systems:
diversification driven by class 1 integron
gene cassettes. Front. Microbio. 3:2. doi:
10.3389/fmicb.2012.00002
This art icle was submitted to Fron-
tiers in Antimicrobials, Resistance and
Chemotherapy, a specialty of Frontiers in
Microbiology.
Copyright © 2012 Heuer, Binh, Jechalke,
Kopmann, Zimmerling , Krögerrecklen-
fort , Ledger, González, Top and Smalla.
This is an open-access article distributed
under the terms of the Creative Commons
Attribution Non Commercial License,
which permits non-commercial use, dis-
tribution, and reproduction in other
forums, provided the or iginal authors and
source are credited.
Frontiers in Microbiology | Antimicrobials, Resistance and Chemotherapy January 2012 | Volume 3 | Article 2 | 8
    • "The significantly higher abundance of intI1 genes observed in the arable soil post manure application (Fig. 4a ) and the significant correlations between several β-lactam-resistance genes and the abundance of intI1 genes in both soils (Fig. 5) suggested an increased horizontal transfer potential of these ARGs. In particular, the potential for horizontal gene transfer would be higher when the class 1 integrons are located in the transferable IncP-1ε plasmids or other mobility elements (Heuer et al. 2012; Jechalke et al. 2014c; Wolters et al. 2015 ). The class 1 integrons are also important for co-selection and mobilization of other ARGs (apart from β-lactamases), especially when selective pressure by antibiotics is present (Jechalke et al. 2014c ). "
    [Show abstract] [Hide abstract] ABSTRACT: The emerging environmental spread of antibiotic resistance genes (ARGs) and their subsequent acquisition by clinically-relevant microorganisms is a major threat to public health. Animal manure has been recognized as an important reservoir of ARGs, however, the dissemination of manure-derived ARGs and the impacts of manure application on the soil resistome remain obscure. Here, we conducted a microcosm study to assess the temporal succession of total bacteria and a broad-spectrum of ARGs in two contrasting soils following manure application from cattle which had not been treated with antibiotics. High-capacity quantitative PCR detected 52 unique ARGs across all the samples, with β-lactamase as the most dominant ARG type. Several genes of soil indigenous bacteria conferring resistance to β-lactam, which could not be detected in manure, were found to be highly enriched in manure-treated soils, and the level of enrichment was maintained over the entire course of 140 days. The enriched β-lactam resistance genes had significantly positive relationships with the relative abundance of the integrase intI1 gene, suggesting an increasing mobility potential in manure-treated soils. The changes in ARG patterns were accompanied by a significant effect of cattle manure on the total bacterial community compositions. Our study indicates that even in the absence of selective pressure imposed by agricultural use of antibiotics, manure application could still strongly impact the abundance, diversity and mobility potential of a broad spectrum of soil ARGs. Our findings are important for reliable prediction of ARG behaviours in soil environment and development of appropriate strategies to minimise their dissemination.
    Full-text · Article · Dec 2015
    • "Class 1 integrons, which are able to acquire, exchange, and accumulate resistance genes embedded in gene cassettes (Gillings, 2014; Jechalke et al., 2014b ), were frequently found on plasmids of the IncP-1ε group (Heuer et al., 2012). These plasmids are able to efficiently transfer and replicate in a broad range of hosts and are widely spread in clinical and environmental settings, such as agricultural soil and wastewater, where they might be important vectors of antibiotic and heavy metal resistance genes (Schlüter et al., 2007; Sen et al., 2011; Heuer et al., 2012; Popowska and Krawczyk-Balska, 2013). However, in this study no significant positive correlations between relative abundance of resistance genes, class 1 integrons, IncP-1 plasmids and years of irrigation were observed, indicating no enrichment in the soil bacterial community. "
    [Show abstract] [Hide abstract] ABSTRACT: Long-term irrigation with untreated wastewater can lead to an accumulation of antibiotic substances and antibiotic resistance genes in soil. However, little is known so far about effects of wastewater, applied for decades, on the abundance of IncP-1 plasmids and class 1 integrons which may contribute to the accumulation and spread of resistance genes in the environment, and their correlation with heavy metal concentrations. Therefore, a chronosequence of soils that were irrigated with wastewater from 0 to 100 years was sampled in the Mezquital Valley in Mexico in the dry season. The total community DNA was extracted and the absolute and relative abundance (relative to 16S rRNA genes) of antibiotic resistance genes (tet(W), tet(Q), aadA), class 1 integrons (intI1), quaternary ammonium compound resistance genes (qacE+qacEΔ1) and IncP-1 plasmids (korB) were quantified by real-time PCR. Except for intI1 and qacE+qacEΔ1 the abundances of selected genes were below the detection limit in non-irrigated soil. Confirming the results of a previous study, the absolute abundance of 16S rRNA genes in the samples increased significantly over time (linear regression model, p < 0.05) suggesting an increase in bacterial biomass due to repeated irrigation with wastewater. Correspondingly, all tested antibiotic resistance genes as well as intI1 and korB significantly increased in abundance over the period of 100 years of irrigation. In parallel, concentrations of the heavy metals Zn, Cu, Pb, Ni, and Cr significantly increased. However, no significant positive correlations were observed between the relative abundance of selected genes and years of irrigation, indicating no enrichment in the soil bacterial community due to repeated wastewater irrigation or due to a potential co-selection by increasing concentrations of heavy metals.
    Full-text · Article · Mar 2015
    • "Plasmid transfer is believed to be a main mechanism in rapid bacterial adaption to environmental 37 changes (Heuer and Smalla, 2012; Grohmann, 2011; Sørensen et al., 2005). Plasmids can be 2 "
    [Show abstract] [Hide abstract] ABSTRACT: Mobilizable plasmids lack necessary genes for complete conjugation and are therefore non-self-transmissible. Instead, they rely on the conjugation system of conjugal plasmids to be horizontally transferred to new recipients. While community permissiveness, the fraction of a mixed microbial community that can receive self-transmissible conjugal plasmids, has been studied, the intrinsic ability of a community to mobilize plasmids that lack conjugation systems is unexplored. Here, we present a novel framework and experimental method to estimate the mobilization potential of mixed communities. We compare the transfer frequency of a mobilizable plasmid to that of a mobilizing and conjugal plasmid measured for a model strain and for the assayed community. With Pseudomonas putida carrying the gfp-tagged mobilizable RSF1010 plasmid as donor strain, we conducted solid surface mating experiments with either a P. putida strain carrying the mobilizing plasmid RP4 or a model bacterial community that was extracted from the inner walls of a domestic shower conduit. Additionally, we estimated the permissiveness of the same community for RP4 using P. putida as donor strain. The permissiveness of the model community for RP4 (at 1.16x10-4 transconjugants per recipient (T/R)) was similar to that previously measured for soil microbial communities. RSF1010 was mobilized by the model community at a frequency of 1.16x10-5 T/R, only one order of magnitude lower than its permissiveness to RP4. This mobilization frequency is unexpectedly high considering that (i) mobilization requires the presence of mobilizing conjugal plasmids within the permissive fraction of the recipients; (ii) in pure culture experiments with P. putida retromobilization of RSF1010 through RP4 only took place in approximately half of the donors receiving the conjugal plasmid in the first step. Further work is needed to establish how plasmid mobilization potential varies within and across microbial communities.
    Full-text · Article · Dec 2014
Show more