Article

Covalent Attachment of DNA to Agarose. Improved Synthesis and Use in Affinity Chromatography

Authors:
To read the full-text of this research, you can request a copy directly from the authors.

Abstract

DNA has been covalently linked to insoluble matrices of agarose (Sepharose) in high yield using cyanogen bromide activation. Both double-stranded and single-stranded DNA have been coupled with yields up to 225 nmol/mg dry weight Sepharose or 3-8 mumol nucleotide phosphate/ml bed volume. The DNA-Sepharose has been used for (a) the affinity chromatography of various enzymes (Escherichia coli DNA polymerase I and RNA polymerase) from crude extracts or after initial purification steps, resulting in high yields and degrees of purification, and for (b) nucleic acid hybridization. The DNA-Sepharose is stable to high temperature, prolonged storage, and in the case of single-stranded DNA, can be washed with NaOH to destroy nuclease activity and to release any digested oligonucleotides or mononucleotides.

No full-text available

Request Full-text Paper PDF

To read the full-text of this research,
you can request a copy directly from the authors.

... The protein (Fr II; 5,752 mg) was applied to a 200 ml Fast Flow SP Sepharose column (GE Healthcare) equilibrated in Buffer B + 100 mM NaCl, washed with Buffer B and then eluted with a 2000 ml, 100 to 500 mM NaCl gradient in Buffer B. Peak fractions were pooled (FrIII; 210 ml, 147 mg), dialyzed against Buffer B + 100 mM NaCl and then applied to a 60 ml Heparin agarose (Bio-Rad) column equilibrated in Buffer B + 100 mM NaCl. The column was washed with 300 ml of the same buffer before elution with a 600 ml, 100 mM to 500 mM NaCl gradient in Buffer B. Peak fractions containing Mcm4 were pooled (Fr IV, 157 ml, 110 mg) and dialyzed against Buffer B and then 20 mg was applied to a 20 ml single stranded DNA (ssDNA) Sepharose column [59] equilibrated against Buffer B, washed with the same buffer and then eluted with a 200 ml, 0 to 500 mM NaCl gradient in Buffer B. The peak fractions were pooled (FrV, 23 ml, 14 mg) and then dialyzed against Buffer B before being applied to a 1 ml Mono S column equilibrated in Buffer B with 100 mM NaCl. The column was washed in Buffer B with 100 mM NaCl and then eluted with a 20 ml, 100 to 500 mM NaCl gradient in Buffer B. ...
Article
Full-text available
Minichromosome maintenance proteins (Mcm) 2, 3, 4, 5, 6 and 7 are related by sequence and form a variety of complexes that unwind DNA, including Mcm4/6/7. A Mcm4/6/7 trimer forms one half of the Mcm2-7 hexameric ring and can be thought of as the catalytic core of Mcm2-7, the replicative helicase in eukaryotic cells. Oligomeric analysis of Mcm4/6/7 suggests that it forms a hexamer containing two Mcm4/6/7 trimers, however, under certain conditions trimeric Mcm4/6/7 has also been observed. The functional significance of the different Mcm4/6/7 oligomeric states has not been assessed. The results of such an assessment would have implications for studies of both Mcm4/6/7 and Mcm2-7. Here, we show that Saccharomyces cerevisiae Mcm4/6/7 reconstituted from individual subunits exists in an equilibrium of oligomeric forms in which smaller oligomers predominate in the absence of ATP. In addition, we found that ATP, which is required for Mcm4/6/7 activity, shifts the equilibrium towards larger oligomers, likely hexamers of Mcm4/6/7. ATPγS and to a lesser extent ADP also shift the equilibrium towards hexamers. Study of Mcm4/6/7 complexes containing mutations that interfere with the formation of inter-subunit ATP sites (arginine finger mutants) indicates that full activity of Mcm4/6/7 requires all of its ATP sites, which are formed in a hexamer and not a trimer. In keeping with this observation, Mcm4/6/7 binds DNA as a hexamer. The minimal functional unit of Mcm4/6/7 is a hexamer. One of the roles of ATP binding by Mcm4/6/7 may be to stabilize formation of hexamers.
... In brief, the sequence-specific affinity column was prepared as follows: two single-stranded 26-nt oligos, representing the DNaseI-protected region, were chemically synthesized. After gel purification they were annealed leaving a complementary 5' end protruding tetranucleotide: The annealed product was 5' phosphorylated and self-ligated to obtain a 20-met that was covalently attached to a 0.8 ml CNBr-modified Sepharose CL-2B (Pharmacia) according to Arndt et al. (1975). The proteins bound to the column were eluted with 0.8 ml of buffer Z [25 mM HEPES(K + ), pH 7.8/12.5 mM MgC12/I mM DTT/20% (v/v) glycerol/0.1% (v/v) Nonidet P-40/I.0 ...
Article
Full-text available
We have purified, by sequence-specific affinity chromatography, a mitochondrial (mt) matrix protein which binds to the curved DNA located between the replication origin (ori) of the leading strand (ori-H) and the two transcription promoters in the rat mt genome. The protein was characterized by gel electrophoresis as a 67-kDa polypeptide and seems to be involved in the DNA contact on the mt light strand. This protein differs (in the size and location of its DNA-binding site) from other DNA-binding proteins studied so far in animal mt systems. We suggest a role for the 67-kDa protein, assisted by other proteins, in regulating the initiation of leading-strand replication.
... Mcm2-containing fractions from the MonoQ step were pooled (approximately 3 ml, 2.7 mg/ml) and dialyzed overnight against buffer H. The dialysate was applied to a 10-ml ssDNA-Sepharose column, 43 washed with 100 ml of buffer H, and eluted with 100 ml of 0-500 mM NaCl gradient. ...
Article
The essential minichromosome maintenance (Mcm) proteins Mcm2 through Mcm7 likely comprise the replicative helicase in eukaryotes. In addition to Mcm2-7, other subcomplexes, including one comprising Mcm4, Mcm6, and Mcm7, unwind DNA. Using Mcm4/6/7 as a tool, we reveal a role for nucleotide binding by Saccharomyces cerevisiae Mcm2 in modulating DNA binding by Mcm complexes. Previous studies have shown that Mcm2 inhibits DNA unwinding by Mcm4/6/7. Here, we show that interaction of Mcm2 and Mcm4/6/7 is not sufficient for inhibition; rather, Mcm2 requires nucleotides for its regulatory role. An Mcm2 mutant that is defective for ATP hydrolysis (K549A), as well as ATP analogues, was used to show that ADP binding by Mcm2 is required to inhibit DNA binding and unwinding by Mcm4/6/7. This Mcm2-mediated regulation of Mcm4/6/7 is independent of Mcm3/5. Furthermore, the importance of ATP hydrolysis by Mcm2 to the regulation of the native complex was apparent from the altered DNA binding properties of Mcm2(KA)-7. Moreover, together with the finding that Mcm2(K549A) does not support yeast viability, these results indicate that the nucleotide-bound state of Mcm2 is critical in regulating the activities of Mcm4/6/7 and Mcm2-7 complexes.
Article
Human IgG antibodies reacting in the indirect immunofluorescence test with clusters of intracytoplasmic A particles in mouse tissues were analyzed by means of both radioimmunoprecipitation and enzyme-linked immuno-absorbant assays. Generally, antibody-containing sera reacted with epitopes of p14, the nucleic-acid-binding core protein of mouse mammary tumor virus, corresponding to the protein Ap14 of intracytoplasmic A particles. Comparatively few sera reacted with epitopes of the main core protein p28 corresponding to the protein Ap28 of intracytoplasmic A particles. The two types of reactivity occurred independently of each other.
Article
A mitochondrial protein, able to specifically bind two double-stranded homologous sequences of seaurchin mitochondrial DNA, has been partially purified from Paracentrotus lividus eggs. This protein, present at a low concentration, is a polypeptide of 40 kDa. One of the binding sequences, located in the main non-coding region, contains the replication origin of the mitochondrial DNA H-strand. By a combination of band-shift, DNase footprinting, and modification interference analyses with homologous and heterologous probes we identified YCYYATCAN(A/T)RC as the minimum sequence required for the binding. The protein also shows a single-stranded DNA-binding activity, as it is able to specifically interact with one of the strands of the binding sites. These features are consistent with a function of the protein in the modulation of sea-urchin mitochondrial DNA replication during the developmental stages.
Chapter
DNA affinity chromatography has been used for the purification of polynucleotides and polynucleotide-binding proteins, including restriction endonucleases, polymerases, proteins involved in recombination, and various transcription factors (reviewed in [1,2]). The earliest supports used were DNA celluloses. P. T. Gilham pioneered the chemical synthesis of homopolymeric DNA-celluloses such as oligo dT cellulose and their use for purifying polynucleotides, especially polyA mRNA, by hybridization (3). Later, Alberts, Litman, and their coworkers adsorbed DNA to cellulose to purify DNA-binding proteins (4,5). Arnt-Jovin and colleagues (6) attached DNA to agarose and Kadonaga and Tijan (7) introduced the addition of competitor DNA to the mobile phase to lessen nonspecific binding. Various other laboratories have attached DNA to Teflon fibers, latex beads, magnetic particles, and other media for DNA affinity chromatography (reviewed in ref. 1).
Article
The mechanisms underlying a new hybridocytochemical method, which is based on mercurated nucleic acid probes and their binding to sulfhydryl-hapten ligands, have been studied. Furthermore we developed a simple procedure for the preparation of mercurated probes at a microgram scale. Nucleic acids immobilized on Sephadex beads have been immunochemically detected after hybridization with mercurated probes and binding of the sulfhydryl-hapten ligand trinitrophenyl-glutathione. In this system, the method proved to be specific and sensitive. However, the same procedure, when applied in situ, failed to give a positive result. ELISA experiments showed that these results cannot be attributed to a suboptimal immunochemical detection of the ligand. Chromatographic analysis of mercurated polynucleotide-ligand complexes revealed, however, an unexpected lability of the mercury-sulfhydryl bond. Under non-equilibrium conditions, as present during a cytochemical washing procedure, the mercury-sulfhydryl bond was found to dissociate rapidly. On basis of these results the hypothesis was forwarded that the bond between mercurated nucleic acids iminobilized on Sephadex and the ligand was stabilized by the positive charge of the Sephadex matrix. This charge was introduced during the cyanogen bromide activation and inactivation necessary for the covalent coupling of nucleic acids to Sephadex. In situ, however, no such positive charges are present. By reversing the charge of the ligand we expected to stabilize the mercury-sulfhydryl bond. In a subsequent paper data are presented that confirm this hypothesis.
Article
Full-text available
The copolymer of glycidylmethacrylate with ethylene-dimethacrylate, its derivatives, bead cellulose and Sepharose were used for immobilization of DNA via new coupling methods: reaction with oxirane, acylhydrazide hydrazide, and diazonium salt. The susceptibility of immobilized DNA for DNAse was tested. The most efficient immobilization was achieved on carriers with acylhydrazide groups. The binding capacity of the carrier and the susceptibility of immobilized DNA for the DNase depends on the length of the spacer. The immobilized DNA is stable in solution for several weeks, and in the lyophilized state for several months.
Article
The DNA-dependent RNA polymerase II or B (ribonucleotide-triphosphate: RNA nucleotidyl transferase, EC 2.7.7.6) from the Oomycete fungusAchlya ambisexualis has been purified to apparent homogeneity. The purification procedures involve precipitation with polyethylenimine, selective elution of RNA polymerase from the polyethyleneimine precipitate, ammonium sulfate fractionation, DEAE-cellulose chromatography, CM-cellulose chromatography, and chromatography on DNA-Sepharose 4B affinity columns. Utilizing these procedures 3 mg of RNA polymerase II is recovered from 1.6 kg of mycelium (wet weight). Purified RNA polymerase II fromA. ambisexualis was half-maximally inhibited by the mushroom toxin α-amanitin at a concentration of 0.046 μg/ml (5 × 10−8m). A second RNA polymerase activity is half-maximally inhibited at 55.6 μg/ml (6 × 10−5m). RNA polymerase II fromAchlya has 13 subunits with the following molecular weights: 180,000; 140,000; 99,000; 89,000; 69,000; 53,000; 41,000; 35,000; 29,000; 25,000; 19,000; 16,500; and 14,000. With regard to template preference, salt optima, and divalent metal cation optima,Achlya RNA polymerase is quite typical of other eucaryotic RNA polymerases.
Article
A limited coupling reaction between 4-diazobenzoic acid ([14C]carboxyl) and sheared single-stranded DNA was employed to prepare a ligand capable of bonding covalently with aminopentane Sepharose C1-4B. The ligand AzoDNA demonstrated small changes in ultraviolet absorbance spectra yet, unlike the parent DNA, had a distinct fluorescence emission peak at 400 nm when excited at 292 nm in neutral or alkaline solutions. On hydroxyapatite thermal chromatography the AzoDNA eluted as single-stranded DNA, while following catalytic reduction, the associated fluorescence and [14C]azobenzoate radioactivity were removed in large part from the derivatized DNA. In the coupling reaction, prior derivatization of the ligand DNA was required for covalent bonding to aminopentane Sepharose C1-4B and, at optimal polydeoxynucleotide concentrations, about 75 μg was bound/ml of packed gel. DNA:DNA hybridization reactions were accomplished using AzoDNA aminopentane Sepharose C1-4B gels with 50% of the hybridized polynucleotide strands being eluted at temperatures approximating the Tm values measured optically. The use of the AzoDNA gel was extended to the hybridization of adenovirus 2 and vaccinia complementary RNA. The viral complementary RNAs were specifically bound to matrices containing the homologous AzoDNA and eluted under conditions consistent with destabilization of RNA:DNA hybrids. These applications indicate the potential utility of AzoDNA-extensor arm affinity chromatography for the isolation of specific viral RNA molecules.
Article
Two simple procedures for the preparation of DNA fragments covalently and specifically linked to a solid support are presented. The first method consists of the preparation of a nucleoside primer which serves as the initiative site for conventional synthesis of oligomers in either 3' or 5' direction. The second procedure involves the direct attachment of independently synthesized and purified oligomers to a functionalized solid support. The accessibility of such supported oligodeoxynucleotides to enzymes is checked with restriction endonucleases.
Article
Purification of ecdysterone receptor from Drosophila melanogaster to apparent homogeneity is reported. Purified receptor binds specifically to several sequences in the promoters of the developmentally active hsp27 and hsp23 heat shock genes that were previously implied in ecdysterone regulation of the genes and that share limited homology among themselves and with mammalian steroid receptor binding sites. Some of these elements confer ecdysterone regulation on a basal promoter in transfected cells, acting in a synergistic fashion. Transcription in vitro of promoters containing such elements is stimulated up to 100-fold by added purified ecdysterone receptor, depending on receptor dosage and the number of elements present. Transcriptional enhancement requires sequence-specific binding of receptor to template promoters which facilitates the formation of a preinitiation complex. Ecdysterone stimulates DNA binding of the receptor in vitro.
Article
A system consisting of donor (1), template (2) and immobilized acceptor molecules (58,59,64-67) which may be used for an enzymatic extension (T4 DNA ligase) of immobilized DNA fragments is described. The synthesis of the donor (1), template (2) and the functionalized acceptor molecules (3-8) was performed via phosphotriester intermediates. The functionalized acceptor molecules used in this study contained: base labile bonds (i.e. compounds 3-6), an acid labile bond (i.e. compound 7) or a RNase labile bond (i.e. compound 8). The functionalized acceptor molecules (3,4) could be immobilized to cellulose activated with 2,4,6-trichloro-s-triazine and the other molecules (5-8) to 2-amino-4, 6-dichloro-s-triazine to give the immobilized DNA complexes 58, 59 and 64-67, respectively, in high yield. The immobilized DNA fragments could be released quantitatively from the solid support by: base treatment (i.e. 58, 59, 64 and 65 gave DNA-fragments 60, 61, 68 and 69 respectively), acid treatment (i.e. 66 gave DNA-fragment 70) or RNase digestion (i.e. 67 gave deoxythymidine).
Article
Full-text available
An easy and efficient procedure for the immobilization of polynucleotide liganda to bisoxirane activated insoluble polysaccharides has been elaborated and is described in this paper. The resulting materials have been applied to the chromatography of DNA polymarase I, and RNA polymerase from E.coli. Because of their extraordinary stability to temperature, formamide, and alka-line conditions they seem to be particularly useful adsorbents for nucleic acid hybridization.
Article
We describe the partial purification of an endonuclease from calf thymus that nicks phage PM2 DNA irradiated with UV doses producing only a few pyrimidine dimers per molecule. It has much less activity on DNA that has been subjected to enzymatic photoreactivation after UV irradiation. The calf thymus endonuclease is different from other mammalian UV-endonucleases so far described in that it seems to be dimer specific. The enzyme is stimulated by Mg2+ and is inactive in the presence of EDTA. It binds to UV-irradiated DNA-Sepharose from which it is released by low concentrations of KCl. Gel filtration data indicate that the endonuclease may belong to a high molecular weight protein or protein complex. The enzyme is very labile and freezing increases its lability.
Article
Full-length, single-stranded rabbit globin cDNA, synthesized by AMV reverse transcriptase, apparently contains a small double-stranded sequence (hairpin) at the 3' terminus. This cDNA can serve as template-primer for E. coli DNA polymerase I, which synthesizes a strand complementary to the cDNA and covalently bound to it. The loop connecting the two strands can be cut by S1 nuclease. Reassociation, hybridization, and restriction endonuclease studies, as well as electrophoretic analyses, indicate that the sequential actions of reverse transcriptase, DNA polymerase 1, and S1 nuclease generate full-length, double-stranded synthetic globin genes.
Article
We describe a method for linking RNA and DNA covalently to finely divided cellulose through a diazotized aryl amine, which reacts primarily with guanine and uracil (thymine) residues of single strands. The high efficiency of coupling and high capacity of the cellulose for nucleic acid make possible a product with as much as 67 mug of nucleic acid per mg of cellulose. The product is especially suitable for hybridization experiments where very low backgrounds are important, and it is stable in 99% formamide at 80 degrees C so that hybridized nucleic acid can be recovered easily. Full length linear Simian Virus 40 (SV40) DNA, produced by cleavage of SV40(I) DNA with S1 nuclease, can be coupled to diazo cellulose with an efficiency of 80-90%, and is effective in hybridization experiments with SV40 DNA, complementary RNA synthesized in vitro from SV40(I) DNA with E. coli RNA polymerase, and the SV40-specific fraction of total RNA from SV40-infected and transformed cells. In these experiments an excess of cellulose-bound DNA was used, and the efficiency of hybridization was about 90% when ribonuclease treatment of the hybrids was omitted.
Article
Synthesis of cytoplasmic DNA-binding proteins was investigated after a shift from the nonpermissive to the permissive temperature in NRK cells transformed by a temperature-sensitive mutant of Rous sarcoma virus [ts339(RSV)]. Cells were labeled for several generations in [3H]leucine and were pulse-labeled with [35S]methionine for 1 h at the nonpermissive temperature (39 degrees C) and at the permissive temperature (33 degrees C, 5 h after shift from 39 degrees C). Proteins binding to sequential columns of double-stranded and single-stranded DNA-cellulose were examined by polyacrylamide gel electrophoresis in the presence of sodium dodecyl sulfate, and the 35S/3H ratios were obtained for each column fraction and for individual polypeptides. The protein fractions binding to single-stranded, but not double-stranded, DNA and eluting at high salt concentrations (greater than 0.60 M NaCl) showed elevated 35S/3H ratios. This indicated increased synthesis of these proteins within 5 h after the onset of transformation. The majority of the polypeptides in these fractions showed increased synthesis as a consequence of transformation. One prominent polypeptide among them constituted 0.1% of the cytosol protein and had a molecular weight of 93,000. We conclude that the synthesis of proteins binding tightly to single-stranded DNA is increased early after the onset of transformation.
Article
Sequential chromatography on double-stranded DNA and single-stranded DNA columns selects two proteins with marked preference for single-stranded DNA from the complex set of proteins that is released by NaCl from chromatin of cultured hepatoma cells. By a number of criteria, these two proteins appear to be analogous to the calf thymus chromatin proteins HMG-1 and HMG-2.
Article
An Epstein-Barr virus-related herpesvirus, termed Herpesvirus papio (HVP), was isolated from baboons (Papio hamadryas) at the Institute of Experimental Pathology and Therapy, Sukhumi, USSR, where there is a continuing outbreak of lymphoma. In the present study sera from diseased baboons and from age- and sex-matched control animals were examined for antibodies to HVP antigens. Results showed that animals with lymphoid disease had antibodies to HVP virus capsid, early, soluble, and nuclear antigens at higher frequencies and at higher titers than did control animals. Antibody titers were not age- or sex-related. No concordancy was detected for antibodies to soluble and nuclear antigens. The sera were also examined for antibodies to two other widely distributed viruses of hamadryas baboons, cytomegalovirus and foamy virus. The results of these studies did not indicate a disease-related role for either of these viruses.
Article
Early alterations in the synthesis of proteins which bind to single-stranded DNA have been examined following the onset of transformation in NRK cells transformed by a heat-sensitive mutant (ts339) of Rous sarcoma virus. Transformation was initiated by shifting quiescent cultures from non-permissive to permissive temperatures. Cultures were prelabelled with [³H]leucine for several generations at the non-permissive temperature, and with [³⁵S]methionine at times after shift to the permissive temperature. Cytosol extracts were passed through sequential columns of double-stranded and single-stranded DNA bound to cellulose.
Article
We describe a method for the purification of proteins binding to specific DNA sites based on the strong interaction between streptavidin and biotin. We tested the efficiency of this method using the Escherichia coli lactose operon operator-repressor system. dUTP coupled to biotin is incorporated into a DNA fragment containing the lactose operator. A crude E. coli extract is first incubated with the biotinylated fragment and the reaction mixture is filtered on a streptavidin-agarose column. Proteins retained on the column are either eluted alone by high salt or isopropyl β-d-thiogalactoside, or as a complex with the DNA site by enzymatic digestion of the DNA. We thus obtained a 3400-fold enrichment of the repressor complexed to the operator in one step. The method is simple and makes use of commercially available reagents. The large concentration of biotin-binding sites of the streptavidin-agarose matrix (0.1 umol/ml packed gel) provides a very high capacity for the concentration and purification of large amounts of proteins. The advantage of this method for the detection and purification of other DNA-binding proteins is discussed.
Article
A method is described by which specific tRNA isoacceptors may be identified in small amounts of bulk tRNA. The strategy relies on the retention of aminocyl-tRNA by CNBr-Sepharose through covalent coupling of th α-NH2 group of the amino acid to the matix. After removing unbound material by thorough washing, the bound specific isoacceptors are released by cleavage of the labile aminoacyl-tRNA ester bond through mild alkaline treatment. The product is analyzed by two-dimensional gel electrophoresis and the spots obtained may be correlated with the pattern from bulk tRNA. Optimum sensitivity is achieved by combining the method with the recently introduced silver staining technique (gloi, G.L. (1983) Anal. Biochem. 134, 184–188) for tRNA1.
Chapter
The identification of replication proteins in eukaryons has generally been hampered by the complexity of eukaryon chromosomes, the unavailability of appropriate conditional lethal mutations, and an inability to define DNA replication in Vitro as opposed to repair or recombination reactions. As a result, we have initiated a biochemical study on the unicellular green alga, Chlamydomonas reinhartii, since this organism is ideal for cell genetics, biochemical studies, and physiological manipulation in the laboratory (1). Density transfer experiments in Vivo suggest that DNA replication is restricted to a limited portion of either the mitotic or meiotic cell cycles, that DNA repair occurs during normal replication, and that recombination events are limited to meiotic gametes (2–4). Vegetatively grown cells thus appear to contain primarily the enzymes necessary for replication. We have attempted to study the DNA replication proteins by preparing extracts from the cell-wallless mutant, CW-15, of Chlamydomonas and by selecting experimental conditions which favor the formation of high molecular weight complexes which can interact with single stranded DNA. Our approach therefore relies upon observations which have been made on bacterial extracts which contain multienzymatic protein complexes that efficiently duplicate phage chromosomes (5,6).
Article
Nuclear high affinity triiodothyronine binding proteins from rat liver were purified about 500-fold over Triton-washed nuclei by a three-step procedure using gel filtration, DEAE-Sephadex and DNA-Sepharose chromatography. Although unstable, they retain most of the properties exhibited in crude nuclear extract: affinity and stereospecificity for T3, thermolability, molecular size. Furthermore, their isolation from several chromatin constituents under reducing conditions allows their study with decreased aggregation risks.
Chapter
The interactions of E. coli RNA polymerase holoenzyme with the synthetic polynucleotide poly [d (A-s4 T)] have been studied using the filter retention assay. The binary complexes demonstrate high thermodynamic and physical stability, being insensitive to added heparin, high ionic strength, and elevated temperature. The association kinetics are second order and compatible with a diffusion controlled reaction.
Chapter
Affinity chromatography was originally developed as an enzyme purification aid.1 However the potential of the technique was soon recognised, leading to its widespread use for the purification of many biological materials.
Chapter
Recent advances in the purification of DNA-binding proteins have been due primarily to the use of the specific sequence of the binding site as a ligand for affinity chromatography. Different variations of this basic principle have been developed in several laboratories, and all have been found to function effectively.
Article
Full-text available
A set of instruments and specialized equipment is necessary to equip a laboratory to work with DNA. Reducing the barrier to entry for DNA manipulation should enable and encourage new labs to enter the field. We present three examples of open source/DIY technology with significantly reduced costs relative to commercial equipment. This includes a gel scanner, a horizontal PAGE gel mold, and a homogenizer for generating DNA-coated particles. The overall cost savings obtained by using open source/DIY equipment was between 50 and 90%.
Chapter
Publisher Summary This chapter focuses on the proteins that bind preferentially and nonspecifically to single-stranded DNA and have no other (enzymatic) activity. These proteins are essential to many physiological functions, including replication, recombination, and repair, in a host of organisms ranging from bacteriophage to higher eukaryotes. Thus, single-stranded DNA binding proteins represent systems that have evolved substantially beyond primitive precursors, which may only have been capable of direct and uncontrolled nucleic acid binding. The chapter describes molecular aspects of the involvement of DNA binding proteins in entire systems of DNA replication, recombination, and repair. Nature and measurement of DNA–protein interactions along with general purification strategies for single-stranded DNA binding proteins are also presented. In addition, the chapter discusses the ways in which the single-stranded DNA binding proteins have been exploited as tools in molecular biological research, particularly in the electron microscopy of biological macromolecules and in certain biochemical assays. All DNA binding proteins seem to operate stoichiometrically (as opposed to catalytically), in that they are present at intracellular levels sufficient to effectively saturate the single-stranded DNA intermediates produced during replication, recombination, and repair. Binding cooperativity is essential in permitting complete coverage of single-stranded sequences and also in effectively destabilizing the small duplex hairpins formed by intrastrand base pairing in single-stranded DNA.
Article
The recent developments of affinity techniques concerning single- and double-stranded DNA are reviewed. Based on the opinion that the immobilization of DNA is essential for the analytical and preparative use of the ligand function of DNAs, the two items are extensively discussed concerning the choice of conjugation chemistry and supports. Finally, a variety of applications, mainly for sensing and purification, are discussed.
Chapter
The separation and purification of groups of biological macromole-cules, such as enzymes, proteins, nucleic acids, and polysaccharides, by conventional procedures often requires considerable experience and expertise since individual members of the groups may differ only slightly in their physicochemical properties. However, one of the most characteristic properties of biological macromolecules is their ability to bind specifically and reversibly to other biomolecules. The technique of affinity chromatography exploits this formation of specific reversible complexes for the resolution of biological macromolecules.(1–3)
Article
p53 tumor suppressor plays an important role in the regulation of cellular proliferation. To identify proteins regulating the expression of p53 in rat liver, we analyzed p53 promoter by electrophoretic mobility shift assay (EMSA) and DNase I footprinting assay. We found that a protein binds the sequence CACGTG, bHLH consensus sequence in rat p53 promoter. Southwestern blotting analysis with oligonucleotides containing this sequence shows that the molecular weight of the protein is 100 kDa. This size is not compatible with the bHLH family such as USF or c-Myc/Max which is known to regulate the expression of the human and mouse p53 gene. Therefore this 100 kDa protein may be a new protein regulating basal transcription of rat p53. We purified this 100 kDa protein through sequence-specific DNA affinity chromatogaphy.
Article
During fertilization the condensed sperm chromatin rapidly disperses and forms the male pronucleus. The possibility exists that substances which are concerned with chromatin dispersion may be present in the egg prior to insemination. To test for the presence of factors that may induce chromatin decondensation within the egg cytoplasm, a cell-free system was devised in which isolated sperm nuclei were incubated in egg cytosol. Isolated sperm nuclei incubated in egg cytosol underwent nuclear enlargement and spherulation, i.e., increased at least three times that of the original volume of the sperm nucleus. This effect was potentiated, i.e., relatively more protein became associated with sperm nuclei, when sperm nuclei were treated with 0.25 N HCl to extract basic proteins prior to incubation in egg cytosol. Incubation in cytosol from Physarum, transformed NRK cells or Novikoff cells had no effect on the morphology of isolated sperm nuclei. Analysis of the proteins which became associated with acid-extracted sperm nuclei showed that many had the same apparent molecular weight as those associated with male and female pronuclei. Analysis of egg cytosol proteins also indicated that many polypeptides had an affinity for DNA and the same apparent molecular weight as those associated with male and female pronuclei and zygote nuclei.
Article
A DNA-dependent ATPase (molecular weight 68000) has been purified from extracts of . The enzyme shows specificity for single-stranded DNA and for hydrolysis of ATP (Km 0.4 mM). Similarities with the gene product from are discussed.
Article
Nuclei and chromatin were isolated from cell line (TN-368) derived from the ovary of the cabbage looper, Trichoplusia ni. The chromatin proteins were examined by sodium dodecyl sulphate polyacrylamide gel electrophoresis. The non-histone proteins extracted with 0.35 M NaCl from T. ni chromatin were subjected to sequential chromatography on columns containing immobilized double-strand and single-strand DNA. A protein with an apparent mol.wt of 7 × 104 was found to bind preferentially to single-strand DNA.
Article
A non-swellable, highly porous support material -CPG 3000 - was used in building up covalently bound nucleic acids by combined chemical and enzymatic methods. Bases are optimal accessible for hybridization and enzymatic reactions because they are not involved in the linking procedure.
Article
Purification of transcription factor IIIA on internal control region DNA coupled to aldehyde-silica is described and compared with purification on cyanogen bromide-activated Sepharose and Bio-Rad Affi-Gel-10. The Affi-Gel support results in mixed-mode chromatography; both ion-exchange and affinity modes contribute. Coupling DNA to aldehyde-silica is advantageous in that it has no ion-exchange properties and performs as well as DNA coupled to CNBr-activated Sepharose. Purification of lac repressor on aldehyde-silica, and CAAT enhancer binding protein on Affi-Gel also shows the advantages of a neutral support and the disadvantages of mixed-mode chromatography for transcription factor purification. Aldehyde-silica couples to alkylamines and to the amines of adenine, guanine, and cytosine nucleoside bases. Reaction occurs with either single- or double-stranded DNA, although it is less efficient with the latter. Overall, the results demonstrate that predominantly neutral coupling chemistries, such as aldehyde or CNBr-mediated coupling, have distinct advantages for transcription factor purification. Since the CNBr chemistry has not yet been applied to silica supports, aldehyde-silica coupling is currently the most attractive method for DNA affinity HPLC.
Article
We describe a new method for the mapping of mammalian genes, utilizing hybridization of mRNA to DNA of chromosomes. It involves the hydrogen bonding of the polyadenylic acid at the 3′ end of hybridized mRNA to the polyuridylic acid tail of a highly fluorescent latex microsphere. The resultant double hybrid can be visualized by fluorescence microscopy. The chromosomal localization of human α + β globin genes has been explored by this method. Our data point to the long arms of chromosomes 4 and 5 as the loci for the human globin genes.
Article
The first efficient synthesis of solid-anchored DNA oligomers has been realized; it relies on the use of allyl and (allyloxy)carbonyl groups as protectors of internucleotide linkage and nucleoside bases, respectively, in conjunction with palladium chemistry. The preparation is performed via a phosphoramidite approach on controlled pore glass supports with a long-chain alkylamine spacer. The fully protected DNA is deblocked on the solid supports by removal of the allylic protecting groups by treatment with a mixture of the tris(dibenzylideneacetone)dipalladium(0)-chloroform complex, triphenylphosphine, butylamine, and formic acid at 50°C for 0.5-1 h. Exposure of the solid-bound materials to concentrated ammonia at room temperature for 2 h affords free DNAs of excellent purity. The efficiency of this method has been demonstrated by the synthesis of d(5′CAAGTTGATGAACAATACTTCATACCTAAACT3′) (32mer), d(5′TATCGGACACGTAACCCTCCCATGTC-GATGCAAATCTTTAACA 3′) (43mer), and d( 5′TATGGGCCTTTTGATAGGATGCTCACCGAGCAAAACCAAG- AACAACCAGGAGATTTTATT3′) (60mer).
Article
The demonstration that the inhibition of Escherichia coli DNA polymerase I by 1,10-phenanthroline is due to the nicking of DNA by the 1,10-phenanthroline-copper complex of DNA rather than the coordination of tightly bound zinc ion has prompted the reexamination of the metal ion content of PolI and the "Klenow fragment". Both proteins were purified to greater than 95% purity and dialyzed against a Chelex-treated 50 mM Tris-HCl buffer, pH 7.4. Although both enzymes had high specific activities for polymerization, they only contained 0.08-0.20 mol of Zn2+/mol of enzyme upon analysis using atomic absorption spectrophotometry. The 3′-5′ exonuclease activity was also independent of zinc content. The rec A protein of E. coli likewise lacks zinc ions. Although RNA polymerase and the restriction endonuclease EcoRI contain zinc ion, our findings are not consistent with zinc ion serving a unique function in enzymes that use DNA as a substrate. 1,10-Phenanthroline and its metal complexes bind to DNA. Even if the DNA scission reaction of the 1,10-phenanthroline-copper complex is suppressed, this interaction provides another mechanism of inhibition of DNA and RNA polymerase that is not related to the presence of a tightly bound metal ion.
Article
Full-text available
The published data on the main methods for the preparation of polymeric supports containing nucleic acids (NA) or their fragments (oligonucleotides) are reviewed with special emphasis on chemical immobilisation. Some physical and physicochemical immobilisation techniques, including those based on the use of enzymes and avidin–biotin interactions and preparation of NA-containing supports by direct oligonucleotide synthesis on these supports are considered. A special section is devoted to the application of NA-containing sorbents for the isolation of individual NA and proteins as well as in hybridisation analysis including those utilising DNA chips and DNA biosensors. The bibliography includes 391 references.
Article
Full-text available
A simple purification method has been developed for isolation of bovine cGMP phosphodiesterase from photoreceptor rod outer segments. The enzyme is peripherally membrane bound in its native state and is present in relatively high concentrations. In the bovine photoreceptors its molar ratio to rhodopsin can be estimated to be as great as 1:40 and not lower than 1: 170. The isolated enzyme is purified to homogeneity as demonstrated by gel electrophoresis under native and denaturing conditions and analytical ultracentrifuga- Con. The core enzyme has a molecular weight of approximately 170,000, as demonstrated by sucrose gradient centrifugation and analytical ultracentrifugation, and is composed of two major subunits, 88,000 (CY) and 84,000 (p), augmented by a small subunit of 13,000 (y). In its purified state, the enzyme is activated neither by light nor GTP in contrast to the native membranebound enzyme. As isolated, the molar activity of the enzyme is 45 mol of cGMP hydrolized s-’ mol-’ with a Km = 150 PM (cGMP) and Km > 4 XnM (CAMP). Protamine activates the enzyme to 360 mol of cGMP see-’ mol-’ @-fold) and limited digestion by trypsin activates it to as great as 2100 mol of cGMP s-l mol-’ @O-fold). Journal Article
Article
Full-text available
1. RNA polymerase activity of Escherichia coli extracts prepared from cells in exponential and stationary phases of growth, when measured in the presence and absence of external template, showed significant qualitative differences. 2. In both extracts, polymerase activity was higher when assayed with external template, suggesting the presence of a pool of enzyme not bound to cellular DNA. 3. In the crude extract, the fraction of enzyme bound to cellular DNA is higher during the exponential phase of growth. 4. A method is described for the purification of enzyme molecules not tightly bound to cellular DNA from exponential- and stationary-phase cultures. 5. Purified enzyme preparations showed differences in template requirement and subunit composition. 6. On phosphocellulose chromatography of stationary-phase enzyme, a major portion of polymerase activity eluted from the column with 0.25m-KCl. In the case of exponential-phase enzyme, polymerase activity eluted from a phosphocellulose column mainly with 0.35m-KCl. 7. Enzyme assays done with excess of bacteriophage T(4) DNA showed a strong inhibition of stationary-phase enzyme by this template. The exponential-phase enzyme was only slightly inhibited by excess of bacteriophage T(4) DNA.
Article
Full-text available
A rapid procedure involving DNA-cellulose chromatography followed either by sedimentation in a high-salt glycerol gradient or by gel filtration is described for the complete purification of Escherichia coli DNA-dependent RNA polymerase.
Article
Full-text available
This paper describes a method for the purification of Escherichia coli DNA-dependent RNA polymerase which is rapid, reproducible, high in yield, and able to handle preparations using from 1 g to 3 kg of cells. The method involves disruption of the bacterial cells with glass beads in a Waring Blendor, digestion with DNase I, centrifugation to remove ribosomes and debris, fractionation with ammonium sulfate, and chromatography on diethylaminoethyl cellulose, phosphocellulose, and Bio-Gel A-1.5m. Addition of 5% glycerol and 0.1 mm dithiothreitol to all buffers substantially increases the stability of the enzyme throughout the purification. Depending on how cells are grown, 100 to 300 mg of polymerase are obtained from 1 kg of cells. The polymerase is greater than 98% pure and free of contaminating nucleases.
Article
Full-text available
An oligomer of deoxyribothymidylate in 5'-ester linkage to cellulose particles serves as a primer and template for the Escherichia coli DNA polymerase, as a template for RNA polymerase, and as an initiator for the calf thymus terminal deoxynucleotidyltransferase. Synthesis by DNA polymerase of the homopolymer pair, polydeoxyriboadenylate and polydeoxyribothymidylate, takes place when oligodeoxyribothymidylate cellulose is hydrogen-bonded to an oligodeoxyriboadenylate to form a template pair. The product contains deoxythymidylate covalently linked to the cellulose and deoxyadenylate hydrogen-bonded to the deoxythymidylate. Block copolymers formed by transferase extension of an oligonucleotide cellulose can form hybrids with other synthetic polymers according to base pair specificities. Single stranded DNA extended with a homopolymer by terminal transferase can hydrogen bond via the homopolymer region to a complementary derivative of polynucleotide cellulose. Upon replication with DNA polymerase, the product strand is covalently attached to the cellulose. The advantages of the polynucleotide cellulose system include the known polarity of primer and product, the ease of quantitative collection and separation of the insoluble template and complementary product, and the capacity to distinguish between reactions occurring free in solution and those involving components fixed to a solid state matrix.
Article
Full-text available
A deoxyribonucleic acid polymerase from Micrococcus luteus has been isolated by allowing it to bind to its substrate, DNA, attached to a solid matrix of cellulose and subsequent detachment from the DNA by high salt concentrations. This approach has permitted the isolation of a highly purified enzyme by easy and reproducible methods from a partially purified preparation in which the polymerase is only a minor constituent. The enzyme preparations are quite active with DNA primers, almost entirely free of endo- or exonucleases, and extremely stable in the presence of DNA and other nucleotide polymers, or in high salt solution. At low salt concentrations, however, activity is rapidly lost. The active polymerase in high salt has a sedimentation rate of about 7 S. Kinetic studies indicate that the interactions between the polymerase-DNA structure and the deoxynucleoside triphosphates and Mg⁺⁺ or Mn⁺⁺ are complex. It can be calculated from DNA saturation data that there are only one or two sites of initiation on helical linear DNA molecules, and that reinitiation on a synthetic complex does not occur. DNA synthesis stops when a doubling of the added primer is reached.
Article
Full-text available
Forty proteins with polypeptide chains of well characterized molecular weights have been studied by polyacrylamide gel electrophoresis in the presence of sodium dodecyl sulfate following the procedure of Shapiro, Viñuela, and Maizel (Biochem. Biophys. Res. Commun., 28, 815 (1967)). When the electrophoretic mobilities were plotted against the logarithm of the known polypeptide chain molecular weights, a smooth curve was obtained. The results show that the method can be used with great confidence to determine the molecular weights of polypeptide chains for a wide variety of proteins.
Article
This chapter discusses the deoxynucleotide polymerizing enzymes from calf thymus gland. Calf thymus gland is a source of two separate deoxynucleotidyl transferases—DNA polymerase and a terminal deoxynucleotidyl transferase. Both enzymes are conveniently isolated from the same preparative process because separation of the two polymerizing activities is the final purification step. The assays measure the conversion of 14C-deoxynucleoside triphosphate (acid soluble) to l4C-polydeoxynucleotide (acid insoluble) and are applicable at any stage of purification. The DNA polymerase reaction mixtures contain only one labeled triphosphate, and all the four are incorporated in proportion to the base composition of the denatured DNA template used. To obtain total nucleotide incorporation for calf thymus DNA template, multiply 14C-dATP incorporation by 3.4. Other methods of assay, useful after partial purification, are the measurement of pyrophosphate formation and hypochromicity due to polymer formation. Terminal deoxynucleotidyl transferase, isolated from calf thymus gland, may be used to prepare a series of a single-chain polydeoxynucleotides. Replicative deoxynueleotidyl transferase (DNA polymerase), isolated from calf thymus gland, may be used to prepare a series of double-chain polydeoxynucleotides. The availability of procedures for the synthesis of single-chain polydeoxynucleotides with terminal deoxynucleotidyl transferase and the homopolymer complexes with calf thymus DNA polymerase or Escherichia coli DNA polymerase provides material for the degradative synthesis of oligodeoxynueleotides. The chapter also discusses the degradation of single-chain polydeoxynucleotides and double-chain polydeoxynucleotides.
Article
A method for the incorporation of chemically synthesized polynucleotides onto cellulose has been developed. By the polymerization of the appropriate mononucleotides, celluloses have been obtained to which thymidine, deoxyadenosine, or deoxycytidine polymers are attached at one of their ends by covalent linkages. Series of oligonucleotides can be bound to columns of these substituted celluloses in base-pairing complexes of different stabilities and subsequently can be fractionally eluted by using a temperature-gradient technique. The application of this method to separation of complex polynucleotides and to the sequence analysis of nucleic acids is discussed.
Article
The ascorbic acid method of Ammon and Hinsberg, modified by Lowry and associates, has been applied to the determination of phosphorus in whole blood, plasma, serum, and urine. A sensitivity about eight times that of the aminonaphtholsulfonic acid method permits the use of much smaller samples for measurement in conventional cells (as little as 0.15 γ of phosphorus can be determined in ordinary 3-ml. cuvettes.) A comparison with an accepted procedure on a number of samples showed that the ascorbic acid method gave essentially the same results.
Article
A new purification procedure for Escherichia coli DNA polymerase yields about 10 mg of homogeneous enzyme per kg of cell paste, with exonuclease III as a by-product. DNA polymerase consists of a single polypeptide chain of molecular weight 1.09 × 10⁵. This tentative conclusion is based on (a) an unchanged molecular weight after unfolding in solutions containing guanidine hydrochloride and mercaptoethanol, (b) the presence of approximately one residue of NH2-terminal methionine, and (c) the presence of a single zone on polyacrylamide gel electrophoresis in a denaturing solvent at several pH values. The enzyme contains one disulfide bond and a single reactive sulfhydryl group, which can be modified by iodoacetic acid without change in either polymerase or its associated exonuclease activity. There is less than one phosphorus atom per molecule, thus minimizing the possibility of enzyme-associated nucleotide material in stoichiometric amounts.
Article
A rapid assay for endonuclease activity which cleaves high-molecular-weight RNA to acid-precipitable fragments has been developed. RNA is covalently coupled to beaded agarose under conditions that produce relatively few coupling sites. The immobilized RNA can be used qualitatively or semiquantitatively in an assay for endonuclease activity by determining the release of acid-precipitable RNA from the complex. This assay is compared to one employing separation of degraded RNA by gel electrophoresis.
Article
A general method of gene isolation has been developed that involves the chemical linkage of RNA to cellulose by a water-soluble carbodiimide, and the continuous circulation of DNA containing specific sequences complementary to the RNA. The temperature of the cellulose matrix is maintained at 37 degrees (50% formamide, 0.3 M NaCl-0.03 M Na(3) citrate) to allow efficient DNA-RNA interaction in the stationary phase, while unreacted and any reassociated DNA is denatured at 90 degrees and then recirculated into the hybridization chamber. Between 40 and 45% of fragmented (32)P-labeled simian virus (SV)40 DNA was removed from the circulating solution when cellulosebound SV40-specific RNA, assymmetrically transcribed in vitro with Escherichia coli RNA polymerase, was used. In the presence of 10(4)-fold excess of sheared E. coli DNA, nearly half of the [(32)P]SV40 DNA was recovered from the mixture as a DNA-RNA hybrid with negligible contamination by bacterial DNA. The isolation procedure is almost quantitative for the complementary DNA. The efficiency and selectivity of this method permit the isolation of a defined DNA sequence from a large and complex genome.
Article
The use of immobilized nucleic acids and polynucleotides in the study of nucleic acids and their associated enzymes has become widespread in recent years. There are two main areas of application: the fractionation of nucleic acids and polynucleotides through base-paired complex formation and the isolation and purification of nucleic acid-associated enzymes by affinity chromatography. There are now a number of methods for the preparation of immobilized polynucleotides and the potential uses of these materials depend to some extent on the means by which the polymers are attached to the insoluble supports.
Article
DNA and RNA were covalently attached to cellulose and used in a continuous hybridization system to isolate complementary nucleic acid sequences. Simian virus (SV) 40 DNA fragments were stably and efficiently (45-78%) linked to neutral cellulose powder with a water-soluble carbodiimide. SV40 complementary RNA, synthesized in vitro with Escherichia coli RNA polymerase, was securely immobilized onto phosphocellulose powder activated by 1,1′-carbonyldiimidazole. Approximately 60% of input 3H-labeled SV40 cRNA (1 μg), present in a mixture containing 10 mg of unrelated yeast RNA, was selectively isolated using SV40 DNA cellulose. The continuous hybridization system consisted of a SV40 DNA column maintained at 30° and a circulant mixture (50% formamide (v/v), 0.3 M NaCl, 1 mM EDTA, and 0.03 M sodium phosphate (pH 7.0)) cooled to 4°. Complementary 3H-labeled SV40 DNA could be quantitatively isolated in the presence of an excess of unrelated Micrococcus lysodeikticus DNA utilizing a phosphocellulose column, containing unlabeled SV40 cRNA, connected in series to a denaturation column (70°). The thermal stability of labeled SV40 cRNA or DNA hybrid structures with the immobilized species was also evaluated; the Tm values obtained (55-57°) were similar to that determined directly in the circulant mixture for native mouse cell DNA which has a similar G + C content.
Article
This paper describes the isolation and the properties of DNA-dependent RNA polymerase from Lactobacillus curvatus. The enzyme is highly labile and shows a tendency to dissociate into fragments. Therefore, a special purification procedure also suitable for the isolation of labile RNA polymerases from other prokaryotes was developed. Three enzyme species, E (core enzyme), Eσ (full enzyme) and Ey were obtained. The subunit composition corresponds to that of other prokaryote RNA polymerases. In contrast to Escherichia coli enzyme, the β′ subunit (Mr= 145000) has a lower molecular weight than the β subunit (Mr= 151000). The β subunit was identified by its capacity to bind [3H]rifamycin. σ is extremely small (Mr= 44000). y is a peptide chain (Mr= 84000) present once in the Ey monomer. By incomplete dissociation, βα2, β′σ and β′y complexes were obtained. y and σ have never been found together in the same enzyme particle. In contrast to RNA polymerase from E. coli, Eσ from L. curvatus exhibits optimal activity in the presence of Mn2+ as bivalent metal ion. Co2+ and Mg2+ also activate though with considerably lower efficiency. All subunits except y were isolated in pure state. σ was catalytically active. y could only be obtained as a complex with β'. On single-stranded DNA, Eσ and E are equally active. For the transcription of double-stranded DNA, σ is absolutely required. Even the transcription of poly[d(A-T)] σ [d(A-T)] is strongly stimulated by σ. σ from L. curvatus is able to replace σ from E. coli on E. coli core enzyme even for the formation of the stable preinitiation complex. This effect requires Mg2+, that is conditions optimal for the E. coli system. Thus, the core and not σ appears to determine the requirement for the bivalent metal ion. Different double-stranded templates are transcribed with highly different efficiency. The ionic strength optimum is different for different templates. Ey in contrast to E exhibits a low, though significant background activity on double-stranded DNA. It is stimulated by σ to twice the specific activity of Eσ. Thus, σ and y act synergistically though they appear to exclude each other on the core.
Article
Messenger RNA from polysomes of KB-cells was isolated by affinity chromatography on columns of polyuridylic acid covalently linked to Sepharose. The mRNA molecules were retained by the resin apparently via their poly(A) segments by base pairing to the poly(U). Ribosomal RNA and transfer RNA were not retained by the columns and were thus removed from the mRNA. The mRNA was recovered to an extent of 90% and apparently in intact form. This method allows studies of mRNA resulting from unabated synthesis and was used here in studies of the size distribution of different classes of cytoplasmic poly(A)-containing RNA. The presence of poly(A)-containing RNA in the non-polysomal fractions of the cytoplasm was demonstrated. This putative mRNA was shown to constitute about 30% of the total cytoplasmic poly(A)-containing RNA. Also by using the poly (U)-Sepharose technique it was demonstrated that actinomycin D at low concentration, 0.04 μg/ml, supresses the appearance of mRNA on polysomes to an extent of 50%. This low concentration of the drug was previously though to effect only ribosomal RNA synthesis.
Article
Excerpt A fascinating variety of proteins must interact with DNA within the cell in order to make possible such basic genetic processes as DNA replication and repair, DNA recombination, selective gene expression, and mRNA transcription. Before gene function can be precisely defined at the molecular level, many such DNA-associated proteins will have to be individually isolated and characterized. We have developed a general method which should facilitate such analyses. This method, which we call ‘DNA-cellulose chromatography’, relies upon the fact that many of the proteins which function on DNA inside the cell bind tightly to DNA at physiological ionic strengths in vitro. At higher salt concentrations these proteins are reversibly released from the DNA, apparently in an undamaged state. Previously characterized proteins with such binding properties include the E. coli RNA polymerase (J. R. Richardson, 1966b; Pettijohn and Kamiya, 1967) and the lactose and phage λ repressors (Gilbert and Muller-Hill, 1967;...
Article
A new procedure is described for purifying proteins that specifically bind to DNA. DNA is entrapped in polyacrylamide gel particles which can then be used in standard column chromatographic procedures. The method was developed using Escherichia coli DNA polymerase as the test material. The crude enzyme was applied at low ionic strength and eluted at high ionic strength with a 200-fold increase in specific activity on a single passage through the column. The method is versatile and simple and is not restricted to DNA-protein systems. Any macromolecule can be entrapped in the gel particles; these can interact with other large or small molecules in the liquid phase. The gel is stable at elevated temperatures and can therefore be used in hybridization experiments.
Article
Agarose gels containing immobilized single-stranded circular DNA from phage fd or denatured calf thymus DNA were investigated for their use in the affinity chromatography of DNA-binding enzymes. The DNA content of gel fragments is stable under the conventional conditions of enzyme purification. Single-stranded DNA-agarose columns have a high capacity to bind DNA-specific proteins. They were used to differentiate between similar enzymatic activities in DNA-free extracts from Escherichia coli. Preparative purification is described for the following enzymes: E. coli DNA polymerase I, DNA polymerase II, RNA polymerase, exonuclease III and T4 polynucleotide kinase. Enzyme purification was as high as 200-fold, recovery of enzymatic activity was 75–100%.
Article
Poly rI was covalently bound through its terminal 5′-phosphate moiety to Sepharose and then annealed with poly rC to yield insoluble matrix bound poly (rI:rC). The method has no serious deleterious effects on the integrity or biological activity of the double stranded complexes.
Article
Covalently closed circular duplex DNA's are now known to be widespread among living organisms. This DNA structure, originally identified in polyoma viral DNA,(1,2) has been assigned to the mitochondrial DNA's in ox(3) and sheep heart,(4) in mouse and chicken liver,(3) and in unfertilized sea urchin egg.(5) The animal viral DNA's--polyoma, SV40,(6) rabbit(7) and human(8) papilloma--the intracellular forms of the bacterial viral DNA's φX174,(9,10) lambda,(11,12) M13,(13) and P22(14) -- and a bacterial plasmid DNA, the colicinogenic factor E2,(15) have all been shown to exist as closed circular duplexes. Other mitochondrial DNA's(16,17) and a portion of the DNA from boar sperm(18) have been reported to be circular, but as yet have not been shown to be covalently closed.
Article
The covalent coupling of deoxy- and ribonucleic acids to the agarose derived matrix activated with cyanogen bromide has been investigated. It has been found that whereas single-stranded DNA can be easily attached to agarose, double-stranded DNA binds with very low efficiency. However, introduction of single-stranded ends into a double-stranded molecule permits covalent attachment to agarose. Similarly, the covalent binding of single-stranded RNA to agarose can be effectively accomplished. tRNA which contains double-stranded regions, attaches very poorly by this technique. However, the predominantly double-stranded RNA obtained from reovirus was bound with high efficiency. Experiments with DNA polymerase obtained from HeLa cells showed that DNA attached to agarose was about 50-fold more efficient in binding the enzyme than a corresponding DNA-cellulose matrix.
Article
A new and versatile method for the incorporation of nucleotides, polynucleotides, and nucleic acids onto cellulose has been developed. The method involves specific activation of the terminal monosubstituted phosphate or polyphosphate group of the nucleotide or polynucleotide (in aqueous solution at pH 6) in the presence of cellulose chromatographic paper. The activation is brought about by N-cyclohexyl-N′-β-(4-methylmorpholinium)ethyl carbodiimide p-toluenesulfonate and the condensation with the cellulose is achieved by a novel technique in which the reaction mixture is concentrated within the fibers of the cellulose. The products of the reaction are considered to consist of nucleotides or polynucleotides connected to the cellulose by ester linkages between the terminal phosphate or polyphosphate groups of the nucleotide chains and the sterically favored hydroxyl groups of the cellulose. The reaction has been applied to a variety of nucleotides, polynucleotides, and nucleic acids, containing terminal phosphate, diphosphate, or triphosphate groups, and the yields of incorporation have varied from 15 to 71%. Polynucleotide celluloses prepared by this method are expected to be of some value in the study of those enzymes which are concerned with the synthesis or degradation of nucleic acids. In addition, the capacity of the method to readily incorporate nucleotides and polynucleotides onto an insoluble support should permit the development of new methods for the chemical and enzymatic synthesis of polynucleotides as well as new techniques for the fractionation and sequence analysis of polynucleotides from natural sources.
Article
Biologically active proteins and polypeptides can be coupled by various means to cellulose, starch and cross-linked polysaccharide gels such as `Sephadex'. The use of cyanogen halides for this purpose gives a high yield of bound polypeptide or protein which retains a substantial part of its activity.
Article
WE have reported a method for transforming polysaccharides into reactive derivatives useful for coupling proteins to carbohydrates1 which consists in treating the polysaccharide with cyanogen halide. Imino carbonic acid esters are probably formed and these react with the primary amino groups of proteins and other substances. This method of activation and coupling is gentle and therefore particularly useful for the production of immunosorbents and insoluble enzymes.
Abstr. Commun. 9th Meet. Fed. Eur. Biochem. Soc
  • W. Bähr
  • T. M. Jovin
  • R M Litman
Litman, R. M. (1968) J. Biol. Chem. 243, 6222-6233.
  • A L Shapiro
  • E Vinuela
  • J V Maizel
Shapiro, A. L., Vinuela, E. & Maizel, J. V. (1967) Biochem.
  • W Mcclure
  • T M Jovin
McClure, W. & Jovin, T. M. (1975) J. Biol. Chem. in press. Lehrach, H. (1974) Doctoral Thesis, University of
  • M G Sevag
  • D B Lackman
  • J Smolens
Sevag, M. G., Lackman, D. B. & Smolens, J. (1938) J. Biol.
  • T M Jovin
  • A Kornberg
Jovin, T. M. & Kornberg, A. (1968) J. Biol. Chem. 243, 250- Gilham, P. T. (1964) J. Am. Chem. Soc. 86, 4982.
  • U Lindberg
  • T Persson
Lindberg, U. & Persson, T. (1972) Eur. J. Biochem. 31, 246- Gilham, P. T. (1974) Adv. Exp. Med. Biol. 42,173 -185.
  • F J Bollum
Bollum, F. J. (1968) Methods Enzymol. 12B, 591-611.
Abteilung Molekulare Biologie, Max-Planck-Institut fur Biophysikalische Chemie
  • D J Arndt-Jovin
  • T M Jovin
  • W Bahr
  • M Marquardt
D. J. Arndt-Jovin, T. M. Jovin, W. Bahr, and M. Marquardt, Abteilung Molekulare Biologie, Max-Planck-Institut fur Biophysikalische Chemie, D-3400 Gottingen, Postfach 968, Federal Republic of Germany A. M. Frischauf, Department of Chemistry, Harvard University, 12 Oxford Street, Cambridge, Massachusetts, U.S.A. 01238
Cold Spring Harbor Symp
  • B M Alberts
  • F J Amodie
  • M Jenkins
  • E D Gutmann
  • F J Ferris
  • U Lindberg
  • T Persson
Lindberg, U. & Persson, T. (1972) Eur. J. Biochem. 31, 246-Gilham, P. T. (1974) Adv. Exp. Med. Biol. 42,173 -185.
  • T M Jovin
  • P T Englund
  • L L Bertsch
Jovin, T. M., Englund, P. T. & Bertsch, L. L. (1969) J. Biol.
  • T M Jovin
  • A Kornberg
Jovin, T. M. & Kornberg, A. (1968) J. Biol. Chem. 243, 250Gilham, P. T. (1964) J. Am. Chem. Soc. 86, 4982.
  • M V Berridge
  • A I Aronson
Berridge, M. V. & Aronson, A. I. (1973) Anal. Biochem. 53, Phdrmacia Fine Chemicals AB, Affinity Chromatography. Principles and Methods (1974) pp. 45-46, Rahms i Lund, Sweden.
  • W Mcclure
  • T M Jovin
McClure, W. & Jovin, T. M. (1975) J. Biol. Chem. in press. Lehrach, H. (1974) Doctoral Thesis, University of Braun
  • K Weber
  • M Osborn
  • W Mcclure
  • T M Jovin
Weber, K. & Osborn, M. (1969) J. Biol. Chem. 244,4406. McClure, W. & Jovin, T. M. (1975) J. Biol. Chem. in press. Lehrach, H. (1974) Doctoral Thesis, University of Braun-Bahr, W. & Jovin, T. M. (1974) Abstr. Commun. 9th Meet.
  • M V Berridge
  • A I Aronson
  • Sweden Rahms I Lund
  • H Lehrach
  • A M Frischauf
  • K H Scheit
Berridge, M. V. & Aronson, A. I. (1973) Anal. Biochem. 53, Phdrmacia Fine Chemicals AB, Affinity Chromatography. Principles and Methods (1974) pp. 45-46, Rahms i Lund, Sweden. Lehrach, H., Frischauf, A. M. & Scheit, K. H. submitted for publication.