Article

A rapid method for determining sequences in DNA by primed synthesis with DNA polymerase

Authors:
To read the full-text of this research, you can request a copy directly from the authors.

Abstract

A simple and rapid method for determining nucleotide sequences in single-stranded DNA by primed synthesis with DNA polymerase is described. It depends on the use of Escherichia coli DNA polymerase I and DNA polymerase from bacteriophage T4 under conditions of different limiting nucleoside triphosphates and concurrent fractionation of the products according to size by ionophoresis on acrylamide gels. The method was used to determine two sequences in bacteriophage φX174 DNA using the synthetic decanucleotide A-G-A-A-A-T-A-A-A-A and a restriction enzyme digestion product as primers.

No full-text available

Request Full-text Paper PDF

To read the full-text of this research,
you can request a copy directly from the authors.

... com) and NEB Builder (nebuilder.neb.com). Furthermore, plasmid JAQP was sequenced according to the Colson and Sanger technique (Sanger and Coulson 1975). All primers used for sequencing are in Table S4. ...
... Furthermore, the genomic DNA of both regions was amplified by PCR, purified and then sequenced according to the Colson and Sanger technique (Sanger and Coulson 1975). The primers used are on Table S4. ...
Article
Full-text available
Gallic acid is a powerful antioxidant with multiple therapeutic applications, usually obtained from the acidic hydrolysis of tannins produced by many plants. As this process generates a considerable amount of toxic waste, the use of tannases or tannase-producing microorganisms has become a greener alternative over the last years. However, their high costs still impose some barriers for industrial scalability, requiring solutions that could be both greener and cost-effective. Since Pseudomonas putida KT2440 is a powerful degrader of gallic acid, its metabolism offers pathways that can be engineered to produce it from cheap and renewable carbon sources, such as the crude glycerol generated in biodiesel units. In this study, a synthetic operon with the heterologous genes aroG4, quiC and pobA* was developed and expressed in P. putida, based on an in silico analysis of possible metabolic routes, resulting in no production. Then, the sequences pcaHG and galTAPR were deleted from the genome of this strain to avoid the degradation of gallic acid and its main intermediate, the protocatechuic acid. This mutant was transformed with the vector containing the synthetic operon and was finally able to convert glycerol into gallic acid. Production assays in shaker showed a final concentration of 346.7 ± 0.004 mg L −1 gallic acid after 72 h.
... The "first generation" of gene-sequencing technology was born with the advent of the chain-termination method described by Sanger and Coulson (1975) and the chain-degradation method described by Maxam and Gilbert (1977). Gilbert and Sanger built the first sequencer in 1977 and used it to sequence the first Frontiers in Microbiology | www.frontiersin.org ...
Article
Full-text available
A body temperature >38.3°C that lasts ≥3 weeks and lacks a clear diagnosis after 1 week of standard hospital examination and treatment is called "fever of unknown origin" (FUO). The main causes of FUO are infections, hematological diseases, autoimmune diseases, and other non-infectious inflammatory diseases. In recent years, quantitative metagenomics next-generation sequencing (Q-mNGS) has been used widely to detect pathogenic microorganisms, especially in the contribution of rare or new (e.g., severe acute respiratory syndrome-coronavirus-2) pathogens. This review addresses the undetermined cause of fever and its evaluation by Q-mNGS.
... Shotgun sequencing is a random sampling process that requires large amount of sampling to ensure that a given nucleotide is represented in the reconstructed sequence. Shotgun sequencing is a classical chain termination method (Sanger method) that is based on the selective incorporation of chain-terminating dideoxynucleotides by DNA polymerase during in vitro DNA replication (Sanger & Coulson, 1975). But nowadays, this method is incorporated with highthroughput sequencing for large-scale automated genome analysis. ...
Chapter
Genomics could also be defined as the analysis of an organism complete DNA sequence (Bustamante, De La Vega, & Burchard, 2011; Hardison, 2003). The suffix omics when added to protein, genome, transcriptome, and metabolome make a sense and study of respective fields such as proteomics, genomics, transcriptomics, and metabolomics. Genomics is the study of whole genome of an organism which uses a combination of recombinant DNA, DNA sequenc-ing methods, and bioinformatics to sequence, assemble, and analyze the structure and functions of genomes. Most importantly, genomics focuses on interactions between loci and alleles within the genomes. It also deals with other interactions like epistasis, pleiotropy, and heterosis (Fig. 5.1)(Ogbe et al., 2016; Cooper, Kaufman, & Ward, 2003). The work on genomics and next-generation sequencing technology is pioneered by Fred Sanger. Fred Sanger and his colleagues established the technique of sequencing, genome mapping, data storage, and bioinformatics analysis between 1970 and 1980. This work paved the establishment of Human genome Project in 1990 and completed with the publica-tion of complete human genome sequence in 2003 (http://www.ebi.ac.uk/)
... net/ tools/ conte st16s). The resultant sequence was found to be identical to one generated using the Sanger method (Sanger and Coulson 1975). The 16S rRNA gene sequences were compared with corresponding sequences of the type strains of Actinospica, Actinocrinis and Catenulispora species taken from the EZBioCloud webserver following multiple sequence alignment using MUSCLE software (Edgar 2010). ...
Article
Full-text available
A polyphasic study was designed to resolve the taxonomic position of isolate MGRD01-02 T which was recovered from an acidic hot spring in Indonesia and assigned to the genus Actinospica . Phylogenetic analyses based on 16S rRNA gene sequences show that the isolate is most closely related to the type strains of Actinospica acidiphila (98.5%), Actinospica robiniae (97.8%) and Actinospica durhamensis (96.8%). Morphological and chemotaxonomic data underpin the assignment of the isolate to the genus Actinospica as it forms an extensively branched substrate mycelium which carries tufts of white aerial hyphae that differentiate into straight to flexuous chains of cylindrical spores with faint rugose surfaces, contains 2,6-diamino-3-hydroxydiaminopimelic acid in the peptidoglycan, mixtures of hydrogenated menaquinones with nine isoprene units, iso- C 15:O and iso -C 16:O as major fatty acids and phosphatidylethanolamine as the diagnostic phospholipid. Whole-genome sequence analyses show that the isolate, A. durhamensis CSCA 57 T and Actinocrinis puniceicyclus DSM 45168 T have genome sizes of 7.9, 9.6 and 6.7 Mbp, respectively. A phylogenomic tree shows that they form distinct branches in a well-supported clade, a result supported by associated phenotypic data. Average nucleotide identity and digital DNA:DNA hybridization similarities are below the recommended thresholds for assigning strains to the same species; they also indicate that isolate MGRD01-02 T is most closely related to the A. durhamensis and A. robiniae strains. Corresponding amino acid identity and conserved protein data not only support these relationships but also confirm the taxonomic integrity of the genus Actinocrinis . Based on these results, it is proposed that isolate MGRD01-02 T (= CCMM B1308 T = ICEBB-09 T = NCIMB 15218 T ) be classified in the genus Actinospica as Actinospica acidithermotolerans sp. nov. The draft genome of the isolate and its closest phylogenomic neighbours contain biosynthetic gene clusters with the potential to produce new natural products, notably antibiotics.
... En los años 70, se inició la carrera de la secuenciación del ADN mediante el método Sanger, que usaba dideoxinucleótidos que interrumpían la polimerización del ADN dando lugar a fragmentos de diferente longitud a partir de los que se deducía la secuencia [1]. Posteriormente, a finales de los 90´s, se emplearon dideoxinucleótidos marcados con diferentes colorantes, lo que agilizó la lectura del ADN; permitiendo leer secuencias de hasta 1000 bases de forma automática. ...
Article
Full-text available
El Proyecto ENCODE (Encyclopedia of DNA Elements) fue considerado como una continuación del Proyecto Genoma Humano (PGH) que tenía como objetivo identificar todos los elementos funcionales en el genoma y profundizar en el análisis de la expresión del gen y su complejidad. A pesar de los cientos de miles de proteínas presentes en el ser humano únicamente 20.000 genes habían sido descritos. El objetivo principal del proyecto ENCODE era determinar el papel del resto del componente del genoma, excluyendo las regiones codificantes o genes. Sin embargo, partir de ENCODE, en la nueva era posgenómica, se evidenciaron nuevos fenómenos moleculares relacionados con el genoma y localizados en el núcleo de la célula (incluyendo las variaciones de copia del genoma, los genes de fusión, los fenómenos de pleiotropía, la herencia epigenética, la epitranscriptómica, las epimutaciones, los daños del ADN, la transmisión transgeneracional de información ambiental o la agrupación del ADN en una cuádruple hélice) o no relacionados con el genoma y localizados en el citoplasma celular (incluyendo la herencia mediada por material extra-genómico, las modificaciones postraduccionales de proteínas, la presencia de glucógenos y la regulación de ARNt nuclear, cloroplástico y mitocondrial) que cuestionan el concepto de gen y el Dogma Central de la Biología Molecular (DCBM). Estos nuevos fenómenos que discutiremos a continuación han supuesto una nueva perspectiva molecular del gen y del DCBM.
... scRNAseq is a fairly new technology, as the latest innovation in a series of sequencing applications. The first sequencing method was invented by Sanger in the seventies [87,88], based on the principle of chain termination: the nucleotide polymerisation mix contains deoxynucleotide triphosphates (dNTPs) as well as di-deoxynucleotide triphosphates (ddNTPs) that will be randomly incorporated in the newly synthesised DNA fragment, and interrupt the synthesis. The ddNTPs are labelled, either with fluorescence or radioactivity. ...
Thesis
Single-cell ARN sequencing (scRNAseq) is a fairly young technique. It makes a snapshot of a single-cell transcriptome. After a slow start, its usage became more systemic. Indeed, the richness of the data enables a fine dissection of a living organism’s biology. It gives access to an unprecedented amount of information to better understand cell heterogeneity, or quantify the differences between physiological and pathological states. However, the single-cell approach is a double-edged sword. In spite of its democratisation, the wet lab part is still perfectible, as we are currently only able to capture 5 to 20% of the reads. Regarding the computer process, it is challenging: scRNAseq data is noisy as its effective dimension is high, and because of the incomplete capture.Because scRNAseq is still a young technique, not enough time elapsed for analysis stan- dards to emerge. On the contrary, there is an exponential increase in the number of ana- lytical tools. However, there is a common pipeline: load the genes × cells count matrix -or its transpose-, filter out outlier cells and genes, normalise and reduce the dimension. From the data projected onto a smaller subspace, the next steps can be clustering, trajectory inference or visualisation. Finally, the different clusters or trajectory nodes are annotated. This last step, where we interpret the data, is critical but unfortunately often biased.In this thesis, I focused on two aspects of the analysis of scRNAseq data: a methodological aspect, and the interpretation step.First, I studied dimensional noise, alternatively called the curse of dimensionality. The curse complicates the analysis. It blurs the differences between close and far away data points. Since analysing scRNAseq relies heavily on the production of neighbor graphs, the performance will be degraded by the curse, which distorts the graphs. The usual trick is to reduce the dimension. However, the blurring, or concentration, of distances is not the only effect of dimensional noise. An additional phenomenon called the hubness phenomenon is also detrimental to the analysis as it distorts nearest neighbors graphs. While measure concentration cannot be corrected in high dimensional spaces, hubness can. I quantified the magnitude of the hubness phenomenon in omics data, and the effect of correcting for hubness on the performance of scRNAseq analysis. scRNAseq data is indeed "hubby", especially the datasets with a high intrinsic dimension. The performance when analysing the latter would be improved upon hubness correction, with the best performance reached in the space with the highest effective dimension. I reckon that it might be perceived as just another tool in the already existing jungle, but I believe that the change of paradigm is really interesting, as we modified conceptually one of the most performed step of the analysis, the dimension reduction.Second, I focused more specifically on T cells, through the prism of regulatory T cells. Those cells have a precise functional definition, while there is no strong consensus on the population’s markers for humans. I hypothesized that there might be a decorrelation between function and phenotype and I decided to extend my study to all T cells, since the lineage paradigm is also questionable here. I did a supervised analysis of scRNAseq data in order to better unveil T cells’ functionality. After defining functional modules, I can link each cell to its function/s. First, I assessed the novelty of the approach, by comparing it to the unsupervised pipeline. Then, I characterized the functional differences between T cells from a healthy or a cancer tissue. We also implemented this method to analyse dendritic cells from Covid-19 patients, scoring functions exerted by dendritic cells. This strategy can be applied for other immune cells, other diseases, and even in a physiological setting, so as to functionally map immune cells.
... The genomic DNA of transformed plants was extracted from young leaves using the CTAB method [42]. The target sites of the T 0 , T 1 , and T 2 generations were sequenced using the Sanger method [43]. The PCR products were detected using agarose gel electrophoresis. ...
Article
Full-text available
The type of soft rice with low amylose content (AC) is more and more favored by consumers for its better eating and cooking quality, as people’s quality of life continuously improves in China. The Wx gene regulates the AC of rice grains, thus affecting the degree of softness of the rice. Mei Meng B (MMB), Tian Kang B (TKB), and DR462 are three indica rice maintained lines with good morphological characters, but also with undesirably high AC. Therefore, CRISPR/Cas9 technology was used to edit the Wx gene of these lines to create a batch of soft rice breeding materials. New gene-edited lines MMB-10-2, TKB-21-12, and DR462-9-9, derived from the above parental lines, respectively, were selected in the T2 generations, with an AC of 17.2%, 16.8%, and 17.8%, and gel consistency (GC) of 78.6 mm, 77.4 mm, and 79.6 mm, respectively. The rapid viscosity analysis (RVA) spectrum showed that the three edited lines had a better eating quality as compared to the corresponding wild type, and showing new characteristics, different from the high-quality soft rice popular in the market. There was no significant difference in the main agronomic traits in the three edited lines compared to the corresponding wild types. Moreover, the chalkiness of DR462-9-9 was reduced, resulting in an improved appearance of its polished rice. The present study created soft rice germplasms for breeding improved quality hybrid rice, without changing the excellent traits of their corresponding wild type varieties.
... Further modification of PCR into a quantitative format (qPCR) by Higuchi et al. in 1993 has enabled accurate determination of pathogen loads in clinical specimens (18). Additionally, the automation of the Sanger sequencing method by Leroy Hood and Michael Hunkapillar at Applied Biosystems in 1987 rendered the rapid generation of complete genome sequences of Haemophilus influenzae (19) and Mycoplasma genitalium (20) a reality (21). ...
Article
Full-text available
Clinical microbiology has possessed a marvelous past, an important present and a bright future. Western medicine modernization started with the discovery of bacterial pathogens, and from then, clinical bacteriology became a cornerstone of diagnostics. Today, clinical microbiology uses standard techniques including Gram stain morphology, in vitro culture, antigen and antibody assays, and molecular biology both to establish a diagnosis and monitor the progression of microbial infections. Clinical microbiology has played a critical role in pathogen detection and characterization for emerging infectious diseases as evidenced by the ongoing COVID-19 pandemic. Revolutionary changes are on the way in clinical microbiology with the application of “-omic” techniques, including transcriptomics and metabolomics, and optimization of clinical practice configurations to improve outcomes of patients with infectious diseases.
... They were made possible by the development of NGS technologies, which became available between 2004 and 2006 (Hu et al. 2021). Less expensive and with much higher throughput than the Sanger method (Sanger and Coulson 1975;Sanger et al. 1977), NGS methods have made it possible to carry out high-density and high-throughput genotyping, i.e., with good genome coverage in large populations, at an affordable cost. SNP arrays have been developed in several tropical perennial crops and plantation trees, with, for example, a 200 K array in oil palm (Kwong et al. 2016), a 60 K array in eucalyptus (Silva-Junior et al. 2015), and a 15 K array in cacao (McElroy et al. 2018). ...
Article
Full-text available
subject of many GS articles. In this review, we discuss the factors that affect GS accuracy (statistical models, linkage disequilibrium, information concerning markers, relatedness between training and target populations, the size of the training population, and trait heritability) and the genetic gain expected in these species. The impact of GS will be particularly strong in tropical perennial crops and plantation trees as they have long breeding cycles and constrained selection intensity. Future GS prospects are also discussed. High-throughput phenotyping will allow constructing of large training populations and implementing of phenomic selection. Optimized modeling is needed for longitudinal traits and multi-environment trials. The use of multi-omics, haploblocks, and structural variants will enable going beyond single-locus genotype data. Innovative statistical approaches, like artificial neural networks, are expected to efficiently handle the increasing amounts of heterogeneous multi-scale data. Targeted recombinations on sites identified from profiles of marker effects have the potential to further increase genetic gain. GS can also aid re-domestication and introgression breeding. Finally, GS consortia will play an important role in making the best of these opportunities. Abstract To overcome the multiple challenges currently faced by agriculture, such as climate change and soil deterioration, more efficient plant breeding strategies are required. Genomic selection (GS) is crucial for the genetic improvement of quantitative traits, as it can increase selection intensity, shorten the generation interval, and improve selection accuracy for traits that are difficult to phenotype. Tropical perennial crops and plantation trees are of major economic importance and have consequently been the Supplementary Information The online version contains supplementary material available at https:// doi.
... The resulting amplicons were visualized via electrophoresis in a 0.8% agarose gel, purified based on the ammonium and ethanol purification protocol (Fregel et al., 2010), and diluted and quantified to the desired concentration for sequencing (12 ng/μL) via fluorometry. The successfully amplified samples were sent to the SSiGMol Molecular Lab, Genetic Institute, National University of Colombia, for Sanger sequencing (Sanger & Coulson, 1975). ...
Article
The spectacled caiman (Caiman crocodilus) is currently considered to be a species complex due to the relatively high morphological and molecular diversity expressed across its range. One of the populations of interest, inhabiting the Apaporis River (Colombia), was described based on skull features as an incipient species (C. c. apaporiensis) and has been treated by some authors as a full species. Recent molecular work challenged this hypothesis, because relatively low mitochondrial molecular differentiation was found between the morphologically described Apaporis caiman and C. crocodilus (s.s.) Amazonian populations. Here, we present an update on the topic based on a larger molecular sample size and on analysis of expanded geometric morphometric data that include six newly collected skulls. Morphometric data support the existence of previously recognized morphotypes within the complex in Colombia and demonstrate that the newly collected material can be assigned to the classic Apaporis caiman morphotype. However, our expanded genetic analysis fails to find appreciable mitochondrial molecular divergence of the Apaporis caiman population from the C. c. crocodilus population (COI-CytB: Amazon Peru 0.17 ± 0.06%, CytB-only: Caquetá River Colombia 0.08 ± 0.07%). The Apaporis caiman is interpreted to be a phenotypically distinct member of the cis-Andean C. crocodilus metapopulation that has not yet achieved (or may not be undergoing at all) appreciable genetic differentiation. Thus, it should not be considered a fully independent evolutionary lineage, nor given full species rank.
... To obtain approximate identities of all stone-dwelling bacterial isolates, partial sequences corresponding to the mid-region of isolate 16S genes were obtained by Sanger Sequencing [15] through Genewiz according to the service guidelines (Genewiz Inc., South Plainfield, NJ) and using primer 907r (5'-CCG-TCA-ATT-CCT-TTR-AGT-TT-3'), as described previously [16]. Partial sequences were aligned with the 16S ribosomal RNA sequence (Bacteria and Archaea) database using the Basic Local Alignment Search Tool (BLAST), through blastn Version 2.7.1 (NCBI, Bethesda, MD). ...
Article
Full-text available
Metagenomic analysis of stone microbiome from samples collected in New England, USA and Tamil Nadu, India identified numerous Actinobacteria including Geodermatphilaceae. A culture-dependent approach was performed as a companion study with this culture-independent metagenomic analysis of these stone samples and resulted in the isolation of eleven Geodermatphilaceae strains (2 Geodermatophilus and 9 Blastococcus strains). The genomes of the 11 Geodermatphilaceae strains were sequenced and analyzed. The genomes for the two Geodermatophilus isolates, DF1-2 and TF2-6, were 4.45 and 4.75 Mb, respectively, while the Blastococcus genomes ranged in size from 3.98 to 5.48 Mb. Phylogenetic analysis, digital DNA:DNA hybridization (dDDH), and comparisons of the average nucleotide identities (ANI) suggest the isolates represent novel Geodermatophilus and Blastococcus species. Functional analysis of the Geodermatphilaceae genomes provides insight on the stone microbiome niche.
... DNA sequencing methods have a history of only 60 years back, but these methods evolved very rapidly and can be said an outstanding example of progress resulting in enormous improvement and enhancement in cost reduction, high throughput, capability, and applications [1][2][3]. History of DNA sequencing started when two fundamental methods, i.e., Sanger sequencing [4] and Maxam and Gilbert's approach [5], were introduced. Developments in polymerize chain reaction [6,7], availability of good quality enzymes to modify DNA, and fluorescent automated sequencing enabled to sequence first human genome in 2001 [8,9]. ...
Article
Full-text available
Background: Next-generation sequencing methods have been developed and proposed to investigate any query in genomics or clinical activity involving DNA. Technical advancement in these sequencing methods has enhanced sequencing volume to several billion nucleotides within a very short time and low cost. During the last few years, the usage of the latest DNA sequencing platforms in a large number of research projects helped to improve the sequencing methods and technologies, thus enabling a wide variety of research/review publications and applications of sequencing technologies. Objective: The proposed study is aimed at highlighting the most fast and accurate NGS instruments developed by various companies by comparing output per hour, quality of the reads, maximum read length, reads per run, and their applications in various domains. This will help research institutions and biological/clinical laboratories to choose the sequencing instrument best suited to their environment. The end users will have a general overview about the history of the sequencing technologies, latest developments, and improvements made in the sequencing technologies till now. Results: The proposed study, based on previous studies and manufacturers' descriptions, highlighted that in terms of output per hour, Nanopore PromethION outperformed all sequencers. BGI was on the second position, and Illumina was on the third position. Conclusion: The proposed study investigated various sequencing instruments and highlighted that, overall, Nanopore PromethION is the fastest sequencing approach. BGI and Nanopore can beat Illumina, which is currently the most popular sequencing company. With respect to quality, Ion Torrent NGS instruments are on the top of the list, Illumina is on the second position, and BGI DNB is on the third position. Secondly, memory- and time-saving algorithms and databases need to be developed to analyze data produced by the 3rd- and 4th-generation sequencing methods. This study will help people to adopt the best suited sequencing platform for their research work, clinical or diagnostic activities.
... Bacterial community identification based on massive parallel sequencing of partial 16S rRNA gene sequences is a widely used and effective method [70][71][72][73][74][75]. In contrast, using a culture-dependent approach, almost the whole 16S rRNA gene sequence of isolated bacteria can be determined, one at a time, using the Sanger sequencing method with an appropriate primer pair [76]. For fungi, the nuclear rRNA internal transcribed spacer (ITS) regions exhibits the highest probability of correct identification for a wide number of fungal lineages [77]. ...
Thesis
Full-text available
Ambient air pollution is one of the serious problems our world is currently facing, exerting wide-ranging and deleterious effects on the environment and on our health. It is most pronounced in high-traffic environments such as urban areas where substantial quantities of airborne pollutants, including particulate matter (PM) and volatile organic compounds (VOCs), are generated. While technological improvements and stricter emission regulations have contributed to a decrease in traffic-related emissions of airborne pollutants, current emission abatement strategies are not sufficient to cope with the global threat of air pollution and there remains a strong demand for effective solutions to be developed. This doctoral research contributes to meet this demand by exploring the use of plants and their associated microorganisms to detoxify airborne pollutants. We provide an in-depth analysis of the phylloplane microbiome associated with Hedera helix (ivy), an evergreen plant known for its hardiness and climbing ability, including a comprehensive study of the influence of ambient air pollution on the leaf communities. We present a thorough taxonomic description of the microbial communities living on H. helix leaves, which we show to be dominated by the phyla Proteobacteria, Actinobacteria, Bacteroidetes, Firmicutes, Ascomycota, and Basidiomycota, and the genera Hymenobacter, Sphingomonas, Pseudomonas, Methylobacterium, Massilia, Pantoea, Cryptococcus, Davidiella, Mycosphaerella, Sporobolomyces, Kabatiella, and Rhodotorula. We also evaluated the culturability of this habitat using five different growth media, and present a collection of microbial phylloplane isolates underrepresented in current databases, including the characterization of PGP profiles, trace metal resistance, and pollutant degradation potential. In a pilot phase, we started with investigating if ambient air pollution has the potential to influence the structure and function of bacterial communities in the phylloplane of H. helix. Our results indicated that ambient air pollution increases the metabolic versatility of microbial leaf communities and the prevalence of bacterial functional traits affiliated to an increased fitness in a polluted environment. Continuing on these results, we designed a field study with a duration of two years where we sampled a total of 4,320 H. helix leaves at six locations exposed to different ambient air pollution conditions. We performed eight sampling events, one in every season, from autumn 2017 until summer 2019. Daily we monitored ambient black carbon (BC), PM2.5, PM10, nitrogen dioxide, and ozone concentrations and found that ambient air pollution led to a 2- to 7-fold increase of BC that was present on the sampled leaves, the phylloplane BC load. Our results further indicated this phylloplane BC load strongly correlates with the diversity of bacterial and fungal H. helix leaf communities, impacting this diversity even more than seasonal effects and suggesting that ambient air pollution significantly contributes to the shaping of bacterial and fungal ivy leaf communities. Further, we focus on the phylloplane-associated Microbacteriaceae genera Curtobacterium, Rathayibacter, Frigoribacterium, and Frondihabitans in a genus-level pangenomic approach and propose updated phylogenies. We show that phylloplane bacteria have primarily invested in genomic features related to interactions with their environment, among which osmoregulation, ion transport, uptake and metabolism of various nutrients, and signal transduction, reflecting key adaptations to bacterial life in the harsh conditions of the phylloplane. Lastly, we present six phylloplane microorganisms that were isolated from an air-polluted environment and able to metabolize diesel fuel. Three of these isolates, Bacillus licheniformis VSD4, Pseudomonas sp. VS38, and Rhodotorula sp. VS67, also degraded the fossil fuel-related VOCs benzene, toluene, and/or xylene (BTX), and constitute promising candidates as inoculants towards (phyllo)remediation applications.
... A phylogenetic tree was also constructed using BLAST to show strain relatedness of the bacteria (Sanger and Coulson, 1975). ...
Article
Full-text available
Indoor air contains large number of airborne microorganisms such as bacteria and fungi and their estimation is important for use as index of cleanliness for any particular environment and to determine the relation they bear on human health. This study was aimed at determining the bacteriological air quality of the living rooms in some selected Staff Quarters in University of Benin and University of Benin Teaching Hospital. The airborne bacterial loads of indoor air in the living rooms of Twelve (12) Staff Quarters in University of Benin and University of Benin Teaching Hospital both in Benin City were determined using the Settle Plate methods. The houses were categorized as Apartment 1 which represents University of Benin Junior Staff Quarters (JSQ), Apartment 2 which represents University of Benin Teaching Hospital Quarters, and Apartment 3 which represents University of Benin Senior Staff Quarters (SSQ). The living rooms were sampled twice a month between April, 2017 and September, 2017. The airborne samples were studied using standard microbiological methods and Polymerase Chain Reaction and 16S rRNA techniques were used for the gene sequencing. The antibiotic susceptibility pattern and plasmid profile of the characterized airborne bacterial isolates were evaluated using spread plate and agarose gel electrophoresis methods. The temperature and relative humidity of the indoor air environment in the sampled areas in the living rooms were determined using the thermometer and hygrometer respectively. The mean indoor temperature and relative humidity for Apartments 1, 2 and 3 ranged from 26.10 ± 1.19 0 C to 31.20 ± 0.87 0 C and 81 ± 2.70% to 87 ± 1.89% respectively. The mean indoor airborne bacterial counts in Apartment 1 and Apartment 3 ranged between 1.00 x 10 3 ± 0cfu/m 3 to 4.42 x 10 3 ± 1.42cfu/m 3 and 1.09 x 10 3 ± 0.09cfu/m 3 to 5.17 x 10 3 ± 3.17cfu/m 3 respectively. In Apartment 2, the counts ranged from 1.00 x 10 3 ± 0.00cfu/m 3 to 6.99 x 10 3 ± 4.69cfu/m 3. The difference in the airborne bacterial counts obtained in the morning and afternoon period of study in Apartment 1 was statistically significant (P<0.05) while Apartments 2 and 3 showed no significant differences respectively (P>0.05). Ten airborne bacterial isolates were characterized, further characterization by molecular techniques, confirmed them to be identified as Staphylococcus aureus strain S33 R, Bacillus subtilis subsp. strain 168, Oceanobacillus manasiensis strain YD3-56, Streptomyces vietnamensis strain GIM4.0001, Actinosynnema pretiosum strain C-15003, Micrococcus caseolyticus strain 235, Ornithinibacillus composti strain GSS05 and Bacillus ectoiniformans strain NE-14. General and personal hygienic practices are important for healthy living, and living rooms used for close contact interactions and good ventilation.
... Sequencing of the PCR-product was performed according to the method established by Sanger and colleagues [35,36] using M13 primers and the ABI-Prism 3100 Genetic Analyzer (PE Applied Biosystems, Rodgau-Jügesheim, Germany). Alignment of the 16s rRNA gene fragment of D. orale to other related microorganisms was performed using the algorithm Megablast (National Center for Biotechnology Information, Maryland, USA, http://www.ncbi.nlm. ...
... Any other clinical features related to PHP and PPHP were not observed in the patients. Both twins share the same de novo pathogenic mutation in the GNAS locus (n565-568delGACT, exon 7), detected in the blood through Sanger sequencing (20). The mutation was absent in both parents. ...
Article
Full-text available
Background Progressive osseous heteroplasia (POH) is an ultrarare genetic disorder characterized by an inactivating mutation in the GNAS gene that causes heterotopic ossification. Inhibition of the mammalian target of the rapamycin (mTOR) signalling pathway has been proposed as a therapy for progressive bone fibrodysplasia and non-genetic forms of bone heteroplasia. Herein, we describe the impact of using Everolimus as a rescue therapy for an identical twin girl exhibiting an aggressive clinical phenotype of POH. Methods Clinical evaluation of the progression of the disease during Everolimus treatment was performed periodically. Cytokine markers involved in bone metabolism and protein markers related to bone activity were analyzed to explore bone turnover activity. Results The patient received Everolimus therapy for 36 weeks. During treatment, no clinical improvement of the disease was perceived. Analysis of biochemical parameters, namely, β-CTX ( r ² = −0.576, P -value = 0.016) and PNIP ( r ² = −0.598, P -value = 0.011), indicated that bone turnover activity was significantly reduced. Additionally, bone metabolism-related biomarkers showed only a significant positive correlation with PTH levels. Conclusions Everolimus treatment did not modify the clinical progression of the disease in an aggressive form of POH, although an impact on the protein markers studied was observed.
... L'utilisation des données moléculaires pour délimiter les espèces remonte à la fin des années 1960, faisant suite à la démocratisation des techniques de biologie moléculaire. L'hybridation ADN-ADN, une technique mesurant le degré de similarité génétique entre deux pools de séquences ADN (Brenner et al. 1969;Rosselló-Mora 2006), a alors largement été utilisée pour différencier les espèces bactériennes (Wayne et al. 1987 (Sanger et Coulson 1975;Sanger et al. 1977) et de la théorie de la coalescence (Kingman 1982) a conduit au développement de critères de délimitation des espèces basés sur les modèles observés dans les arbres génétiques. Le critère d'exclusivité ou de monophylie réciproque, selon lequel tous les individus d'une même espèce forment un groupe monophylétique dans l'arbre, a ainsi été proposé (Baum et Donoghue 1995;Palumbi et al. 2001). ...
Thesis
Dans un contexte de changements globaux et de déclin des récifs coralliens, mieux comprendre les processus qui régissent ces écosystèmes, afin de mieux les conserver, s’avère crucial. Cela nécessite de connaître ce sur quoi nous travaillons, d’estimer correctement la biodiversité, et donc de convenablement délimiter les espèces. C’est d’autant plus essentiel pour les coraux scléractiniaires, principaux bio-constructeurs des récifs coralliens, et donc indispensables à leur maintien. Pourtant, ces organismes, et notamment le genre Pocillopora, représentent de véritables défis taxinomiques à travers, d’une part, l’absence de caractères macromorphologiques diagnostiques fiables, et d’autre part la difficulté à résoudre les relations phylogénétiques entre individus. Toutefois, les récents progrès des techniques de séquençage à haut-débit et de la bioinformatique permettent désormais d’augmenter considérablement le nombre de marqueurs génétiques, ce qui semble prometteur pour résoudre les phylogénies complexes. Ces travaux de thèse portent ainsi sur la diversité et la connectivité génétiques des coraux du genre Pocillopora dans l’Indo-Pacifique, à l’aide de données génomiques. Dans un premier temps, les limites d’espèces au sein du genre ont été réexplorées à partir d’analyses basées sur plusieurs centaines d’individus et plusieurs milliers de marqueurs génétiques (SNPs), conduisant à la définition de 21 hypothèses d’espèces. Ces dernières ont ensuite été confrontées à d’autres critères (génétiques, morphologiques, biogéographiques et symbiotiques), afin d’aller vers une délimitation robuste et intégrative de 13 espèces distinctes, là où seulement sept sont reconnues par la taxinomie actuelle. Une révision taxinomique du genre Pocillopora apparaît donc plus que nécessaire. Au-delà de cet aspect, la définition claire des espèces permet d’identifier les unités de base pour des études de connectivité génétique, et donc de mieux comprendre les flux de gènes entre populations d’une même espèce. Ainsi, dans un second temps, la diversité et la structuration génétiques des populations de quatre espèces de Pocillopora du Sud-Ouest de l’océan Indien (P. acuta, P. cf. meandrina, P. cf. verrucosa et P. villosa nomen nudum) ont été étudiées. L’utilisation de données génomiques a également permis de retracer leurs histoires démographiques. Cette approche multi-spécifique a mis en évidence des patrons de structuration et des histoires démographiques semblables entre les quatre espèces, bien que présentant des traits d’histoire de vie différents. Les populations de ces espèces ont donc probablement été soumises aux mêmes contraintes et y ont réagi de la même manière, tendance qui devrait persévérer avec les changements actuels. Enfin, la variabilité génétique intra-coloniale a été étudiée au sein de plusieurs populations du corail P. acuta à La Réunion (Sud-Ouest de l’océan Indien). Les résultats suggèrent un phénomène fréquent (touchant plus de 50% des colonies), et bien que la plupart des variations alléliques intra-coloniales soient non codantes ou silencieuses, la diversité des gènes et des fonctions biologiques impactés n’en reste pas moins élevée. Ce phénomène joue donc un rôle clé dans la diversité génétique et le potentiel adaptatif des populations. Ainsi, dans son ensemble, cette thèse offre un aperçu hiérarchisé de la diversité génétique au sein du genre Pocillopora, en partant du genre lui-même, pour aller jusqu’aux individus, en passant par les espèces et les populations. Elle permet une meilleure compréhension des processus de diversification et de structuration génétiques, qui pourront, à terme, aider à mettre en place des mesures de conservation adaptées à ces organismes.
... Genomic DNA of T 1 transgenic plants was used as the template to perform PCR amplification using Cas9 specific primer (Cas9F: CACGAGGTCCGACAAGAACA and Cas9R: ACCTTGCGAACAGTAGCGAA), and the Cas9 free plants were selected for further study. To examine the deletion details, PCR fragments amplified with the specific primer pairs surrounding the designed target site from Cas9-free homozygous plants were sequenced by the Sanger sequencing [65]. ...
Article
Full-text available
Type-B response regulator proteins in rice contain a conserved receiver domain, followed by a GARP DNA binding domain and a longer C-terminus. Some type-B response regulators such as RR21, RR22 and RR23 are involved in the development of rice leaf, root, flower and trichome. In this study, to evaluate the application potential of type-B response regulators in rice genetic improvement, thirteen type-B response regulator genes in rice were respectively knocked out by using CRISPR/Cas9 genome editing technology. Two guide RNAs (gRNAs) were simultaneously expressed on a knockout vector to mutate one gene. T0 transformed plants were used to screen the plants with deletion of large DNA fragments through PCR with specific primers. The mutants of CRISPR/Cas9 gene editing were detected by Cas9 specific primer in the T1 generation, and homozygous mutants without Cas9 were screened, whose target regions were confirmed by sequencing. Mutant materials of 12 OsRRs were obtained, except for RR24. Preliminary phenotypic observation revealed variations of various important traits in different mutant materials, including plant height, tiller number, tillering angle, heading date, panicle length and yield. The osrr30 mutant in the T2 generation was then further examined. As a result, the heading date of the osrr30 mutant was delayed by about 18 d, while the yield was increased by about 30%, and the chalkiness was significantly reduced compared with those of the wild-type under field high temperature stress. These results indicated that osrr30 has great application value in rice breeding. Our findings suggest that it is feasible to perform genetic improvement of rice by editing the type-B response regulators.
... En 1975 Frederik Sanger (1918-2013) desarrolló en la Universidad de Cambridge la metodología de secuenciación de ácidos nucleicos (121), que le hiciera merecedor en 1980 a un segundo premio Nobel de Química, la cual pese a haberse descrito variantes y automatizado dando lugar a plataformas muy robustas, continua siendo el estándar de oro de estas técnicas, gracias a las cuales ha mejorado enormemente el conocimiento del genoma, contribuyendo en forma decisiva la investigación biomédica y más recientemente al diagnóstico de un sinnúmero de enfermedades (122). ...
Article
Full-text available
Los avances en el ámbito de la patología y cirugía realizados entre 1500 y 1750 sirvieron como base para su desarrollo en los siglos XVIII y XIX, comprendiendo la naturaleza y composición macroscópica y microscópica de los tumores benignos y malignos. Desde entonces, los conceptos se volvieron a enfocar desde el órgano al tejido y a la célula, afectando el nacimiento de la histopatología que ha dominado esta ciencia durante siglo y medio. Luego, cuando el segundo milenio se acercaba a su fin, nuevas y poderosas tecnologías comenzaron a forzar una nueva revisión de las ideas alrededor de la patología convencional, desde las enfermedades basadas en alteraciones celulares hacia las enfermedades basadas en genes, pasando por el estudio de moléculas individuales y su interacción. El auge de la medicina de precisión comenzó en la década de 1980 con el desarrollo de la inmunohistoquímica. Este método permitió a los patólogos investigar rápidamente la expresión de proteínas en piezas obtenidas de muestras quirúrgicas. Estos niveles de expresión pronto serían relevantes para las subclasificaciones de los tumores que no eran accesibles por la microscopía óptica clásica. Recientemente, la introducción de la patología molecular tuvo un impacto positivo en el manejo de los pacientes con cáncer, especialmente para seleccionar terapias dirigidas y permitir el uso de técnicas como las biopsias líquidas que establecieron un nuevo estándar para los regímenes de monitorización continua durante el curso de la enfermedad. Esta técnica permite la detección de las recurrencias de la enfermedad antes que la radiología, lo que permite adaptar las terapias con anticipación. Además, también puede detectarse el desarrollo de mutaciones somáticas asociadas con la resistencia a las intervenciones realizadas.
... Modern genome sequencing methods started when Sanger et al. elaborated on the plus-minus method developed in 1975 (Sanger & Coulson, 1975) by incorporating random chain-terminating radiolabeled dideoxynucleotides (ddNTPs) during primed DNA synthesis (Sanger et al., 1977a). Since ddNTPs lack 3 hydroxyl groups, the new chain could no longer be extended once ddNTPs were incorporated into the strand ( Fig. 2.1). ...
Chapter
The enormous volume of data related to the production, processing, transport, and marketing of food products is created in the food supply chain. Large data are generated from different modalities with different formats and for different purposes in the food supply chain. Due to the heterogeneous nature of data provided by this network of processes and players, data interoperability has become a complex challenge in the food supply chain. Data standardization is a critical foundation for addressing data interoperability challenges by enhancing data governance, data sharing, data quality, semantic interoperability, and data reusability. This paper discusses data interoperability challenges and focuses on semantic interoperability. It reviews several standardization approaches as a pathway to semantic interoperability and optimization of data quality within the food supply chain. This paper also explains the advantages of data standardization and the main barriers that can be overcome by standardization. Additionally, we provide an overview of an applicable case study to explain foodborne outbreak data standardization steps.
... Modern genome sequencing methods started when Sanger et al. elaborated on the plus-minus method developed in 1975 (Sanger & Coulson, 1975) by incorporating random chain-terminating radiolabeled dideoxynucleotides (ddNTPs) during primed DNA synthesis (Sanger et al., 1977a). Since ddNTPs lack 3 hydroxyl groups, the new chain could no longer be extended once ddNTPs were incorporated into the strand ( Fig. 2.1). ...
Chapter
The demand for high-quality food and low-cost production has increased the need to automate and optimize supply chain processes. The recent trends in emerging artificial intelligence technologies offer new solutions for many of the agri-food problems. In the last two decades, many studies on the application of machine learning have successfully improved the speed and/or accuracy of many processes in the food supply chain. This paper provides a brief survey of the application of machine learning techniques to the food supply chain to discuss the challenges such as efficient real-time data collecting, quickly and meaningfully unraveling massive or complex data, and automation of decision-making without human intervention. Moreover, this paper reviews the recent application of machine learning techniques that have already been proposed and applied in food safety, food quality, and food production domains.
Article
Gene editing can modify gene function by inserting or deleting nucleotides in a specific region in a gene, which can alter the desired trait in the plant. In the selection process of gene-editing plants, many populations are created and need to be checked for the edited genes, but traditional gDNA extraction methods are laborious. Here, we used Biocube to extract gDNA and designed a specific primers to identify Cas9 in tomato [marker genes]. Biocubes are directly pressed into plant tissues to absorb and store DNA, and allow for quick and easy gDNA extraction. In this study, using template DNA obtained from tomato (Solanum lycopersicum L.) leaves by the traditional gDNA and the Biocube extraction methods, we confirmed carried DNA and editing in gene-editing plants, and compared the results of the two methods. Template DNA was obtained from cvs. Micro-Tom and M82 by the two extraction methods. Cas9, a gene-specific primer, and rbcl, an internal control, were used in PCR to confirm the presence of carried DNA. To verify the carried DNA, four samples were selected and whole-genome sequencing was performed. High-resolution melting analysis was used to check whether the target gene sequence was edited. Editing was compared using the targeted deep-sequencing results. The results showed no differences between the two gDNA extraction methods. In conclusion, we established a rapid assay for carried DNA and edited sites in gene-editing tomato plants.
Article
Genomes are one of the most essential sensitive molecular biomarkers that are used to be discovered in a very small amount in a sample to identify a specific type of diseases. Since genomics is the science that studies structures, interactions, and functions of all genomes, genomics approach is used to identify genomes as diseases’ biomarkers. However, health informatics approach, especially bioinformatics, has a main rule in data analysis. The purpose of this review is to describe briefly the technologies and methods that are used in both genomics and health informatics approaches to identify these biomarkers. Therefore, this paper is based on a computerized database search. In genomics approach, after collecting samples, first start with extraction and purification of DNA to get a purified DNA that is extracted from the nucleus of cells. Then, DNA amplification is to produce many copies of a specific DNA sequence. Next is sequencing of DNA to determine and read the sequence of nucleic acid sequence in DNA. Once the DNA sequence is determined, the following procedure is the health informatics approach and called bioinformatics pipeline steps, which is DNA data analysis steps. Finally, there are several different techniques and methods of genomics approach to identify a genome as a disease’s biomarker. However, next generation techniques and methods whether extraction, purification, amplification, and sequencing of DNA or bioinformatics pipeline are more accurate, faster, and cheaper from other generation sequencing of genomic approach.
Article
High-quality genome chromosome-scale sequences provide an important basis for genomics downstream analysis, especially the construction of haplotype-resolved and complete genomes, which plays a key role in genome annotation, mutation detection, evolutionary analysis, gene function research, comparative genomics and other aspects. However, genome-wide short-read sequencing is difficult to produce a complete genome in the face of a complex genome with high duplication and multiple heterozygosity. The emergence of long-read sequencing technology has greatly improved the integrity of complex genome assembly. We review a variety of computational methods for complex genome assembly and describe in detail the theories, innovations and shortcomings of collapsed, semi-collapsed and uncollapsed assemblers based on long reads. Among the three methods, uncollapsed assembly is the most correct and complete way to represent genomes. In addition, genome assembly is closely related to haplotype reconstruction, that is uncollapsed assembly realizes haplotype reconstruction, and haplotype reconstruction promotes uncollapsed assembly. We hope that gapless, telomere-to-telomere and accurate assembly of complex genomes can be truly routinely achieved using only a simple process or a single tool in the future.
Article
Full-text available
Patients presenting with degenerative spinal changes are often poor surgical candidates due to associated co-morbidities, frailty, or sarcopenia. Additionally, surgeries of a degenerative spine can prove difficult due to the distortion of normal surgical anatomy. Therefore, many patients are managed conservatively with a variety of modalities, including over-the-counter and prescription medications. Nevertheless, several patients do not experience adequate relief from pain with analgesic medications , precipitating multiple hospital visits, and usage of resources. As a result, back pain is regarded as a major economic burden, with total costs of associated treatment exceeding $100 billion annually. Pharmacogenetics is a relatively novel method of evaluating an individual's response to analgesic medications, through analysis of germline polymorphisms. It entails obtaining a genetic sample, often via buccal swab or peripheral blood sample, and genetic analysis achieved through either polymerase chain reaction +/− Sanger sequencing, microassays, restriction length fragment polymorphism analysis, or genetic library preparation and next generation sequencing. The potential efficacy of pharmacogenetic analysis has been highlighted across several specialities to date. However, a paucity of evidence exists regarding spine surgery populations. Nevertheless, regular prospective pharmacogenetic analysis may ultimately prove beneficial when concerning degenera-tive spinal cohorts due to aforementioned surgical and economic considerations. The purpose of this narrative review is to outline how metaboliser profile variants affect the pharmacokinetics of specific analgesia used to treat back pain, and to discuss the current potential and limitations of employing regular pharmacogenetic analysis for spine surgery populations with degenerative conditions.
Chapter
Public health authorities attempt to delineate foodborne bacterial outbreaks by identifying connected human cases, sources of contaminated food, and contaminated food items. The analysis of whole genome sequences from causative bacterial pathogens is the most accurate way to determine if bacterial isolates are phylogenetically related and are part of the same cluster of cases. In addition to being useful to determine relationships for defining the scope of outbreaks, whole genome sequences can also be used to identify the likely geographic source of an outbreak – although for accuracy this task requires well-maintained databases of whole genome sequences from clinical, environmental, and agricultural isolates. Whole genome sequences also provide useful information on virulence and antimicrobial resistance for the purposes of risk assessment. As whole genome sequencing and bioinformatic tools and technologies continue to advance, it is likely that methods for more rapid detection and source attribution will emerge to the benefit of consumers and industry.
Thesis
Full-text available
Les infections bactériennes intestinales et gastriques par les bactéries du genre Campylobacter et Helicobacter sont très fréquentes: l’une pouvant provoquer des gastro-entérites sévères des suites d’une contamination alimentaire (principalement la viande) et l’autre étant liée au développement d’ulcères ou bien de cancers gastriques. Plus de 200 000 cas de campylobacterioses sont recensés dans l’Union Européenne chaque année, avec comme principale espèce Campylobacter jejuni. De plus, environ 50% de la population mondiale est infectée par Helicobacter pylori. De très nombreuses souches de Campylobacter et de biopsies gastriques sont reçues quotidiennement au CNR des Campylobacters et des Hélicobacters (CNRCH) où y sont menées des analyses telles l’identification de l’espèce et de la résistance aux antibiotiques. Plusieurs méthodes sont mises en place pour étudier ces pathogènes : cultures bactériennes, antibiogrammes, spectromètre de masse MALDI-TOF et extraction d’ADN pour des PCR en temps réel. Malgré la rapidité et le moindre coût de ces méthodes, les utiliser en routine présente des désavantages notamment des identifications d’espèces parfois non concluantes avec le MALDI-TOF ou la difficulté de déterminer les mécanismes moléculaires de résistance. Aujourd’hui, le séquençage haut débit couplé à la bio-informatique permet de générer des données cruciales pour résoudre ces nombreuses problématiques rencontrées en laboratoire. C’est en vue de moderniser les analyses de cas cliniques français effectuées au CNRCH que différents outils et scripts bio-informatiques ont été mis en place mais aussi développés durant ce doctorat. Le principal objectif étant d’enrichir nos connaissances sur ces infections bactériennes : de mettre en évidence des variations dans les séquences d’ADN (gène et mutations) mais aussi protéiques impliquées dans diverses problématiques. Ainsi, il a pu être identifié durant ces trois années : des SNPs (Single Nucleotide Polymorphisms) dans le génome de Campylobacter coli spécifiques à trois différentes sources de contamination (la volaille, les bovins et les porcs), des nouveaux gènes de résistance aux antibiotiques qui émergent sur le territoire métropolitain mais aussi des nouvelles espèces du genre Helicobacter ou Campylobacter. Ces outils et données sont d’ores et déjà utilisés en routine au sein du CNRCH. Toutes ces analyses ont pu être possibles via l’utilisation de l’environnement Linux (progammation Bash et Python) permettant d’étudier des milliers de séquences d’ADN provenant d’une variété de souches séquencées au cours des différents projets. Cette «exploration génomique» fût ici la clé pour répondre aux différentes problématiques cliniques.
Chapter
Frederick Sanger (1918–2013) was a British biochemist who devised methods for determining the sequences of amino acids in proteins in the 1940s and for determining the sequences of nucleotides in nucleic acids in the 1970s. The two contributions were foundational for the field of molecular genetics and Sanger was recognized for these contributions with two Nobel prizes in chemistry, the only individual so honored. Sanger’s work from the time he was an undergraduate to his retirement was carried out in entirely in the department of biochemistry at Cambridge University. In addition to his appointment at Cambridge University, he joined the Medical Research Council’s Laboratory of Molecular Biology (in Cambridge) as head of its protein chemistry division upon its founding in 1962. Sanger’s early work provided the first amino acid sequence of a protein, insulin, the results of which clarified many open genetic problems, especially as related to the genetic code (e.g., the observation that there were no restrictions on the order of amino acids ruled out several proposed versions of the genetic code). Sanger’s laboratory generated much of the seminal work on nucleic acid and protein chemistry that allowed him and his collaborators to determine the first complete DNA sequences of several small phage genomes (φX174 and Lambda) and later, much larger animal viruses (Epstein Barr Virus). This work set the stage for the human genome project, a centerpiece of current genetic study.
Article
The genetic testing of solid tumors has evolved rapidly. With an ever-increasing number of clinically significant and/or actionable gene alterations in addition to increasing biologic, gene, or mutation-specific therapies, single-target testing is no longer suitable for many modern oncology patients. This review explores panel-based testing, including its history and evolution from prior testing modalities. We also discuss its current usefulness, as best exemplified by lung cancer, and other special considerations including a summary of the pros and cons of panel implementation and use. Lastly, we discuss the successes and challenges of panel-based testing and explore future directions.
Chapter
neglected tropical diseases such as Chagas disease, dengue, Zika, chikungunya, and malaria cause millions of deaths each year and they are caused by a variety of pathogens whose diagnosis is very limited or subject to conventional testing, making a treatment less accessible, accurate and timely diagnosis for choosing their treatments. Traditional methods for pathogen detection have not been able to meet the growing need for diagnosis and control. The incorporation of new technologies such as next-generation sequencing (NGS) and digital PCR (dPCR) represent a better diagnostic possibility due to their ability to absolutely quantify pathogens with high selectivity and precision. Our planet is currently experiencing environmental changes of an unprecedented magnitude and rate, including climate change, globalized pollution, biodiversity loss, and land use changes, so neglected diseases require a comprehensive understanding of the ecology of vectors in the different eco-epidemiological contexts, as well as of the transmission cycles of pathogens and their transmission dynamics. In this sense, NGS and dPCR open a new panorama for a better understanding of these diseases with the aim of proposing new programs for their care.
Article
Full-text available
Next-generation sequencing (NGS) technologies have become increasingly available for use in the clinical microbiology diagnostic environment. There are three main applications of these technologies in the clinical microbiology laboratory: whole genome sequencing (WGS), targeted metagenomics sequencing and shotgun metagenomics sequencing. These applications are being utilized for initial identification of pathogenic organisms, the detection of antimicrobial resistance mechanisms and for epidemiologic tracking of organisms within and outside hospital systems. In this review, we analyze these three applications and provide a comprehensive summary of how these applications are currently being used in public health, basic research, and clinical microbiology laboratory environments. In the public health arena, WGS is being used to identify and epidemiologically track food borne outbreaks and disease surveillance. In clinical hospital systems, WGS is used to identify multi-drug-resistant nosocomial infections and track the transmission of these organisms. In addition, we examine how metagenomics sequencing approaches (targeted and shotgun) are being used to circumvent the traditional and biased microbiology culture methods to identify potential pathogens directly from specimens. We also expand on the important factors to consider when implementing these technologies, and what is possible for these technologies in infectious disease diagnosis in the next 5 years.
Chapter
Analysis of DEL selection results requires the generation of large DNA sequence data sets and the conversion of DNA sequence to chemical structure. SAM and BAM formats are the generic formats for storing sequence alignment results. However, such formats are not directly applicable for analysis of DEL selection results due to the lack of reference sequences. In this protocol, reference sequences are constructed from DEL structure files using the central dogma of molecular biology analogy. Enabling the use of SAM and BAM formats drastically facilitates data access while also reducing data storage requirements and permits the efficient translation of DNA sequence to chemical structure of DEL compounds.Key wordsDNA-encoded libraryData analysisSequence alignmentChemical structureBioinformatics
Article
Full-text available
Maize is considered the third most important cereal crop in Asia after rice and wheat. Many diseases affect this crop due to the cultivation of various hybrids. This research aimed to characterize the causative agent of northern corn leaf blight disease in Bihar, India, caused by Ex-serohilum turcicum (Passerini) Leonard and Suggs. Leaf samples were collected from infected fields in five maize growing districts of Bihar in 2020-2022. A total of 45 fungal isolates from 135 samples were examined for cultural, morphological, and molecular characteristics and were identified as E. turcicum. The isolates were grouped into four groups based on colony color, i.e., olivaceous brown, blackish brown, whitish black, and grayish, and into two groups based on regular and irregular margins. The conidial shapes were observed to be elongated and spindle-shaped with protruding hilum, with conidial septa ranging from 2-12. Similarly, conidial length varied from 52.94 μm to 144.12 μm. β-tubulin gene sequences analysis made it possible to verify the identities of fungal strains and the phylogenetic relationships of all isolates, which were clustered in the same clade. The β-tubulin gene sequences of all the isolates showed a high level of similarity (100%) with reference isolates from GenBank accession numbers KU670342.1, KU670344.1, KU670343.1, KU670341.1, and KU670340.1. The findings of this study will serve as a baseline for future studies and will help to minimize yield losses.
Article
Full-text available
The cost of a diploid human genome sequence has dropped from about $70M to $2000 since 2007- even as the standards for redundancy have increased from 7x to 40x in order to improve call rates. Coupled with the low return on investment for common single-nucleotide polymorphisms, this has caused a significant rise in interest in correlating genome sequences with comprehensive environmental and trait data (GET). The cost of electronic health records, imaging, and microbial, immunological, and behavioral data are also dropping quickly. Sharing such integrated GET datasets and their interpretations with a diversity of researchers and research subjects highlights the need for informed-consent models capable of addressing novel privacy and other issues, as well as for flexible data-sharing resources that make materials and data available with minimum restrictions on use. This article examines the Personal Genome Project's effort to develop a GET database as a public genomics resource broadly accessible to both researchers and research participants, while pursuing the highest standards in research ethics.
Chapter
With over 200 types of cancer diagnosed to date, researchers the world over have been forced to rapidly update their understanding of the biology of cancer. In fact, only the study of the basic cellular processes, and how these are altered in cancer cells, can ultimately provide a background for rational therapies. Bringing together the state-of-the-art contributions of international experts, Systems Biology of Cancer proposes an ultimate research goal for the whole scientific community: exploiting systems biology to generate in-depth knowledge based on blueprints that are unique to each type of cancer. Readers are provided with a realistic view of what is known and what is yet to be uncovered on the aberrations in the fundamental biological processes, deregulation of major signaling networks, alterations in major cancers and the strategies for using the scientific knowledge for effective diagnosis, prognosis and drug discovery to improve public health.
Article
The complete mitochondrial genome (mitogenome) contributed crucial information, which could improve the better understanding of molecular phylogenetic analysis, evolution, and gene rearrangements. However, only a few Coenobitidae and Albuneidae mitogenomes have been described, and controversies about the Anomuran phylogeny remain. Here, we determined three Coenobitidae species (Coenobita perlatus, Coenobita rugosus, Coenobita clypeatus) and one Albuneidae species (Emerita talpoida). As the representative species of genera or families, and even the first species of the genus, supplementing these four species is essential to study the phylogenetic relationships within Anomura. Most of the four novel mitogenomes have the typical 37 genes, except for E. talpoida, which lacked trnF. Through combining these new data with 31 Anomuran mitogenomes from Genbank, different gene rearrangement patterns and internal phylogenetic relationships of Anomura were investigated. In our phylogeny analysis, all the Anomuran species were clustered into one group, and the polyphyly of Paguroidea was well supported. Moreover, various peculiar mitochondrial gene orders (MGOs) were summarized among Anomura and preliminary determined their rearrangement mechanisms through CREx. Twenty different MGOs were suggested in our research, and we were focused seven MGO patterns (Pattern A-J) in the process of discussing the gene rearrangement mechanism. Currently making full use of the large taxon sampling, our results provide valuable information on the evolutionary status of Anomuran species and are available for systematic rearrangement and phylogenetic analyses.
Article
The status of four Frankia strains isolated from a root nodule of Alnus glutinosa was established in a polyphasic study. Taxonogenomic and phenotypic features show that the isolates belong to the genus Frankia. All four strains form extensively branched substrate mycelia, multilocular sporangia, vesicles, lack aerial hyphae, but contain meso-diaminopimelic acid as the diamino acid of the peptidoglycan, galactose, glucose, mannose, ribose, xylose and traces of rhamnose as cell wall sugars, iso-C16:0 as the predominant fatty acid, diphosphatidylglycerol, phosphatidylglycerol, phosphatidylinositol as the major polar lipids, have comparable genome sizes to other cluster 1, Alnus-infective strains with structural and accessory genes associated with nitrogen fixation. The genome sizes of the isolates range from 7.0 to 7.7 Mbp and the digital DNA G+C contents from 71.3 to 71.5%. The four sequenced genomes are rich in biosynthetic gene clusters predicted to express for novel specialized metabolites, notably antibiotics. 16S rRNA gene and whole genome sequence analyses show that the isolates fall into two lineages that are closely related to the type strains of Frankia alni and Frankia torreyi. All of these taxa are separated by combinations of phenotypic properties and by digital DNA:DNA hybridization scores which indicate that they belong to different genomic species. Based on these results, it is proposed that isolates Agncl-4T and Agncl-10, and Agncl-8 T and Agncl-18, be recognised as Frankia gtarii sp. nov. and Frankia tisae sp. nov. respectively, with isolates Agncl-4T (= DSM 107976T= CECT 9711T) and Agncl-8T (= DSM 107980T= CECT 9715T) as the respective type strains.
Article
Short tandem repeat (STR) is regarded as a crucial tool for personal identification as well as parentage testing. Thus, genotyping errors of STRs could have negative effects on the reliability of forensic identification. A null allele at the combined DNA index system (CODIS) core loci D2S1338 was found in a father-daughter pair with the AGCU Expressmarker 22 kit which was a commonly used commercial kit during our daily laboratory work. This null allele caused the father and daughter to not conform to the laws of inheritance, thus potentially generating erroneous conclusions that excluded parentage. To figure out the reason for this phenomenon, re-amplification with new primers and then large fragment Sanger sequencing was conducted. We found a G to G/T variation at the position which is fifty-nine bases away from the 3' end of the core repeat in both samples. This probably could be considered a novel variant at the primer binding region which had not been reported that resulted in the emergence of the null allele. We also found that there was more than one single-nucleotide polymorphism (SNP) with minor allele frequency (MAF) greater than 0.1 in the upstream and downstream sequences of D2S1338. When designing primers for amplification of D2S1338, the possible adverse results of these SNPs should be taken into account and avoided.
Article
Full-text available
Fungi are vast in terms of diversity, ecological roles, habitats they occupy, physiology, metabolism, and in many other characteristics [...]
Thesis
Since first being described in 2009 [ 1], single cell RNA sequencing (scRNA-seq) has rapidly advanced into a staple for interrogating cellular identity in heterogeneous populations. Researchers routinely capture transcriptome-wide snapshots of thousands or even millions of individual cells. From these readouts the challenge is to accurately identify distinct patterns of mRNA expression that separate cells with distinct identities. However, several intrinsic properties of scRNA-seq data obfuscate our ability to extract biologically relevant information. Technical error can lead to the loss of resolution in cell similarity or gene co-regulatory relationships, or generate artificial correlations that are related to experimental design rather than biological signals. Often we lack a clear ground truth that would define what cell types should be present in the data set, and which genes are strong discriminators for them. Consequently, it is difficult to know whether any information we have garnered is truly representative of the entire population of cells within the data. The lack of a ground truth is particularly relevant since scRNA-seq data often suffers from the "curse of dimensionality” [ 2– 4], as scRNA-seq data sets typically span tens of thousands of genes. The high number of genes diminishes the validity of common data analysis techniques such as distance and correlation metrics, making it more difficult to identify cell or gene relationships in the data. My aim in this work is to establish a new methodology that can successfully navigate the complexities of scRNA-seq data and maximise our ability to obtain biologically relevant and meaningful insights into a cell population under study. Existing methods designed to interrogate scRNA-seq data struggle to account for two major phenomena: technical drop outs and uninformative genes. Drop outs occur when a gene is measured as having low or zero expression in a cell, but this is a false negative due vi to technical errors in capture or amplification of the mRNA. Uninformative genes are those that are present in the data, but have little relevance to cellular identity and hinder our ability to differentiate distinct cell types. To address these issues, I introduce a framework termed Entropy Sorting (ES). ES uniquely quantifies the correlative relationships between pairs of genes as a sorting problem. Doing so enables us to quantify how far away the observed functional states of the two genes are from an ideal perfectly correlated system, where the dependent relationship between the two features has been maximised. This approach enables us to pose and test hypotheses on whether the observed gene expression states are likely due to gene dependencies or random chance. The theory around ES is encoded in an algorithm, Functional Feature Amplification Via Entropy Sorting (FFAVES). I demonstrate that FFAVES allows us to simultaneously quantify gene co-regulation, correct for false negative and false positive data points and perform feature selection for highly informative genes. Crucially, it does so in an entirely unsupervised manner, minimising the introduction of bias to the data that would prevent us from identifying unknowns, such as rare cell types or gene signatures. On synthetic data I demonstrate that FFAVES recovers gene relationships more accurately than the most popular methods currently used. On real scRNA-seq data sets I use FFAVES to uncover high resolution gene expression dynamics during human embryo pre-implantation blastocyst development. Through FFAVES, I expose rare cell types and cell type specific gene expression, by mitigating the contribution of technical confounders such as batch effects and false negative drop outs. To demonstrate that our analysis is biologically relevant, I use detailed cell embeddings created from the human embryo scRNA- seq data to identify sequential transcription factor expression dynamics during the formation of primitive endoderm cells. Preliminary results from human embryo staining are used to validate the findings from FFAVES. In summary, I hope to demonstrate that ES and FFAVES serve as powerful tools for increasing the amount of information that can be extracted from scRNA-seq data, and more generally any high dimensional data set with complex feature relationships. Having improved the quality of a data set by removing technical noise and amplifying functional relationship with ES and FFAVES, users should gain clearer insights vii into their system of study, enhancing ability to draw accurate conclusions and plan future experiments.
Chapter
RNA is an important connecting link between DNA and proteins. Levels of RNA within a cell or a tissue serve as the unique genetic signatures, which can help in correlating gene expression to the resultant phenotype(s) during development and disease. Transcriptomics is the study of all RNAs expressed/available in cells or tissues that allow study of (1) differences in gene expression patterns among various cell types or organs, (2) identify novel messenger RNAs and transcripts, and (3) study epigenetic changes within the transcriptome. This knowledge can be applied to human disease(s) by developing disease markers or to study developmental landmarks using biomarkers. In this chapter, we have highlighted the history of transcriptomic and genetic engineering, the available transcriptomic techniques to study various types of RNA, their analysis using gene ontology tools, and finally the utility of genetic engineering tools and model organisms in transcriptomics research.
Chapter
With over 200 types of cancer diagnosed to date, researchers the world over have been forced to rapidly update their understanding of the biology of cancer. In fact, only the study of the basic cellular processes, and how these are altered in cancer cells, can ultimately provide a background for rational therapies. Bringing together the state-of-the-art contributions of international experts, Systems Biology of Cancer proposes an ultimate research goal for the whole scientific community: exploiting systems biology to generate in-depth knowledge based on blueprints that are unique to each type of cancer. Readers are provided with a realistic view of what is known and what is yet to be uncovered on the aberrations in the fundamental biological processes, deregulation of major signaling networks, alterations in major cancers and the strategies for using the scientific knowledge for effective diagnosis, prognosis and drug discovery to improve public health.
Chapter
With over 200 types of cancer diagnosed to date, researchers the world over have been forced to rapidly update their understanding of the biology of cancer. In fact, only the study of the basic cellular processes, and how these are altered in cancer cells, can ultimately provide a background for rational therapies. Bringing together the state-of-the-art contributions of international experts, Systems Biology of Cancer proposes an ultimate research goal for the whole scientific community: exploiting systems biology to generate in-depth knowledge based on blueprints that are unique to each type of cancer. Readers are provided with a realistic view of what is known and what is yet to be uncovered on the aberrations in the fundamental biological processes, deregulation of major signaling networks, alterations in major cancers and the strategies for using the scientific knowledge for effective diagnosis, prognosis and drug discovery to improve public health.
Chapter
With over 200 types of cancer diagnosed to date, researchers the world over have been forced to rapidly update their understanding of the biology of cancer. In fact, only the study of the basic cellular processes, and how these are altered in cancer cells, can ultimately provide a background for rational therapies. Bringing together the state-of-the-art contributions of international experts, Systems Biology of Cancer proposes an ultimate research goal for the whole scientific community: exploiting systems biology to generate in-depth knowledge based on blueprints that are unique to each type of cancer. Readers are provided with a realistic view of what is known and what is yet to be uncovered on the aberrations in the fundamental biological processes, deregulation of major signaling networks, alterations in major cancers and the strategies for using the scientific knowledge for effective diagnosis, prognosis and drug discovery to improve public health.
Chapter
With over 200 types of cancer diagnosed to date, researchers the world over have been forced to rapidly update their understanding of the biology of cancer. In fact, only the study of the basic cellular processes, and how these are altered in cancer cells, can ultimately provide a background for rational therapies. Bringing together the state-of-the-art contributions of international experts, Systems Biology of Cancer proposes an ultimate research goal for the whole scientific community: exploiting systems biology to generate in-depth knowledge based on blueprints that are unique to each type of cancer. Readers are provided with a realistic view of what is known and what is yet to be uncovered on the aberrations in the fundamental biological processes, deregulation of major signaling networks, alterations in major cancers and the strategies for using the scientific knowledge for effective diagnosis, prognosis and drug discovery to improve public health.
Chapter
With over 200 types of cancer diagnosed to date, researchers the world over have been forced to rapidly update their understanding of the biology of cancer. In fact, only the study of the basic cellular processes, and how these are altered in cancer cells, can ultimately provide a background for rational therapies. Bringing together the state-of-the-art contributions of international experts, Systems Biology of Cancer proposes an ultimate research goal for the whole scientific community: exploiting systems biology to generate in-depth knowledge based on blueprints that are unique to each type of cancer. Readers are provided with a realistic view of what is known and what is yet to be uncovered on the aberrations in the fundamental biological processes, deregulation of major signaling networks, alterations in major cancers and the strategies for using the scientific knowledge for effective diagnosis, prognosis and drug discovery to improve public health.
Chapter
With over 200 types of cancer diagnosed to date, researchers the world over have been forced to rapidly update their understanding of the biology of cancer. In fact, only the study of the basic cellular processes, and how these are altered in cancer cells, can ultimately provide a background for rational therapies. Bringing together the state-of-the-art contributions of international experts, Systems Biology of Cancer proposes an ultimate research goal for the whole scientific community: exploiting systems biology to generate in-depth knowledge based on blueprints that are unique to each type of cancer. Readers are provided with a realistic view of what is known and what is yet to be uncovered on the aberrations in the fundamental biological processes, deregulation of major signaling networks, alterations in major cancers and the strategies for using the scientific knowledge for effective diagnosis, prognosis and drug discovery to improve public health.
Chapter
With over 200 types of cancer diagnosed to date, researchers the world over have been forced to rapidly update their understanding of the biology of cancer. In fact, only the study of the basic cellular processes, and how these are altered in cancer cells, can ultimately provide a background for rational therapies. Bringing together the state-of-the-art contributions of international experts, Systems Biology of Cancer proposes an ultimate research goal for the whole scientific community: exploiting systems biology to generate in-depth knowledge based on blueprints that are unique to each type of cancer. Readers are provided with a realistic view of what is known and what is yet to be uncovered on the aberrations in the fundamental biological processes, deregulation of major signaling networks, alterations in major cancers and the strategies for using the scientific knowledge for effective diagnosis, prognosis and drug discovery to improve public health.
Chapter
s RNA-seq is an amalgam of standard molecular biology techniques and computational bioinformatics methods that are designed to identify and quantify transcriptional activity in the cell. The nomenclature, RNA-seq, comes from “RNA sequence analysis” and the technology is a widely regarded asset within the scientific community. The utility and popularity of this transcriptomics tool are based on the high-throughput massively parallel character of NGS and the unique characteristics of third-generation sequencing. RNA-seq has revolutionized and invigorated the mining of the transcriptome for its secrets by providing much greater latitude in experimental design and providing an understanding of the transcriptome at heretofore unknown levels of detail. RNA-seq produces a quantitative and a qualitative profile of each sample. The quantitative profile reflects the expression level of each gene and permits the discernment of abundance relationships among RNAs in the sample across a wide dynamic range. The qualitative data that are generated are essential for observing structural alterations in transcripts as a consequence of transcriptional or posttranscriptional events. While earlier molecular biology hybridization-, PCR-, or microarray-based methods were limited to the study of only one or a few transcripts in a single experiment, RNA-seq will assay whatever transcripts are present in the starting material. Further, no a priori knowledge or designation of target sequences is needed. RNA-seq consists of multiple well-defined steps. The amount of data generated at the end of the sequencing run is enormous and relies on computational bioinformatics software to sort, manage, and mine the data. Much like other standard molecular biology methods, there are multiple variants of PCR that focus on different RNA subpopulations or on RNA molecules which exhibit specific characteristics.
Article
Full-text available
Escherichia coli RNA molecules in the size range of 70 to 400 nucleotides have been characterized by polyacrylamide gel electrophoresis and by RNase T1 (EC 2.7.7.26) finger-printing. RNA labeled by ³²PO4³⁻ for 20 min is separated into about 20 bands by electrophoresis in 5, 10, and 20% polyacrylamide gels; many of them represent pure RNA species. Some correspond to known molecules such as tRNAs, 5 S RNA, 4.5 S RNA, and 6 S RNA, but others have not been described previously. The amounts of these latter molecules are low, usually less than 10% of the level of 5 S RNA. One molecule, with electrophoretic mobility similar to 5 S RNA, has a 5′-terminal guanosine triphosphate. Another, with a mobility similar to that of 6 S RNA, contains dihydrouracil. Several different RNA preparation methods give essentially the same results. Two-dimensional polyacrylamide gel electrophoresis (10% → 20% polyacrylamide) was used to purify RNA in the 4 S to 5 S region. This technique is capable of resolving at least 30 different RNA species; many of them are pure tRNA molecules. It allows for direct comparison of the quantities of purified tRNAs and the other molecules described in this paper. Such analysis shows that during 20 min labeling the newly characterized molecules accumulate at levels comparable to many individual tRNAs.
Article
Full-text available
DNA polymerase induced in Escherichia coli by phage T4 am N82 has been prepared in a highly purified state. The molecular weight of about 112,000 for this enzyme compares with a value of 109,000 for the host (E.coli) DNA polymerase. The amino acid compositions of the two enzymes, however, are distinctive, especially the half-cystine value of 15 residues for the phage enzyme and 3 for the bacterial enzyme. The purified phage enzyme contains an exonuclease activity which is physically inseparable from the polymerase activity but is suppressed or obscured by conditions favorable for replication. The polymerase requires a single stranded template, with a free 3'-hydroxyl terminus, which is replicated to an extent that approaches but never exceeds the DNA input. The product is a helical structure in which the newly synthesized strand is covalently linked from its 5'-terminus to the 3'-terminus of the template. Various features of the replication process and the product suggest a mechanism in which the 3'-terminus of the template first loops back upon itself and then serves as the priming end for replication of the remainder of the template. The evidence indicates that the phage polymerase, unlike the E. coli enzyme, is unable to initiate new strands or utilize a fully helical DNA as template.
Article
Full-text available
The restriction enzyme from Hemophilus influenzae, endonuclease R, cleaves phiX174 replicative-form deoxyribonucleic acid (DNA) into at least 13 specific limit fragments. The molecular weights of 12 of the fragments have been estimated by gel electrophoresis and electron microscopy. Using the genetic assay for small fragments of phiX DNA, we have shown that we can salvage markers from the endonuclease R phiX-RF fragments.
Article
Full-text available
The accumulation of small RNAs (4 to 6 S) in Escherichia coli during amino acid starvation has been studied by 10% polyacrylamide gel electrophoresis and two-dimensional fingerprint analysis. In CP78, a stringent (rel+) strain, RNA labeled with 32PO43- during amino acid starvation has a gel electrophoresis pattern that is very different from that of nonstarved cells. However, in CP79, a relaxed (rel-) mutant, RNA labeled during starvation has a gel pattern similar to normal. During starvation of the stringent strain, 32PO43- labeling of 5 S RNA, 4.5 S RNA, and most tRNAs is reduced to about 5% normal. The accumulation of an unstable molecule containing dihydrouracil, with an electrophoretic mobility similar to that of 6 S RNA, is also reduced. In contrast, 6 S RNA (which is stable) and an unstable molecule with GTP at its 5' end are much less severely reduced, if at all. Thus the accumulation of these molecules during stringent control is noncoordinate and the inhibition of accumulation is not necessarily correlated with metabolic stability. When cells of the stringent strain are treated with the antibiotic trimethoprim, an undermethylated form of tRNALeu1 appears as the most highly labeled single species of the small RNAs. Trimethoprim treatment reduces both the level of bulk tRNA labeling and the extent of tRNA methylation. These effects of trimethoprim are inhibited by the addition of methionine to the medium. The various RNA molecules are labeled with different kinetics. In short labeling periods the GTP-starting unstable molecule is one of the most highly labeled species. From radioactivity pulse-chase experiments under normal and starvation conditions it was found that amino acid starvation does not seem to affect the stability of the RNAs.
Article
Full-text available
The T4 DNA polymerase catalyzes extensive exonucleolytic degradation of linear duplex DNA starting at the 3' ends. However, the enzyme will release only a few nucleotides from each DNA molecule if the degradation is run in the presence of a single deoxynucleosidè triphosphate. Several experiments suggested that the polymerase degrades a chain only until a nucleotide is released which can be replaced by transfer from the triphosphate. Subsequent reaction consists only of alternating removal and replacement of that nucleotide, without net degradation of the DNA. Because only a few nucleotides are released in the presence of a single triphosphate, it seemed possible that the polymerase could be used for analysis of nucleotide sequences at 3' termini of duplex DNA. This possibility was verified by the analysis of the 3'-terminal sequence of fragments of bacteriophage T7 DNA produced by endonuclease R, the Hemophilus influenzae restriction endonuclease. This terminal sequence had been previously identified by Kelly and Smith (J. Mol. Biol., 51, 393 (1970)). The method used in this analysis, which should also be applicable to other DNAs, was to degrade ³²P-labeled DNA by the T4 polymerase in the presence of each of the four triphosphates. The nucleotides released in each case were identified and quantitatively determined by thin layer chromatography, and were consistent with the previously determined terminal sequence.
Article
Extracts of Hemophilus influenzae strain Rd contain an endonuclease activity which produces a rapid decrease in the specific viscosity of a variety of foreign native DNA's; the specific viscosity of H. influenzae DNA is not altered under the same conditions. This “restriction” endonuclease activity has been purified approximately 200-fold. The purified enzyme contains no detectable exo- or endonucleolytic activity against H. influenzae DNA. However, with native phage T7 DNA as substrate, it produces about 40 double-strand 5′-phosphoryl, 3′-hydroxyl cleavages. The limit product has an average length of about 1000 nucleotide pairs and contains no single-strand breaks. The enzyme is inactive on denatured DNA and it requires no special co-factors other than magnesium ions.
Article
Die Synthese eines Decadesoxyribonukleotids wird beschrieben, dessen Basensequenz dA-G-A-A-A-T-A-A-A-A im Minus-Strang der DNA des Phagen ϕX 174 vorkommt. Mit Hilfe dieses synthetischen Primers sollen weitere Bereiche der DNA des Phagen ϕX 174 sequenziert werden. Das Decanukleotid wird nach der Methode von Khorana et al. aus den geschützten Nukleotidblöckend(MeOTr)bzA-ibuG, dpbzA-bzA(Ac), dpbzA-T(Ac) und dpbzA-bzA-bzA-bzA(Ac) unter Verwendung von TPS als Kondensationsmittel in drei Kondensationsschritten aufgebaut.The synthesis of the decadeoxyribonucleotide dA-G-A-A-A-T-A-A-A-A corresponding to the minus strand fragment of ϕX 174 DNA is discribed. This synthetic primer should allow sequence determination of the adjacent region. The decanucleotide was prepared in three steps according to the method of Khorana et al., using the protected nucleotide blocksd(MeOTr)bzA-ibuG, dpbzA-bzA(Ac), dpbzA-T(Ac) and dpbzA-bzA-bzA-bzA(Ac) as intermediates for condensation reactions in the presence of TPS.
Article
At the ends of bacteriophage λ DNA, the 5′-terminated strands are 12 nucleotides longer than the 3′-terminated strands. The complete sequence of deoxynucleotides in both the protruding 5′-terminated single strands of λ DNA has been determined by partial repair and by complete repair followed by sequencing of isolated oligonucleotides. Starting from the 5′-end of the left-hand cohesive end, the 12 nucleotides are in the sequence dpGpGpGpCpGpGpCpGpApCpCpT. The sequence from the right-hand cohesive end is exactly complementary to that from the left-hand end.
Article
The sequence of 33 nucleotides immediately preceding the start point of transcription of an operon in bacteriophage lambda has been determined. This region includes recognition sites for lambda repressor and, probably, for other proteins. The sequence contains interdigitating symmetries.
Article
Braes, Habing and Schoenmaker1 have detected radio emission from MWC 349, the flux density at 1,415 MHz being 0.060 ± 0.007 f.u. They also summarize the remarkable properties of this star, which is believed to be an early B-type star2 with some 10 mag of obscuration and with a strong IR excess, which may be associated with a surrounding dense cloud of gas and dust3,4.
Article
At the ends of molecules of bacteriophage λ DNA, the 5′-terminated strands are 20 nucleotides longer than the 3′-terminated strands. Part of the sequence of bases in the protruding single strands has been determined by the Escherichia coli DNA polymerase-catalyzed addition of nucleotides, lengthening the 3′-terminated strands. In this way 13 residues of dG, 13 of dC, 7 of dA and 7 of dT were incorporated. The equivalence of dG to dC and of dA to dT implies that the protruding single strands have complementary base sequences. The first residue incorporated into the right cohesive end was the same as the 5′-terminal residue on the left end and the first residue incorporated into the left end was the same as the 5′-terminal residue on the right end, showing that the two cohesive ends are the same length. Sequence data is summarized in Figure 7.
Article
For the routine preparation of the common [α-32P]ribo- and deoxyribonucleoside 5'-triphosphates with high specific activity, the most practical route is the chemical synthesis of the monophosphate from [32P]orthophosphoric acid and the appropriate nucleoside followed by its enzymatic conversion to the triphosphate. This chapter describes the method for the synthesis of [α-32P] ribo- and deoxyribonucleoside 5'-triphosphates. This method allowed the preparation of [a-32P]ribo- and deoxyribonucleoside 5'-triphosphates with a specific activity of 1-20 mCi/μmole, higher specific activities are quite feasible. A total working time of about 3 hours spread over three days is required for the preparation of each labeled triphosphate. It is considered desirable to purify reaction mixtures after the chemical synthesis of the monophosphate as well as after the enzymatic synthesis of the triphosphate in order to ensure a high purity of the final product. However, purification only after the enzymatic step has been reported.
Article
Methods for the direct determination of nucleotide sequences in DNA have been developed and used to determine the complete primary structure of a fragment of bacteriophage φX174 DNA which is 48 residues in length. This fragment was liberated from φX DNA by digestion at low temperature and high ionic strength with the T4 phage-induced endonuclease IV. The fragment was redigested with endonuclease IV under vigorous conditions and the products fractionated two-dimensionally providing a characteristic endonuclease IV “fingerprint” of the fragment. The Burton (Burton & Petersen, 1960) depurination reaction was used to characterize the redigestion products and identify the pyrimidine residues at their 5′ and 3′ termini. These oligonucleotide products were then fully sequenced by partial exonuclease digestion with spleen and snake venom phosphodiesterase and analysis of the fractionated digests by base composition, depurination, and 5′ end-group analysis using exonuclease I. Rules for the interpretation of two-dimensional fingerprints of partial exonuclease digests, which rapidly provide sequence information by simple inspection, were also deduced. To derive the complete structure of the fragment, the fully sequenced oligonucleotides were ordered by characterizing large, overlapping, partial endonuclease IV digestion products by means of the depurination reaction. The sequencing methods described are general and may be used for the direct determination of the primary structures of other fragments of DNA.
Article
WE describe here the isolation and sequence analysis of a single-stranded DNA fragment of biological interest. One way to obtain unique DNA fragments is to use biological macro-molecules which can bind specific regions of DNA. These might protect such regions from DNAase digestion so that they could be separated from the bulk DNA. Such an approach has been used successfully for the ribosome binding sites of bacteriophage RNA1-3.We have used Escherichia coli ribosomes to protect the single-stranded DNA of phage ??
Article
A sequence of 50 residues in f1 DNA has been determined by the extension of a chemically synthesized octadeoxyribonucleotide by Escherichia coli DNA polymerase I, with radioactive nucleoside triphosphates and f1 DNA template. The polymerized product was synthesized either in the presence of manganese and a mixture of ribo- and deoxyribotriphosphates or in a magnesium-containing reaction with one or more of the four triphosphates absent. The sequence determination depended largely on fractionation of the polymerized products by two-dimensional "homochromatography." This approach and the techniques for the subsequent sequence analysis should be of general use for determining other sequences of DNA. Several features of this sequence suggest that it is located in an intercistronic region of f1 DNA.
Article
Purification of DNA polymerase from E. coli B has in two cases each time led to the isolation of two separate polymerase activities, enzyme A and enzyme B. Enzyme A was in contrast to enzyme B almost completely devoid of exonuclease activity. Each of the two enzymes yielded a single symmetrical activity peak in gel filtration chromatograms. From the elution volumes the molecular weights were estimated to be about 70,000 for enzyme A and about 150,000 for enzyme B. Treatment of enzyme B with subtilisin led to an increase of about 30 per cent of the polymerase activity while the exonuclease activity almost completely disappeared. The product of the subtilisin treatment (enzyme C) gave rise to a single symmetrical polymerase activity peak in a gel filtration chromatogram. The elution volume was identical to that obtained with enzyme A. It is concluded that enzyme A and enzyme C are formed by limited proteolysis of enzyme B.
Article
A simple procedure has been developed for determining short nucleotide sequences at 3′ termini of duplex DNA molecules. The DNA is incubated at 11 °C with the T4 DNA polymerase and a single α-32P-labeled deoxynucleoside triphosphate. The enzyme sequentially degrades each strand from the 3′ terminus until a mononucleotide is released which can be replaced by transfer from the 32P-labeled triphosphate. Subsequent reaction consists of alternating removal and replacement of the 32P-labeled nucleotide, and the enzyme never penetrates deeper into the strand. These reactions result in the steady-state incorporation of about one mole of radioactive nucleotide per mole of strand at a unique position in the sequence at or near the original 3′ terminus. In separate experiments, the DNA is labeled with each of the four 32P-labeled nucleotides and the strands of the DNA are separated to permit independent analysis of the two termini. Sequence information is obtained from the 32P-labeled strands by nearest-neighbor analyses and from a related method for identifying the terminal nucleotide of each strand. Using this method on phage T7 DNA, a trinucleotide sequence at the terminus of each strand was determined. The r strand terminates with the sequence pApGpA and the l strand terminates with the sequence pCpCpT.
Article
High molecular weight ribonucleic acid (RNA) from rat liver, kidney, and brain has been fractionated by polyacrylamide gel electrophoresis. A large number of new species of RNA have been resolved with electrophoretic mobilities and sedimentation coefficients intermediate between 30S and 18S RNA and intermediate between 18S and 4S RNA. The number and relative amount of each of these species were constant from preparation to preparation from the same tissue as well as from different tissues. Evidence is presented that these RNA components are present in vivo and are not the result of in vitro artifacts. The results suggest that the current classification of RNA into three major types (30, 18, and 4 S) is inadequate to describe the true heterogeneity of cytoplasmic RNA, and therefore hinders studies of the functional role played by different RNA species.
  • R H Symons
  • A D Kaiser
Symons, R. H. (1974). In Mewa in Enzymology (Grossman, L. & Moldave, K., eds), vol. 29, part E, pp. 102-115, Academia Press, New York and London, Wu, R. & Kaiser, A. D. (1968). J. Mol. Biol. 35, 523-527.
Die MakrmolekuZare Chew&
  • H Schott
Schott, H. (1974). Die MakrmolekuZare Chew&, 175, 1683-1693.
  • R Wu
  • E Taylor
Wu, R. & Taylor, E. (1971). J. Mol. BioZ. 57, 491-611.
  • F Galibert
  • J Sedat
  • E Ziff
Galibert, F., Sedat, J. t Ziff, E. (1974). J. Mol. BioZ. 87, 377-407.