ArticlePDF Available

Characterization of polymorphic microsatelite markers for the endangered Mediterranean bath sponge Spongia officinalis L

Authors:
Thanos Dailianis at Hellenic Centre for Marine Research
Thanos Dailianis
Costas Tsigenopoulos at Hellenic Centre for Marine Research
Costas Tsigenopoulos
Download full-text PDF
Read full-text
Download citation

Abstract

Abstract Ten polymorphic microsatellite markers are described for the Mediterranean bath sponge Spongia officinalis. Loci were isolated from a genomic library enriched for AC repeats. Microsatellite markers were evaluated on a Cretan population of 28 individuals; the allelic richness ranged from 5 to 34 with an average of 17, while expected and observed heterozygosities varied from 0.505 to 0.964 and 0.444 to 0.963, respectively. In a species whose populations in the eastern Mediterranean basin have been substantially declined due to recurring mass mortality incidents and intensive harvesting, these markers are expected to assist studies of genetic structure and differentiation between populations.
Content uploaded by Costas Tsigenopoulos
Author content
All content in this area was uploaded by Costas Tsigenopoulos
Content may be subject to copyright.
TECHNICAL NOTE
Characterization of polymorphic microsatellite markers
for the endangered Mediterranean bath sponge
Spongia officinalis L.
Thanos Dailianis
Æ
Costas S. Tsigenopoulos
Received: 18 March 2009 / Accepted: 21 March 2009 / Published online: 3 April 2009
ÓSpringer Science+Business Media B.V. 2009
Abstract Ten polymorphic microsatellite markers are
described for the Mediterranean bath sponge Spongia
officinalis. Loci were isolated from a genomic library
enriched for AC repeats. Microsatellite markers were
evaluated on a Cretan population of 28 individuals; the
allelic richness ranged from 5 to 34 with an average of 17,
while expected and observed heterozygosities varied from
0.505 to 0.964 and 0.444 to 0.963, respectively. In a spe-
cies whose populations in the eastern Mediterranean basin
have been substantially declined due to recurring mass
mortality incidents and intensive harvesting, these markers
are expected to assist studies of genetic structure and dif-
ferentiation between populations.
Keywords Porifera Population genetics
Molecular markers SSR Enrichment
The importance of the Mediterranean bath sponges as a
biological resource relies both on their economic value and
the cultural heritage they represent (Pronzato and Manconi
2008). However, especially in the eastern Mediterranean
basin, their populations have suffered a dramatic decline
due to the combined effect of overharvesting and mass
mortality incidents attributed to climate change (Vacelet
1991;Pe
´rez et al. 2000). The common bath sponge Spongia
officinalis L. 1759 is one of the main harvested sponge
species, presenting a wide distribution in the Mediterranean
Sea. Additionally, it is the archetypical representative of
the phylum Porifera. Although its stocks have been sub-
stantially limited to scarce, localized populations of
reduced size (Pronzato 1999; Voultsiadou et al. 2008), it is
still being exploited intensively without any management
plan. For the latter to be effective, an in-depth investigation
of the species population structure and reproductive strat-
egy is required. Microsatellite markers have proved
effective in resolving relevant issues in marine inverte-
brates including sponges (Duran et al. 2004); such markers
were previously developed for four sponge species (Duran
et al. 2002; Knowlton et al. 2003; Blanquer et al. 2005;
Hoshino and Fujita 2006). In the present work, we report
for the first time the development of microsatellite markers
for the commercial sponge species S. officinalis.
Individuals of S. officinalis (28 specimens) were col-
lected by scuba diving from Chania, Crete (Eastern
Mediterranean, N35°3402500/E23°4603800) from depths
ranging from 3 to 11 m. The samples were preserved in
ethanol at -20°C until DNA extraction. A genomic library
was constructed for the isolation of microsatellite loci,
following a previously described enrichment protocol
(Tsagkarakou and Roditakis 2003; Tsigenopoulos et al.
2003). Genomic DNA (10 lg) was obtained from a single
individual with DNeasy Blood & Tissue Kit (Qiagen),
digested with RsaI restriction enzyme (Minotech) and
purified using NucleoSpin Extract kit (Macherey-Nagel).
Three micrograms of blunt-end DNA fragments of 200–
1,100 bp were ligated to 1 nm of double-stranded linker-
adapted primers using T4 DNA ligase (New England
Biolabs). A selective hybridization protocol was followed,
using a 30-biotinylated (AC)
12
as the probe, and products
were captured with MagneSphere streptavidin-coated
T. Dailianis (&)C. S. Tsigenopoulos
Institute of Marine Biology and Genetics (IMBG), Hellenic
Centre for Marine Research (HCMR), Thalassocosmos,
P.O. Box 2214, 715 00 Heraklion, Crete, Greece
e-mail: thanosd@her.hcmr.gr
T. Dailianis
Department of Zoology, School of Biology, Aristotle University
of Thessaloniki, 541 24 Thessaloniki, Greece
123
Conserv Genet (2010) 11:1155–1158
DOI 10.1007/s10592-009-9906-0
Table 1 Characteristics of the 10 microsatellite loci isolated from Spongia officinalis
Locus GenBank
accession no.
Repeat motif Primer sequences (50–30)T
a
(
o
C)
MgCl
2
(mM)
Allele
size
range (bp)
No. of
alleles
H
E
H
O
Spof_005 FJ705063 (GT)
12
(GT)
5
F: CATTCTCATTATGGAAGCCA
R: TCTCTGTAGAGGCCATTAGTCC
54 2.5 227–243 7 0.689 0.542
Spof_050 FJ705064 (TG)
12
(TG)
3
(TG)
3
(TG)
5
F: TAGCTGCAACTGCAGGAATC
R: TCTACATGCCATCCTTGTGC
60 2.5 124–192 16 0.820 0.481
Spof_054 FJ705065 (CA)
4
(CA)
3
(CA)
25
F: ACATGTCACTTGGCCACC
R: ACTGATGCACCGATCAGAC
60 2.5 230–284 17 0.907 0.808
Spof_057 FJ705066 (GT)
23
(GT)
4
(GT)
5
F: TGGTCTGGACCAAGACTAC
R: TTAGTTAATGAATTGCTCACAA
58 2.5 177–395 34 0.964 0.741
Spof_069 FJ705068 (AC)
11
(AC)
4
(AC)
5
(AC)
17
F: CATCGTAAGCTGATGCCATT
R: AGCCTGACATTACATGGTTGG
56 2.5 205–281 23 0.940 0.889
Spof_102 FJ705069 (AC)
3
(AC)
7
(AC)
3
(AC)
4
F: ACATAGCAAGCCTTCGTGTT
R: AGTGTGCATGTGTATGCAGTG
58 1.5 139–191 12 0.850 0.444
Spof_130 FJ705070 (GT)
23
F: AGCCATATGGTTGATACGACAC
R: GGCACCGCCACTAGTTATTC
60 2.5 172–212 10 0.799 0.750
Spof_136 FJ705071 (CA)
3
(CA)
5
(CA)
13
F: CGTAACCATTATCGTAATAAGTAGAA
R: GACAGCCAAGACCATCTGAA
58 1.5 153–281 27 0.930 0.963
Spof_148 FJ705072 (AC)
3
(AC)
7
F: CCATGTACAATCTTATGTAGC
R: AATTCCTGTGATGGATTG
56 2.5 128–138 5 0.505 0.536
Spof_240 FJ705074 (CA)
5
(CA)
3
(CA)
10
(CA)
4
–(CA)
11
(CA)
4
(CA)
6
F: GGTGTTGAATATGTTAGACGCAAG
R: TGTCTCCACATTGGTGTGTG
60 2.5 239–295 17 0.913 0.857
T
a
optimized annealing temperature; H
E
expected heterozygosity; H
O
observed heterozygosity
1156 Conserv Genet (2010) 11:1155–1158
123
paramagnetic particles (Promega). Recovered DNA was
cloned using TOPO TA Cloning Kit (Invitrogen).
Recombinant clones were screened via Polymerase Chain
Reaction (PCR), and plasmid DNA from clones containing
repeats was extracted using NucleoSpin Plasmid kit
(Macherey-Nagel). In total, 246 positive colonies were
screened for inserts, and 91 were selected and sequenced.
Plasmid DNA from each clone (200–300 ng) was used for
single stranded sequencing in both directions using the T7
and SP6 primers, with the BigDye Terminator v3.1 Cycle
Sequencing Kit (Applied Biosystems) following manufac-
turer’s guidelines; sequencing reaction were run on a 3700
DNA Analyzer (Applied Biosystems) and sequences were
manually edited using BioEdit software (Hall 1999).
Primers were designed for 41 sequences containing tandem
repeats using Primer 3 software (Rozen and Skaletsky
2000). For each microsatellite locus, the reverse primer
was labeled with a fluorescent dye (FAM, HEX, ROX or
TAMRA).
The developed primers were evaluated for correct
amplification and polymorphism on the 28 individuals of the
sampled population, resulting in 10 loci (Table 1) which
showed better results in both aspects. Reactions were per-
formed in a 10 ll volume containing 5–10 ng of S. officinalis
genomic DNA, 0.2 mM of dNTP mix, 0.35 lM of each
locus-specific primer, 19Taq buffer and 0.5 U of Taq
polymerase (Genaxxon BioScience). Magnesium chloride
concentrations and annealing temperatures (T
a
) for each
locus are shown in Table 1. Amplification in a thermal cycler
(BioRad) included an initial denaturation at 95°C for 3 min,
35 cycles of 1 min at 93°C, 1 min at the annealing temper-
ature (see T
a
, Table 1) and 1 min at 72°C, and a last step at
72°C for 10 min. The sizes of the fluorescently labeled PCR
products were estimated according to an internal size marker
(GeneScan 500 LIZ) on an ABI Prism 3700 sequencer
(Applied Biosystems) and analyzed using STRand v.2.3.48
software (UC Davis Veterinary Genetics Laboratory,
www.vgl.ucdavis.edu/informatics/strand.php).
The number of alleles per locus, allele size range as well
as observed and expected heterozygosities were calculated
using GENETIX v.4.03 software (Belkhir et al. 2000) and
are presented in Table 1. The number of alleles for the 10
loci varied from 5 to 34 with a mean of 17, and their size
from 124 to 395 bp. The expected heterozygosities ranged
from 0.505 to 0.964 while observed heterozygosities from
0.444 to 0.963. Tests for Hardy–Weinberg equilibrium in
each locus and genotypic linkage disequilibrium for each
pair of loci were performed with Genepop v.3.3 (Raymond
and Rousset 1995). Significance levels (P=0.05) were
adjusted for multiple comparisons using the sequential
Bonferroni correction (Rice 1989). Genotyping frequencies
conformed to Hardy–Weinberg expectations for all loci,
while no evidence for linkage disequilibrium was observed
for any loci pair. Use of Micro-Checker v.2.2.3 software
(van Oosterhout et al. 2004) indicates probability of null
alleles for loci Spof_050, Spof_057 and Spof_102, though
without evidence for scoring errors due to stuttering or
large allele dropout.
The reported molecular markers will be used to inves-
tigate population structure and gene flow in Mediterranean
S. officinalis populations and are expected to provide a
better understanding of the ecology of the species, and
consequently a basis for a sustainable management
framework.
Acknowledgments The authors would like to thank Dr. C. Dounas
and Dr. A. Magoulas for their support throughout the progress of the
present work, as well as J. Lagnel for assistance with the primer
design. Financial support was provided by the research project
‘Innovative measures for the support of the sponge fisheries in the
Aegean Sea’ (Operational Program for the Fisheries Sector 2000–
2006) and an Excellence Grant to the IMBG (Service Plan 2006–
2008) from the Hellenic General Secretariat for Research and Tech-
nology (GSRT).
References
Belkhir K, Borsa P, Chikhi L (2000) GENETIX 4.05, logiciel sous
Windows TM pour la ge
´ne
´tique des populations. Laboratoire
Ge
´nome, Populations, Interactions, CNRS UMR 5000. Univer-
site
´de Montpellier II, Montpellier
Blanquer A, Uriz MJ, Pascual M (2005) Polymorphic microsatellite
loci isolated from the marine sponge Scopalina lophyropoda
(Demospongiae: Halichondrida). Mol Ecol Notes 5:466–468.
doi:10.1111/j.1471-8286.2005.00927.x
Duran S, Pascual M, Estoup A, Turon X (2002) Polymorphic
microsatellite loci in the sponge Crambe crambe (Porifera:
Poecilosclerida) and their variation in two distant populations.
Mol Ecol Notes 2:478–480. doi:10.1046/j.1471-8286.2002.
00285.x
Duran S, Pascual M, Estoup A, Turon X (2004) Strong population
structure in the marine sponge Crambe crambe (Poecilosclerida)
as revealed by microsatellite markers. Mol Ecol 13:511–522.
doi:10.1046/j.1365-294X.2004.2080.x
Hall TA (1999) BioEdit: a user-friendly biological sequence align-
ment editor and analysis program for Windows 95/98/NT.
Nucleic Acids Symp Ser 41:95–98
Hoshino S, Fujita T (2006) Isolation of polymorphic microsatellite
markers from Hymeniacidon sinapium (Porifera: Demospongiae:
Halichondrida). Mol Ecol Notes 6:829–831. doi:10.1111/j.1471-
8286.2006.01360.x
Knowlton AL, Pierson BJ, Talbot SL, Highsmith RC (2003) Isolation
and characterization of microsatellite loci in the intertidal sponge
Halichondria panicea. Mol Ecol Notes 3:560–562. doi:10.1046/
j.1471-8286.2003.00511.x
Pe
´rez T, Garrabou J, Sartoretto S, Harmelin J-G, Francour P, Vacelet
J (2000) Mortalite
´massive d’inverte
´bre
´s marins: un e
´ve
´nement
sans pre
´ce
´dent en Me
´diterrane
´e nord-occidentale. C R Acad Sci
Paris, Sci/Life Sci 323:853–865
Pronzato R (1999) Sponge-fishing, disease and farming in the Mediter-
ranean Sea. Aquat Conserv Mar Freshw Ecosyst 9:485–493.
doi:10.1002/(SICI)1099-0755(199909/10)9:5\485::AID-AQC362
[3.0.CO;2-N
Conserv Genet (2010) 11:1155–1158 1157
123
Pronzato R, Manconi R (2008) Mediterranean commercial sponges:
over 5000 years of natural history and cultural heritage. Mar
Ecol (Berl) 29:146–166. doi:10.1111/j.1439-0485.2008.00235.x
Raymond M, Rousset F (1995) GENEPOP Version 1.2: a population
genetics software for exact tests and ecumenism. J Hered
86:248–249
Rice WR (1989) Analyzing tables of statistical tests. Evol Int J Org
Evol 43:223–225. doi:10.2307/2409177
Rozen S, Skaletsky H (2000) Primer 3 on the WWW for general users
and for biologist programmers. Methods Mol Biol 132:365–386
Tsagkarakou A, Roditakis N (2003) Isolation and characterization of
microsatellite loci in Bemisia tabaci (Hemiptera: Aleyrodidae).
Mol Ecol Notes 3:196–198. doi:10.1046/j.1471-8286.2003.
00393.x
Tsigenopoulos CS, Hellemans B, Christiakov DA, Libertini A,
Kotoulas G, Vo
¨lckaert F (2003) Eleven new microsatellites of
the sea bass (Dicentrarchus labrax L.). Mol Ecol Notes 3:352–
354. doi:10.1046/j.1471-8286.2003.00447.x
Vacelet J (1991) Statut des e
´ponges commerciales en Me
´diterrane
´e.
In: Boudouresque CF, Avon M, Graver V (eds) Les espe
`ces
marines a proteger en Me
´diterrane
´e. Marseille. GIS Posidonie,
Marseille, pp 35–42
Van Oosterhout C, Hutchinson WF, Wills DPM, Shipley P (2004)
MICRO-CHECKER: software for identifying and correcting
genotyping errors in microsatellite data. Mol Ecol Notes 4:535–
538. doi:10.1111/j.1471-8286.2004.00684.x
Voultsiadou E, Vafidis D, Antoniadou C (2008) Sponges of
economical interest in the Eastern Mediterranean: an assessment
of diversity and population density. J Nat Hist 42:529–543.
doi:10.1080/00222930701835506
1158 Conserv Genet (2010) 11:1155–1158
123
... Until now, microsatellite loci have been characterized for nine species of the phylum Porifera, only one of them belonging to the class Calcarea (Paraleucilla magna) (Duran et al. 2002;Knowlton et al. 2003;Blanquer et al. 2005;Hoshino and Fujita 2006;Noyer et al. 2009;Dailianis and Tsigenopoulos 2010;Gigliarelli et al. 2010;Agell et al. 2011;Giles et al. 2013). ...
... Deviations from HWE associated with an excess of homozygotes seem to be common in sponge species (Uriz and Turon 2012). Moreover, the occurrence of null alleles has been commonly reported during the characterization of microsatellite loci and in population genetics studies (Dakin and Avise 2004), also being described in sponge species (Duran et al. 2002;Noyer et al. 2009;Dailianis and Tsigenopoulos 2010;Gigliarelli et al. 2010;Agell et al. 2011;Giles et al. 2013). Therefore, the low occurrence of amplification failure in Cau_B2 and Cau_G3 (3 and 13 %, respectively) may indicate that the significant excess of homozygotes may be a common fact in sponge populations resulting from biological phenomena instead of the presence of null alleles. ...
... Using this traditional method, we had a high efficiency in isolating microsatellites of C. aurea even when compared to vertebrates (Zane et al. 2002), as 7 polymorphic loci could be characterized from 21 positive colonies (yield of 33.3 %). In other sponge species, only 1.5-10.7 % of the positive colonies resulted in useful polymorphic loci (Duran et al. 2002;Blanquer et al. 2005;Noyer et al. 2009;Dailianis and Tsigenopoulos 2010;Gigliarelli et al. 2010;Agell et al. 2011). In fact, the maximum number of loci characterized for a sponge species is 12 (for Stylissa carteri) and the average is 8.7 loci per species (Duran et al. 2002;Knowlton et al. 2003;Blanquer et al. 2005;Hoshino and Fujita 2006;Noyer et al. 2009;Dailianis and Tsigenopoulos 2010;Gigliarelli et al. 2010;Agell et al. 2011;Giles et al. 2013). ...
Isolation and characterization of polymorphic microsatellite loci from Clathrina aurea (Porifera, Calcarea)
Article
  • Dec 2013
Although microsatellites are the most popular molecular markers for population genetic studies, only a few loci have been characterized for sponges (Porifera). In the present work, we describe the isolation and characterization of seven polymorphic microsatellite loci from an enriched library of the marine calcareous sponge Clathrina aurea. This species is considered endemic to Brazil, where it is widely distributed. However, it was recently found in Peruvian waters. Seven loci were tested in 30 individuals of one population in southeastern Brazil (Cabo Frio). The number of alleles ranged from 5 to 18 (average 12.3 ± 3.9). The species presented high average values of observed and expected heterozygosities: 0.672 ± 0.25 and 0.837 ± 0.08, respectively. No linkage disequilibrium between all pairs of loci was found, but two loci in this population showed a significant excess of homozygotes. This is the second set of loci ever characterized for a calcareous sponge. These loci will be useful for population genetics studies among Brazilian populations, to elucidate the possible introduction of this species in the Pacific Ocean and to analyze other still poorly investigated issues in sponges.
View
... To date, genetic resources for sponges are extremely limited. For instance, microsatellite markers have only been characterized for eight species not including Stylissa carteri (Duran et al. 2002;Knowlton et al. 2003;Blanquer et al. 2005;Hoshino and Fujita 2006;Noyer et al. 2009;Dailianis and Tsigenopoulos 2010;Gigliarelli et al. 2010;Guardiola et al. 2011). The purpose of this study was to identify polymorphic loci that are informative for determining the population structure, connectivity patterns, and possible reproductive capabilities of S. carteri. ...
... The 12 microsatellite markers developed here will make useful contributions to the future studies of sponge population genetics. Until now, microsatellites have only been developed for eight species within all the Porifera (Duran et al. 2002;Knowlton et al. 2003;Blanquer et al. 2005;Hoshino and Fujita 2006;Noyer et al. 2009;Dailianis and Tsigenopoulos 2010;Gigliarelli et al. 2010;Guardiola et al. 2011) and have only been used for population-wide analyses in few species (Duran et al. 2004a;Calderón et al. 2007;Hoshino et al. 2008;Blanquer et al. 2009;Uriz 2010, 2011;Noyer 2010;Dailianis et al. 2011;Guardiola et al. 2011). The highly variable markers presented herein will be useful for determining fine scale variability between sponge populations and tools for determining species identification for cryptic taxa within this group. ...
Novel polymorphic microsatellite markers developed for a common reef sponge, Stylissa carteri
Article
Full-text available
  • Sep 2013
Despite the ubiquitous role sponges play in reef ecosystem dynamics, little is known about population-level connectivity in these organisms. The general field of population genetics in sponges remains in its infancy. To date, microsatellite markers have only been developed for few sponge species and no sponge population genetics studies using microsatellites have been conducted in the Red Sea. Here, with the use of next-generation sequencing, we characterize 12 novel polymorphic loci for the common reef sponge, Stylissa carteri. The number of alleles per loci ranged between three and eight. Observed heterozygosity frequencies (Ho) ranged from 0.125 to 0.870, whereas expected (He) heterozygosity frequencies ranged from 0.119 to 0.812. Only one locus showed consistent deviations from Hardy-Weinberg equilibrium (HWE) in both populations and two loci consistently showed the possible presence of null alleles. No significant linkage disequilibrium was detected for any pairs of loci. These microsatellites will be of use for numerous ecological studies focused on this common and abundant sponge.
View
... During the last decade, microsatellite DNA loci have been used extensively as markers for population studies in a variety of marine invertebrates, including commercial ones (Addison & Hart 2004;Gutiérrez-Rodríguez & Lasker 2004;Baums et al. 2005;Pérez-Portela & Turon 2008;Ledoux et al. 2010). Polymorphic microsatellites have been isolated for six sponge species up to date, among which are the Mediterranean bath sponges Spongia lamella (Noyer et al. 2009, as Spongia agaricina) and S. officinalis (Dailianis & Tsigenopoulos 2010). Nevertheless, only three studies on noncommercial sponge natural populations utilizing some of these sets have been published (Duran et al. 2004c;Blanquer et al. 2009;Blanquer & Uriz 2010). ...
... Samples from all studied geographical locations were screened for variation at eight microsatellite loci (Spof054, Spof057, Spof069, Spof102, Spof130, Spof136, Spof148 and Spof240) previously described for S. offici- nalis by Dailianis & Tsigenopoulos (2010), with amplifying conditions as described therein. The sizes of the fluorescently labelled PCR products were estimated according to an internal size marker (GeneScanÔ 500 LIZ) on an ABI PrismÔ 3700 sequencer (Applied Biosystems) and analysed using STRAND v.2.3.48 (UC Davis Veterinary Genetics Laboratory, http://www.vgl.ucdavis. ...
Genetic diversity of the imperilled bath sponge Spongia officinalis Linnaeus, 1759 across the Mediterranean Sea: Patterns of population differentiation and implications for taxonomy and conservation
Article
Full-text available
  • Aug 2011
  • MOL ECOL
The Mediterranean bath sponge Spongia officinalis is an iconic species with high socio-economic value and precarious future owing to unregulated harvesting, mortality incidents and lack of established knowledge regarding its ecology. This study aims to assess genetic diversity and population structure of the species at different geographical scales throughout its distribution. For this purpose, 11 locations in the Eastern Mediterranean (Aegean Sea), Western Mediterranean (Provence coast) and the Strait of Gibraltar were sampled; specimens were analysed using partial mitochondrial cytochrome oxidase subunit I (COI) sequences, along with a set of eight microsatellite loci. According to our results (i) no genetic differentiation exists among the acknowledged Mediterranean morphotypes, and hence, S. officinalis can be viewed as a single, morphologically variable species; (ii) a notable divergence was recorded in the Gibraltar region, indicating the possible existence of a cryptic species; (iii) restriction to gene flow was evidenced between the Aegean Sea and Provence giving two well-defined regional clusters, thus suggesting the existence of a phylogeographic break between the two systems; (iv) low levels of genetic structure, not correlated to geographical distance, were observed inside geographical sectors, implying mechanisms (natural or anthropogenic) that enhance dispersal and gene flow have promoted population connectivity; (v) the genetic diversity of S. officinalis is maintained high in most studied locations despite pressure from harvesting and the influence of devastating epidemics. These findings provide a basis towards the effective conservation and management of the species.
View
... Microsatellite markers are more variable than standard nuclear and mitochondrial markers and are widely used to study the population structure of marine (Duran et al. 2002;Knowlton et al. 2003;Blanquer et al. 2005;Hoshino and Fujita 2006;Noyer et al. 2009;Anderson 2010;Dailianis and Tsigenopoulos 2010;Guardiola et al. 2012;Giles et al. 2013;Taboada et al. 2018) and freshwater (Anderson 2010;Yakhnenko and Itskovich 2021) sponges. However, to date, no sets of microsatellite markers have been published for the Baikal endemic sponges. ...
Genetic diversity studies of Baikal endemic sponges at the interspecies and population levels using high-resolution microsatellite markers
Article
Full-text available
  • Jul 2024
Lake Baikal, an ancient, massive lake in Siberia that holds 20% of the world’s fresh water reserves, is a unique center of speciation. Changes in the lake’s ecosystem in recent years require comprehensive monitoring activities to track the continuously evolving situation. Sponges are bioindicators of the state of aquatic ecosystems, and in Lake Baikal sponges are represented by both cosmopolitan and endemic species. However, the study of intra- and interspecific relationships between endemic sponges is complicated by the fact that standard molecular genetic markers are not suitable for these purposes. In this regard, the search for suitable high-resolution molecular genetic markers is especially relevant. Here we report on the development of a set of universal microsatellite markers that allows the interspecific relationships between Lake Baikal endemic sponges to be studied. We tested the effectiveness of this set of microsatellite markers on representatives of four endemic sponge species and achieved a reliable separation of representatives of all four genera of the endemic sponge family Lubomirskiidae. This is the first report of a set of highly variable molecular genetic markers that has been developed specifically for the study of interspecific relationships between Lake Baikal sponges. This set also has the potential to be a marker for species identification, which is important for monitoring activities in connection with events of mass death and diseases of sponges in Lake Baikal. The described approach can be used to study endemic sponges from other ancient lakes. It has great potential for use in the development of universal markers for identifying groups of closely related species.
View
... This drawback is likely responsible for the scarce number of sponge species (8) for which microsatellite markers have been developed so far: Crambe crambe (Schmidt) (Duran et al., 2002), Halichondria panicea (Pallas) (Knowlton et al., 2003), Scopalina lophyropoda Schmidt (Blanquer et al., 2005), Hymeniacidon sinapium de Laubenfels (Hoshino and Fujita, 2006), Spongia lamella (¼S. agaricina) (Schulze) (Noyer et al., 2009), Spongia officinalis Linnaeus (Dailianis and Tsigenopoulos, 2010), Ephydatia fluviatilis Topsent (Cigliarelli et al., 2008), and Paraleucilla magna Klautau, Monteiro and Borojevic (Guardiola et al., 2011). ...
Ancient Animals, New Challenges: Developments in Sponge Research
Book
  • Jan 2012
This book summarizes the latest advances in sponge science through a concise selection of studies presented at the VIII World Sponge Conference. The collection of articles reflects hot, ongoing debates in molecular research, such as the monophyletic versus paraphyletic nature of the sponge group, or the new awareness on pros and cons of standard barcodes and other markers in sponge taxonomy and phylogeny. It also features articles showing how the new sequencing technologies reveal the functional and phylogenetic complexity of the "microbial universe" associated to sponge tissues. The ecological interactions of sponges, the effects of nutrients and pollutants, the variability in reproductive patterns, and the processes generating genotypic and phenotypic variability in sponge populations are covered in several contributions. Zoogeography, population structure and dynamics are also approached with both traditional and molecular tools. The effect of anthropogenic disturbance on the natural environment finds its place in this volume with papers dealing with metal accumulation and the potential role of sponges as biomonitors. Biodiversity data from unexplored tropical and deep sea areas are presented. We hope readers will enjoy the selection of papers, which we believe represent collectively a significant contribution to our current understanding of sponges. Previously published in Hydrobiologia, vol. 687, 2012
View
... However, no distinct patterns, which could be ascribed either to demosponges or calcarean sponges can be confirmed by our results. The mean number of alleles per loci (Na = 8.9) was higher in P. magna populations than in the two (S.lophyropoda and C.crambe) out of the three previously studied species using microsatellites (Na = 3.95, and Na = 5.9, respectively) but lower than in a third species (Spongia officinalis, Na = 15.1, Dailianis & Tsigenopoulos, 2010). The populations of S. lophyropoda presented an unexplained outcrossing, given its patchy distribution and philopatric larvae (Uriz et al., 1998;Blanquer & Uriz, 2010). ...
Genetic structure and differentiation at a short-time scale of the introduced calcarean sponge Paraleucilla magna to the Western Mediterranean
Article
  • May 2012
The allochthonous calcarean sponge Paraleucilla magna has proliferated in the western Mediterranean during the last decade, where it currently shows a highly patchy distribution with dense populations in the neighboring of sea farms and slightly eutrophised marinas, and more sparse populations in well-preserved habitats. To gain knowledge about the species invasive capacity, we studied spatial genetic differentiation and structure, clonality, and temporal differentiation, in three close populations of P. magna at the NE of the Iberian Peninsula, in three successive years. The study hypothesis was that the species is able to proliferate under favorable conditions in newly colonized habitats but populations can easily disappear where perturbations occur with some frequency. Samples were genotyped for nine polymorphic microsatellites. Spatial genetic structure was found in the three populations of 2006. One population disappeared in 2007, and the other two remained slightly differentiated, while the three populations were in place again in 2008, and showed very low (but significant) F ST values, and non-significant D values. Low but statistically significant differentiation also occurred for the three populations between years. Results showed high-allele diversity, but heterozygote deficit and changes in allele frequencies in the populations over the 3 years, which are consistent with some genetic drift. The whole population descriptors pointed to the species as a good opportunistic colonizer as it has been hypothesized, but highly sensitive to stochastic events affecting recruitment. This suggests a high impact of the species in favorable habitats (sea culture and sheltered zones) and a low-medium influence in native communities.
View
... should also be experimentally evaluated in order to estimate interconnection between populations and possible regeneration sources for diminished stocks. The recent development of highly informative molecular markers, specific for Mediterranean bath sponge species (Noyer et al., 2009;Dailianis and Tsigenopoulos, 2010), can prove extremely useful towards this direction. Data on the current distribution pattern for all species in the Aegean (and, generally, throughout the Mediterranean) should be collected. ...
Aegean Bath Sponges: Historical Data and Current Status
Article
Full-text available
  • Jan 2011
This study attempts to evaluate the status of the populations of bath sponges (species of the genera Spongia and Hippospongia) in the Aegean, combining historical sources dated before a series of disease outbreaks that occurred from 1986 on, unpublished data obtained during the recovery phase after the first incident, as well as a current survey of the main spongiferous beds in the area. The latter was implemented through an extensive sampling trip assisted by professional sponge fishermen, including 55 stations distributed in 17 Aegean islands. Our analysis of population and morphometric data exhibits regeneration potential for bath sponge stocks, yet highlights the contrast between their present status and that of historical times. Uniformity is not evident, as several populations retain high abundances, while simultaneously areas purportedly rich in bath sponges appear deprived. Small-scale environmental regimes in the Aegean are proposed as the shaping factors of this situation; however, the importance of additional elaborate studies and the implementation of an effective regulation scheme regarding their fisheries are stressed.
View
... This drawback is likely responsible for the scarce number of sponge species (8) for which microsatellite markers have been developed so far: Crambe crambe (Schmidt) (Duran et al., 2002), Halichondria panicea (Pallas) (Knowlton et al., 2003), Scopalina lophyropoda Schmidt (Blanquer et al., 2005), Hymeniacidon sinapium de Laubenfels (Hoshino and Fujita, 2006), Spongia lamella (=S. agaricina) (Schulze) (Noyer et al., 2009), S. officinalis Linnaeus ( Dailianis and Tsigenopoulos, 2010), Ephydatia fluviatilis Topsent (Cigliarelli et al., 2008), and Paraleucilla magna Klautau, Monteiro and Borojevic (Guardiola et al., 2011). ...
Sponge Ecology in the Molecular Era
Article
  • Dec 2012
  • ADV MAR BIOL
Knowledge of the functioning, health state, and capacity for recovery of marine benthic organisms and assemblages has become essential to adequately manage and preserve marine biodiversity. Molecular tools have allowed an entirely new way to tackle old and new questions in conservation biology and ecology, and sponge science is following this lead. In this review, we discuss the biological and ecological studies of sponges that have used molecular markers during the past 20 years and present an outlook for expected trends in the molecular ecology of sponges in the near future. We go from (1) the interface between inter- and intraspecies studies, to (2) phylogeography and population level analyses, (3) intra-population features such as clonality and chimerism, and (4) environmentally modulated gene expression. A range of molecular markers has been assayed with contrasting success to reveal cryptic species and to assess the genetic diversity and connectivity of sponge populations, as well as their capacity to respond to environmental changes. We discuss the pros and cons of the molecular gene partitions used to date and the prospects of a plentiful supply of new markers for sponge ecological studies in the near future, in light of recently available molecular technologies. We predict that molecular ecology studies of sponges will move from genetics (the use of one or some genes) to genomics (extensive genome or transcriptome sequencing) in the forthcoming years and that sponge ecologists will take advantage of this research trend to answer ecological and biological questions that would have been impossible to address a few years ago.
View
A Novel All-Nature Material for Oil/Water Separation
Article
  • Jan 2019
Traditional oil/water separation materials were prepared with partial or all non-renewable raw materials, which would not only increase resource consumption, but also cause new environmental pollution after abandoned. In this work, a superhydrophobic and superoleophilic oil/water separation all-natural material were prepared using a simple and fast emulsion immersing method. The raw materials used including natural sponges and natural vegetable waxes, all of which are renewable. The as-prepared all-natural material can not only absorb various of oils from water with high oil absorption capacity, fast oil absorption rate and good recyclability, but also achieve the reuse of the absorbed oil by squeezing. In addition, the as-prepared all-natural material exhibits strong stability against cyclic compression, excellent resistance to corrosive aqueous solutions contacting and organic solvents immersing. Furthermore, the surface wax coating can be easily recycled. This work provides a new method to prepare oil/water separation materials by using all-natural and renewable raw materials.
View
View
Sponge-fishing, disease and farming in the Mediterranean Sea
Article
Full-text available
  • Sep 1999
1. Some Mediterranean sponge species belonging to the genera Spongia and Hippospongia, have been harvested for commercial purposes since ancient times. Recently, a widespread epidemic has greatly reduced the density of sponge populations which has had serious repercussions in the commercial field. 2. The synergetic action of harvesting and disease has taken a number of populations to the brink of extinction. Sponge-population densities are steadily decreasing and their recovery after the disease event is incomplete and has taken a long time. 3. There is a simple solution to the problem: sponge-farming. Trials have been underway since the beginning of the century and recently, Cuba, the Philippines and Micronesia Islands have started commercial sponge-farming. 4. Sponges are naturally able to remove dissolved organic matter, organic particles and bacteria from the water-column and this ability could be exploited in an integrated mariculture system. Floating cages for fish production result in the release of a lot of organic wastes that can be used as a source of food for surrounding intensive commercial sponge communities. Such an integrated system could result in effective eutrophication control, commercial sponge production and a consequent reduction of fishing effort on already heavily-stressed natural sponge populations. Copyright (C) 1999 John Wiley & Sons, Ltd.
View
Polymorphic microsatellite loci isolated from the marine sponge Scopalina lophyropoda (Demospongiae: Halichondrida)
Article
Full-text available
  • May 2005
  • MOL ECOL NOTES
A total of seven microsatellites out of 88 isolated from a genomic library enriched for (CA)n and (GA)n repeats were characterized in the Mediterranean marine sponge Scopalina lophyropoda. The microsatellite motifs were large (34.81 ± 13.9 bp) and imperfect. The seven microsatellite loci were screened in 30 individuals collected from Blanes, northwestern Mediterranean. All of them were polymorphic (allele numbers and observed heterozygosities ranged from 3 to 6 and from 0.16 to 0.76, respectively). No significant linkage disequilibrium between pairs of loci and no departure from Hardy–Weinberg equilibrium were found. These markers are therefore promising for studies of the population structure of the species.
View
View
View
View
Sponges of economical interest in the Eastern Mediterranean: An assessment of diversity and population density
Article
  • Feb 2008
The aim of this paper was to investigate diversity and population density of sponges with manifest or potential economical interest for the first time in the Eastern Mediterranean. For this purpose, the area of Dodecanese, an Aegean area traditionally harvested for sponges was surveyed for bath sponges and species known as sources of bioactive compounds. Twenty stations of diverse orientation, substrate inclination and type of substratum, located on seven islands, were surveyed and totally 36 demosponge species were found. The data, collected with a non-destructive method, were subjected to multivariate analysis which showed that sponge diversity was higher in areas with vertical cliffs. A considerable spatial variation was revealed by the formation of two groups of stations, according to sponge species presence/absence: one including vertical cliffs and a second one, including moderately inclined cliffs, Posidonia meadows and detritic biogenic bottoms. Bath sponges occurred at a restricted number of stations and although in relatively low population densities, they revealed a sign of recovery after the devastating epidemic events. Higher stock availability was found for six biotechnologically promising species which were distributed all over the study area. The above results are encouraging for a future sustainable stock exploitation and open a new perspective for sponge mariculture in the area.
View
Mortalité massive d’invertébrés marins : un événement sans précédent en Méditerranée nord-occidentale
Article
  • Oct 2000
  • Compt Rendus Acad Sci III Sci Vie
An unprecedented mass mortality event has been observed at the end of the summer 1999 along the coasts of Provence (France) and Ligury (Italy). This event has severely affected a wide array of sessile filter-feeder invertebrates from hard-substratum communities, such as sponges (particularly the keratose sponges Hippospongia and Spongia), cnidarians (particularly the anthozoans Corallium, Paramuricea, Eunicella and Cladocora), bivalves, ascidians and bryozoans. Along the Provence coasts, the outbreak spread from east to west. Exceptionally high and constant temperatures of the whole water column (23–24 °C, for over one month, down to 40 m) could have determined an environmental context favourable to the mass mortality event. Like the thermal anomaly, the mortality is limited in depth. However, we cannot ascertain whether temperature had a direct effect on organisms or acted in synergy with a latent and/or waterborne agent (microbiological or chemical). Taking into account the global warming context in the NW-Mediterranean, monitoring programs of physical-chemical parameters and vulnerable populations should rapidly be set up.
View
Isolation and characterization of microsatellite loci in Bemisia tabaci (Hemiptera: Aleyrodidae)
Article
  • Apr 2003
  • MOL ECOL NOTES
Microsatellite-enriched genomic libraries were obtained from the whitefly Bemisia tabaci (Hemiptera: Aleyrodidae) using a magnetic/biotin capture of repetitive sequences. Ten dinucleotide markers were successfully isolated and characterized from these libraries. Variability was assessed in six populations of B. tabaci collected from different localities of the island of Crete, Greece. The number of alleles per locus in approximately 105 individuals screened across populations ranged from two to 13. Averaged observed heterozygosity over the six populations ranged from 0.001 to 0.58.
View
Isolation and characterization of microsatellite loci in the intertidal sponge Halichondria panicea
Article
  • Sep 2003
  • MOL ECOL NOTES
GA- and CA-enriched genomic libraries were constructed for the intertidal sponge Halichondria panicea. Unique repeat motifs identified varied from the expected simple dinucleotide repeats to more complex repeat units. All sequences tended to be highly repetitive but did not necessarily contain the targeted motifs. Seven microsatellite loci were evaluated on sponges from the clone source population. All seven were polymorphic with 5.43 ± 0.92 mean number of alleles. Six of the seven loci that could be resolved had mean heterozygosities of 0.14–0.68. The loci identified here will be useful for population studies.
View