Article

Nuclear Transport of Plant Potyviral Proteins

Authors:
To read the full-text of this research, you can request a copy directly from the authors.

Abstract

We have used immunoblotting, immunocytochemical, and gene fusion methods to examine the differential subcellular partitioning of tobacco etch potyvirus proteins that are potentially associated with RNA replication. From the earliest timepoints at which viral proteins could be detected, proteins Nla (49-kilodalton proteinase) and Nlb (58-kilodalton polymerase) were localized primarily in the nucleus, whereas the 71-kilodalton cylindrical inclusion protein was identified in the cytoplasm. The Nla and Nlb coding regions were fused to the beta-glucuronidase (GUS) sequence in a plant expression vector, resulting in synthesis of chimeric proteins in transfected protoplasts and in transgenic plants. In situ localization of GUS activity revealed nuclear localization of the GUS-Nla and GUS-Nlb fusion proteins and cytoplasmic localization of nonfused GUS. These results indicate that both Nla and Nlb contain nuclear targeting signals, and that they may serve as useful models for studies of plant cell nuclear transport. A discussion of the general utility of the nuclear transport system described here, as well as the role of nuclear translocation of potyviral proteins, is presented.

No full-text available

Request Full-text Paper PDF

To read the full-text of this research,
you can request a copy directly from the authors.

... In potyviruses and in related bymoviruses, some viral proteins are transported to the nucleus of infected cells. Although the biological significance of their nuclear localization is uncertain, these proteins have been used as a model system to investigate the principles of nuclear import of proteins in plant cells (45,272,273). ...
... Nuclear localization signals in potyvirus proteins. Two proteins of TEV, the NIa protease and the 58-kDa NIb protein (putative RNA polymerase), are found in the nuclei of virusinfected tobacco plant cells (204,272). In some other potyviruses, one or both of the equivalent proteins may also be transported to the nucleus (305). ...
... It is not known whether the nuclear location of these proteins is essential for the virus infection or whether the nuclear localization signal (NLS) in potyvirus proteins is fortuitous. Nevertheless, dissection of NLS in TEV proteins has been performed (45,204,272,273). ...
Article
Full-text available
Viruses have developed successful strategies for propagation at the expense of their host cells. Efficient gene expression, genome multiplication, and invasion of the host are enabled by virus-encoded genetic elements, many of which are well characterized. Sequences derived from plant DNA and RNA viruses can be used to control expression of other genes in vivo. The main groups of plant virus genetic elements useful in genetic engineering are reviewed, including the signals for DNA-dependent and RNA-dependent RNA synthesis, sequences on the virus mRNAs that enable translational control, and sequences that control processing and intracellular sorting of virus proteins. Use of plant viruses as extrachromosomal expression vectors is also discussed, along with the issue of their stability.
... Therefore, the question arises as to why VRCs required proteins are mainly localized in the nucleus when expressed alone but are critical for the formation of cytoplasmic VRCs. In addition, diverse host factors are also relocated from the nuclei into VRCs during virus infection (Restrepo et al., 1990;Dufresne et al., 2008;Barton et al., 2017). ...
... Replication of TuMV has previously been thought to occur in the cytoplasm (Cotton et al., 2009;Grangeon et al., 2012), and TuMV 6K2-induced VRCs structures are replication markers that localize around the periphery of the nucleus (Fig S1). While many TuMV proteins including NIa-VPg, NIa-Pro, NIb, and CP localize in the nuclei (Restrepo et al., 1990;Rajamäki and Valkonen, 2009;Revers et al., 2015;Wei et al., 2010a). Therefore, we hypothesize that these viral proteins shuttle from the nuclei to the cytoplasm to support or regulate TuMV replication. ...
... These results support a model in which XPO1 proteins participate in TuMV VRCs formation. Of note, it is possible that XPO1 also transports other TuMV encoded nuclear proteins and pro-viral host factors to the TuMV VRCs via their interactions with NIb (Restrepo et al., 1990;Dufresne et al., 2008;Barton et al., 2017). However, the cytoplasmic localized NIb can be recognized and degraded by Beclin1-mediated autophagic degradation to suppress viral infection (Li et al., 2018), indicating the evolutionary arms race between plants and pathogens. ...
Article
Exportin 1/XPO1 is an important nuclear export receptor that binds directly to cargo proteins and translocates the cargo proteins to the cytoplasm. To understand XPO1 protein functions during potyvirus infections, we investigated the nuclear export of the NIb protein encoding the RNA‐dependent RNA polymerase (RdRp) of turnip mosaic virus (TuMV). Previously, we found that NIb is transported to the nucleus after translation and sumoylated by the sumoylation (small ubiquitin‐like modifier) pathway to support viral infection. Here, we report that XPO1 interacts with NIb to facilitate translocation from the nucleus to the viral replication complexes (VRCs) that accumulate in the perinuclear regions of TuMV infected cells. XPO1 contains two NIb‐binding domains that recognize and interact with NIb in the nucleus and in the perinuclear regions, respectively, which facilitates TuMV replication. Moreover, XPO1 is involved in nuclear export of the sumoylated NIb and host factors tagged with SUMO3 that is essential for suppression of plant immunity in the nucleus. Deficiencies of XPO1 in Arabidopsis and Nicotiana benthamiana plants inhibit TuMV replication and infection. These data demonstrate that XPO1 functions as a host factor in TuMV infection by regulating NIb nucleo‐cytoplasmic transport and plant immunity.
... HTR4 and HTR11 cDNAs were obtained as plasmids E2817 and E2819, respectively (Tenea et al. 2009). To construct plasmids for transient assays, histone cDNAs were cloned into pRTL2 (Restrepo et al. 1990) under the control of a CaMV double 35S promoter. EcoRI/XbaI fragments from E2817 and E2819 were cloned into the EcoRI/XbaI sites of pBluescript SK(+) to generate E3903 and E3904, respectively. ...
... EcoRI/XbaI fragments from E2817 and E2819 were cloned into the EcoRI/XbaI sites of pBluescript SK(+) to generate E3903 and E3904, respectively. Synthetic nucleotides (BamXbaT7Spe-1 and BamXbaT7Spe-2) that encode a triple T7 epitope tag were cloned into the BamHI/SpeI sites of pRTL2-GUS (b-glucuronidase) (Restrepo et al. 1990) to generate E3905. BamXbaT7T7Spe-1 and BamXbaT7T7Spe-2 were cloned into the BamHI/SpeI sites of E3905 to generate E3906. ...
Article
Full-text available
Agrobacterium-mediated transformation is a core technology for basic plant science and agricultural biotechnology. Improving transformation frequency is a major goal for plant transgenesis. We previously showed that T-DNA insertions in some histone genes decreased transformation susceptibility, whereas overexpression of several Arabidopsis H2A and H4 isoforms increased transformation. Overexpression of several histone H2B and H3 isoforms had little effect on transformation frequency. However, overexpression of histone H3-11 (HTR11) enhanced transformation. HTR11 is a unique H3 variant that lacks lysine at positions 9 and 27. The modification status of these lysine residues in canonical H3 proteins plays a critical role in epigenetic determination of gene expression. We mutated histone H3-4 (HTR4), a canonical H3.3 protein that does not increase transformation when overexpressed, by replacing K9 and/or K27 with the amino acids in HTR11 (K9I and/or K27Q). Overexpression of HTR4 with the K27Q but not the K9I substitution enhanced transformation. HTR4K27Q was incorporated into chromatin, and HTR4K27Q overexpression lines exhibited deregulated expression of H3K27me3-enriched genes. These results demonstrate that mutation of K27 in H3.3 is sufficient to perturb H3K27me3-dependent expression in plants as in animals, and suggest a distinct epigenetic role for histone HTR11. Further, these observations implicate manipulation of H3K27me3-dependent gene expression as a novel strategy to increase transformation susceptibility.
... Alternatively, the RING finger or helical domains might provide an autonomous CLS for either nuclear export or cytoplasmic retention. To test the second hypothesis directly, we fused individual COP1 fragments to the predominantly nuclear NIa protein (Restrepo et al., 1990;von Arnim and Deng, 1994). As shown quantitatively in Figure 6 and with representative micrographs in Figure 7, the chimeric NIa protein carrying the N-terminal 287 amino acids of COP1, COP1(1-287)NIa, localized predominantly, although not exclusively, to the cytoplasm in onion epidermal cells, whereas NIa alone was strongly nuclear (Figures 7A, 7B, 7D, and 7E). ...
... CONSTITUTIVE PHOTOMORPHOGENIC1 (COP1) mutant cDNAs were cloned as in-frame C-terminal fusions to ␤-glucuronidase (GUS) and the green fluorescent protein (GFP) via the vectors pRTL2-GUSNIa⌬Bam (Restrepo et al., 1990) and pRTL2-GFP (von Arnim et al., 1998), respectively. Subfragments of COP1 were also cloned into pRTL2-GUS-NIa (Carrington et al., 1991) and pRTL2-GFP-NIa (von Arnim et al., 1998) to create fusions to the C terminus of GUS or GFP and the N terminus of NIa. ...
Article
Full-text available
The Arabidopsis CONSTITUTIVE PHOTOMORPHOGENIC1 (COP1) protein plays a critical role in the repression of photomorphogenesis during Arabidopsis seedling development. We investigated the control of COP1 partitioning between nucleus and cytoplasm, which has been implicated in the regulation of COP1 activity, by using fusion proteins between COP1 and β-glucuronidase or the green fluorescent protein. Transient expression assays using onion epidermal cells and data from hypocotyl cells of stably transformed Arabidopsis demonstrated that COP1 carries a single, bipartite nuclear localization signal that functions independently of light. Nuclear exclusion was mediated by a novel and distinct signal, bordering the zinc-finger and coiled-coil motifs, that was able to redirect a heterologous nuclear protein to the cytoplasm. The cytoplasmic localization signal functioned in a light-independent manner. Light regulation of nuclear localization was reconstituted by combining the individual domains containing the nuclear localization signal and the cytoplasmic localization signal; the WD-40 repeat domain of COP1 was not required. However, phenotypic analysis of transgenic seedlings suggested that the constitutively nuclear-localized WD-40 repeat domain was able to mimic aspects of COP1 function, as indicated by exaggerated hypocotyl elongation under light conditions.
... The potyvirus-encoded proteins NIa and NIb accumulate mainly in the nuclei of virus-infected cells [20,21,64,65]. Several unique peptides specific to the VPg domain of NIa were detected in the nuclear protein samples of PVA-infected leaves, but the peptides were absent from the samples of healthy leaves. ...
... Surprisingly, no peptides specific to NIb were found, even if both NIa and NIb have been reported to accumulate in the nucleus in large amounts. They may also form nuclear inclusions [64,66,67]. It is possible that NIb was present in the nuclei of PVA-infected leaves at levels too low to be detected, e.g., because of rapid degradation or its association with aggregates of nuclear inclusions. ...
Article
Full-text available
Background: Infection of plants by viruses interferes with expression and subcellular localization of plant proteins. Potyviruses comprise the largest and most economically damaging group of plant-infecting RNA viruses. In virus-infected cells, at least two potyviral proteins localize to nucleus but reasons remain partly unknown. Results: In this study, we examined changes in the nuclear proteome of leaf cells from a diploid potato line (Solanum tuberosum L.) after infection with potato virus A (PVA; genus Potyvirus; Potyviridae) and compared the data with that acquired for healthy leaves. Gel-free liquid chromatography-coupled to tandem mass spectrometry was used to identify 807 nuclear proteins in the potato line v2-108; of these proteins, 370 were detected in at least two samples of healthy leaves. A total of 313 proteins were common in at least two samples of healthy and PVA-infected leaves; of these proteins, 8 showed differential accumulation. Sixteen proteins were detected exclusively in the samples from PVA-infected leaves, whereas other 16 proteins were unique to healthy leaves. The protein Dnajc14 was only detected in healthy leaves, whereas different ribosomal proteins, ribosome-biogenesis proteins, and RNA splicing-related proteins were over-represented in the nuclei of PVA-infected leaves. Two virus-encoded proteins were identified in the samples of PVA-infected leaves. Conclusions: Our results show that PVA infection alters especially ribosomes and splicing-related proteins in the nucleus of potato leaves. The data increase our understanding of potyvirus infection and the role of nucleus in infection. To our knowledge, this is the first study of the nuclear proteome of potato leaves and one of the few studies of changes occurring in nuclear proteomes in response to plant virus infection.
... Reporter protein techniques provide one convenient approach for investigating the distribution of proteins in vivo. For example, translational fusions with ␤ -glucuronidase (GUS) or the green fluorescent protein (GFP) have been widely used to examine the subcellular localization of various proteins (Restrepo et al., 1990;Chalfie et al., 1994). This technique has been applied in the study of phytochrome distribution by Sakamoto and Nagatani (1996), who fused fragments of Arabidopsis PhyB apoprotein (PHYB) to a GUS reporter protein in transgenic Arabidopsis plants. ...
Article
Although the physiological functions of phytochrome A (PhyA) are now known, the distribution of endogenous PhyA has not been examined. We have visualized endogenous PhyA apoprotein (PHYA) by immunolabeling cryosections of pea tissue, using PHYA-deficient mutants as negative controls. By this method, we examined the distribution of PHYA in different tissues and changes in its intracellular distribution in response to light. In apical hook cells of etiolated seedlings, PHYA immunolabeling was distributed diffusely in the cytosol. Exposure to continuous far-red (cFR) light caused a redistribution of the immunolabeling to the nucleus, first detectable after 1.5 hr and greatest at 4.5 hr. During this time, the amounts of spectrally active phytochrome and PHYA did not decline substantially. Exposure to continuous red (cR) light or to a brief pulse of red light also resulted in redistribution of immunolabeling to the nucleus, but this occurred much more rapidly and with a different pattern of intranuclear distribution than it did in response to cFR light. Exposures to cR light resulted in loss of immunolabeling, which was associated with PHYA degradation. These results indicate that the light-induced intracellular location of PHYA is wavelength dependent and imply that this is important for PhyA activity.
... We suggest that the structures may be similar to those described in the earlier studies. This proposal is consistent with previous observations that the replication complexes of TMV copurify with membrane extracts from infected cells (Watanabe and Okada, 1986;Young and Zaitlin, 1986;Young et al., 1987;Restrepo et al., 1990;Osman and Buck, 1996). Recent experiments in our laboratory have confirmed that both the MP and replicase are associated with the ER isolated from infected leaf tissues (C. ...
Article
Tobacco mosaic virus (TMV) derivatives that encode movement protein (MP) as a fusion to the green fluorescent protein (MP:GFP) were used in combination with antibody staining to identify host cell components to which MP and replicase accumulate in cells of infected Nicotiana benthamiana leaves and in infected BY-2 protoplasts. MP:GFP and replicase colocalized to the endoplasmic reticulum (ER; especially the cortical ER) and were present in large, irregularly shaped, ER-derived structures that may represent “viral factories.” The ER-derived structures required an intact cytoskeleton, and microtubules appeared to redistribute MP:GFP from these sites during late stages of infection. In leaves, MP:GFP accumulated in plasmodesmata, whereas in protoplasts, the MP:GFP was targeted to distinct, punctate sites near the plasma membrane. Treating protoplasts with cytochalasin D and brefeldin A at the time of inoculation prevented the accumulation of MP:GFP at these sites. It is proposed that the punctate sites anchor the cortical ER to plasma membrane and are related to sites at which plasmodesmata form in walled cells. Hairlike structures containing MP:GFP appeared on the surface of some of the infected protoplasts and are reminiscent of similar structures induced by other plant viruses. We present a model that postulates the role of the ER and cytoskeleton in targeting the MP and viral ribonucleoprotein from sites of virus synthesis to the plasmodesmata through which infection is spread.
... The RTM2 cDNA was amplified by using Pfu polymerase (Stratagene) and primers that added XhoI and BamHI sites to the 5Ј and 3Ј ends, respectively. The PCR product was digested with XhoI and BamHI and then inserted into the expression vector pRTL2 (Restrepo et al., 1990), which contains an enhanced CMV 35S promoter and terminator. The expression cassette was digested with PstI and inserted into pSLJ755I5, generating clones 46-2 and 46-3. ...
Article
Arabidopsis plants have a system to specifically restrict the long-distance movement of tobacco etch potyvirus (TEV) without involving either hypersensitive cell death or systemic acquired resistance. At least two dominant genes, RTM1 and RTM2, are necessary for this restriction. Through a series of coinfection experiments with heterologous viruses, the RTM1/RTM2–mediated restriction was shown to be highly specific for TEV. The RTM2 gene was isolated by a map-based cloning strategy. Isolation of RTM2 was confirmed by transgenic complementation and sequence analysis of wild-type and mutant alleles. The RTM2 gene product is a multidomain protein containing an N-terminal region with high similarity to plant small heat shock proteins (HSPs). Phylogenetic analysis revealed that the RTM2 small HSP–like domain is evolutionarily distinct from each of the five known classes of plant small HSPs. Unlike most other plant genes encoding small HSPs, expression of the RTM2 gene was not induced by high temperature and did not contribute to thermotolerance of seedlings. The RTM2 gene product was also shown to contain a large C-terminal region with multiple repeating sequences.
... The coding sequence of PME3 was cloned into the pRTL2-GUS vector (38). Two adaptors, 5'-CATGGCACCCGGGGCGGCCGCCACCACC ACCACCACCACTGAG-3' (Forward) and 5'-GATCCTCAGTGGTGGTGGTGGTGGTGGC GGCCGCCCCGGGTGC-3' (Reverse) were synthesized and inserted into pRTL2, replacing GUS and producing pRTL2Adapt. ...
Article
Full-text available
Pectin methylesterases (PMEs) catalyze the demethylesterification of homogalacturonan domains of pectin in plant cell walls and are regulated by endogenous pectin methylesterase inhibitors (PMEIs). In Arabidopsis dark-grown hypocotyls, one PME (AtPME3) and one PMEI (AtPMEI7) were identified as potential interacting proteins. Using RT-qPCR analysis and gene promoter::GUS fusions, we first showed that AtPME3 and AtPMEI7 genes had overlapping patterns of expression in etiolated hypocotyls. The two proteins were identified in hypocotyl cell wall extracts by proteomics. To investigate the potential interaction between AtPME3 and AtPMEI7, both proteins were expressed in a heterologous system and purified by affinity chromatography. The activity of recombinant AtPME3 was characterized on homogalacturonans (HGs) with distinct degrees (DM)/patterns of methylesterification. AtPME3 showed the highest activity at pH 7.5 on HG substrates with a DM between 60% and 80% and a random distribution of methyl esters. On the best HG substrate, AtPME3 generates long non-methylesterified stretches and leaves short highly methylesterified zones indicating that it acts as a processive enzyme. The recombinant AtPMEI7 and AtPME3 interaction reduces the level of demethylesterification of the HG substrate but does not inhibit the processivity of the enzyme. These data suggest that the AtPME3/AtPMEI7 complex is not covalently linked and could, depending on the pH, be alternately formed and dissociated. Docking analysis indicated that the inhibition of AtPME3 could occur via the interaction of AtPMEI7 with a PME ligand-binding cleft structure. All these data indicate that AtPME3 and AtPMEI7 could be partners involved in the fine-tuning of HG methylesterification during plant development. Copyright © 2015, The American Society for Biochemistry and Molecular Biology.
... The final PCR was performed using PCR products of the previous two reactions as template and primer pair Bln1-NcoN_pf1 and GFP-Bam_pr1. The final PCR product was digested with NcoI and BamHI and ligated into similarly treated pTRL2 (Restrepo et al., 1990) to yield p35S:BLN1+SP, harboring coding regions for full-length BLN1 and GFP. A similar strategy was adopted to make the Bln1 signal peptide-GFP construct, p35S:BLN1_SP only, as well as Bln1-GFP construct absent the Bln1 signal peptide, p35S:BLN1-SP. ...
Article
Full-text available
Plants have evolved complex regulatory mechanisms to control a multi-layered defense response to microbial attack. Both temporal and spatial gene expression are tightly regulated in response to pathogen ingress, modulating both positive and negative control of defense. BLUFENSINs, small knottin-like peptides in barley, wheat, and rice, are highly induced by attack from fungal pathogens, in particular, the obligate biotrophic fungus, Blumeria graminis f. sp. hordei (Bgh), causal agent of barley powdery mildew. Previous research indicated that Blufensin1 (Bln1) functions as a negative regulator of basal defense mechanisms. In the current report, we show that BLN1 and BLN2 can both be secreted to the apoplast and Barley stripe mosaic virus (BSMV)-mediated overexpression of Bln2 increases susceptibility of barley to Bgh. Bimolecular fluorescence complementation (BiFC) assays signify that BLN1 and BLN2 can interact with each other, and with calmodulin. We then used BSMV-induced gene silencing to knock down Bln1, followed by Barley1 GeneChip transcriptome analysis, to identify additional host genes influenced by Bln1. Analysis of differential expression revealed a gene set enriched for those encoding proteins annotated to nuclear import and the secretory pathway, particularly Importin α1-b and Sec61 γ subunits. Further functional analysis of these two affected genes showed that when silenced, they also reduced susceptibility to Bgh. Taken together, we postulate that Bln1 is co-opted by Bgh to facilitate transport of disease-related host proteins or effectors, influencing the establishment of Bgh compatibility on its barley host.
... The coding sequences of C58VirF and C58VirFmut were amplified using the primer pairs 5′ GGAAGATCTATGGAGCCCAGCCAACG AAGC3′ /5′ CCGCTCGAGTTATCGCGATAGTCCAGAGCGAC3′ and 5′ CCGGAATTCTATGGAGCC CAGCCAACGAAGC3′ /5′ CCGCTCGAGTTATCGCGATAGTCCAGAGCGAC3′ and inserted into the BglII-SalI or EcoRI-SalI sites, respectively, of pSAT6-nCerulean-C 31 . All constructs were verified by DNA sequencing, and all of them expressed proteins from the constitutive tandem 35S RNA promoter of the Cauliflower mosaic virus (CaMV) 45 . ...
Article
Full-text available
During Agrobacterium-mediated genetic transformation of plants, several bacterial virulence (Vir) proteins are translocated into the host cell to facilitate infection. One of the most important of such translocated factors is VirF, an F-box protein produced by octopine strains of Agrobacterium, which presumably facilitates proteasomal uncoating of the invading T-DNA from its associated proteins. The presence of VirF also is thought to be involved in differences in host specificity between octopine and nopaline strains of Agrobacterium, with the current dogma being that no functional VirF is encoded by nopaline strains. Here, we show that a protein with homology to octopine VirF is encoded by the Ti plasmid of the nopaline C58 strain of Agrobacterium. This protein, C58VirF, possesses the hallmarks of functional F-box proteins: it contains an active F-box domain and specifically interacts, via its F-box domain, with SKP1-like (ASK) protein components of the plant ubiquitin/proteasome system. Thus, our data suggest that nopaline strains of Agrobacterium have evolved to encode a functional F-box protein VirF.
... The cDNA encoding TG2 (GenBank Accession Number GI 50593093) from Caco 2 (Human colonic carcinoma) cell line (Bayardo et al., 2012) was amplified with the oligonucleotide primers forward F-SP-TG2 (GTGGGTACCCAATGGCCGAGGA GCTGGTC) and reverse R-TG2HisSal (CCCGTCGACGTGGT GGTGGTGGTGGTGGGCGGGGCCAATGATGAC), designed to place TG2 in frame with the sequence encoding a mouse immunoglobulin heavy chain signal peptide (SP; MGWSWIF LFLLSGAAGGY) from pRTL202 (Restrepo et al., 1990) and to introduce the sequence encoding a six histidine purification tag at the TG2 sequence 3 end. The PCR product was digested with Kpn I and Sal I and cloned into pRTL-G-KDEL and pRTL-G-KISIA (Petruccelli et al., 2007) to produce p-ER-TG2 and p-vac-TG2, respectively. ...
Article
Full-text available
Celiac Disease (CD) is a gluten sensitive enteropathy that remains widely undiagnosed and implementation of massive screening tests is needed to reduce the long term complications associated to untreated CD. The main CD autoantigen, human tissue transglutaminase (TG2), is a challenge for the different expression systems available since its cross-linking activity affects cellular processes. Plant-based transient expression systems can be an alternative for the production of this protein. In this work, a transient expression system for the production of human TG2 in Nicotiana benthamiana leaves was optimized and reactivity of plant-produced TG2 in CD screening test was evaluated. First, a subcellular targeting strategy was tested. Cytosolic, secretory, endoplasmic reticulum (C-terminal SEKDEL fusion) and vacuolar (C-terminal KISIA fusion) TG2 versions were transiently expressed in leaves and recombinant protein yields were measured. ER-TG2 and vac-TG2 levels were 9- to 16-fold higher than their cytosolic and secretory counterparts. As second strategy, TG2 variants were co-expressed with a hydrophobic elastin-like polymer (ELP) construct encoding for 36 repeats of the pentapeptide VPGXG in which the guest residue X were V and F in ratio 8:1. Protein bodies (PB) were induced by the ELP, with a consequent two-fold-increase in accumulation of both ER-TG2 and vac-TG2. Subsequently, ER-TG2 and vac-TG2 were produced and purified using immobilized metal ion affinity chromatography. Plant purified ER-TG2 and vac-TG2 were recognized by three anti-TG2 monoclonal antibodies that bind different epitopes proving that plant-produced antigen has immunochemical characteristics similar to those of human TG2. Lastly, an ELISA was performed with sera of CD patients and healthy controls. Both vac-TG2 and ER-TG2 were positively recognized by IgA of CD patients while they were not recognized by serum from non-celiac controls. These results confirmed the usefulness of plant-produced TG2 to develop screening assays. In conclusion, the combination of subcellular sorting strategy with co-expression with a PB inducing construct was sufficient to increase TG2 protein yields. This type of approach could be extended to other problematic proteins, highlighting the advantages of plant based production platforms.
... PCR products of N-terminal coded sequences were digested with NheI, and then ligated to the NheIdigested GFP PCR fragment. These ligated fragments were cut with NcoI/XbaI, and cloned into pRTL2 (Restrepo et al. 1990). These plasmids were digested with PvuII, and the DNA fragment containing the 2´35S-N-terminal peptide-GFP was cloned into pCAMBIA1300 (Roberts et al. 1997) (Fig. 2). ...
Article
;Three ADP-glucose pyrophosphorylase clones were isolated from the cotyledon cDNA library of the oil plant, Perilla frutescens, and their intracellular localization investigated. Two of three cDNAs (PfagpS1 and PfagpS2 )w ere homologous to the catalytic small subunit of AGPases found in other plants, while the third clone (PfagpL) was highly similar to the large subunit type. Transcripts for PfagpS1 and PfagpS2 were observed in both photosynthetic and non-photosynthetic tissue, showing the highest expression in the stem, while PfagpL transcripts were abundantly expressed in stem and cotyledon. To evaluate the subcellular localization of PfagpS2 and PfagpL as well as the maize BT2, N-terminus-GFP DNA fusion were constructed and transformed into tobacco plants. Immunoblot analysis showed that the expressed PfagpS2- and PfagpL-GFP fusions were targeted to the plastid in the heterologous tobacco system whereas the BT2-GFP remained intact, suggesting a cytoplasmic location. These intracellular assignments were confirmed by direct confocal microscopic examination. GFP signals were localized to the cytoplasm as well as in the nucleus in BT2-GFP plants, and to the plastids in PfagpS2- and PfagpL-GFP plants. Our results indicate that Perilla cotyledons contain multiple AGPase subunits, of which at least two isoforms and very likely the third, are plastidial in nature.
... T166 (PpCBF1) transgenic line was initially described by Wisniewski et al. (2011). Briefly, M.26 leaves underwent Agrobacteriummediated transformation with a vector consisting of a pBIN-PLUSARS (Belknap et al., 2008) backbone and the peach (Prunus persica) PpCBF1 gene driven by a dual 35 s enhancer segment derived from pRTL2 (Restrepo et al., 1990). Plants were maintained in tissue culture, roots initiated, plantlets grown successively in growth chambers and greenhouse, before being planted in October, 2010 at the Appalachian Fruit Research Station, USDA-ARS, Kearneysville, WV per Artlip et al. (2014). ...
Article
Full-text available
The timing of cold acclimation and deacclimation, dormancy, and budbreak play an integral role in the life cycle of woody plants. The molecular events that regulate these parameters have been the subject of much study, however, in most studies these events have been investigated independently of each other. Ectopic expression of a peach CBF (PpCBF1) in apple increases the level of both non-acclimated and acclimated freezing tolerance relative to the non-transformed control, and also inhibits growth, induces early bud set and leaf senescence, and delays bud break in the spring. The current study examined differences in the seasonal expression of genes (CBF, DAM, RGL, and EBB) that have been reported to be associated with freezing tolerance, dormancy, growth, and bud break, respectively, in the PpCBF1 T166 transgenic apple line and the non-transformed M.26 control. Results indicated that expression of several of these key genes, including MdDAM, MdRGL, and MdEBB was altered in transgenic T166 trees relative to non-transformed M.26 trees. In particular, several putative MdDAM genes, associated with the dormancy-cycle in other species of woody plants in the Rosaceae, exhibited different patterns of expression in the T166 vs. M.26 trees. Additionally, for the first time a putative APETALA2/Ethylene-responsive transcription factor, originally described in poplar and shown to regulate the timing of bud break, was shown to be associated with the timing of bud break in apple. Since the overexpression of PpCBF1 in apple results in a dramatic alteration in cold acclimation, dormancy, and growth, this transgenic line (T166) may represent a useful model for studying the integration of these seasonal life-cycle parameters.
... Very little is known about the role that NIb could play in the nucleus of the infected cells (Li, Valdez, Olvera, & Carrington, 1997;Restrepo, Freed, & Carrington, 1990). It has been recently reported that NIb interacts with the SUMO-conjugating enzyme SCE1 both in the nucleus and in the cytoplasm (Xiong & Wang, 2013; Table 1). ...
Article
Potyvirus is the largest genus of plant viruses causing significant losses in a wide range of crops. Potyviruses are aphid transmitted in a nonpersistent manner and some of them are also seed transmitted. As important pathogens, potyviruses are much more studied than other plant viruses belonging to other genera and their study covers many aspects of plant virology, such as functional characterization of viral proteins, molecular interaction with hosts and vectors, structure, taxonomy, evolution, epidemiology, and diagnosis. Biotechnological applications of potyviruses are also being explored. During this last decade, substantial advances have been made in the understanding of the molecular biology of these viruses and the functions of their various proteins. After a general presentation on the family Potyviridae and the potyviral proteins, we present an update of the knowledge on potyvirus multiplication, movement, and transmission and on potyvirus/plant compatible interactions including pathogenicity and symptom determinants. We end the review providing information on biotechnological applications of potyviruses. © 2015 Elsevier Inc. All rights reserved.
... It is partially localized in the endoplasmic reticulum membranes and can interact with other proteins of the host cell, thus promoting the viral replication cycle [25,26,28]. NIb has a nuclear translocation activity and accumulates in the nucleus, forming together with NIa amorphous or crystalline nuclear inclusions in the host cells [23,[29][30][31]. Mutations in NIb that disrupt this nuclear translocation activity prevent viral genome replication [23]. ...
... The second nuclear inclusion protein (NIb) is the RNA-dependent RNA polymerase involved in the replication of viral RNA (Domier et al. 1987;Hong and Hunt 1996). As is the case for NIa, the vast majority of NIb molecules predominantly accumulates in the nucleus of infected 13 cells and is able to form amorphous or crystalline nuclear inclusions in infected cells (Knuhtsen et al. 1974;Baunoch et al. 1988;Restrepo et al. 1990; Edwardson and Christie 1991). Since NI proteins and their inclusions accumulate in high levels in the nucleus especially towards the later stages of infection, Ivanov et al. (2014) postulated, that the nucleus may serve as a sequestration site for the "overproduced" NI proteins. ...
Thesis
Full-text available
Virus resistance research on potato has a high priority. In African potato growing countries the majority of seed tubers offered on rural markets are infected with potato viruses, such as Potato virus Y (PVY) and/or Potato leaf roll virus (PLRV) resulting in a catastrophic reduction of yields. By contrast, in industrial nations virus infection of potatoes is virtually irrelevant due to efficient seed certification schemes. Nevertheless, the high yield loss potential has led PVY and PLRV becoming two of the most important pathogens on the potato crop worldwide. Due to their high replication rate viruses evolve quickly and could overcome existing resistances. In the recent history, common PVY strains, were more and more replaced by recombinant strains, such as PVYN-Wi , PVYN:O or PVYNTN that are highly virulent and able to cause the potato tuber necrotic ring spot disease (PTNRD). Taken together, these challenges in potato research and production call for an increased knowledge about the epidemiology of PVY and PLRV strains. Furthermore, breeding programs have to focus on the introduction of new resistance genes and generation of varieties that are adapted to the climatic conditions of their growing regions. These efforts can be supported by reliable and sensitive virus detection methods. In this thesis the development and applications of reverse transcription real-time PCR (RTqPCR) detection assays are presented that are able to quantify the worldwide most important potato viruses PVY and PLRV and thus can contribute to several areas of potato research. It is demonstrated that the developed RT-qPCR assay for the quantification of PVY is highly sensitive and can be utilized for the direct testing even of freshly harvested tubers during seed certification. A similar sensitive assay was applied to evaluate Solanum species and progenies of somatic hybrids regarding their level of resistance to PVY. The accumulation of PVY differed in progenies of wild potato species that previously were uniformly classified as extreme resistant. Therefore, RT-qPCR may be an interesting tool for a resistance evaluation in breeding programs. Another application of RT-qPCR is the estimation of virulence of different PLRV isolates. A correlation between the PLRV titer in potato plants and virulence could not be assessed. However, a discriminating quantification of different PLRV RNA species allows further epidemiological studies. Finally, RT-qPCR was demonstrated to be a useful tool to evaluate the equivalence of genetically modified potatoes regarding their level of susceptibility to PVY. An increased susceptibility to PVY could be a reliable indicator for possible unintended effects caused by the genetic modification. It is shown that equivalence is difficult to approve if the non-transgenic comparator is non-equivalent and if the classification into equivalent or non-equivalent is dependent on environmental conditions.
... TuMV NIb catalyzes the synthesis of new viral genomic RNA. The NIb protein accumulates predominantly in the nucleus as nuclear inclusions and is also recruited into the cytoplasmic membrane-bound vesicles that house the VRC during viral infection 21,23,49 . The interaction of AtRH9 with NIb was confirmed by both BiFC and Y2H assays. ...
Article
Full-text available
Positive-sense RNA viruses have a small genome with very limited coding capacity and are highly dependent on host components to fulfill their life cycle. Recent studies have suggested that DEAD-box RNA helicases play vital roles in many aspects of RNA metabolism. To explore the possible role of the RNA helicases in viral infection, we used the Turnip mosaic virus (TuMV)-Arabidopsis pathosystem. The Arabidopsis genome encodes more than 100 putative RNA helicases (AtRH). Over 41 Arabidopsis T-DNA insertion mutants carrying genetic lesions in the corresponding 26 AtRH genes were screened for their requirement in TuMV infection. TuMV infection assays revealed that virus accumulation significantly decreased in the Arabidopsis mutants of three genes, AtRH9, AtRH26, and PRH75. In the present work, AtRH9 was further characterized. Yeast two-hybrid and bimolecular fluorescence complementation (BiFC) assays showed that AtRH9 interacted with the TuMV NIb protein, the viral RNA-dependent RNA polymerase. Moreover, the subcellular distribution of AtRH9 was altered in the virus-infected cells, and AtRH9 was recruited to the viral replication complex. These results suggest that Arabidopsis AtRH9 is an important component of the TuMV replication complex, possibly recruited via its interaction with NIb.
... A G2 gene fragment comprising the whole coding region was ligated 3Ј to ␤-glucuronidase (GUS) in the plant expression vector pRTL2-GUS (Restrepo et al., 1990), according to standard protocols (Sambrook et al., 1989). Sequence of the fusion junctions of this clone was verified by dideoxy sequencing of double-stranded DNA templates by using a Sequenase kit. ...
Article
Full-text available
The differentiation of distinct cell types within the leaf is essential for normal plant development. We characterized previously a transposon-induced mutant of maize (bundle sheath defective1) that disrupts the differentiation of a single photosynthetic cell type in the leaf. In this study, we show that this mutation is allelic to golden2 (g2), a lesion first reported 70 years ago. We cloned G2 by using Suppressor-mutator as a molecular tag. The gene encodes a 2.2-kb transcript that is present throughout the wild-type leaf but is most abundant in C4 leaf blade tissue. Gene sequence data showed the existence of a bipartite nuclear localization signal encoded by the first exon, and we determined that G2 reporter gene fusions are targeted to the nucleus in onion epidermal cells. Further sequence analysis indicated the presence of a novel motif within the deduced protein sequence that shares features with TEA DNA binding domains. Therefore, we propose that G2 acts as a novel transcriptional regulator of cellular differentiation in the maize leaf.
... The forward (5Ј-ACCAGCCATGGATCTTTCCCGACCTACCGGCG; NcoI site is underlined) and reverse (5Ј-TTGAGCTCATTT-GTTCAATAGTGCATCCAGATCCATAGGTT; SacI site and the altered NcoI site are underlined) primers were used to amplify a 2.4-kb DNA fragment from pCmKB-1 (Yamaguchi et al., 1996). The 2.4-kb DNA fragment was inserted into the NcoI-SacI site of pRTL2 (Restrepo et al., 1990). This plasmid was digested with HindIII and SacI, and the resulting 3.1-kb DNA fragment was ligated into the HindIII-SacI sites of the binary vector pBI101.2 ...
Article
The ga2 mutant ofArabidopsis thaliana is a gibberellin-deficient dwarf. Previous biochemical studies have suggested that the ga2mutant is impaired in the conversion of copalyl diphosphate toent-kaurene, which is catalyzed byent-kaurene synthase (KS). Overexpression of the previously isolated KS cDNA from pumpkin (Cucurbita maxima) (CmKS) in the ga2 mutant was able to complement the mutant phenotype. A genomic clone coding for KS, AtKS, was isolated from A. thalianausing CmKS cDNA as a heterologous probe. The corresponding A. thaliana cDNA was isolated and expressed in Escherichia coli as a fusion protein. The fusion protein showed enzymatic activity that converted [³H]copalyl diphosphate to [³H]ent-kaurene. The recombinant AtKS protein derived from the ga2–1 mutant is truncated by 14 kD at the C-terminal end and does not contain significant KS activity in vitro. Sequence analysis revealed that a C-2099 to T base substitution, which converts Gln-678 codon to a stop codon, is present in the AtKS cDNA from the ga2–1 mutant. Taken together, our results show that the GA2 locus encodes KS.
... The CocH3-Fc fusion PCR was done based on 12 bp nucleotide sequences overlapping the 3'-end of CocH3 gene and 5'-end of Fc fragment, followed by a full-length PCR using a CocH3 forward primer and an Fc reverse primer. The promoter and terminator used are the cauliflower mosaic virus (CaMV) 35S promoter and the CaMV 35S terminator, respectively, from pRTL2-GUS [18]. benthamiana plants with 4-5 true leaves were used for protein expression in this study. ...
Article
Full-text available
BackgroundA recently reported cocaine hydrolase (CocH3) fused with fragment crystallizable (Fc) region of human immunoglobulin G1, denoted as CocH3-Fc, is known as a promising therapeutic candidate for the treatment of cocaine overdose and addiction. A challenge for practical therapeutic use of this enzyme exists in the large-scale protein production and, therefore, it is interesting to identify a low-cost and feasible, sustainable source of CocH3-Fc production. ResultsCocH3-Fc was transiently expressed in plant Nicotiana benthamiana leaves. The plant-expressed protein, denoted as pCocH3-Fc, was as active as that expressed in mammalian cells both in vitro and in vivo. However, compared to the mammalian-cell expressed CocH3-Fc protein, pCocH3-Fc had a shorter biological half-life, probably due to the lack of protein sialylation in plant. Nevertheless, the in vivo half-life was significantly extended upon the PEGylation of pCocH3-Fc. The Fc fusion did not prolong the biological half-life of the plant-expressed enzyme pCocH3-Fc, but increased the yield of the enzyme expression in the plant under the same experimental conditions. Conclusions It is feasible to express pCocH3-Fc in plants. Further studies on the pCocH3-Fc production in plants should focus on the development of vectors with additional genes/promoters for the complete protein sialylation and for a better yield.
... The NIa proteinase is known to accumulate in the nucleus by virtue of its specific nuclear localization signals (Restrepo-Hartwig et al., 1990;Carrington et al., 1991). This protein is multifunctional consisting of two domains: the 22 kDa Vpg domain at the N-terminus which is necessary for RNA replication, and the 27 kDa proteinase at the C-terminus (Dougherty and Parks, 1991;Parks et al., 1992). ...
... HcoCas9 was PCR amplified using a forward primer with a BamHI site extension and a reverse primer carrying an extension with an XhoI site. A modified pRTL22 (Restrepo et al., 1990) carrying the 39 TEV sequence upstream of the CaMV 35S terminator sequence was used as the subcloning vector. The 35S-Cas9-term cassette was then transferred into the binary destination plasmid pBINPLUSsel through the HindIII site. ...
Article
The CRISPR/Cas9 gene editing platform has been adapted as a transient screening device for most biological model systems, although a comparable transient system has yet to be regularly implemented in plant biology. Here, we use the Tobacco mosaic virus-derived viral vector, TRBO, to evaluate the ability of three single guide RNA (sgRNA) delivery constructs in Nicotiana benthamiana by measuring the presence of genomic indels (inserts and deletions) when co-delivered through agroinfiltration with a Cas9 nuclease expressing construct. Indel percentages averaged nearly 70% within 7 days post-inoculation (dpi) using the TRBO-sgRNA tool to target the mgfp5 coding region of transgenic GFP-expressing N. benthamiana (16c) plants. Surprisingly, these high rates of editing occurred with the TRBO-sgRNA construct without 5' or 3' ribozyme-based processing capabilities. Green fluorescent images and GFP protein immunoblot assays showed a reduced level of GFP protein expression in 16c plants. The N. benthamiana paralogs Argonaute 1-H and Argonaute 1-L were targeted using a single sgRNA which effectively created indels within both genes. Similar indel efficiencies were observed when both the NbAGO1 and mgfp5 sgRNAs were co-delivered using a single TRBO delivery construct. Additionally, TRBO successfully delivered a RNA transcript consisting of a sgRNA adjoining a GFP protein coding region, which effectively established indels in the target while simultaneously allowing for viral based GFP overexpression. Delivery of sgRNAs using the TRBO system offers a transient gene knockout screening method for localized functional genetic studies, and a new transient plant engineering tool.
... The NbBeclin1-NIb interaction was confirmed by bimolecular fluorescence complementation (BiFC) in transgenic N. benthamiana leaves that express H2B-RFP, a nuclear marker (Fig. 2b). NIb-YFP was present in the cytoplasm and nucleus [31][32][33] . NbBeclin1-CFP was localized to a single or a few bright dots in the cytoplasm ( Fig. 2c and Supplementary Fig. 3a), consistent with the distribution pattern of Arabidopsis AtATG6/VPS30 34 a AD-NbBeclin1+BD ...
Article
Full-text available
Autophagy emerges as an essential immunity defense against intracellular pathogens. Here we report that turnip mosaic virus (TuMV) infection activates autophagy in plants and that Beclin1 (ATG6), a core component of autophagy, inhibits virus replication. Beclin1 interacts with NIb, the RNA-dependent RNA polymerase (RdRp) of TuMV, via the highly conserved GDD motif and the interaction complex is targeted for autophagic degradation likely through the adaptor protein ATG8a. Beclin1-mediated NIb degradation is inhibited by autophagy inhibitors. Deficiency of Beclin1 or ATG8a enhances NIb accumulation and promotes viral infection and vice versa. These data suggest that Beclin1 may be a selective autophagy receptor. Overexpression of a Beclin1 truncation mutant that binds to NIb but lacks the ability to mediate NIb degradation also inhibits virus replication. The Beclin1-RdRp interaction further extends to several RNA viruses. Thus Beclin1 restricts viral infection through suppression and also likely autophagic degradation of the viral RdRp.
... The potyviral RNA polymerase, NIb, is a nuclear targeting protein (Restrepo et al., 1990;Li et al., 1997;Revers and García, 2015). We functionally identified that the TuMV NIb protein contains one strong NLS and two NESs in the middle domain (Figures 1-3) that mediate the nucleocytoplasmic shuttling of NIb. ...
Article
Full-text available
The nuclear localization signal (NLS) and nuclear export signal (NES) are key signatures of proteins for controlling nuclear import and export. The NIb protein of turnip mosaic virus (TuMV) is an RNA-dependent RNA polymerase (RdRP) that is absolutely required for viral genome replication. Previous studies have shown that NIb is a nucleocytoplasmic shuttling protein and contains four putative NES and four putative NLS motifs. Here, we analyzed the function of these NESs and NLSs, and identified two functional NESs and one functional NLS. Mutation of the identified functional NESs or NLS inhibited viral RNA accumulation and systemic infection. Exportin 1 (XPO1) is a nuclear export receptor that binds directly to cargo proteins harboring a leucine-rich NES and translocates them to the cytoplasm. We found that XPO1 contains two NIb-binding domains, which recognize the NLS and NES of NIb, respectively, to mediate the nucleocytoplasmic transport of NIb and promote viral infection. Taken together, these data suggest that the nucleocytoplasmic transport of NIb is modulated by XPO1 through its interactions with the functional NLS and NES of NIb to promote viral infection.
... Cloning of PME3 and PMEI7 Coding Sequences into Expression Plasmids-The coding sequence of PME3 was cloned into the pRTL2-GUS vector (38). Two adaptors, 5Ј-CATGGCACC-CGGGGCGGCCGCCACCACCACCACCACCACTGAG-3Ј (forward) and 5Ј-GATCCTCAGTGGTGGTGGTGGTGGT-GGCGGCCGCCCCGGGTGC-3Ј (reverse), were synthesized and inserted into pRTL2, replacing GUS and producing pRTL2Adapt. ...
... 5. Isolate plasmids and resuspend them in Milli-Q water to reach a final concentration of 500 -10 0 0 ng/μl. For example, we use 1.5 μg the of the pRTL2 plasmids [11] per bombardment. The remaining steps should be carried out in a sterile laminar flow hood. ...
Article
Full-text available
Expressing transgenes in the endosperm of cereals by developing stably transformed lines is an expensive and labor-intensive process. An alternative that is less expensive and faster is to express the transgenes transiently. We describe here a detailed protocol to express transiently genes in maize aleurone cells by biolistic bombardment of in vitro cultured developing endosperms. Maize endosperms are isolated from kernels at 6-8 days after pollination and placed on culture medium plates for 1-2 days. Afterwards, the endosperms can be transfected with either a single gene or multiple transgenes simultaneously. Microparticles coated with the selected plasmids are delivered into the aleurone cells by biolistic bombardment. As a demonstration, we co-expressed two transgenes simultaneously, one tagged by GFP and the other tagged by mCherry. Our transfection efficiency is comparable to that obtained with Agrobacterium-mediated transformation, but requires a shorter time for gene expression after transfection. We provide optimized conditions and parameters for key steps in this procedure. •Small, non-binary plasmids can be used to drive expression of fluorescent proteins. •Optimized distribution of DNA-coated microparticles maximizes transfection of in vitro grown maize endosperms while minimizing cellular damage. •Transgene expression can be detected as early as one day after bombardment.
... However, the NIb protein contains nuclear localization signals (NLSs) and has nuclear translocation activity. Consistently, it accumulates predominantly in the nucleus and together with NIa forms amorphous or crystalline nuclear inclusions (NIs) in infected cells [12,[16][17][18]. Clustered point mutations within the NLSs of NIb that disrupt its nuclear translocation activity abolish viral genome replication, and this replication defection can be rescued in transgenic cells expressing a functional NIb [12]. ...
Article
Full-text available
Potyviruses represent the largest group of known plant RNA viruses and include many agriculturally important viruses, such as Plum pox virus, Soybean mosaic virus, Turnip mosaic virus, and Potato virus Y. Potyviruses adopt polyprotein processing as their genome expression strategy. Among the 11 known viral proteins, the nuclear inclusion protein b (NIb) is the RNA-dependent RNA polymerase responsible for viral genome replication. Beyond its principal role as an RNA replicase, NIb has been shown to play key roles in diverse virus–host interactions. NIb recruits several host proteins into the viral replication complexes (VRCs), which are essential for the formation of functional VRCs for virus multiplication, and interacts with the sumoylation pathway proteins to suppress NPR1-mediated immunity response. On the other hand, NIb serves as a target of selective autophagy as well as an elicitor of effector-triggered immunity, resulting in attenuated virus infection. These contrasting roles of NIb provide an excellent example of the complex co-evolutionary arms race between plant hosts and potyviruses. This review highlights the current knowledge about the multifunctional roles of NIb in potyvirus infection, and discusses future research directions.
... Both PBS1 and RPS5 are tethered to the plasma membrane, along with 72 AvrPphB ( Qi et al. 2012;Dowen et al. 2009). However, the TuMV NIa protease is 73 primarily located at the endoplasmic reticulum and in the nucleus ( Cotton et al. 74 2009; Restrepo et al. 1990), raising the possibility that PBS1 TuMV is only cleaved 75 late in the infection process, once high levels of viral proteins have accumulated 76 and neighboring cells have already been infected. To test this hypothesis, we used 77 genetic techniques to relocate the PBS1 TuMV -RPS5 complex to regions of NIa 78 accumulation and then assessed for improved activation of RPS5. ...
Preprint
Full-text available
The Arabidopsis resistance protein RPS5 is activated by proteolytic cleavage of the protein kinase PBS1 by the Pseudomonas syringae effector protease AvrPphB. We have previously shown that replacing seven amino acids at the cleavage site of PBS1 with a motif cleaved by the NIa protease of turnip mosaic virus (TuMV) enables RPS5 activation upon TuMV infection. However, this engineered resistance conferred a trailing necrosis phenotype indicative of a cell death response too slow to contain the virus. We theorized this could result from a positional mismatch within the cell between PBS1TuMV, RPS5 and the NIa protease. To test this, we re-localized PBS1TuMV and RPS5 to cellular sites of NIa accumulation. These experiments revealed that relocation of RPS5 away from the plasma membrane compromised RPS5-dependent cell death in N. benthamiana, even though PBS1 was efficiently cleaved. As an alternative approach, we tested whether overexpression of plasma membrane-localized PBS1TuMV would enhance RPS5 activation by TuMV. Significantly, over-expressing the PBS1TuMV decoy protein conferred complete resistance to TuMV when delivered by either Agrobacterium or by aphid transmission, showing that RPS5-mediated defense responses are effective against bacterial and viral pathogens. Lastly, we have now extended this PBS1 decoy approach to soybean by modifying a soybean PBS1 ortholog to be cleaved by the NIa protease of soybean mosaic virus (SMV). Transgenic overexpression of this soybean PBS1 decoy conferred immunity to SMV, demonstrating that we can use endogenous PBS1 proteins in crop plants to engineer economically relevant disease resistant traits.
... We recently reported that NIb interacts with SCE1 and that this 57 interaction is essential for potyviral infection (Xiong and Wang, 2013). It is well known that the 58 potyviral NIb is a nuclear targeting protein (Restrepo et al., 1990). However, the functional role 59 of NIb targeting to the nucleus remains a mystery. ...
Article
Sumoylation is a transient, reversible dynamic posttranslational modification that regulates diverse cellular processes including plant-pathogen interactions. Sumoylation of NPR1, a master regulator of basal and systemic acquired resistance to a broad spectrum of plant pathogens, activates the defense response. Here, we report that NIb, the only RNA-dependent RNA polymerase of Turnip mosaic virus (TuMV) that targets the nucleus upon translation, interacts exclusively with and is sumoylated by SUMO3 (SMALL UBIQUITIN-LIKE MODIFIER3), but not the three other Arabidopsis thaliana SUMO paralogs. TuMV infection upregulates SUMO3 expression, and the sumoylation of NIb by SUMO3 regulates the nuclear-cytoplasmic partitioning of NIb. We identified the SUMO-interacting motif in NIb that is essential for its sumoylation and found that knockout or overexpression of SUMO3 suppresses TuMV replication and attenuates viral symptoms, suggesting that SUMO3 plays dual roles as a host factor of TuMV and as an antiviral defender. Sumoylation of NIb by SUMO3 is crucial for its role in suppressing the host immune response. Taken together, our findings reveal that sumoylation of NIb promotes TuMV infection by retargeting NIb from the nucleus to the cytoplasm where viral replication takes place and by suppressing host antiviral responses through counteracting the TuMV infection-induced, SUMO3-activated, NPR1-mediated resistance pathway.
... (TAA) and an XhoI site. The PCR amplicon was then cloned into a modified 481 pRTL22(Restrepo et al. 1990) sub-cloning vector, as previously. The 35S-Cas9-term cassette482 was then transferred into the binary destination plasmid pBINPLUS-sel using the HindIII site to 483 create p-NLSCas9.484 ...
Preprint
Full-text available
The current CRISPR/Cas9 gene editing dogma for single guide RNAs (sgRNA) delivery is based on the premise that 5′ and 3′ nucleotide overhangs negate Cas9/sgRNA catalytic activity in vivo. This has led to engineering strategies designed to either avoid or remove extraneous nucleotides on the 5′ and 3′ termini. Previously, we used a Tobacco mosaic virus viral vector to express both GFP and a sgRNA from a single virus-derived mRNA in Nicotiana benthamiana. This vector yielded high levels of GFP and catalytically active sgRNAs. Here, in an effort to understand the biochemical interactions of this result, we used in vitro assays to demonstrate that nucleotide overhangs 5′, but not 3′, proximal to the sgRNA do in fact inactivate Cas9 catalytic activity at the specified target site. Next we showed that in planta sgRNAs bound to Cas9 are devoid of the expected 5′ overhangs transcribed by the virus. Furthermore, when a plant nuclear promoter was used for expression of the GFP-sgRNA fusion transcript it also produced indels when delivered with Cas9. These results reveal that 5′ "auto-processing" of progenitor sgRNAs occurs natively in plants. Towards a possible mechanism for the perceived "auto-processing", we found, using in vitro generated RNAs and those isolated from plants, that the 5′ to 3′ exoribonuclease XRN1 can degrade elongated progenitor sgRNAs whereas the mature sgRNA end-products are resistant. Comparisons with other studies suggest that sgRNA "auto-processing" may be a phenomenon not unique to plants, but other eukaryotes as well.
... For this, the Cas9-encoding sequence without the NLS was amplified using a forward primer designed downstream of the NLS sequence and contained a BamHI site as well as a start codon (ATG) and a reverse primer was designed upstream of the C-terminal NLS sequence followed by a stop codon (TAA) and an XhoI site (Supplemental Table S1). The PCR amplicon was then cloned into a modified pRTL22 (Restrepo et al., 1990) subcloning vector, as previously described. The 35S-Cas9-term cassette was then transferred into the binary destination plasmid pBINPLUS-sel using the HindIII site to create p-NLSCas9. ...
Article
Full-text available
The current CRISPR/Cas9 gene editing dogma for single guide RNA (sgRNA) delivery is based on the premise that 5'- and 3'-nucleotide overhangs negate Cas9/sgRNA catalytic activity in vivo. This has led to engineering strategies designed to either avoid or remove extraneous nucleotides at the 5' and 3' termini of sgRNAs. Previously, we used a Tobacco mosaic virus viral vector to express both GFP and a sgRNA from a single virus-derived mRNA in Nicotiana benthamiana. This vector yielded high levels of GFP and catalytically active sgRNAs. Here, in an effort to understand the biochemical interactions of this result, we used in vitro assays to demonstrate that nucleotide overhangs 5', but not 3', proximal to the sgRNA do in fact inactivate Cas9 catalytic activity at the specified target site. Next we showed that in planta sgRNAs bound to Cas9 are devoid of the expected 5' overhangs transcribed by the virus. Furthermore, when a plant nuclear promoter was used for expression of the GFP-sgRNA fusion transcript, it also produced indels when delivered with Cas9. These results reveal that 5' "auto-processing" of progenitor sgRNAs occurs natively in plants. Towards a possible mechanism for the perceived "auto-processing", we found, using in vitro-generated RNAs and those isolated from plants, that the 5' to 3' exoribonuclease XRN1 can degrade elongated progenitor sgRNAs whereas the mature sgRNA end products are resistant. Comparisons with other studies suggest that sgRNA "auto-processing" may be a phenomenon not unique to plants, but present in other eukaryotes as well.
... These include: non-probing (np), intracellular stylet puncture (pd), intercellular stylet pathway (C), salivation into phloem sieve elements (E1), and passive phloem sap uptake from phloem sieve elements (E2) [81][82][83]. Since potyvirus infection is not limited to any particular plant tissue [84], potyviruses appear to be most frequently acquired and inoculated during intracellular stylet puncture (pd) phase [81,85]. Previous EPG studies showed that aphids acquire non-persistent viruses within 3-5 s of stylet penetration into the epidermal cells [85][86][87] and lose their ability to transmit them within minutes of their removal from infected plants [2]. ...
Article
Full-text available
Potyviruses are the largest group of plant infecting RNA viruses that cause significant losses in a wide range of crops across the globe. The majority of viruses in the genus Potyvirus are transmitted by aphids in a non‑persistent, non‑circulative manner and have been extensively studied vis-à-vis their structure, taxonomy, evolution, diagnosis, transmission, and molecular interactions with hosts. This comprehensive review exclusively discusses potyviruses and their transmission by aphid vectors, specifically in the light of several virus, aphid and plant factors, and how their interplay influences potyviral binding in aphids, aphid behavior and fitness, host plant biochemistry, virus epidemics, and transmission bottlenecks. We present the heatmap of the global distribution of potyvirus species, variation in the potyviral coat protein gene, and top aphid vectors of potyviruses. Lastly, we examine how the fundamental understanding of these multi‑partite interactions through multi‑omics approaches is already contributing to, and can have future implications for, devising effective and sustainable management strategies against aphid-transmitted potyviruses to global agriculture.
... Here, we expressed P. trifoliata FT1 (PtFT1) as a translational fusion with a single-chain variable fragment antibody (scFv; Pack and Pl€ uckthun, 1992) that is part of a separate study. A constitutive expression cassette was used that included the Cauliflower mosaic virus (CaMV) 35S promoter with a double enhancer region (CaMV 35Sp), the Tobacco etch virus 5 0 untranslated region and the CaMV 35S polyadenylation signal (35S t ; Restrepo et al., 1990). The PtFT1-scFvcoding region included the PtFT1 cDNA sequence, a flexible linker sequence ([gly 4 ser] 4 ), the scFv sequence and a C-terminal cMyc epitope tag ( Figure 1a). ...
Article
Full-text available
Citrus (family Rutaceae) is one of the most important fruit crops, with world production exceeding 150 million metric tons in 2018 and a gross production value of 37.5 billion international dollars in 2016 (http://www.fao.org/faostat/en/#data). Citrus breeding programs seek improvements in areas ranging from fruit quality (e.g., seedlessness, acid content) to resistance against emergent diseases (e.g., huanglongbing). Unfortunately, breeding efforts are hampered by a long juvenility period of 6 or more years, characterized by thorniness, lack of flowering, and vertical as opposed to spreading growth form (Spiegel‐Roy and Goldschmidt, 1996).
... The resulting IOMT8 and EGFP open reading frame fragments were recovered from an agarose gel and served as templates in a second PCR using the IOMT forward and EGFP reverse primers. After digestion with EcoRI and XbaI, the resulting chimeric cDNA was inserted into the corresponding sites of the shuttle vector pRTL2 (Restrepo et al., 1990) under the control of a double 35S promoter. ...
Article
The first committed step in the gibberellin (GA) biosynthetic pathway is the conversion of geranylgeranyl pyrophosphate (GGPP) through copalyl pyrophosphate (CPP) to ent-kaurene catalyzed by ent-kaurene synthetases A and B. The ga1 mutants of Arabidopsis are gibberellin-responsive male-sterile dwarfs. Biochemical studies indicate that biosynthesis of GAs in the ga1 mutants is blocked prior to the synthesis of ent-kaurene. The GA1 locus was cloned previously using the technique of genomic subtraction. Here, we report the isolation of a nearly full-length GA1 cDNA clone from wild-type Arabidopsis. This cDNA clone encodes an active protein and is able to complement the dwarf phenotype in ga1-3 mutants by Agrobacterium-mediated transformation. In Escherichia coli cells that express both the Arabidopsis GA1 gene and the Erwinia uredovora gene encoding GGPP synthase, CPP was accumulated. This result indicates that the GA1 gene encodes the enzyme ent-kaurene synthetase A, which catalyzes the conversion of GGPP to CPP. Subcellular localization of the GA1 protein was studied using 35S-labeled GA1 protein and isolated pea chloroplasts. The results showed that the GA1 protein is imported into and processed in pea chloroplasts in vitro.
Article
As a member of the newly established Betaflexiviridae family, Grapevine rupestris stem pitting-associated virus (GRSPaV) has a RNA genome containing five open reading frames (ORFs). ORF1 encodes a putative replicase polyprotein typical of the Alphavirus superfamily of positive-strand, ssRNA viruses. Several viruses of this superfamily have been demonstrated to replicate in structures designated as viral replication complexes associated with intracellular membranes. However, structure and cellular localization of the replicase complex have not been studied for members of Betaflexiviridae, a family of mostly woody plant viruses. As a first step toward the elucidation of the replication complex of GRSPaV, we investigated the subcellular localization of full-length and truncated versions of its replicase polyprotein via fluorescent tagging, followed by fluorescence microscopy. We found that the replicase polyprotein formed distinctive punctate bodies in both Nicotiana benthamiana leaf cells and tobacco protoplasts. We further mapped a region of 76 amino acid in the methyl-transferase domain responsible for the formation of these punctate structures. These punctate structures are distributed in close proximity to the endoplasmic reticulum network. Membrane flotation and biochemical analyses demonstrate that the N-terminal region responsible for punctate structure formation associated with cellular membrane likely through an amphipathic a helix serving as an in-plane anchor. The identity of this membrane is yet to be determined. This is, to our knowledge, the first report on the localization and membrane association of the replicase proteins of a member of the family Betaflexiviridae.
Article
Unlabelled: Most plant viruses counter the RNA silencing-based antiviral defense by expressing viral suppressors of RNA silencing (VSRs). In this sense, VSRs may be regarded as virulence effectors that can be recognized by the host as avirulence (avr) factors to induce R-mediated resistance. We made use of Agrobacterium-mediated transient coexpression of VSRs in combination with Potato virus X (PVX) to recapitulate in local tissues the systemic necrosis (SN) caused by PVX-potyvirus synergistic infections in Nicotiana benthamiana. The hypersensitive response (HR)-like response was associated with an enhanced accumulation of PVX subgenomic RNAs. We further show that expression of P25, the VSR of PVX, in the presence of VSR from different viruses elicited an HR-like response in Nicotiana spp. Furthermore, the expression of P25 by a Plum pox virus (PPV) vector was sufficient to induce an increase of PPV pathogenicity that led to necrotic mottling. A frameshift mutation in the P25 open reading frame (ORF) of PVX did not lead to necrosis when coexpressed with VSRs. These findings indicate that P25 is the main PVX determinant involved in eliciting a systemic HR-like response in PVX-associated synergisms. Moreover, we show that silencing of SGT1 and RAR1 attenuated cell death in both PVX-potyvirus synergistic infection and the HR-like response elicited by P25. Our study underscores that P25 variants that have impaired ability to suppress RNA silencing cannot act as elicitors when synergized by the presence of other VSRs. These findings highlight the importance of RNA silencing suppression activity in the HR-like response elicited by VSRs in certain hosts. Importance: The work presented here describes how the activity of the PVX suppressor P25 elicits an HR-like response in Nicotiana spp. when overexpressed with other VSR proteins. This finding suggests that the SN response caused by PVX-associated synergisms is a delayed immune response triggered by P25, once it reaches a threshold level by the action of other VSRs. Moreover, this work supports the contention that the silencing suppressor activity of PVX P25 protein is a prerequisite for HR elicitation. We propose that unidentified avr determinants could be involved in other cases of viral synergisms in which heterologous "helper" viruses encoding strong VSRs exacerbate the accumulation of the avr-encoding virus.
Article
MicroRNA (miRNA)‐directed posttranscriptional gene silencing (miR‐PTGS) is an integral component of gene regulatory networks governing plant development and responses to the environment. The sequence homology between Sly‐miR4376, a miRNA common to Solanaceae and reported to target autoinhibited Ca2+‐ATPase 10 (ACA10) mRNA in tomato, and Arabidopsis miR391 (Ath‐miR391), previously annotated as a non‐conserved member of the deeply conserved miR390 family, has prompted us to revisit the function of Ath‐miR391, as well as its regulatory conservation. ● A combination of genetic, molecular, and bioinformatic analyses revealed a hidden conservation for miR‐PTGS of ACA10 homologs in spermatophytes. ● We found that the Arabidopsis ACA10 mRNA undergoes miR391‐directed cleavage in vivo. Furthermore, transgenic overexpression of miR391 recapitulated the compact inflorescence (cif) phenotypes characteristic of ACA10 loss‐of‐function mutants, due to miR391‐directed PTGS of ACA10. Significantly, comprehensive data mining revealed robust evidence for widespread PTGS of ACA10 homologs directed by a superfamily of related miRNAs sharing a conserved sequence core. Intriguingly, the ACA‐targeting miRNAs in Poaceae also direct PTGS for calmodulin‐like proteins which are putative Ca2+ sensors. ● The PTGS of ACA10 homologs is therefore directed by a miRNA superfamily that is of ancient origin and has undergone rapid sequence diversification associated with functional innovation.
Chapter
Full-text available
This report describes the taxa and member viruses approved by the ICTV between 1970 and 1993. Descriptions of the most important characteristics of these taxa are provided, together with a list of members and selected references. These descriptions represent the work of the chairpersons and members of the Subcommittees and Study Groups of the ICTV. A glossary of abbreviations and terms is provided first; followed by a set of virus diagrams and listings of the taxa, alphabetically, then by host, and then by nucleic acid and genome characteristics. A key to the placement of the viruses in the taxa is provided. Descriptions of the taxa and a listing of unassigned viruses follow.
Article
Defence responses were measured in leaves of alfalfa (Medicago sativa L.) after infection by virulent (compatible) and avirulent (incompatible) races of the anthracnose fungusColletotrichum trifolii . In the incompatible interaction, the isoflavonoid phytoalexin medicarpin and its conjugates started to accumulate 24 and 48 h after inoculation, respectively, whereas their appearance was delayed to 48 and 72 h, respectively, in the compatible interaction. No differences in the activities of β-1,3-glucanase isoforms were detected between infected and mock-inoculated tissues; expression of these defence-related hydrolases was constitutive. Constitutive overexpression of the alfalfa acidic glucanase Aglu1 in Regen SY, an alfalfa cultivar susceptible to C. trifolii, did not result in a greater or more rapid phytoalexin response, nor did it reduce the symptoms following pathogen attack, even though the majority of transgenic plants expressing the aglu1 transgene produced other glucanase isoforms that were not expressed in the non-transformed plants. The results do not support the hypothesis that glucanases may function in host defence to release elicitors of the phytoalexin response in the alfalfa/ C. trifolii interaction.
Article
The specificity of protein targeting processes is the basis of maintaining structural and functional integrity of the cell, enabling the various subcellular compartments to carry out their unique metabolic roles. Studies in plants have progressed markedly in the last 5 years, and many of the specific signals involved in the transport and targeting of proteins to the nucleus, chloroplast, mitochondrion and microbody, and to organelles along the secretory pathway (endoplasmic reticulum [ER], Golgi complex, and vacuole) have been characterized. Exciting prospects include the identification of receptors involved in the recognition of protein targeting signals, mechanisms of vesicle targeting, and the role of mRNA targeting. Although important exceptions exist, a striking feature of the mechanisms and cellular machinery of protein targeting is their universality — among plants, animals, and eukaryotic microorganisms — and even between prokaryotes and eukaryotes. More information is required about the structural features of proteins that allow for their stable accumulation in a particular subcellular compartment, of particular interest to the plant genetic engineer. Our understanding of the rules that govern protein folding and oligomer assembly and how these processes relate to a protein's ultimate stability in the cell is limited.
Chapter
Genetic transformation of maize is routine in several genotypes despite the many difficulties encountered in developing reliable transformation techniques in this major cereal species. Aspects of maize tissue culture, including the target expiant, subsequent rapid in vitro proliferation and dependable regeneration from competent cells were prerequisite developments for gene delivery into maize. Recovery of transgenic, fertile maize required high levels of gene expression and identification of new selectable markers, along with DNA delivery into competent maize cells. DNA delivery by particle bombardment, Agrobacterium, electroporation and silica fiber methods have been the most carefully documented, each of which can now be used for gene transfer into maize. Promoters such as those from the CaMV 35S or ubiquitin genes, together with various introns have been widely used to achieve high expression levels, while the herbicide resistance gene, bar, has served as an important selectable marker for numerous studies in maize transformation. Although tissue culture cells were instrumental in the development of maize transformation, the direct use of expiants such as the immature embryo and/or meristems has found favor in more recent applications. Gene delivery in maize has shifted from emphasis on technology development to evaluation of gene expression with various transgenes, some of which are already in large-scale commercial development (e.g. insect and herbicide resistance). Maize transformation is increasingly being used to address more sophisticated aspects of gene regulation, plant development and physiology. The stability of transgene expression in primary transgenic plants and subsequent generations is of obvious academic and commercial importance. The isolation of promoters with a variety of expression profiles that are tissue-specific and/or temporally regulated will become more important as trait modification strategies evolve. Technologies such as site-directed integration, homologous recombination, ‘chimeraplasty’, and others will likely become routine in higher plants such as maize as this research area, now in its infancy, continues to develop. These technologies have the potential to aid our understanding of gene regulation, and to more directly make changes in endogenous gene sequences or to permit targeting of new genes (or regulatory elements) into precise genomic locations. With an assortment of accompanying genetic tools such as reverse genetic methods, mapping, genome-scale analysis and gene expression information, maize transformation has evolved into an important tool for both basic and applied studies in plants.
Chapter
From the very beginnings of genetic engineering, researchers have questioned whether the genes that were being transformed into plants would be expressed as predictably as those that had evolved there. In one of the most extensive of the early studies on the inheritance of newly introduced traits, Müller et al. (1987) reported that the rate of transgene inactivation was comparable to rates of spontaneous mutation for a naturally evolved gene. To measure this, they introduced the coding region for neomycin phosphotransferase II (npt) driven by the nopaline synthase promoter (nos pr) into tobacco. When homozygous transformants with a single copy of the nos pr-npt gene were back-crossed to untransformed plants, the frequencies of nos pr-npt gene inactivation in the progenies of two transgenic lines were 6/45 000 and 25/45 000. Unfortunately, none of those plants that appeared to have lost resistance to kanamycin could be rescued before they died. As a result, it was not possible to determine whether the loss of the trait was due to mutational inactivation of the gene or to epigenetic suppression of the phenotype. In a more recent study, Dehio and Schell (1993) produced morphologically altered Arabidopsis plants by introducing a single copy of the Agrobacterium rhizogenes rolA gene. They then screened the progeny of homozygous plants for individuals that reverted to normal. None was found within a sampling of 10 000 progeny. In fact, reversion to a wild-type appearance was only seen among the M2 progeny of plants treated with the chemical mutagen ethylmethanesulphonate (EMS).
Article
Maintaining high crop yields in an environmentally sustainable manner requires the development of disease-resistant crop varieties. We describe a method to engineer disease resistance in plants by means of an endogenous disease resistance gene from Arabidopsis thaliana named RPS5, which encodes a nucleotide-binding leucine-rich repeat (NLR) protein. RPS5 is normally activated when a second host protein, PBS1, is cleaved by the pathogen-secreted protease AvrPphB. We show that the AvrPphB cleavage site within PBS1 can be substituted with cleavage sites for other pathogen proteases, which then enables RPS5 to be activated by these proteases, thereby conferring resistance to new pathogens. This “decoy” approach may be applicable to other NLR proteins and should enable engineering of resistance in plants to diseases for which we currently lack robust genetic resistance.
Chapter
The nucleus and subnuclear structures such as Cajal bodies and the nucleolus function as pleiotropic control centres which regulate cellular activities. In recent years it has been found that proteins encoded by diverse genera of plant viruses can localize and interact with components of these structures during the infection process. In some cases such interactions are required for successful replication and systemic spread of the viruses, whereas in other cases these associations are detrimental to virus infection. This chapter aims to discuss the types of interaction at the mechanistic level, to provide the reader with a broad understanding of the role of subnuclear domains during plant virus infections.
Chapter
The T-DNA (transferred DNA) of Agrobacterium tumefaciens is the only non-viral nucleic acid known to genetically transform a higher eukaryotic cell in nature. The bacterium has to produce plant-infectious DNA which then has to penetrate the bacterial and plant membranes, find the plant cell nucleus, and finally has to integrate into the chromosomal DNA. An adaptation of the bacterium to the eukaryotic condition of the recipient must have been the nuclear targeting of the T-DNA. Here we address the question of how the T-DNA is directed to the plant nucleus. Virulence protein D2, covalently attached to T-DNA in the bacterium, is a prime candidate for the function of nuclear targeting. We show that VirD2 protein contains two nuclear localization signals (NLS) which are able to target an otherwise cytoplasmatically localized β-galactosidase protein to the nuclei of both yeast and plant cells. Experiments employing a transient assay for T-DNA transfer reveal that deletion of the C-terminal NLS of VirD2 drastically reduces (but does not abolish) the efficiency of T-DNA transfer, whereas mutations in the N-terminal NLS coding sequence seem to have no effect on T-DNA transfer. This result complements the in vitro nuclear localization data.
Chapter
Protein nuclear import is basic to all eukaryotic organisms. While this process has been studied extensively in animal and yeast systems, it is only now being addressed in plants. For these studies in plants, it is critical to develop a simple, reliable and sensitive assay to monitor nuclear import. Recently, an assay that involves a histochemical analysis of the enzymatic activity of β-glucuronidase (GUS) fused to a test protein has emerged [3–5, 11, 21, 24, 27]. Are there alternatives to this GUS assay? At least two other approaches have been used in studies of plant nuclear import, E. coli β-galactosidase (lacZ gene) fusions [10] and immunostaining [18, 26]. In contrast to the success of lac fusions in other systems, this approach has proved difficult in plants because of high endogenous β-galactosidase activity in plant cells [12]. In the second approach, plant nuclear import is detected using immunostaining techniques. Although sensitive and specific, this procedure is time-consuming, requiring production of antibodies and processing of the plant material for light or electron microscopy. Presently, therefore, the GUS assay is the most convenient and reliable assay for protein nuclear import in plant cells.
Thesis
Potato virus A (PVA) is a single stranded RNA virus, belonging to genus Potyvirus. It is commonly found in potato growing countries and it can decrease potato yield up to 40%. PVA replicates in the cytoplasm of the plant cell, but some of its proteins are targeted to the nucleus. Dnajc14 is a protein chaperone found in potato plants and it plays a role in protein folding, complex assembly and molecular disaggregation. These functions might also help RNA virus infection. When nuclear proteome analysis of potato plants was done, it was found that Dnajc14 protein was present in the nucleus of healthy potato cells, while it was absent from the nucleus of PVA infected cells. The objective of this research work was to confirm the subcellular localization of Dnajc14 in healthy and PVA-infected plants. In this research work, Dnajc14 protein was cloned in fusion with Green Fluorescent Protein (Dnajc14-GFP and GFP-Dnajc14) and the localization of the protein was checked in both healthy Nicotiana benthamiana leaves and N. benthamiana leaves systemically infected with PVA using epifluorescence microscope. PVA was tagged with Red Fluorescence Protein in order to identify the infected cells under the microscope. It was observed that in healthy cells, Dnajc14 protein was localized to the nucleus. When various views of the cells in different leaves were checked, it was found that in PVA-infected cells, the number of cells showing nuclear fluorescence was less than in the healthy cells. The decrease in the amounts of Dnajc14 protein in the nucleus of PVA-infected plants was calculated to be about 31%. The results suggest that there is an alteration in the level of this protein chaperone during PVA infection. This change may be beneficial for the viral infection. This report confirms the localization of Dnajc14 in the nucleus of healthy potato plants.
Article
Full-text available
About 50% of Semliki Forest virus-specific nonstructural protein nsP2 is associated with the nuclear fraction in virus-infected BHK cells. Transport into the nucleus must be specific, since only trace amounts of nsP3 and nsP4 and about 13% of nsP1, all derived from the same polyprotein, were found in the nucleus. Subfractionation of [35S]methionine-labeled Semliki Forest virus-infected cells showed that 80 to 90% of the nuclear nsP2 was associated with the nuclear matrix. Indirect immunofluorescence, with anti-nsP2 antiserum, showed the most intensive staining of structures which by Nomarski optics appeared to be nucleoli. In the presence of 1 to 5 micrograms of dactinomycin per ml the nuclei were stained evenly and no nucleoli could be found. Transport of nsP2 into the nucleus occurred early in infection and was fairly rapid. A cDNA encoding the complete nsP2 was isolated by the polymerase chain reaction technique and ligated into a simian virus 40 expression vector derivative. When BHK cells were transfected with this pSV-NS2 vector by the lipofection procedure, nsP2 was expressed in about 1 to 5% of the cells, as shown by indirect immunofluorescence. In positively transfected cells the immunofluorescence stain was most intensive in the nucleoli. Thus, Semliki Forest virus-specific nsP2 must have information which directs it into the nuclear matrix and, more specifically, into the nucleoli.
Article
Full-text available
A simple method for fixing and embedding plant tissue for hybridization histochemistry has been developed. Material is fixed with paraformaldehyde-glutaraldehyde by the phase-partition technique and embedded in LR Gold. The method preserves nucleic acids in situ. Double-stranded 32P-labelled DNA probes hybridized to complementary RNAs in thin and semithin sections. Biotinylated probes detected with immunogold markers have been used to localize transcripts at the electron microscopic level.
Article
Full-text available
The infectivity of plum pox potyvirus (PPV) RNA was decreased by treatment with proteases. Ribonuclease digestion of iodinated PPV RNA yielded material which had an electrophoretic mobility corresponding to Mr 22,000. This protein presumably corresponds to the protease-sensitive structure needed for infectivity. A protein-linked RNase T1-resistant oligonucleotide, 38 nucleotides long, was sequenced and shown to correspond to the 5' terminus of the RNA by sequence comparison to the RNAs of two other potyviruses, tobacco etch virus and tobacco vein mottling virus. A 12 nucleotide block was found to be completely conserved in the RNAs of the three viruses.
Article
Full-text available
Five monoclonal antibodies to the matrix (M) protein of Newcastle disease virus (NDV) Australia-Victoria (AV) strain were generated and characterized. In competitive antibody-binding assays, the antibodies fell into three discrete groups. The antigenic sites described by these antibody groups were designated M1, M2, and M3. Each antibody reacted with a panel of NDV strains in a manner unique to its group, confirming the grouping by competitive antibody binding. Only site M1 was found on all 12 of the strains tested and may be a "pan-NDV" epitope. A large portion of the M protein of strain AV was detected in the nuclei of infected cells by all five monoclonal antibodies. In addition, the antibodies only stained the nuclei of cells infected with NDV strains expressing M protein containing the corresponding antigenic site. These results confirm that the immunoreactivity in the nucleus is actually caused by the M protein and not by a cross-reacting host protein induced by viral infection.
Article
Full-text available
Large nuclear proteins must possess a signal sequence to pass through the nuclear pores. Using an in vitro system, we have been able experimentally to dissect nuclear protein transport into two distinct steps: binding and translocation. In the absence of ATP, we observe a binding of nuclear proteins to the pore that is signal sequence-dependent. Translocation through the pore, on the other hand, strictly requires ATP. These steps, visualized in the fluorescence and electron microscopes, were observed both with a natural nuclear protein, nucleoplasmin, and a synthetic nuclear protein, composed of the signal sequence of SV40 T antigen coupled to HSA. When a mutant signal sequence was coupled to HSA, neither transport nor binding were observed, indicating that both result from the presence of a functional signal sequence. An inhibitor of transport, the lectin WGA, also arrested nuclear proteins in a bound state at the cytoplasmic face of the pore. Therefore, only the translocation step is sensitive to the inhibitor WGA, which is known to bind specifically to proteins of the nuclear pore.
Article
Thin sections of tobacco etch virus (TEV)-infected leaves were treated with goat anti-rabbit antibodies conjugated to 15-nm gold particles after the sections had been exposed to rabbit antisera specific to virus particles, virus capsid, 70K CI protein, 54K NI protein, or 49K NI protein. Anti-TEV or anti-TEV capsid sera specifically detected virus particles and capsid protein in the cytoplasm and capsid protein which was also found arrayed in a regular fashion adjacent to the cell wall. The NI 54K and 49K inclusions were found primarily in the nucleus and surprisingly in the cytoplasm. Free NI 54K and 49K proteins were also found in regions adjacent to the nuclear membrane and in association with the nucleolus. The 70K CI protein was found in the pinwheel inclusions and laminated aggregates as well as filamentous structures associated with the cell membrane. The latter observation is significant in view of the hypothesis that the 70K CI protein represents the membrane binding component of the viral replication complex.
Article
Immunoelectron microscopy with gold-labelled antibodies showed that homologous capsid proteins or virions are associated with cylindrical inclusions of wheat streak mosaic virus and of wheat spindle streak mosaic virus in vivo. Capsid proteins did not bind to any other structure in the cell. The specific association of capsid proteins with cylindrical inclusions is discussed in relation to cell-to-cell spread of virions through plasmodesmata.
Article
TEV-RNA was separated into poly(A)+ and poly(A)- RNA by affinity chromatography. Both classes of RNA have similar base ratios. The poly(A) segment in the RNA was shown to be located at the 3'-OH end by dihydroxyborylaminoethyl-cellulose chromatography. Although the poly(A) was heterodisperse in length, ranging from about 200 to less than 33 AMP residues, two size classes averaging about 150 and 30 AMP residues, respectively, could be recognized. The presence of a genome-linked protein of molecular weight 6000 daltons was detected. The viral RNA is infectious even after proteinase K treatment, indicating that the genome-linked protein is not required for infectivity.
Article
The translations of tobacco etch virus (TEV) RNA and pepper mottle virus (PeMV) RNA in the mRNA-dependent rabbit reticulocyte lysate produced products which comigrated with potyviral inclusion proteins on polyacrylamide gels. The TEV RNA translation products comigrating with the 49,000 and 54,000 molecular weight TEV nuclear inclusion proteins were also immunoprecipitated by antisera specific to the nuclear inclusion proteins. The proteolytic peptide map of the comigrating in vitro translation products for TEV RNA was similar to that generated by the nuclear inclusion proteins. The PeMV RNA translation product comigrating with the cylindrical (pinwheel) inclusion protein was immunoprecipitated by antiserum to PeMV cylindrical inclusion protein. These results provided direct evidence that the inclusions associated with potyviruses consist of virus-coded, nonstructural proteins.
Article
RNAs of pepper mottle virus (PeMV) and tobacco etch virus (TEV) were efficient messengers when translated in the rabbit reticulocyte lysate system. Viral RNA (39 S) isolated from sucrose density gradients stimulated [35S]methionine incorporation into products precipitated by trichloroacetic acid 15- to 20-fold over endogenous background levels. Optimal reaction conditions for in vitro translation contained 2 mug RNA/30 mul reaction assay, 0.8-1.0 mM magnesium ions, and 100-125 mM potassium ions. Labeled products from the translation of TEV and PeMV show distinct electrophoretic patterns on sodium dodecyl sulfate polyacrylamide gradient gels (PAGE). The major products of TEV translation had estimated sizes of 87 x 10(4) daltons (87 kd), 85, 54, 49, and 30 kd. PeMV-RNA stimulated the synthesis of 90-, 77-, 68-, 49-, and 33-kd proteins. The 30-kd protein for TEV and the 33-kd protein for PeMV were identified as capsid protein on the basis of estimated size on PAGE, serological reaction, and peptide mapping. The strategy of the in vitro translation of potyvirus RNA is discussed.
Article
All proteins encoded by the plant potyvirus, tobacco etch virus (TEV), arise by proteolytic processing of a single polyprotein. Two virus-encoded proteinases (NIa and HC-Pro) that catalyze most of the proteolytic events have been characterized previously. The two proteins that are derived from the N-terminal 87 kd region of the viral polyprotein are a 35 kd protein and HC-Pro (52 kd). It is demonstrated in this study that a third proteolytic activity is required to process the junction between these proteins. Proteolysis at the HC-Pro N terminus to separate these proteins occurred poorly, if at all, after in vitro synthesis of a 97 kd polyprotein, whereas cleavage of the HC-Pro C terminus occurred efficiently by an autoprocessing mechanism. Synthesis of the same polyprotein in transgenic tobacco plants, however, resulted in complete and accurate proteolysis at both termini of HC-Pro. A point mutation affecting an amino acid residue essential for the proteolytic activity of HC-Pro had no effect on N-terminal processing. Expression in transgenic plants of a construct with a large deletion in the 35 kd protein coding region resulted in partial inhibition of HC-Pro N-terminal cleavage, suggesting that the 35 kd protein may affect the proteolytic event but not in a catalytic role. We speculate that this cleavage event is catalyzed by either a cryptic potyviral proteinase that requires a host factor or subcellular environment for activation, or possibly a host proteinase.
Article
The RNA genome of tobacco etch virus (TEV), a plant potyvirus, functions as an mRNA for synthesis of a 346-kilodalton polyprotein that undergoes extensive proteolytic processing. The RNA lacks a normal 5' cap structure at its terminus, which suggests that the mechanism of translational initiation differs from that of a normal cellular mRNA. We have identified a translation-enhancing activity associated with the 144-nucleotide, 5' nontranslated region (NTR) of the TEV genome. When fused to a reporter gene encoding beta-glucuronidase (GUS), the 5' NTR results in an 8- to 21-fold enhancement over a synthetic 5' NTR in a transient-expression assay in protoplasts. A similar effect was observed when the 5' NTR-GUS fusions were expressed in transgenic plants. By using a cell-free translation system, the translation enhancement activity of the TEV 5' NTR was shown to be cap independent, whereas translation of GUS mRNA containing an artificial 5' NTR required the presence of a cap structure. Translation of GUS transcripts containing the TEV 5' NTR was relatively insensitive to the cap analog m7GTP, whereas translation of transcripts containing the artificial 5' NTR was highly sensitive. The 144-nucleotide TEV 5' NTR synthesized in vitro was shown to compete for factors that are required for protein synthesis in the cell-free translation reaction mix. Competition was not observed when a transcript representing the initial 81 nucleotides of the TEV 5' NTR was tested. These results support the hypothesis that the TEV 5' NTR promotes translation in a cap-independent manner that may involve the binding of proteins and/or ribosomes to internal sites within the NTR.
Article
A mouse monoclonal antibody (MAb) to dengue 4 (DEN-4) virus reacted with the antigen in the nucleus as well as in the cytoplasm of DEN-4-infected mammalian and mosquito cells, as demonstrated by the peroxidase-antiperoxidase staining method. The intranuclear antigen appeared to accumulate at the nucleoli, forming spots, whereas the cytoplasmic antigen appeared to be localized mainly in large perinuclear foci in the infected cells. The MAb-reactive antigen was produced in the presence of actinomycin D, which caused the accumulation in the nucleus to be altered to a dispersed pattern. Radioimmunoprecipitation analysis of [35S]methionine-labelled purified virions and Western blot analysis of the antigens prepared from the infected mammalian and mosquito cells showed that the MAb was directed against the DEN-4 virus core protein (Mr 15.5K). These results indicated that the DEN-4 virus core protein was partially transported, soon after its synthesis in the cytoplasm, into the nucleus and accumulated at the nucleoli.
Article
The RNA genome of tobacco etch virus (TEV) encodes a large polyprotein precursor that is processed to mature proteins by virus-specific proteinases. Cleavage sites located within the carboxyl-terminal two-thirds of the polyprotein are processed by a TEV-encoded 49 kd proteinase, while the enzyme(s) responsible for cleaving the remaining sites has not been found. In this study, a second TEV-encoded proteinase has been identified based on cell-free expression of defined RNA transcripts. The boundaries of this proteinase have been delineated by deletion analysis and site-directed mutagenesis. The proteolytically active domain has been localized to the carboxyl-terminal half of the 56 kd aphid-transmission helper component. A cleavage site that is recognized by this proteinase has been identified in the polyprotein adjacent to the carboxyl-terminus of the enzyme, and the proteinase appears to cleave by an autocatalytic mechanism. Proteolysis in vitro occurs between a Gly-Gly dipeptide as determined by radiochemical sequencing at the amino-terminus of the proteolytic product.
Article
Guidelines for submitting commentsPolicy: Comments that contribute to the discussion of the article will be posted within approximately three business days. We do not accept anonymous comments. Please include your email address; the address will not be displayed in the posted comment. Cell Press Editors will screen the comments to ensure that they are relevant and appropriate but comments will not be edited. The ultimate decision on publication of an online comment is at the Editors' discretion. Formatting: Please include a title for the comment and your affiliation. Note that symbols (e.g. Greek letters) may not transmit properly in this form due to potential software compatibility issues. Please spell out the words in place of the symbols (e.g. replace “α” with “alpha”). Comments should be no more than 8,000 characters (including spaces ) in length. References may be included when necessary but should be kept to a minimum. Be careful if copying and pasting from a Word document. Smart quotes can cause problems in the form. If you experience difficulties, please convert to a plain text file and then copy and paste into the form.
Article
Guidelines for submitting commentsPolicy: Comments that contribute to the discussion of the article will be posted within approximately three business days. We do not accept anonymous comments. Please include your email address; the address will not be displayed in the posted comment. Cell Press Editors will screen the comments to ensure that they are relevant and appropriate but comments will not be edited. The ultimate decision on publication of an online comment is at the Editors' discretion. Formatting: Please include a title for the comment and your affiliation. Note that symbols (e.g. Greek letters) may not transmit properly in this form due to potential software compatibility issues. Please spell out the words in place of the symbols (e.g. replace “α” with “alpha”). Comments should be no more than 8,000 characters (including spaces ) in length. References may be included when necessary but should be kept to a minimum. Be careful if copying and pasting from a Word document. Smart quotes can cause problems in the form. If you experience difficulties, please convert to a plain text file and then copy and paste into the form.
Article
The M protein of vesicular stomatitis virus (VSV) was localized in the nuclei and cytoplasm of VSV-infected cells by subcellular fractionation and immunofluorescence microscopy. Nuclei isolated from VSV-infected Friend erythroleukemia cells were fractionated into a nuclear membrane and a nucleoplasm fraction by DNase digestion and differential centrifugation. G protein was present in the membrane fraction, and M protein was present in the nucleoplasm fraction. Immunofluorescence detection of M protein in the nucleus required that fixed cells be permeabilized with higher concentrations of detergent than were required for detection of M protein in the cytoplasm of VSV-infected BHK cells.
Article
M13 RF IV DNA may be prepared in vitro to contain phosphorothioate-modified internucleotldic linkages in the (−)strand only. Certain restriction enzymes react with this modified DNA to hydrolyze the (+)strand exclusively when a phosphorothioate linkage occurs at the normal cleavage point in the (−)strand. The reaction of Pvu I with M3mp2 RF IV DNA containing dCMPS residues in the (−)strand is of this type, and is exploited to allow subsequent digestion with exonuclease III of a portion of the (+)strand opposite different mutagenic mismatched oligonucleotide primers. Two methods are described by which this approach has been used to produce mutations in M13mp2 phage DNA with high efficiency as a result of simple and rapid in vitro manipulations. Plaques containing mutant phage in a genetically-pure form are obtained at a frequency of 40 – 66 %, allowing their characterisation directly by sequence analysis without prior screening and plaque purification. The wide applicability of this approach is discussed.
Article
We have constructed chimaeric genes consisting of sequences encoding the transit peptide and 4, 16, 24, 53 or 126 amino-terminal residues of the mature chlorophyll a/b binding (Cab) apoprotein fused to the Escherichia coli gene encoding beta-glucuronidase (GUS). These genes were introduced into tobacco plants and the fate of the fusion proteins they encode was analysed. Less than 1% of the total activity of fusion proteins containing the transit peptide and 4 (FP4) or 16 (FP16) amino-terminal amino acids of the mature Cab protein was associated with chloroplasts. Moreover, FP4 appears to be unprocessed. This is in striking contrast to fusion proteins containing the transit peptide and 24 (FP24), 53 (FP53) or 126 (FP126) amino-terminal residues of the mature Cab polypeptide. Approximately 98%, 96% or 75%, respectively, of the total activity of these fusion proteins was associated with purified intact chloroplasts, and protease protection experiments showed that of this, approximately 98%, 87% or 50%, respectively, was located within this organelle. Furthermore, both FP24 and FP53 appear to be processed. However, less than 10% of the activity of those fusion proteins translocated into chloroplasts was associated with thylakoid membranes.
Article
When injected into the cytoplasm of Vero cells, nucleoplasmin rapidly concentrates in a narrow layer around the nuclear envelope and then accumulates within the nucleus. Transport into the nucleus can be reversibly arrested at the perinuclear stage by metabolic inhibitors or by chilling. Nucleoplasmin-coated colloidal gold particles concentrate around the nuclear envelope of Vero cells or Xenopus oocytes, and by electron microscopy of oocytes appear to be associated with fibrils attached to nuclear pore complexes. Perinuclear accumulation is not observed for the nonmigrating nucleoplasmin core fragment or nonnuclear proteins. We propose two steps in nuclear migration of proteins: rapid binding around the nuclear envelope, possibly to pore-associated fibrils, followed by slower, energy-dependent translocation through nuclear pores.
Article
The genome of tobacco etch virus contains a single open reading frame with the potential to encode a 346-kilodalton (kDa) polyprotein. The large polyprotein is cleaved at several positions by a tobacco etch virus genome-encoded, 49-kDa proteinase. The locations of the 49-kDa proteinase-mediated cleavage sites flanking the 71-kDa cytoplasmic pinwheel inclusion protein, 6-kDa protein, 49-kDa proteinase, and 58-kDa putative polymerase have been determined by using cell-free expression, proteolytic processing, and site-directed mutagenesis systems. Each of these sites is characterized by the conserved sequence motif Glu-Xaa-Xaa-Tyr-Xaa-Gln-Ser or Gly (in which cleavage occurs after the Gln residue). The amino acid residue (Gln) predicted to occupy the -1 position relative to the scissile bond has been substituted, by mutagenesis of cloned cDNA, at each of four cleavage sites. The altered sites were not cleaved by the 49-kDa proteinase. A series of synthetic polyproteins that contained the 49-kDa proteinase linked to adjoining proteins via defective cleavage sites were expressed, and their proteolytic activities were analyzed. As part of a polyprotein, the proteinase was found to exhibit cis (intramolecular) and trans (intermolecular) activity.
Article
The location of the cistron encoding the genome-linked protein (VPg) in the potyvirus tobacco vein mottling virus (TVMV) was investigated. Precipitation of 125I-labeled VPg with anti-tobacco etch virus 49K nuclear inclusion protein antiserum (which reacts with the NIa nuclear inclusion protein of TVMV) indicated that the TVMV VPg is immunologically related to NIa. Lysyl residues were found to be present at positions 2, 11, and 16 of the amino-terminal region of the VPg. A search of the TVMV polyprotein sequence for this distribution of lysyl residues revealed a unique location beginning at amino acid residue 1801, the proposed amino-terminus of the NIa protein.
Article
As a new aqueous adhesive to affix sections to glass slides, hydrolyzed vinyltriethoxysilane--either pure, in combination with polyvinyl alcohol or with specially prepared aqueous polyacrylate solutions--was applied. The silane proved to be very effective in enhancing bonding to the glass surface. As a general aqueous adhesive, a solution of 2% polyvinyl alcohol (m.w. 108,000; 99.7% hydrolyzed) with 0.2% hydrolyzed vinyltriethoxysilane is recommended. This stock solution is diluted 1:10 to 1:50 and used directly to float sections onto slides on a warming plate.
Article
Protein localization in cells is initiated by the binding of characteristic leader (signal) peptides to specific receptors on the membranes of mitochondria or endoplasmic reticulum or, in bacteria, to the plasma membrane. There are differences in the timing of protein synthesis and translocation into or across the bilayer and in the requirement for a transmembrane electrochemical potential. Comparisons of protein localization in these different membranes suggest underlying common mechanisms.
Article
Tobacco etch virus (TEV) induced intranuclear inclusions (NI) were isolated from tissue of Datura stramonium L. by homogenization in buffer followed by Triton X-100 detergent treatment and by a combination of successive low speed and sucrose density-gradient centrifugations. The isolated NI, which appeared similar to those seen in situ, were rectangular with a striated surface. The NI were readily dissociated in sodium dodecyl sulfate (SDS), 6 M urea and 67% formic or acetic acids. Spectral analysis of dissociated NI revealed a typical protein spectrum with a maximum at 277 nm and a minimum at 250 nm. Sodium dodecyl sulfate polyacrylamide gel electrophoresis analysis of NI revealed two major zones and two minor zones all of which migrated at different rates than viral or cytoplasmic inclusion protein. Molecular weights were estimated to be 49,800 and 54,500 for protein in the major zones and 95,600 and 101,400 for protein in the minor zones. An antiserum produced to purified NI reacted specifically with NI antigens, but not with TEV coat protein, TEV-induced cytoplasmic inclusions, or extracts from uninoculated D. stramonium L. No reaction was detected with purified NI tested against antisera to virus or to cytoplasmic inclusions.
Article
The early stages of absorption of intravenously injected horseradish peroxidase in proximal tubules of mouse kidney were studied with a new ultrastructural cytochemical technique. In animals killed as early as 90 sec after injection, reaction product was found on the brushborder membranes and in the apical tubular invaginations. From the latter structures it was transported to the apical vacuoles, in which it was progressively concentrated to form protein absorption droplets. The method, which employs 3,3'-diaminobenzidine as oxidizable substrate, gives sharp localization and is sensitive. This system is advantageous in studying the early stages of renal tubular protein absorption, since small amounts of protein on membranes and in tubules and vesicles can be detected easily. The method also appears promising for studying protein transport in a variety of other cells and tissues.
Article
RNase labeled with colloidal gold was used as a model for the present technique evolved for the light microscopic localization of gold-labeled substances in semithin resin-embedded sections. Tissue sections placed on glass slides were treated with the gold-enzyme complex and subsequently exposed to a photographic developed containing silver lactate. During the development gold particles are encapsulated in growing shells of metallic silver and gradually made visible in the light microscope. The amplification method can be applied to paraffin-embedded and frozen sections as well. This technique may prove useful as a supplement to studies utilizing colloidal gold or silver as markers normally used at the electron microscopic level.
Article
The nucleotide sequence of the 3'-terminal portion of the tobacco etch virus (TEV) genome was determined. The 2324-nucleotide sequence represented approximately one-fourth of the TEV genome and included the capsid protein gene and flanking regions. An open reading frame of 2135 nucleotides and an untranslated region of 189 nucleotides adjacent to a polyadenylate tract were identified. The sequence began within an open reading frame, indicating that the initiation codon was upstream of the available sequence data. The sequence of the 20 NH(2)-terminal amino acids of the TEV capsid protein was established chemically. An identical amino acid sequence, predicted from the nucleotide sequence, was located, commencing at amino acid - 263. These data indicated that maturation of the capsid protein required a post-translational cleavage of a larger protein precursor, with a probable cleavage site between the amino acids glutamine and glycine.
Article
Tobacco etch virus, a plant potyvirus, expresses its RNA genome as a large polyprotein precursor which undergoes extensive proteolytic processing to yield seven or more mature products. Two of these products, proteins with apparent molecular weights of 49,000 and 54,000 (49K and 54K proteins), aggregate in the form of crystalline inclusions within the nuclei of infected cells. Cell-free translation of synthetic transcripts was used to map the genes for these two products on the viral genome and to express an enzymatically active protein. The 49K protein was determined to be a viral protease responsible for several cleavages of the polyprotein, including its own autocatalytic excision. Analyses of products expressed from the 49K protein genes which were altered by deletion revealed that only the carboxyl-terminal half was required for proteolytic activity.
Hybrid genes in the analysis of transformation condi-tions. 1. Setting up a simple method for direct gene transfer in plant protoplasts Nuclear import can be separated into distinct steps in vitro: Nuclear pore binding and translocation
  • I Negrutiu
  • R Shillito
  • I Potrykus
  • G Biasini
  • F Sala
Negrutiu, I., Shillito, R., Potrykus, I., Biasini, G., and Sala, F. (1 987). Hybrid genes in the analysis of transformation condi-tions. 1. Setting up a simple method for direct gene transfer in plant protoplasts. Plant MOI. Biol. 8, 363-373. r998 The Plant Cell Newmeyer, D.D., and Forbes, D.J. (1988). Nuclear import can be separated into distinct steps in vitro: Nuclear pore binding and translocation. Cell 52, 641-653