ArticlePDF Available

FMS Mutations in Myelodysplastic, Leukemic, and Normal Subjects

Authors:

Abstract

The FMS gene encodes the functional cell surface receptor for colony-stimulating factor 1, the macrophage- and monocyte-specific growth factor. Codons 969 and 301 have been identified as potentially involved in promoting the transforming activity of FMS. Mutations at codon 301 are believed to lead to neoplastic transformation by ligand independence and constitutive tyrosine kinase activity of the receptor. The tyrosine residue at codon 969 has been shown to be involved in a negative regulatory activity, which is disrupted by amino acid substitutions. This study reports on the frequency of point mutations at these codons, in vivo, in human myeloid malignancies and in normal subjects. We studied 110 patients [67 with myelodysplasia (MDS) and 48 with acute myeloblastic leukemia (AML)], 5 patients being studied at the MDS and the later AML stage of the disease. There was a total incidence of 12.7% (14/110) with mutations in codon 969 and 1.8% (2/110) with mutations in codon 301. Two patients had mutations in the AML stage of the disease but not in the preceding MDS and one had a mutation in the MDS stage but not upon transformation of AML. This is consistent with the somatic origin of these mutations. FMS mutations were most prevalent (20%) in chronic myelomonocytic leukemia and AML type M4 (23%), both of which are characterized by monocytic differentiation. One of 51 normal subjects had a constitutional codon 969 mutation, which may represent a marker for predisposition to myeloid malignancy.
Proc.
Natl.
Acad.
Sci.
USA
Vol.
87,
pp.
1377-1380,
February
1990
Medical
Sciences
FMS
mutations
in
myelodysplastic,
leukemic,
and
normal
subjects
(colony-stimulating
factor
1
receptor/polymerase
chain
reaction/constitutional
and
somatic
mutation)
SUSAN
A.
RIDGE*,
MARK
WORWOOD*,
DAVID
OSCIERt,
ALLAN
JACOBS*,
AND
ROSE
ANN
PADUA*t
*Leukaemia
Research
Fund
Preleukaemia
Unit,
Department
of
Haematology,
University
of
Wales
College
of
Medicine,
Heath
Park,
Cardiff,
CF4
4XN,
Wales,
United
Kingdom;
and
tRoyal
Victoria
Hospital,
Bournemouth,
United
Kingdom
Communicated
by
Janet
D.
Rowley,
October
31,
1989
(received
for
review
July
26,
1989)
ABSTRACT
The
FMS
gene
encodes
the
functional
cell
sur-
face
receptor
for
colony-stimulating
factor
1,
the
macrophage-
and
monocyte-specific
growth
factor.
Codons
969
and
301
have
been
identified
as
potentially
involved
in
promoting
the
trans-
forming
activity
of
FMS.
Mutations
at
codon
301
are
believed
to
lead
to
neoplastic
transformation
by
ligand
independence
and
constitutive
tyrosine
kinase
activity
of
the
receptor.
The
tyrosine
residue
at
codon
969
has
been
shown
to
be
involved
in
a
negative
regulatory
activity,
which
is
disrupted
by
amino
acid
substitu-
tions.
This
study
reports
on
the
frequency
of
point
mutations
at
these
codons,
in
vivo,
in
human
myeloid
maligances
and
in
normal
subjects.
We
studied
110
patients
[67
with
myelodysplasia
(MDS)
and
48
with
acute
myeloblastic
leukemia
(AML)],
5
patients
being
studied
at
the
MDS
and
the
later
AML
stage
of
the
disease.
There
was
a
total
incidence
of
12.7%
(14/110)
with
mutations
in
codon
969
and
1.8%
(2/110)
with
mutations
in
codon
301.
Two
patients
had
mutations
in
the
AML
stage
of
the
disease
but
not
in
the
preceding
MDS
and
one
had
a
mutation
in
the
MDS
stage
but
not
upon
transformation
of
AML.
This
is
consistent
with
the
somatic
origin
of
these
mutations.
FMS
mutations
were
most
prevalent
(20%)
in
chronic
myelomonocytic
leukemia
and
AML
type
M4
(23%),
both
of
which
are
charac-
terized
by
monocytic
differentiation.
One
of
51
normal
subjects
had
a
constitutional
codon
969
mutation,
which
may
represent
a
marker
for
predisposition
to
myeloid
malian.
The
FMS
gene
encodes
for
the
receptor
of
the
macrophage-
and
monocyte-specific
growth
factor,
colony-stimulating
fac-
tor
1
(CSF-1)
(1-3).
The
protein
product
of
the
gene
is
a
cell
surface
glycoprotein
that
is
expressed
on
cells
of
the
mono-
cyte/macrophage
lineages
and
possesses
ligand-dependent
tyrosine-specific
kinase
activity
(3,
4).
Binding
of
CSF-1
to
its
receptor
is
required
for
survival,
proliferation,
and
differen-
tiation
of
these
cells
in
vitro.
The
FMS
gene
is
the
cellular
homologue
of
the
v-fms
gene
of
the
Susan
McDonough
feline
sarcoma
virus
(5,
6).
The
v-fms
gene
product
exhibits
ligand-
independent
tyrosine
kinase
activity
(7,
8)
and
will
transform
cells
in
vitro,
whereas
the
normal
human
FMS
gene
will
not
(9,
10).
DNA
sequence
analysis
(11)
has
shown
that
the
FMS
and
v-fms
genes
differ
by
a
number
of
point
mutations
and
by
the
replacement
of
the
50
amino
acids
at
the
carboxy
C
terminus
of
the
human
gene
with
11
unrelated
amino
acids
in
the
v-fms
gene.
This
C-terminal
deletion
removes
a
tyrosine
residue
at
codon
969
that
negatively
regulates
the
response
of
the
gene
product
to
CSF-1
stimulation
(9,
12).
In
vitro
studies
have
shown
that
substitution
of
the
tyrosine
residue
at
codon
969
to
phenylalanine
up-regulates
the
stimulation
of
the
receptor
to
CSF-1
but
is
insufficient
to
confer
transforming
activity
on
the
gene
(9).
Alterations
in
addition
to
Tyr-969
must
therefore
be
necessary
to
fully
activate
the
FMS
gene
in
vitro.
In
the
light
of
the
sequence
differences
between
the
v-fis
and
FMS,
studies
of
chimeric
v-fms/FMS
proteins
have
highlighted
codon
301,
in
the
extracellular
domain,
to
be
functionally
important.
The
human,
feline,
and
murine
FMS
genes
all
encode
leucine
at
this
position,
whereas
the
viral
gene
encodes
a
serine
residue
(13).
Substitution
of
Ser-301
for
Leu-301
in
the
human
FMS
gene
rendered
the
gene
trans-
forming
in
an
in
vitro
assay
(10).
The
mutation
is
believed
to
lead
to
a
conformational
change
that
mimics
ligand
binding,
resulting
in
a
constitutive
tyrosine
kinase
activity.
Mutant
genes
with
Ser-301
and
Phe-969
have
increased
transforma-
tion
efficiency.
The
involvement
of
the
FMS
gene
in
myeloid
malignancy
has
been
implicated
previously.
It
is
known
that
the
FMS
gene
is
located
on
chromosome
5q33
(14),
a
region
frequently
altered
in
myelodysplasia
(MDS)
patients
(15-17).
Loss
of
one
FMS
allele
has
been
demonstrated
in
some
MDS
patients
with
a
5q-
refractory
anaemia
(14,
18).
Expression
of
the
FMS
gene
has
been
demonstrated
in
leukemia
cells
from
acute
myeloblastic
leukemia
(AML)
patients
but
not
in
patients
with
acute
lymphocytic
leukemia.
The
highest
levels
were
detected
in
AML
type
M5,
which
is
characterized
by
a
monocytic
phenotype
(19,
20).
Coexpression
of
EMS
and
CSF-1
in
the
same
leukemia
cells
has
also
been
demonstrated
in
5
of
15
AML
cases
studied
(21),
implicating
autocrine
stimulation
of
the
receptor.
Here
we
report
on
the
frequency
of
mutations
at
potentially
activating
codons,
301
and
969.
We
have
studied
67
patients
with
MDS,
48
with
AML,
and
51
hematologically
normal
individuals.
MATERIALS
AND
METHODS
Patient
Material.
Blood
or
bone
marrow
samples
were
obtained
from
67
patients
with
MDS
[13
with
sideroblastic
anemia
(SA),
14
with
refractory
anemia
(RA),
10
with
RA
with
excess
blasts
(RAEB),
and
30
with
chronic
myelomono-
cytic
leukemia
(CMML)]
and
48
AML
patients
(9
type
Ml,
14
type
M2,
22
type
M4,
2
type
M5,
1
unclassified).
Diagnosis
of
AML
and
MDS
was
made
according
to
the
FAB
(French-
American-British)
classifications
(22,
23).
Fifty-one
normal
blood
samples
were
also
studied,
these
being
obtained
from
healthy
blood
donors,
patients
in
the
ophthalmology
depart-
ment,
and
healthy
volunteers
(17
aged
20-39,
13
aged
40-60,
21
aged
61-80).
Fully
informed
consent
was
obtained
from
all
individuals
and
the
investigation
was
approved
by
the
South
Glamorgan
Joint
Ethics
Committee.
DNA
Extraction.
High
molecular
weight
DNA
was
ex-
tracted
from
cells
as
described
(24).
Abbreviations:
CSF-1,
colony-stimulating
factor
1;
AML,
acute
myeloblastic
leukemia;
MDS,
myelodysplasia;
CMML,
chronic
my-
elomonocytic
leukemia;
SA,
sideroblastic
anemia;
RA,
refractory
anemia;
RAEB,
RA
with
excess
blasts;
PCR,
polymerase
chain
reaction.
fTo
whom
reprint
requests
should
be
addressed.
1377
The
publication
costs
of
this
article
were
defrayed
in
part
by
page
charge
payment.
This
article
must
therefore
be
hereby
marked
"advertisement"
in
accordance
with
18
U.S.C.
§1734
solely
to
indicate
this
fact.
1378
Medical
Sciences:
Ridge
et
al.
301
3'
AGTTTCACTACCACCTCCGGAT
5'
5,
ATGCCAGATGCTTG
3'
5'
GATATCGCCCAGCCCTTGCT
3'
'
Probes
Amino
Acid
Sequence
Probes
Amino
acid
5'
GAGTGCCTACTTGAACTTGA
3'
5.
----------TCG.-------
3
5
----
-----GTG------
3'
5
.
ATG
-
3
51
----------TTC-------
3'
5'
---------TTT-------
3
5,
969
wt
969
Tyr
Phe
Cys
Asp
Asn
His
Ser
31
*
5'
---------.TAG-------
3'
5'
AACAACTATCAGTTCTGCTG
3'
5'
------
TTT
-----------
3'
5'
------TGT-----------
3'
5'
------GAT-----------
3'
5'
------
MAAT---------
3'
5'
------CAT-----------
3'
5'
------TCT-----------
3'
5'
------TAG-----------
3'
**
5'
------
M
-----------
3'
FIG.
1.
Sequences
of
primers
and
mutant-specific
probes
for
codons
301
and
969.
A
single
asterisk
(*)
indicates
the
translational
stop
codon
amber;
a
double
asterisk
(**)
indicates
the
translational
stop
codon
ochre.
Cloning
and
Sequencing.
Four
hundred
thousand
A
phage
from
a
human
leukocyte
library
in
EMBL3
(Cambridge
Bioscience,
Cambridge,
U.K.)
were
screened
(24)
using
a
2.3-kilobase
(kb)
Sst
I
fragment
of
Susan
McDonough
feline
sarcoma
virus containing
5'
v-fms
sequences
(25).
Two
of
400,000
A
phage
clones
were
plaque
purified.
Restriction
enzyme
analysis
showed
these
clones
to
be
identical.
A
2.5-kb
BamHI
fragment
shown
by
hybridization
to
a
codon
301
wild-type
oligonucleotide
probe
(Fig.
1)
to
contain
se-
quences
around
codon
301
was
subcloned
into
a
plasmid,
pUC18.
A
sequencing
primer
(5'-TGAGGTTCTGCTCA-
GAGCTC-3')
3'
to
codon
301
was
designed
from
the
pub-
lished
cDNA
sequence
(11)
and
synthesized
(Applied
Bio-
systems).
This
was
used
to
obtain
intronic
sequences
5'
to
Table
1.
FMS
mutations
in
MDS,
AML,
and
normal
subjects
Amino
acid
Patient
Disease
Codon
substitution
1
MDS
(SA)
301
Phe/Ser
2
MDS
(RA)
969
Cys
3
MDS
(RAEB)
969
Cys
4
MDS
(CMML)
969
Asn/Phe
5
MDS
(CMML)
969
Ochre
6
MDS
(CMML)
969
Cys
7
MDS
(CMML)
969
Cys/Phe
8
MDS
(CMML)
969
Cys
9A
MDS
(CMML)
969
Cys
9B
AML
(M5,
post-MDS)
969
Cys
10
AML
(M2)
969
Asp
11
AML
(M4)
301
Phe
12
AML
(M4)
969
His
13
AML
(M4)
969
Asn
14
AML
(M4)
969
Cys
15
AML
(M4,
post-MDS)
969
Cys
16
AML
(M5,
post-MDS)
969
His
NS
969
Cys
(constitutional)
All
mutations
were
confirmed
by
a
second
PCR
and
oligonucleo-
tide
hybridization
analysis.
NS,
normal
subject.
codon
301.
Two-hundred
fifty
base
pairs
(bp)
of
sequence
was
obtained
by
the
Sanger
dideoxy
chain-termination
method
(26)
using
Sequenase
(Cambridge
Bioscience).
All
restriction
enzyme
digestions
were
carried
out
according
to
the
manufacturer's
recommendations
(GIBCO/BRL).
Polymerase
Chain
Reaction
(PCR).
Methods
of
amplifica-
tion
and
hybridization
were
as
described
(27,
28)
with
mod-
ifications.
Primers
flanking
codons
301
and
%9
(Fig.
1)
of
the
FMS
gene
were
used.
The
primers
were
designed
from
cDNA
sequences
(11)
and
from
sequences
obtained
by
ourselves.
Each
sample
was
subject
to
two
rounds
of
amplification
each
of
50
cycles
with
Taq
polymerase
(Thermus
aquaticus
DNA
polymerase;
Perkin-Elmer),
using
material
from
the
first
round
as
a
template
for
the
second.
The
samples
were
applied
to
the
membrane
without
a
vacuum.
The
filters
were
dena-
tured
in
0.5
M
NaOH/1.5
M
NaCl
and
neutralized
in
1.5
M
NaCl/0.5
M
Tris,
pH
7.5/0.001
M
Na2EDTA
prior
to
baking
at
80°C.
Filters
were
hybridized
to
mutant-specific
oligonu-
cleotide
probes
(Fig.
1)
5'
end-labeled
with
[y-32P]ATP
and
polynucleotide
kinase
(Amersham).
Autoradiography
was
carried
out
with
intensifying
screens
at
-70°C
using
XAR-5
Table
2.
FMS
mutations
in
disease
subtypes
Total
no.
No.
of
mutations
Disease
studied
(amino
acid
position)
SA
13
1
(301)
RA
14
1(969)
RAEB
10
1
(969)
CMML
30
6
(969)
AML
M1
9
0
AML
M2
14
1
(969)
AML
M4
22
5
(1
x
301,
4
x
969)
AML
M5
2
2
(969)
AML
UC
1
0
Total
115*
17t
None
(NS)
51
1
UC,
unclassified;
NS,
normal
subjects.
*Five
patients
sampled
twice
in
MDS
and
AML
stages.
tOne
patient
had
an
FMS
mutation
in
MDS
and
AML
stages.
Proc.
Natl.
Acad.
Sci.
USA
87
(1990)
969
3'
CAACTGCTGTCCCTCATGGT
5'
-U-
301
wt
301
Leu
Ser
I?
Sequence
Val
Met
Phe
Phe
Trp
*
'00or
'\
Proc.
Natl.
Acad.
Sci.
USA
87
(1990)
1379
A
B
C
D
E
F
1
* * - - -
2
a
* X
4
i
969Wt
A
B
C
D
E
F
969
His
High
stringency
FIG.
2.
Detection
of
a
somatic
FMS
mutation.
Hybridization
of
the
AML
sample
of
patient
16
(slot
C2)
to
a
His-969
probe
at
high
stringency
is
shown.
A
previous
MDS
sample
(slot
B2)
showed
no
evidence
of
the
mutation.
The
same
filter
hybridized
to
the
969
wild-type
probe
is
shown.
This
provides
an
estimate
of
quantitation
of
the
DNA
in
each
dot.
(Kodak)
film
for
2
hr
to
3
days.
Potential
mutants
were
rescreened
on
independent
filters
and
reamplified
to
confirm
the
presence
of
mutations.
Only
those
that
stably
hybridized
to
the
mutant
probes
with
significant
signals
were
scored
positive.
Each
mutant
was
therefore
assayed
for
two
inde-
pendent
PCR
reactions.
This
was
a
stringent
screen
as,
unlike
RAS
mutations
where
a
biological
transformation
assay
could
be
employed
to
confirm
the
presence
of
the
mutations
(28),
there
is
no
similar
biological
assay
for
FMS
mutations.
Statistical
Analysis.
Fischer's
exact
test
(29)
was
employed
to
determine
if
the
differences
found
between
the
groups
were
significantly
different
from
the
normal
incidence.
RESULTS
A
total
of
110
patients
with
MDS
or
AML
was
investigated
for
the
presence
of
FMS
mutations
in
their
peripheral
blood
leukocytes
(Tables
1
and
2).
DNA
from
16
of
110
(14.5%)
patients
was
found
to
have
mutations.
Fourteen
of
110
patients
had
mutations
at
codon
969.
A
cysteine
substitution
for
the
wild-type
tyrosine
was
the
most
prevalent
alteration.
Two
of
110
patients
had
mutations
at
codon
301.
The
FMS
mutation
in
a
single
patient
(9)
was
shown
to
be
present
in
leukocytes
from
the
MDS
(9A)
and
AML
M5
(9B)
stages
but
not
in
buccal
epithelium
(data
not
shown).
Patients
15
and
16
had
mutations
in
the
AML
stage
of
disease
but
not
in
the
preceding
MDS
(representative
filter
in
Fig.
2).
Patient
3
possessed
a
mutation
at
the
MDS
stage
of
the
disease,
which
was
apparently
lost
upon
leukemic
transformation.
These
results
indicate
that
FMS
mutations
can
occur
at
early
and
late
stages
of
disease
and
hence
may
not
represent
an
initiating
event
in
the
generation
of
the
abnormal
clone.
These
results
are
consistent
with
the
somatic
origin
of
these
mutations.
No
patients
were
found
to
possess
a
mutation
at
codons
301
and
969.
However,
three
patients
(1,
4,
and
7)
showed
evidence
of
two
mutations
at
the
same
codon.
CMML
and
AML
M4
samples,
both
characterized
by
signif-
icant
monocytic
differentiation,
had
the
highest
rate
of
FMS
A
1
*
B
C
D
mutations
[20%
and
23%,
respectively;
Fisher's
exact
test,
two-tailed
analysis,
P
<
0.02
(29)].
In
1
of
51
(2%)
normal
subjects
analyzed,
a
Cys-969
mutation
was
found
to
be
present
in
peripheral
blood.
Anal-
ysis
of
buccal
epithelial
cells
from
this
person
showed
the
presence
of
the
same
mutation
(Fig.
3).
This
finding
suggests
that
the
Cys-969
mutation
is
constitutional
in
this
instance.
DISCUSSION
We
have
described
the
finding
of
point
mutations
at
codons
301
(2/110)
and
969
(14/110)
of
the
FMS
gene
in
vivo
in
myeloid
disease
and
in
1
of
51
normal
subjects.
Our
results
indicate
that
a
mutation
at
codon
969,
rather
than
codon
301,
is
the
more
common
lesion
in
these
patients.
We
speculate
that
in
the
hemopoietic
environment,
in
the
presence
of
CSF-1,
mutations
at
codon
969
that
alter
a
negative
regula-
tory
site
may
up-regulate
the
response
of
the
receptor
to
ligand
binding
and
thus
confer
a
growth
advantage
to
the
cell.
In
vitro
studies
imply
that
mutations
at
codon
301
may
be
of
little
advantage
in
an
environment
with
normal
or
increased
levels
of
CSF-1
(10).
In
patients
with
reduced
CSF-1
levels,
however,
a
codon
301
mutation
may
confer
a
growth
advan-
tage
on
a
clone
of
cells.
Studies
are
necessary
to
examine
the
relationship
between
serum
CSF-1
levels
and
mutational
status
of
the
FMS
gene
in
these
patients.
In
the
feline
system,
FMS
mutations
at
codons
301
and
374
are
required
in
addition
to
a
C-terminal
modification
involv-
ing
the
loss
of
codon
969
for
a
fully
transformed
phenotype
in
Rat-2
cells
(13),
and
it
is
possible
that
additional
mutations
may
be
found
in
myelodysplastic
and
leukemic
patients.
Cytogenetically,
none
of
the
present
patients
with
FMS
mutations
has
a
gross
deletion
of
chromosome
5q.
We
do
not
know,
however,
if
a
subpopulation
of
cells
has
microscopic
deletions
removing
one
allele,
leaving
only
the
mutant
allele.
We
have
demonstrated
the
presence
of
constitutional
and
somatic
point
mutations
in
the
FMS
gene
using
PCR
and
oligonucleotide
hybridization.
The
somatic
origin
of
FMS
mutations
in
four
patients
and
the
presence
of
a
constitutional
A
B
C
D
0
@
969
wt
969
cys
High
stringency
FIG.
3.
Detection
of
a
constitutional
FMS
mutation
in
a
normal
subject.
Slots
are
DNA
from
a
negative
control
(Al),
original
blood
sample
(Bi),
repeat
blood
sample
(Cl),
and
buccal
mucosa
(Dl);
A2
is
a
Cys-969
mutant
from
a
patient
used
as
a
positive
control;
B2,
C2,
and
D2
are
negative
controls.
Hybridizations
of
the
filter
to
the
969
wild-type
and
the
Cys-969
probes
are
shown.
B1,
Cl,
Dl,
and
A2
hybridize
strongly
to
the
Cys-969
probe.
Medical
Sciences:
Ridge
et
al.
1380
Medical
Sciences:
Ridge
et
al.
mutation
in
one
person
have
been
shown.
Lack
of
material
prevents
us
from
assessing
the
origin
(somatic
or
constitu-
tional)
of
the
FMS
mutations
in
the
other
patients.
The
appearance
and
disappearance
of
these
mutations
during
the
progression
of
disease
in
some
patients
suggest
these
lesions
are
not
initiating
events.
Mutant
RAS
genes,
also
thought
not
to
be
an
initiating
lesion,
are
found
in
a
high
proportion
of
CMML
patients
(28,
30)
possibly
indicating
that
myelodys-
plastic
or
leukemic
clones
already
showing
potential
mono-
cytic
differentiation
may
be
especially
susceptible
to
the
transforming
properties
of
these
oncogenes.
A
constitutional
mutation
has
been
demonstrated
in
one
hematologically
normal
individual.
This
mutant
allele
may
have
been
inherited
from
one
patient
or
may
have
arisen
during
embryonic
development.
In
view
of
the
high
percent-
age
of
CMML
(20%)
and
AML
M4
(23%)
patients
with
a
mutation
at
codon
969
this
may
represent
a
lesion
involved
in
predisposition
to
these
particular
malignancies.
To
our
knowledge,
a
constitutional
point
mutation
in
a
protoonco-
gene
at
a
regulatory
domain
has
not
been
reported
previ-
ously.
Further
studies
are
necessary
to
determine
the
func-
tional
significance
of
these
mutations.
We
thank
Christine
Farr
for
kindly
supplying
DNA
from
the
AML
patients,
Richard
Clark
for
collecting
normal
patient
material,
Lorna
Pearn
for
excellent
technical
assistance,
G.
Carter
and
D.
Hughes
for
helpful
discussions
and
technical
advice,
and
C. Sherr
for
the
Susan
McDonough
feline
sarcoma
virus
clone.
This
work
was
supported
by
the
Blood
Research
Fund
and
Leukaemia
Research
Fund
of
Great
Britain.
1.
Sherr,
C.
J.,
Rettenmier,
C.
W.,
Sacca,
R.,
Roussel,
M.
F.,
Cook,
A.
T.
&
Stanley,
E.
R.
(1985)
Cell
41,
665-676.
2.
Sariban,
E.,
Mitchell,
T.
&
Kufe,
D.
(1985)
Nature
(London)
316,
64-66.
3.
Woolford,
J.,
Rothwell,
V.
&
Rohrschneider,
R.
(1985)
Mol.
Cell.
Biol.
5,
3458-3466.
4.
Yeung,
Y.
G.,
Jubinsky,
P.
T.,
Sengupta,
A.,
Yeung,
D.
C.
Y.
&
Stanley,
E.
R.
(1987)
Proc.
Natl.
Acad.
Sci.
USA
84,
1268-1271.
5.
Donner,
L.,
Fedele,
L.
A.,
Garon,
C.
F.,
Anderson,
S.
J.
&
Sherr,
C.
J.
(1982)
J.
Virol.
41,
489-500.
6.
Hampe,
A.,
Gobet,
M.,
Sherr,
C.
J.
&
Galibert,
F.
(1984)
Proc.
Natl.
Acad.
Sci.
USA
81,
85-89.
7.
Tamura,
T.,
Simon,
E.,
Niemann,
H.,
Snoek,
G.
T.
&
Bauer,
H.
(1986)
Mol.
Cell.
Biol.
6,
4745-4748.
8.
Barbacid,
M.
&
Lauver,
A.
V.
(1981)
J.
Virol.
40,
812-821.
9.
Roussel,
M.
F.,
Dull,
T.
J.,
Rettenmier,
C.
W.,
Ralph,
P.,
Ullrich,
A.
&
Sherr,
C.
J.
(1987)
Nature
(London)
325,
549-552.
Proc.
Natl.
Acad.
Sci.
USA
87
(1990)
10.
Roussel,
M.
F.,
Downing,
J.
R.,
Rettenmier,
C.
W.
&
Sherr,
C.
J.
(1988)
Cell
55,
979-988.
11.
Coussens,
L.,
Beveren,
C.,
Smith,
D.,
Chen,
E.,
Mitchell,
R.
L.,
Isacke,
C.
M.,
Verma,
I.
M.
&
Ullrich,
A.
(1986)
Nature
(London)
320,
277-280.
12.
Browning,
P.
J.,
Bunn,
H.
F.,
Cline,
A.,
Struman,
M.
&
Nienhuis,
A.
W.
(1986)
Proc.
Natl.
Acad.
Sci.
USA
83,
7800-
7804.
13.
Woolford,
J.,
McAuliffe,
A.
&
Rohrschneider,
L.
R.
(1988)
Cell
55,
965-977.
14.
Le
Beau,
M.
M.,
Westbrook,
C.
A.,
Diaz,
M.
O.,
Larson,
R.
A.,
Rowley,
J.
D.,
Gasson,
J.
C.,
Golde,
D.
W.
&
Sherr,
C.
J.
(1986)
Science
231,
984-986.
15.
Jacobs,
R.
H.,
Cornbleet,
M.
A.,
Vardiman,
J.
W.,
Larson,
R.
A.,
Le
Beau,
M.
M.
&
Rowley,
J.
D.
(1986)
Blood
67,
1765-1772.
16.
Heim,
S.
&
Mitelman,
F.
(1986)
Clin.
Haematol.
15,
1003-1021.
17.
Borgstrom,
G.
H.
(1986)
Scand.
J.
Haematol.
36,
74-77.
18.
Nienhuis,
A.
W.,
Bunn,
H.
F.,
Turner,
P.
H.,
Gopal,
T.
V.,
Nash,
W.
G.,
O'Brien,
S.
J.
&
Sherr,
C.
J.
(1985)
Cell
42,
421-428.
19.
Dubreuil,
P.,
Torres,
H.,
Coarcoul,
M.
A.,
Birg,
F.
&
Mannoni,
P.
(1988)
Blood
72,
1081-1085.
20.
Preisler,
H.
D.,
Raza,
A.,
Larson,
R.,
Le
Beau,
M.,
Browman,
G.,
Goldberg,
J.,
Grunwald,
H.,
Volger,
R.,
Verkh,
L.,
Singh,
P.,
Block,
A.
M.
&
Sandberg,
A.
(1989)
Blood
73,
255-262.
21.
Rambaldi,
A.,
Wakamiya,
N.,
Vellenga,
E.,
Horiguchi,
J.,
Warren,
M.
K.,
Kufe,
D.
J.
&
Griffin,
J.
D.
(1988)
J.
Clin.
Invest.
81,
1030-1035.
22.
Bennett,
J.
M.,
Catovsky,
D.,
Daniel,
M.
T.,
Flandrin,
G.,
Galton,
D.
A.
G.,
Gralnick,
H.
R.
&
Sultan,
C.
(1982)
Br.
J.
Haematol.
51,
189-199.
23.
Bennett,
J.
M.,
Catovsky,
D.,
Daniel,
M.
T.,
Flandrin,
G.,
Galton,
D.
A.
G.,
Gralnick,
H.
R.
&
Sultan,
C.
(1985)
Ann.
Intern.
Med.
103,
620-625.
24.
Maniatis,
T.,
Fritsch,
E.
F.
&
Sambrook,
J.
(1982)
Molecular
Cloning:
A
Laboratory
Manual
(Cold
Spring
Harbor
Lab.,
Cold
Spring
Harbor,
NY).
25.
Roussel,
M.
F.,
Sherr,
C.
J.,
Barker,
P.
E.
&
Ruddle,
F.
H.
(1983)
J.
Virol.
48,
770-773.
26.
Sanger,
F.,
Nicklen,
S.
&
Coulson,
A.
R.
(1977)
Proc.
Natl.
Acad.
Sci.
USA
73,
5463-5467.
27.
Saiki,
R.
K.,
Gelfand,
D.
H.,
Stoffel,
S.,
Scharf,
S.
J.,
Higuchi,
R.,
Horn,
G.
T.,
Mullis,
K.
B.
&
Erlich,
H.
A.
(1988)
Science
239,
487-491.
28.
Padua,
R.
A.,
Carter,
G.,
Hughes,
D.,
Gow,
J.,
Farr,
C.,
Oscier,
D.,
McCormick,
F.
&
Jacobs,
A.
(1988)
Leukemia
2,
503-510.
29.
March,
D.
L.
(1972)
Commun.
ACM
15,
991-992.
30.
Yunis,
J.
J.,
Boot,
A.
J.
M.,
Mayer,
M.
G.
&
Bos,
J.
L.
(1989)
Oncogene
4,
609-614.
... Yet, CSF1R mutations found at codon 301 (L301S) and 969 (Y969F) have earlier been identified in some patients with AML (89). Interestingly, mutations at codon 301 are believed to contribute to constitutive activation of the receptor, while the tyrosine residue at codon 969 have shown to be involved in negative regulatory activity (90). However, the total incidence of mutations in codon 969 was 12.7% and only 1.8% in codon 301. ...
Article
Full-text available
Acute myeloid leukemia (AML) is an aggressive heterogeneous blood cancer derived from hematopoietic stem cells. Tumor-stromal interactions in AML are of importance for disease development and therapy resistance, and bone marrow stroma seem like an attractive therapeutic target. Of particular interest is colony stimulating factor 1 receptor (CSF1R, M-CSFR, c-FMS, CD115) and its role in regulating plasticity of tumor-associated macrophages. We discuss first the potential of CSF1R-targeted therapy as an attractive concept with regards to the tumor microenvironment in the bone marrow niche. A second therapy approach, supported by preclinical research, also suggests that CSF1R-targeted therapy may increase the beneficial effect of conventional and novel therapeutics. Experimental evidence positioning inhibitors of CSF1R as treatment should, together with data from preclinical and early phase clinical trials, facilitate translation and clinical development of CSF1R-targeted therapy for AML.
... Together, these data support an important role for neurotoxic microglial activation in regulating posttraumatic neurodegeneration and related neurological impairments after SCI. CSF1, a macrophage-and monocyte-specific growth factor, is a cytokine that controls the proliferation, differentiation, and function of macrophages [65]. The CSF1R gene encoding a tyrosine kinase growth factor receptor for CSF1 mediates most, if not all, of the biological effects of this cytokine. ...
Article
Neuropsychological deficits, including impairments in learning and memory, occur after spinal cord injury (SCI). In experimental SCI models, we and others have reported that such changes reflect sustained microglia activation in the brain that is associated with progressive neurodegeneration. In the present study, we examined the effect of pharmacological depletion of microglia on posttraumatic cognition, depressive-like behavior, and brain pathology after SCI in mice. Methods: Young adult male C57BL/6 mice were subjected to moderate/severe thoracic spinal cord contusion. Microglial depletion was induced with the colony-stimulating factor 1 receptor (CSF1R) antagonist PLX5622 administered starting either 3 weeks before injury or one day post-injury and continuing through 6 weeks after SCI. Neuroinflammation in the injured spinal cord and brain was assessed using flow cytometry and NanoString technology. Neurological function was evaluated using a battery of neurobehavioral tests including motor function, cognition, and depression. Lesion volume and neuronal counts were quantified by unbiased stereology. Results: Flow cytometry analysis demonstrated that PLX5622 pre-treatment significantly reduced the number of microglia, as well as infiltrating monocytes and neutrophils, and decreased reactive oxygen species production in these cells from injured spinal cord at 2-days post-injury. Post-injury PLX5622 treatment reduced both CD45int microglia and CD45hi myeloid counts at 7-days. Following six weeks of PLX5622 treatment, there were substantial changes in the spinal cord and brain transcriptomes, including those involved in neuroinflammation. These alterations were associated with improved neuronal survival in the brain and neurological recovery. Conclusion: These findings indicate that pharmacological microglia-deletion reduces neuroinflammation in the injured spinal cord and brain, improving recovery of cognition, depressive-like behavior, and motor function.
... The present transcriptomic analysis also revealed key genes related to carotenoid colouration i.e. csf1r, srb1, plin2, stard3, bcdo2, stard5 and gsta2. The csf1r gene encodes a tyrosine kinase growth factor receptor for colony-stimulating factor-1, the macrophage-and monocyte-specific growth factor [49]. The srb1 encodes an integral membrane receptor with lipophilic molecules and was up-regulated in nature. ...
... Mutations in CSF1R have been associated with a predisposition to myeloid malignancy but have also been reported in lymphoproliferative disorders including Hodgkin lymphoma and CD30 + anaplastic large-cell lymphoma. 25,26 TSC1 is a tumor suppressor gene that encodes the growth inhibitory protein hamartin, which interacts with and stabilizes the GTPase-activating protein tuberin. This hamartin-tuberin complex negatively regulates mammalian target of rapamycin complex-1 (mTORC1) signaling, which is a major regulator of anabolic cell growth. ...
Article
Primary effusion lymphoma (PEL) is a rare form of aggressive B-cell lymphoma characterized by a malignant serous effusion involving body cavities. It usually associated with human herpes virus-8 (HHV-8) and coexpression of Epstein-Barr virus and mostly affects patients with HIV. We report a rare case of cutaneous PEL with an unusual intravascular presentation, combined with Kaposi sarcoma involving the skin, lung, and gastrointestinal tract. The molecular genetic analysis of the sarcoma and lymphoma components, using next-generation sequencing was performed. The patient was a 67-year-old man who presented with multiple cutaneous tumors and mass in the left lung. He died 17 hours after the admission to the hospital. At autopsy, in addition to the cutaneous lesions, tumors in the left lung and gastrointestinal mucosa were detected, and no effusions in the body cavities were seen. The biopsy from the cutaneous lesions, pulmonary, and intestinal tumors revealed histological and immunohistochemical features of Kaposi sarcoma. In addition, the skin biopsy specimens contained a diffuse infiltrate composed of large pleomorphic cells, with focal intravascular growth that were negative for pan B-cell markers, weakly positive for CD38 and CD138 but expressed CD3, HHV-8, and Epstein-Barr virus. Molecular genetic studies in this specimen revealed monoclonal rearrangements of the IgH gene. The diagnosis of PEL, solid variant, was made. Next-generation sequencing analysis of the tumorous and normal tissue detected a pathogenic germline mutation of the FAM175A gene and somatic mutations in BRCA2 and RAD51B (in both sarcoma and lymphoma specimens), and INPP4B and RICTOR (in lymphoma specimen only).
Article
The macrophage colony-stimulating factor (M-CSF) receptor is expressed in a tissue-specific fashion from two distinct promoters in monocytes/macrophages and the placenta. In order to further understand the transcription factors which play a role in the commitment of multipotential progenitors to the monocyte/macrophage lineage, we have initiated an investigation of the factors which activate the M-CSF receptor very early during the monocyte differentiation process. Here we demonstrate that the human monocytic M-CSF receptor promoter directs reporter gene activity in a tissue-specific fashion. Since one of the few transcription factors which have been implicated in the regulation of monocyte genes is the macrophage- and B-cell-specific PU.1 transcription factor, we investigated whether PU.1 binds and activates the M-CSF receptor promoter. Here we demonstrate that both in vitro-translated PU.1 and PU.1 from nuclear extracts bind to a specific site in the M-CSF receptor promoter just upstream from the major transcription initiation site. Mutations in this site which eliminate PU.1 binding decrease M-CSF receptor promoter activity significantly in macrophage cell lines only. Furthermore, PU.1 transactivates the M-CSF receptor promoter in nonmacrophage cells. These results suggest that PU.1 plays a major role in macrophage gene regulation and development by directing the expression of a receptor for a key macrophage growth factor.
Article
Full-text available
Many proteins contain intrinsically disordered regions (IDRs) which carry out important functions without relying on a single well-defined conformation. IDRs are increasingly recognized as critical elements of regulatory networks and have been also associated with cancer. However, it is unknown whether mutations targeting IDRs represent a distinct class of driver events associated with specific molecular and system-level properties, cancer types and treatment options. Here, we used an integrative computational approach to explore the direct role of intrinsically disordered protein regions driving cancer. We showed that around 20% of cancer drivers are primarily targeted through a disordered region. These IDRs can function in multiple ways which are distinct from the functional mechanisms of ordered drivers. Disordered drivers play a central role in context-dependent interaction networks and are enriched in specific biological processes such as transcription, gene expression regulation and protein degradation. Furthermore, their modulation represents an alternative mechanism for the emergence of all known cancer hallmarks. Importantly, in certain cancer patients, mutations of disordered drivers represent key driving events. However, treatment options for such patients are currently severely limited. The presented study highlights a largely overlooked class of cancer drivers associated with specific cancer types that need novel therapeutic options.
Article
Context.—Myelodysplastic syndromes (MDSs) are clonal stem cell diseases characterized by ineffective hematopoiesis, multilineage dysplasia, and peripheral cytopenias with normocellular or hypercellular marrow. They represent a heterogeneous group of disorders with a varied spectrum of clinical, morphologic, biologic, and genetic characteristics. This heterogeneity in disease characterization has led to evolving classification systems, developing prognostic models, and continuing research efforts to elucidate its pathobiology and pathogenesis. Objective.—To summarize updated information and provide a general overview of the clinicopathologic features, pathobiology, and cytogenetic and molecular pathogenesis of MDSs. Data Sources.—Relevant articles indexed in PubMed (National Library of Medicine) between 1982 and 2005 and reference medical texts. Conclusions.—Although MDSs remain a relatively poorly defined disease entity, recent advancements in cytogenetic and molecular studies have significantly contributed to our present knowledge of MDSs. Novel strategies for studying the pathogenesis and evolution of MDSs continue to shape our understanding of this disease and guide our approaches to diagnosis and treatment.
Article
Purpose of review: Ras pathway mutations are one of the most common type of alterations in pediatric hematologic malignancies and are frequently associated with adverse outcomes. Despite ongoing efforts to use targeted treatments, there remain no Food and Drug Administration (FDA)-approved medications specifically for children with Ras pathway-mutated leukemia. This review will summarize the role of Ras pathway mutations in pediatric leukemia, discuss the current state of Ras pathway inhibitors and highlight the most promising agents currently being evaluated in clinical trials. Recent findings: Efficacy using RAF and MEK inhibitors has been demonstrated across multiple solid and brain tumors, and these are now considered standard-of-care for certain tumor types in adults and children. Clinical trials are now testing these medications for the first time in pediatric hematologic disorders, such as acute lymphoblastic leukemia, juvenile myelomonocytic leukemia, and histiocytic disorders. Novel inhibitors of the Ras pathway, including direct RAS inhibitors, are also being tested in clinical trials across a spectrum of pediatric and adult malignancies. Summary: Activation of the Ras pathway is a common finding in pediatric hematologic neoplasms. Implementation of precision medicine with a goal of improving outcomes for these patients will require testing of Ras pathway inhibitors in combination with other drugs in the context of current and future clinical trials.
Preprint
Full-text available
Intrinsically disordered regions (IDRs) are important functional modules of several proteins, providing extra layers of regulation as switchable structural elements. Protein disorder has been associated with cancer, but it is unknown whether IDR mutations represent a distinct class of driver events associated with specific molecular mechanisms and system level properties, which would require dedicated targeting strategies. Based on an integrative computational approach, we identified 47 IDRs whose genetic mutations can be directly linked to cancer development. While not as common as alterations of globular domains, IDR mutations contribute to the emergence of the same cancer hallmarks through the modulation of distinct molecular mechanisms, increased interaction potential and specific functional repertoire. We demonstrate that in specific cancer subtypes, IDR mutations represent the key events driving tumorigenesis. However, treatment options for such patients are currently severely limited. We suggest targeting strategies that could enable successful therapeutic intervention for this subclass of cancer drivers, extending our options for personalized therapies.
Article
Introduction: Glioblastoma multiforme (GBM) is the most common and aggressive malignant glioma, with patients having a median survival of just over one year. Current chemotherapies, with surgery and radiotherapy, provide only minor patient benefit. There is a great need to discover and develop novel therapies for this devastating disease. Areas Covered: The patent literature reveals novel therapies, providing insights into emerging GBM therapeutics. We have used the Google and USPTO patent databases to generate a detailed landscape of patents and patent applications from companies active in the areas of glioma and/or GBM. Specific patents have been grouped into 6 areas: novel compounds; treatments and therapeutic targets; combination therapies; immunotherapies; delivery methods; and biomarkers for diagnosis and prognosis. Expert Opinion: There has been a steady increase in the number of patents on GBM over the last five years. Despite many new compounds being developed and patented for a broad range of cancers, only a small percentage of these are specifically targeted to GBM. Notable trends in the patent literature include both the development of combination therapies to combat the heterogeneous nature of GBM, and the use of immunotherapies building on the promise of cancer vaccines and CAR T-cell therapy.
Article
Full-text available
Macrophage colony-stimulating factor (CSF-1; M-CSF) is a growth factor required for growth and differentiation of mononuclear phagocytes. The effects of CSF-1 are mediated through binding to specific, high-affinity surface receptors encoded by the c-fms gene. CSF-1 and c-fms gene expression was investigated in fresh human acute myeloblastic leukemic cells by Northern blot hybridization using cDNA probes. 4.0-kb CSF-1 transcripts were detected in 10 of 17 cases of acute myeloblastic leukemia (AML), while c-fms transcripts were detected in 7 of 15. Coexpression of CSF-1 and c-fms was observed in five cases, and in five other cases neither gene was expressed. In situ hybridization demonstrated that transcripts for CSF-1 were present in 70-90% of cells in each of three cases studied while c-fms mRNA was detected in 40-70% of cells. The constitutive expression of CSF-1 transcripts was associated with production of CSF-1 protein, although detectable amounts of CSF-1 were not secreted unless the cells were exposed to phorbol ester. These results demonstrate that leukemic myeloblasts from a subset of patients with AML express transcripts for both the CSF-1 and CSF-1 receptor genes, often in the same leukemic cells in vitro.
Article
Chromosome aberrations occur in 30-50% of patients with myelodysplastic syndromes (MDS). Chromosome aberrations found in MDS are generally found in acute non-lymphocytic leukaemia (ANLL), while certain aberrations of ANLL do not occur in MDS. The clinical significance of these aberrations has been evaluated on the basis of several series from literature and a large series from Helsinki University Central Hospital. The presence of an aberrant clone with major karyotypic aberration (MAKA) or monosomy 7 in a patient with MDS indicates a higher risk of transformation of acute leukaemia and a shorter survival.
Article
A new method for determining nucleotide sequences in DNA is described. It is similar to the "plus and minus" method [Sanger, F. & Coulson, A. R. (1975) J. Mol. Biol. 94, 441-448] but makes use of the 2',3'-dideoxy and arabinonucleoside analogues of the normal deoxynucleoside triphosphates, which act as specific chain-terminating inhibitors of DNA polymerase. The technique has been applied to the DNA of bacteriophage varphiX174 and is more rapid and more accurate than either the plus or the minus method.
Article
The McDonough strain of the feline sarcoma virus contains a transforming gene (v-fms) which contains partial nucleotide homology with proto-oncogenes encoding tyrosine kinases. One of the v-fms-encoded products, gp140fms, is a cell surface transmembrane glycoprotein that may function as a growth factor receptor. Although c-fms transcripts have been detected in placental trophoblasts and normal human bone marrow, the role of the c-fms gene product is unknown. We now report that induction of monocytic, but not granulocytic, differentiation of human HL-60 leukaemic cells is associated with expression of c-fms, preceded by that of c-myc and c-fos. Because c-fms transcripts are also detectable in peripheral blood monocytes and in blasts from certain patients with myelomonocytic leukaemia, the c-fms gene product may play a role in monocytic differentiation.
Article
The feline c-fms proto-oncogene product is a 170 kd glycoprotein with associated tyrosine kinase activity. This glycoprotein was expressed on mature cat macrophages from peritoneal inflammatory exudates and spleen. Similarly, the receptor for the murine colony-stimulating factor, CSF-1, is restricted to cells of the mononuclear phagocytic lineage and is a 165 kd glycoprotein with an associated tyrosine kinase. Rabbit antisera to a recombinant v-fms-coded polypeptide precipitated the feline c-fms product and specifically cross-reacted with a 165 kd glycoprotein from mouse macrophages. This putative product of the murine c-fms gene exhibited an associated tyrosine kinase activity in immune complexes, specifically bound murine CSF-1, and, in the presence of the growth factor, was phosphorylated on tyrosine in membrane preparations. The murine c-fms proto-oncogene product and the CSF-1 receptor are therefore related, and possibly identical, molecules.
Article
A role for proto-oncogenes in the regulation and modulation of cell proliferation has been suggested by the findings that the B-chain of platelet-derived growth factor (PDGF) is encoded by the proto-oncogene sis and that the erb-B oncogene product is a truncated form of the epidermal growth factor (EGF) receptor. Furthermore, the product of the proto-oncogene fms (c-fms) may be related or identical to the receptor for macrophage colony-stimulating factor (CSF-1). v-fms is the transforming gene of the McDonough strain of feline sarcoma virus (SM-FeSV) and belongs to the family of src-related oncogenes which have tyrosine-specific kinase activity. Furthermore, nucleotide sequence analysis of the v-fms gene product revealed topological properties of a cell-surface receptor protein. To elucidate the features involved in the conversion of a normal cell-surface receptor gene into an oncogenic one, we have now determined the complete nucleotide sequence of a human c-fms complementary DNA. The 972-amino-acid c-fms protein has an extracellular domain, a membrane-spanning region, and a cytoplasmic tyrosine protein kinase domain. Comparison of the feline v-fms and human c-fms sequences reveals that the proteins share extensive homology but have different carboxyl termini.
Article
Cells transformed by the McDonough strain of feline sarcoma virus express at their surface a v-fms-specific transmembrane glycoprotein designated gp140v-fms. By labeling with 32Pi, gp140v-fms was shown to be phosphorylated 30-fold more in serine residues than were the cytosolic v-fms polypeptides gp180gag-fms and gp120v-fms. By using the phosphotyrosine phosphatase-specific inhibitor sodium orthovanadate, an additional tyrosine phosphorylation was observed in vivo, again involving predominantly gp140v-fms. In vitro studies showed that the v-fms proteins were phosphorylated by protein kinase C in a calcium- and phosphatidylserine-dependent manner.
Article
A thermostable DNA polymerase was used in an in vitro DNA amplification procedure, the polymerase chain reaction. The enzyme, isolated from Thermus aquaticus, greatly simplifies the procedure and, by enabling the amplification reaction to be performed at higher temperatures, significantly improves the specificity, yield, sensitivity, and length of products that can be amplified. Single-copy genomic sequences were amplified by a factor of more than 10 million with very high specificity, and DNA segments up to 2000 base pairs were readily amplified. In addition, the method was used to amplify and detect a target DNA molecule present only once in a sample of 10(5) cells.