Article

A 10-Minute DNA preparation from yeast efficiently releases autonomous plasmids for transformation of Escherichia Coli

Authors:
To read the full-text of this research, you can request a copy directly from the authors.

Abstract

A procedure for the rapid isolation of DNA from the yeast Saccharomyces cerevisiae is described. To release plasmid DNA for the transformation of Escherichia coli, cells are subjected to vortex mixing in the presence of acid-washed glass beads, Triton X-100, sodium dodecyl sulfate, phenol and chloroform. Centrifugation of this mixture separates the DNA from cellular debris. E. coli can be efficiently transformed with plasmid present in the aqueous layer without further purification of the plasmid DNA. This procedure also releases chromosomal DNA. Following two ethanol precipitations, the chromosomal DNA can be digested by restriction endonucleases and analysed by Southern blot analysis.

No full-text available

Request Full-text Paper PDF

To read the full-text of this research,
you can request a copy directly from the authors.

... The single colonies grown on plates were then streaked on fresh SAB, and once again incubated 2-3 days at 30 °C. Then, from the obtained pure cultures of three new strains, total genomic DNA was isolated [31] and specific fragments (the ITS1-5.8S-ITS2 regions and the D1/D2 domains of 26S rDNA) were amplified by PCR with a pair of ITS1F (5'TCCGTAGGTGAACCTGCGG3') and ITS4R (5'TCCTCCGCTTATTGA-TATGC3') or NL4R (5'GGTCCGTGTTTCAAGACGG3') and NL1F (5'GCATATCAA-TAAGCGGAGGAAAAG3') primers, respectively [32]. ...
... The plates were incubated for 2-3 days at 30 • C. The single colonies grown on plates were then streaked on fresh SAB, and once again incubated 2-3 days at 30 • C. Then, from the obtained pure cultures of three new strains, total genomic DNA was isolated [31] and specific fragments (the ITS1-5.8S-ITS2 regions and the D1/D2 domains of 26S rDNA) were amplified by PCR with a pair of ITS1F (5'TCCGTAGGTGAACCTGCGG3') and ITS4R (5'TCCTCCGCTTATTGATATGC3') or NL4R (5'GGTCCGTGTTTCAAGACGG3') and NL1F (5'GCATATCAATAAGCGGAG-GAAAAG3') primers, respectively [32]. ...
Article
Full-text available
2-Phenylethanol (2-PE) is an alcohol with a rosy scent and antimicrobial activity, and therefore, it is widely used in the food and cosmetic industries as an aroma and preservative. This work was aimed to draw up a technology for 2-PE bioproduction on whey permeate, which is waste produced by the dairy industry, rich in lactase and proteins. Its composition makes it a harmful waste to dispose of; however, with a properly selected microorganism, it could be converted to a value-added product. Herein, two yeast Kluyveromyces marxianus strains and one Kluyveromyces lactis, isolated from dairy products, were tested for 2-PE production, firstly on standard media and then on whey permeate based media in batch cultures. Thereafter, the 2-PE bioproduction in a continuous system in a 4.8 L bioreactor was developed, and subsequently, the final product was recovered from culture broth. The results showed that the yield of 2-PE production increased by 60% in the continuous culture compared to batch culture. Together with a notable reduction of chemical oxygen demand for whey permeate, the present study reports a complete, effective, and environmentally friendly strategy for 2-PE bioproduction with a space-time yield of 57.5 mg L−1 h−1.
... The identification of the isolates was carried out by extracting genomic DNA using the modified protocol of Hoffman and Winston [38]. The amplification of the 16S rRNA gene was carried out using the primers 27F and 1492R [39] with the following amplification conditions: an initial denaturation cycle at 94 • C (5 min), 30 denaturation cycles at 94 • C (1 min), an annealing cycle at 56 • C (30 s), an extension cycle at 72 • C (2 min), and a final extension cycle at 72 • C (10 min). ...
Article
Full-text available
Soil salinity is a condition that limits crop growth and productivity, and soil-dwelling bacteria from halophytic plant roots may be a viable strategy to cope with low productivity due to salt stress. Halophilic and halotolerant bacteria of the root soil of Sesuvium verrucosum were analyzed in this study as there is little evidence regarding its associated microbiology. Soil was sampled from the roots of Sesuvium verrucosum to obtain the cultivable bacteria. Their morphological characteristics were identified and they were molecularly identified by the 16S sequence. The growth capacity of the bacteria was determined at different levels of pH and salinity, and several growth promotion characteristics were identified, such as phosphorus solubilization, indole acetic acid production by the tryptophan-dependent (AIAt) and tryptophan-independent (IAA) pathways, ammonium production from organic sources, solubilization of carbonates, and zinc and sodium capture capacity. In addition, the bacteria that presented the best characteristics for germination variables of Solanum lycopersicum were evaluated. A total of 20 bacteria from root soil of Sesuvium verrucosum Raf. belonging to the phyla Proteobacteria (50%), Firmicutes (45%) and Actinobacteria (5%) were identified, with each one having different morphological characteristics. Among the bacterial isolates, 45% had the ability to resist different levels of salinity and pH, ranging from 0 to 20% of NaCl, and pH between 5 and 11. Moreover, these bacteria had the capacity to solubilize carbonates, phosphorus and zinc, capture sodium, produce ammonium from organic substrates and IAA (indole acetic acid), and promote enzymatic activity of amylases, proteases, lipases and cellulases. The bacteria evaluated on the germination of Solanum lycopersicum had an influence on germination at different salinity levels, with greater influence at 100 mM NaCl. This demonstrated that halophilic bacteria belonging to the rhizosphere of Sesuvium verrucosum have the ability to promote growth in extreme salinity conditions, making them candidates for the recovery of productivity in saline soils.
... Nine sub-samples of 0.5 g soil from each sample were washed with 0.15 M sodium pyrophosphate and 0.15 M phosphate buffer (pH 8.0) to remove fulvic and humic acids (Ceja-Navarro et al., 2010). Three different extraction techniques were used so that a maximum of bacterial cells was lysed and that a complete metagenome was obtained, so three sub-samples were extracted for DNA with the technique described by Valenzuela-Encinas et al. (2008), three with the method of Griffiths et al. (2000) and three with the technique of Hoffman and Vol.: (0123456789) Winston (1987). As such, 13.5 g of organic waste or soil was extracted on each given sampling day. ...
Article
Full-text available
Composting and vermicomposting are an environmentally friendly way to reduce pathogens in organic wastes and generate a valuable product that provides nutrients for crops. However, how the bacterial community structure changes during these different processes and if the bacteria applied with the (vermi)composted products survive in an arable cultivated soil is still largely unknown. In this study, we monitored how the bacterial community structure changed during conditioning, composting with and without Eisenia fetida, and when the end-product was applied to arable soil cultivated with wheat Triticum sp. L. The organic wastes used were biosolid, cow manure, and a mixture of both. Large changes occurred in the relative abundance of some of the most abundant bacterial genera during conditioning, but the changes were much smaller during composting or vermicomposting. The bacterial community structure was significantly different in the organic wastes during conditioning and (vermi)composting but adding E. fetida had no significant effect on it. Changes in the relative abundance of the bacterial groups in the (vermi)composted waste applied to the arable soil cultivated with wheat were small, suggesting that most survived even after 140 days. As such, applying (vermi)composted organic wastes not only adds nutrients to a crop but also contributes to the survival of plant growth-promoting bacteria found in the (vermi)compost. However, putative human pathogens found in the biosolid also survived in the arable soil, and their relative abundance remained high but mixing the biosolid with cow manure reduced that risk. It was found that applying (vermi)composted organic wastes to an arable soil not only provides plant nutrients and adds bacteria with plant growth-promoting capacities, but some putative pathogens also survived.
... Hoffman and Winston's [26] total yeast DNA extraction method was used on randomly selected yeast transformants. Following that, PCR confirmation of the transformants was performed using the extracted DNA as a template. ...
Article
Full-text available
Significant engineering of Saccharomyces cerevisiae is required to enable consolidated bioprocessing (CBP) of lignocellulose to ethanol. Genome modification in S. cerevisiae has been successful partly due to its efficient homology-directed DNA repair machinery, and CRISPR technology has made multi-gene editing even more accessible. Here, we tested the integration of cellulase encoding genes to various sites on the yeast genome to inform the best strategy for creating cellulolytic strains for CBP. We targeted endoglucanase (EG) or cellobiohydrolase (CBH) encoding genes to discreet chromosomal sites for single-copy integration or to the repeated delta sites for multi-copy integration. CBH1 activity was significantly higher when the gene was targeted to the delta sequences compared to single gene integration loci. EG production was comparable, though lower when the gene was targeted to a chromosome 10 site. We subsequently used the information to construct a strain containing three cellulase encoding genes. While individual cellulase activities could be assayed and cellulose conversion demonstrated, it was shown that targeting specific genes to specific loci had dramatic effects on strain efficiency. Since marker-containing plasmids could be cured from these strains, additional genetic changes can subsequently be made to optimize strains for CBP conversion of lignocellulose.
... Correct integration of all expression and disruption cassettes was verified by diagnostic PCR using OneTaq Quick-load DNA polymerase and buffer according to the manufacturer's guidelines (New England Biolabs). Genomic DNA was isolated according to a modified protocol from Hoffman and Winston [30]. Approximately 50 mg of cells were suspended in 200 µL of TE buffer (10 mM Tris, 1 mM EDTA, pH 8.0). ...
Article
Full-text available
Background The microbial production of succinic acid (SA) from renewable carbon sources via the reverse TCA (rTCA) pathway is a process potentially accompanied by net-fixation of carbon dioxide (CO 2 ). Among reduced carbon sources, glycerol is particularly attractive since it allows a nearly twofold higher CO 2 -fixation yield compared to sugars. Recently, we described an engineered Saccharomyces cerevisiae strain which allowed SA production in synthetic glycerol medium with a maximum yield of 0.23 Cmol Cmol ⁻¹ . The results of that previous study suggested that the glyoxylate cycle considerably contributed to SA accumulation in the respective strain. The current study aimed at improving the flux into the rTCA pathway accompanied by a higher CO 2 -fixation and SA yield. Results By changing the design of the expression cassettes for the rTCA pathway, overexpressing PYC2 , and adding CaCO 3 to the batch fermentations, an SA yield on glycerol of 0.63 Cmol Cmol ⁻¹ was achieved (i.e. 47.1% of the theoretical maximum). The modifications in this 2nd-generation SA producer improved the maximum biomass-specific glycerol consumption rate by a factor of nearly four compared to the isogenic baseline strain solely equipped with the dihydroxyacetone (DHA) pathway for glycerol catabolism. The data also suggest that the glyoxylate cycle did not contribute to the SA production in the new strain. Cultivation conditions which directly or indirectly increased the concentration of bicarbonate, led to an accumulation of malate in addition to the predominant product SA (ca. 0.1 Cmol Cmol ⁻¹ at the time point when SA yield was highest). Off-gas analysis in controlled bioreactors with CO 2 -enriched gas-phase indicated that CO 2 was fixed during the SA production phase. Conclusions The data strongly suggest that a major part of dicarboxylic acids in our 2nd-generation SA-producer was formed via the rTCA pathway enabling a net fixation of CO 2 . The greatly increased capacity of the rTCA pathway obviously allowed successful competition with other pathways for the common precursor pyruvate. The overexpression of PYC2 and the increased availability of bicarbonate, the co-substrate for the PYC reaction, further strengthened this capacity. The achievements are encouraging to invest in future efforts establishing a process for SA production from (crude) glycerol and CO 2 .
... In our prior study, populations with lineage tracking barcodes and the GAP1 CNV reporter were evolved in glutamine-limited chemostats [48], and whole population samples were periodically frozen in 15% glycerol. To extract DNA, we thawed pelleted cells using centrifugation and extracted genomic DNA using a modified Hoffman-Winston protocol, preceded by incubation with zymolyase at 37˚C to enhance cell lysis [105]. We measured DNA quantity using a fluorometer and used all DNA from each sample as input to a sequential PCR protocol to amplify DNA barcodes which were then purified using a Nucleospin PCR clean-up kit, as described previously [48,89]. ...
Article
Full-text available
The rate of adaptive evolution depends on the rate at which beneficial mutations are introduced into a population and the fitness effects of those mutations. The rate of beneficial mutations and their expected fitness effects is often difficult to empirically quantify. As these 2 parameters determine the pace of evolutionary change in a population, the dynamics of adaptive evolution may enable inference of their values. Copy number variants (CNVs) are a pervasive source of heritable variation that can facilitate rapid adaptive evolution. Previously, we developed a locus-specific fluorescent CNV reporter to quantify CNV dynamics in evolving populations maintained in nutrient-limiting conditions using chemostats. Here, we use CNV adaptation dynamics to estimate the rate at which beneficial CNVs are introduced through de novo mutation and their fitness effects using simulation-based likelihood–free inference approaches. We tested the suitability of 2 evolutionary models: a standard Wright–Fisher model and a chemostat model. We evaluated 2 likelihood-free inference algorithms: the well-established Approximate Bayesian Computation with Sequential Monte Carlo (ABC-SMC) algorithm, and the recently developed Neural Posterior Estimation (NPE) algorithm, which applies an artificial neural network to directly estimate the posterior distribution. By systematically evaluating the suitability of different inference methods and models, we show that NPE has several advantages over ABC-SMC and that a Wright–Fisher evolutionary model suffices in most cases. Using our validated inference framework, we estimate the CNV formation rate at the GAP1 locus in the yeast Saccharomyces cerevisiae to be 10 −4.7 to 10 ⁻⁴ CNVs per cell division and a fitness coefficient of 0.04 to 0.1 per generation for GAP1 CNVs in glutamine-limited chemostats. We experimentally validated our inference-based estimates using 2 distinct experimental methods—barcode lineage tracking and pairwise fitness assays—which provide independent confirmation of the accuracy of our approach. Our results are consistent with a beneficial CNV supply rate that is 10-fold greater than the estimated rates of beneficial single-nucleotide mutations, explaining the outsized importance of CNVs in rapid adaptive evolution. More generally, our study demonstrates the utility of novel neural network–based likelihood–free inference methods for inferring the rates and effects of evolutionary processes from empirical data with possible applications ranging from tumor to viral evolution.
... Deletion strains and chimeric variants were created using an Sfi1 based cloning system (Brachmann et al., 2004;Kämper, 2004; Supplementary Figure S3). Genomic DNA was extracted according to an established protocol (Hoffman and Winston, 1987). Mutant strains were verified by Southern blot analysis (Sambrook et al., 1989). ...
Article
Full-text available
Peroxisomes are dynamic multipurpose organelles with a major function in fatty acid oxidation and breakdown of hydrogen peroxide. Many proteins destined for the peroxisomal matrix contain a C -terminal peroxisomal targeting signal type 1 (PTS1), which is recognized by tetratricopeptide repeat (TPR) proteins of the Pex5 family. Various species express at least two different Pex5 proteins, but how this contributes to protein import and organelle function is not fully understood. Here, we analyzed truncated and chimeric variants of two Pex5 proteins, Pex5a and Pex5b, from the fungus Ustilago maydis. Both proteins are required for optimal growth on oleic acid-containing medium. The N -terminal domain (NTD) of Pex5b is critical for import of all investigated peroxisomal matrix proteins including PTS2 proteins and at least one protein without a canonical PTS. In contrast, the NTD of Pex5a is not sufficient for translocation of peroxisomal matrix proteins. In the presence of Pex5b, however, specific cargo can be imported via this domain of Pex5a. The TPR domains of Pex5a and Pex5b differ in their affinity to variations of the PTS1 motif and thus can mediate import of different subsets of matrix proteins. Together, our data reveal that U. maydis employs versatile targeting modules to control peroxisome function. These findings will promote our understanding of peroxisomal protein import also in other biological systems.
... Genomic DNA of S. reilianum was isolated according to a modified protocol described by [46]. In brief, overnight cultures were pelleted by centrifugation in the presence of glass beads (200 µL) at 13,000 rpm for 5 min. ...
Article
Full-text available
Genome comparison between the maize pathogens Ustilago maydis and Sporisorium reilianum revealed a large diversity region (19-1) containing nearly 30 effector gene candidates, whose deletion severely hampers virulence of both fungi. Dissection of the S. reilianum gene cluster resulted in the identification of one major contributor to virulence, virulence-associated gene 2 (vag2; sr10050). Quantitative reverse-transcriptase polymerase chain reaction (qRT-PCR) experiments revealed high expression of vag2 during biotrophic growth of S. reilianum. Using the yeast secretion trap assay, we confirmed the existence of a functional signal peptide allowing protein secretion via the conventional secretory pathway. We identified the cytoplasmic maize chorismate mutase ZmCM2 by yeast two-hybrid screening as a possible interaction partner of Vag2. Interaction of the two proteins in planta was confirmed by bimolecular fluorescence complementation. qRT-PCR experiments revealed vag2-dependent downregulation of salicylic acid (SA)-induced genes, which correlated with higher SA levels in plant tissues colonized by Δvag2 deletion strains relative to S. reilianum wildtype strains. Metabolite analysis suggested rewiring of pathogen-induced SA biosynthesis by preferential conversion of the SA precursor chorismate into the aromatic amino acid precursor prephenate by ZmCM2 in the presence of Vag2. Possibly, the binding of Vag2 to ZmCM2 inhibits the back reaction of the ZmCM2-catalyzed interconversion of chorismate and prephenate, thus contributing to fungal virulence by lowering the plant SA-induced defenses.
... The integration of the POF1 KMX cassette into the POF1 locus of the VIN13 and PR7 genome was confirmed by using primers POF1-L and KanMX-Rp (PCR program 2, Table S2) on genomic DNA isolated (according to the protocol by [17]) from colonies growing on YE-G418 plates. After replacing the POF KMX with MPOF END1 expression cassette, primers END1SEQ and MaxiPOF1-L were used with PCR program 4, to screen the putative VIN13 END1 and PR7 END1 strains. ...
Article
Full-text available
Industrial wine yeast strains expressing hydrolytic enzymes were fermented on Chardonnay pomace and were shown to unravel the cell walls of the berry tissues according to the enzyme activities. The yeasts produced a native endo-polygalacturonase (Saccharomyces cerevisiae × Saccharomyces paradoxus hybrid, named PR7) and/or a recombinant endo-glucanase (S. cerevisiae strains named VIN13 END1 and PR7 END1). The impact of the enzymes during the fermentations was evaluated by directly studying the cell wall changes in the berry tissues using a Comprehensive Microarray Polymer Profiling technique. By the end of the fermentation, the endo-glucanase did not substantially modify the berry tissue cell walls, whereas the endo-polygalacturonase removed some homogalacturonan. The recombinant yeast strain producing both enzymes (PR7 END1) unravelled the cell walls more fully, enabling polymers, such as rhamnogalacturonan-I, β-1,4-D-galactan and α-1,5-L-arabinan, as well as cell wall proteins to be extracted in a pectin solvent. This enzyme synergism led to the enrichment of rhamnogalacturonan-type polymers in the subsequent NaOH fractions. This study illustrated the potential utilisation of a recombinant yeast in pomace valorisation processes and simulated consolidated bioprocessing. Furthermore, the cell wall profiling techniques were confirmed as valuable tools to evaluate and optimise enzyme producing yeasts for grape and plant cell wall degradation.
... Genomic DNA was obtained from monosporic isolates by standardized methods [41][42][43]. DNA quality was visualized by agarose gel electrophoresis (1.0%). ...
Article
Full-text available
Contamination of food chains by toxigenic fungi and aflatoxins is a global problem that causes damage to human health, as well as to crop and livestock production. The objective is to evaluate Aspergillus flavus and total aflatoxins (AFs) occurrence in totally mixed rations (TMRs) for dairy cows and aflatoxin M1 (AFM1) in milk for human consumption. Ninety-nine dairy production units located in Aguascalientes, Mexico, were randomly selected, and samples were collected from TMRs, raw milk, and milk marketed in the city in two consecutive agricultural cycles. AFs were quantified in TMRs and milk by indirect enzyme immunoassay and HPLC; aflatoxigenic and molecular (PCR) capacity of monosporic A. flavus isolates in the feed was characterized. All feed, raw, and pasteurized milk samples showed aflatoxin contamination (26.0 ± 0.4 µg/kg, 32.0 ± 1.0, and 31.3 ± 0.7 ng/L, respectively), and a significant proportion (90.4, 11.3, and 10.3%) exceeded the locally applied maximum permissible limits for feed and milk (20.0 µg/kg and 50 ng/L). Aflatoxin contamination in both TMRs and milk indicated a seasonal influence, with a higher concentration in the autumn–winter cycle when conditions of higher humidity prevail. The results obtained suggest the existence of contamination by aflatoxigenic A. flavus and aflatoxins in the diet formulated for feeding dairy cows and, consequently, in the dairy food chain of this region of the Mexican Highland Plateau.
... A quick yeast DNA preparation was performed on the yeast transformants, according to the protocol outlined by Hoffman and Winston. 30 However, the steps requiring suspension in TE and RNase A, the incubation step and addition of ammonium acetate (NH4OAc) plus ethanol were removed. To confirm that the strains were constructed successfully, the ENO1 gene as well as the T.r.xyn2 gene were amplified in a confirmation PCR, using the ENO1-L and -R and nXyn2-L and -R primer sets, respectively. ...
Article
Full-text available
Second‐generation biofuel production strategies require utilization of the largest possible fraction of available sugars in renewable biomass. Xylose can make up as much as 35% of plant DCW, primarily in the form of the hemicellulose polymer xylan. Xylo‐oligosaccharides (XOS) are breakdown products of xylan released during pretreatment and hydrolysis that may inhibit the fermentation process. In an attempt to enable growth on xylan and removal of inhibitory XOS, we used CRISPR‐Cas9 to confer xylanase and GH43 xylosidase activity to xylose‐assimilating Saccharomyces cerevisiae strains. Xylosidase activity was engineered to be cell free or tethered. Gene‐integration and expression of both xylanolytic enzyme‐encoding genes was successful. Secretion yielded higher overall xylosidase activity when strains were cultivated on glucose, but cell‐associated activity was higher when cultivated in the presence of xylose. Growth trials on both xylan and XOS showed that a combination of both enzymes, with cell‐associated xylosidase production, resulted in the highest growth on both substrates. The increased growth on xylan also translated to substantial improvements in ethanol production from polymeric xylan as sole carbon source. Increased enzyme production, growth capabilities and hemicellulosic substrate conversion due to cell‐tethered activity over secreted activity was shown for the first time. The use of a GH43 xylosidase that may help avoid problematic transglycosylation for this purpose is also novel. The development of S. cerevisiae strains capable of xylan utilization and fermentation brings the ideal of utilizing the full range of sugars in biomass feedstocks for large scale ethanol production closer. This article is protected by copyright. All rights reserved.
... DNA extraction, amplification and sequencing of monosporic cultures of each of the A. flavus isolates were carried out by standard methods [46][47][48][49]. The DNA obtained was compared against phage λ DNA concentrations (Thermo Fisher Scientific, Waltham, MA, USA) and visualized in a photodocumenter (Bio-Rad Molecular Imaging-Gel Doctm XR, Hercules, CA, USA). ...
Article
Full-text available
Aspergillus species can produce aflatoxins (AFs), which can severely affect human and animal health. The objective was to evaluate the efficacy of reducing AF contamination of a non-aflatoxigenic isolate of A. flavus experimentally coinoculated with different aflatoxigenic strains in whole plant (WP), corn silage (CS), immature grains (IG) and in culture media (CM). An L-morphotype of A. flavus (CS1) was obtained from CS in a dairy farm located in the Mexican Highland Plateau; The CS1 failed to amplify the AFs biosynthetic pathway regulatory gene (aflR). Monosporic CS1 isolates were coinoculated in WP, CS, IG and CM, together with A. flavus strains with known aflatoxigenic capacity (originating from Cuautitlán and Tamaulipas, Mexico), and native isolates from concentrate feed (CF1, CF2 and CF3) and CS (CS2, CS3). AF production was evaluated by HPLC and fungal growth rate was measured on culture media. The positive control strains and those isolated from CF produced a large average amount of AFs (15,622 ± 3952 and 12,189 ± 3311 µg/kg), whereas A. flavus strains obtained from CS produced a lower AF concentration (126 ± 25.9 µg/kg). CS1 was efficient (p < 0.01) in decreasing AF concentrations when coinoculated together with CF, CS and aflatoxigenic positive control strains (71.6–88.7, 51.0–51.1 and 63.1–71.5%) on WP, CS, IG and CM substrates (73.9–78.2, 65.1–73.7, 63.8–68.4 and 57.4–67.6%). The results suggest that the non-aflatoxigenic isolate can be an effective tool to reduce AF contamination in feed and to minimize the presence of its metabolites in raw milk and dairy products intended for human nutrition.
... Genomic DNA was extracted as previously described [15]. The forward primer (WHI2_UP_45) was GATAAAGATAAAGGTTGTCTGAGCTTACAC-TTATTATAAACAATG and the reverse primer (WHI2_DN_42) was CCCGATCTCTTTCCATTTCTTTCTCTAATATATTATATACAC [16]. ...
Article
Full-text available
Yeast PARK9 (YPK9) shares homology with human ATP13A2, which encodes a polyamine transporter implicated in juvenile forms of Parkinson's disease. We used YPK9 to gain insight into how ATP13A2 affects cell growth and sensitivity to oxidative stress. Surprisingly, the YPK9 deletion strain from the Saccharomyces cerevisiae deletion collection (YKO) in wildtype BY4741 (mating type a) grew faster and was more resistant to hydrogen peroxide than a commercial, putative parental BY4741 wildtype strain (BY4741 COM). In contrast, deleting YPK9 from BY4741 COM rendered it very sensitive to hydrogen peroxide, suggesting its background is different from that of the deletion collection. Whole-genome sequencing revealed that BY4741 COM and BY4741 COM ypk9∆ contain a novel premature stop codon near the 3′ end of WHI2 (WHI2 G1324T), whereas the collection's YPK9 deletion strain contains WHI2, which encodes a 486 amino acid protein, Whi2p. Replacing full-length WHI2 with the sequence coding for the predicted truncation (Whi2p E442*) rendered strains more sensitive to hydrogen peroxide, whereas the converse replacement rendered them more resistant. The sequences of WHI2 in 20 randomly chosen strains from the collection encode the full-length protein, indicating that the putative parental BY4741 WHI2 G1324T strain's genetic background differs from that of the deletion collection. Examination of WHI2 sequences in several commonly used wildtype S. cerevisiae strains and isolates revealed other Whi2p truncations that might yield altered phenotypes. Together, these results demonstrate a novel premature stop codon in WHI2 that renders yeast sensitive to hydrogen peroxide; they also reveal a negative genetic interaction between WHI2 and YPK9 in the presence of hydrogen peroxide in the BY4741 background.
... The Escherichia coli strain DH5α and standard media and methods were used for plasmid manipulation [12]. Genomic DNA was isolated as described previously by Hoffman and Winston [13]. PCR was performed to select clones with the correct gene replacements using Quick TAQ HS DyeMix (Toyobo, Osaka, Japan). ...
Article
Full-text available
Epitope tagging is a powerful strategy for analyzing the functions of targeted proteins. The use of this strategy has become more convenient with the development of the epitope switch, which is another type of epitope tagging designed to convert the previously tagged epitopes on the chromosome to other epitopes of interest. Various modules for C-terminal epitope switching have been developed and amplified using the one-step polymerase chain reaction (PCR) method before transformation. However, PCR amplification occasionally generates mutations that affect the fidelity of epitope switching. Here, we constructed several plasmids to isolate modules for epitope switching through digestion by restriction enzymes. The isolated modules contained DNA sequences for homologous recombination, various epitopes (13×Myc, 6×HA, GFP, Venus, YFP, mCherry, and CFP), and a transformation marker (Candida glabrata LEU2). The restriction enzyme-digested plasmids were used to directly transform the cells for epitope switching. We demonstrate the efficient and accurate switching of the MX6 module-based C-terminal tandem affinity purification tags to each aforementioned epitope. We believe that our plasmids can serve as powerful tools for the functional analysis of yeast proteins.
... Yeast DNA extraction was performed as described previously (Hoffman and Winston, 1987). S. 467 pombe transformations were performed by electroporation (Gallo et al., 2018) using plasmidic 468 supercoiled DNA (0.2 g) or linear DNA (0.5-1 g). ...
Article
Full-text available
Congenital disorders of glycosylation type I (CDG-I) are inherited human diseases caused by deficiencies in lipid-linked oligosaccharide (LLO) synthesis or the glycan transfer to proteins during N-glycosylation. We constructed a platform of 16 Schizosaccharomyces pombe strains that synthesize all possible theoretical combinations of LLOs containing three to zero glucose (Glc) residues and nine to five mannose (Man) residues. The occurrence of unexpected LLOs suggested the requirement of specific Man residues for glucosyltransferase activities. We then quantified protein hypoglycosylation in each strain and found that in S. pombe the presence of Glc in the LLO is more relevant to the transfer efficiency than the number of Man residues. Surprisingly, a decrease in the number of Man residues in glycans somehow improved the glycan transfer. The most severe hypoglycosylation was produced in cells that synthesized LLOs completely lacking Glc and having a high number of Man residues. This deficiency could be reverted by expressing a single-subunit oligosaccharyltransferase with a broad range of substrate specificity. Our work shows the usefulness of this new S. pombe set of mutants as a platform to model the molecular bases of human CDG-I diseases. This article has an associated First Person interview with the first authors of the paper.
... For DNA isolation, pure cultures of yeasts were grown in YPD broth at 28 • C for 48 h. Genomic DNA (gDNA) was extracted as reported by Hoffman and Winston [36]. The final quantity of the resultant DNA was determined by NanoDrop ND-1000 device (Thermo Scientific Waltman, MA, USA) and diluted to 50 ng/µL with sterile ultra-pure water. ...
Article
Full-text available
Whey is the main byproduct of the dairy industry and contains sugars (lactose) and proteins (especially serum proteins and, at lesser extent, residual caseins), which can be valorized by the fermentative action of yeasts. In the present study, we characterized the spoilage yeast population inhabiting natural whey starter (NWS), the undefined starter culture of thermophilic lactic acid bacteria used in Parmigiano Reggiano (PR) cheesemaking, and evaluated thermotolerance, mating type, and the aptitude to produce ethanol and bioactive peptides from whey lactose and proteins, respectively, in a selected pool of strains. PCR-RFLP assay of ribosomal ITS regions and phylogenetic analysis of 26S rDNA D1/D2 domains showed that PR NWS yeast population consists of the well-documented Kluyveromyces marxianus, as well as of other species (Saccharomyces cerevisiae, Wickerhamiella pararugosa, and Torulaspora delbrueckii), with multiple biotypes scored within each species as demonstrated by (GTG)5-based MSP-PCR. Haploid and diploid K. marxianus strains were identified through MAT genotyping, while thermotolerance assay allowed the selection of strains suitable to grow up to 48 °C. In whey fermentation trials, one thermotolerant strain was suitable to release ethanol with a fermentation efficiency of 86.5%, while another candidate was able to produce the highest amounts of both ethanol and bioactive peptides with potentially anti-hypertensive function. The present work demonstrated that PR NWS is a reservoir of ethanol and bioactive peptides producer yeasts, which can be exploited to valorize whey, in agreement with the principles of circularity and sustainability.
... Genomic DNA extraction from yeast was performed using phenol-chloroform-isoamyl alcohol (PCI) according to the method described by [71]. Plasmids were isolated from E. coli DH5α cells from overnight cultures in lysogeny broth (LB) containing 10 g L −1 peptone, 5 g L −1 yeast extract and 10 g L −1 NaCl (pH 7.0) with 100 mg L −1 carbinicilin by using the Qiagen Miniprep Kit (Qiagen, Germany). ...
Article
Full-text available
Background The brewer’s yeast Saccharomyces cerevisiae is exploited in several industrial processes, ranging from food and beverage fermentation to the production of biofuels, pharmaceuticals and complex chemicals. The large genetic and phenotypic diversity within this species offers a formidable natural resource to obtain superior strains, hybrids, and variants. However, most industrially relevant traits in S . cerevisiae strains are controlled by multiple genetic loci. Over the past years, several studies have identified some of these QTLs. However, because these studies only focus on a limited set of traits and often use different techniques and starting strains, a global view of industrially relevant QTLs is still missing. Results Here, we combined the power of 1125 fully sequenced inbred segregants with high-throughput phenotyping methods to identify as many as 678 QTLs across 18 different traits relevant to industrial fermentation processes, including production of ethanol, glycerol, isobutanol, acetic acid, sulfur dioxide, flavor-active esters, as well as resistance to ethanol, acetic acid, sulfite and high osmolarity. We identified and confirmed several variants that are associated with multiple different traits, indicating that many QTLs are pleiotropic. Moreover, we show that both rare and common variants, as well as variants located in coding and non-coding regions all contribute to the phenotypic variation. Conclusions Our findings represent an important step in our understanding of the genetic underpinnings of industrially relevant yeast traits and open new routes to study complex genetics and genetic interactions as well as to engineer novel, superior industrial yeasts. Moreover, the major role of rare variants suggests that there is a plethora of different combinations of mutations that can be explored in genome editing.
... Single cell colonies obtained after transformation were restreaked on selective agar plates. Genomic DNA was isolated according to a modified protocol from Hoffman and Winston [38]. Approximately 50 mg of cells was suspended in 200 µL of TE buffer (10 mM Tris, 1 mM EDTA, pH 8.0). ...
Article
Full-text available
d-galacturonic acid (d-GalUA) is the main constituent of pectin, a complex polysaccharide abundant in several agro-industrial by-products such as sugar beet pulp or citrus peel. During several attempts to valorise d-GalUA by engineering the popular cell factory Saccharomyces cerevisiae, it became obvious that d-GalUA is, to a certain degree, converted to l-galactonate (l-GalA) by an endogenous enzymatic activity. The goal of the current work was to clarify the identity of the responsible enzyme(s). A protein homology search identified three NADPH-dependent unspecific aldo-keto reductases in baker’s yeast (encoded by GCY1, YPR1 and GRE3) that show sequence similarities to known d-GalUA reductases from filamentous fungi. Characterization of the respective deletion mutants and an in vitro enzyme assay with a Gcy1 overproducing strain verified that Gcy1 is mainly responsible for the detectable reduction of d-GalUA to l-GalA.
... mm and 200 μL of a mix containing phenol, chloroform and isoamyl alcohol in a ratio of 25:24:1 were added. The tubes were vortexed at maximum speed for 2 min and centrifuged at 15700 g for 10 min according to a protocol modified from Hoffman and Winston (1987). For 25 µl PCR reactions, 1 μL of a 1:10 dilution (in dH 2 O) of the resulting aqueous phase was used as template. ...
Article
Full-text available
Pectin-rich plant biomass residues represent underutilized feedstocks for industrial biotechnology. The conversion of the oxidized monomer d-galacturonic acid (d-GalUA) to highly reduced fermentation products such as alcohols is impossible due to the lack of electrons. The reduced compound glycerol has therefore been considered an optimal co-substrate, and a cell factory able to efficiently co-ferment these two carbon sources is in demand. Here, we inserted the fungal d-GalUA pathway in a strain of the yeast S. cerevisiae previously equipped with an NAD-dependent glycerol catabolic pathway. The constructed strain was able to consume d-GalUA with the highest reported maximum specific rate of 0.23 g gCDW-1 h-1 in synthetic minimal medium when glycerol was added. By means of a13C isotope-labelling analysis, carbon from both substrates was shown to end up in pyruvate. The study delivers the proof of concept for a co-fermentation of the two 'respiratory' carbon sources to ethanol and demonstrates a fast and complete consumption of d-GalUA in crude sugar beet pulp hydrolysate under aerobic conditions. The future challenge will be to achieve co-fermentation under industrial, quasi-anaerobic conditions.
... Cells were harvested from overnight culture, and DNA was extracted (75). Briefly, cells were washed with ice-cold water and centrifuged at 4000 rpm for 5 0 at 4 C. ...
Article
Full-text available
In Saccharomyces cerevisiae, proteins destined for secretion utilize the post-translational translocon machinery to gain entry into the endoplasmic reticulum (ER). These proteins then mature by undergoing a number of post-translational modifications in different compartments of the secretory pathway. While these modifications have been well established for many proteins, to date only a few studies have been conducted regarding the conditions and factors affecting maturation of these proteins before entering into the ER. Here, using immunoblotting, microscopy and spot test assays, we show that excess copper inhibits the Sec61 translocon function and causes accumulation of two well-known post-translationally translocated (PTT) proteins, Gas1 and CPY, in the cytosol. We further show the copper-sensitive phenotype of sec61 deficient yeast cells is ameliorated by restoring the levels of SEC61 through plasmid transformation. Further, screening of translocation-defective Sec61 mutants revealed that sec61-22, bearing L80M, V134I, M248V, and L342S mutations, is resistant to copper, suggesting that copper might be inflicting toxicity through one of these residues. In conclusion, these findings imply that copper mediated accumulation of PTT proteins is due to the inhibition of Sec61.
... To remove humic and fulvic substances, soil samples were washed as described by Ceja-Navarro et al. (2010). The DNA extraction from each soil sample (0.5 g) was done using three different methods, including chemical lysis with detergent and mechanical disruption (Hoffman and Winston, 1987); enzymatic lysis (Sambrook and Russell, 2001) and thermal lysis (Valenzuela-Encinas et al., 2008), each method was done in triplicate (n = 9). The DNA obtained from the three methods (4.5 g of soil) was pooled and used as a template for subsequent PCR amplification. ...
Article
In recent years, there has been a growing need to understand how salinity affects microbial communities in agricultural soils. The archaeal and bacterial community diversity and structure were investigated through high-throughput sequencing analysis of their 16S rRNA in two arable soils with low electrolytic conductivity (EC) (arable 1 soil 2.3 dS m⁻¹ and arable 2 soil 2.6 dS m⁻¹) and a saline soil (EC = 17.6 dS m⁻¹). The dominant bacterial phyla in the soils were Proteobacteria (relative abundance 46.2±8.9%), followed by Acidobacteria (13.1±9.1%) and Actinobacteria (10.0±4.8%), while Serratia (6.0±5.8%) and Bacillus (4.0±3.6%) were the dominant bacterial genera. Candidatus Nitrososphaera (53.5±46.8%) was the dominant archaeal phylotype in the arable soils, whereas Nitrosopumilus (0.4±0.01%) in the saline soil. The archaeal and bacterial community structure was different between the soils and the sand, As, Ba and Sb content had a significant effect on bacterial and archaeal community structure in the soils of this study, but not soil salinity.
... The DNA was extracted following three protocols based on high temperature, chemical and/or enzymatic treatments with mechanical cell lysis (Hoffman and Winston 1987;Sambrook and Russell 2001;Valenzuela-Encinas et al. 2008). Ten g soil of each replicate sample (n = 6, i.e., three replicates of unamended soil and three of soil amended with young maize plants) was extracted for DNA with each method and then pooled, i.e., overall, 30 g of each soil sample was extracted. ...
Article
Full-text available
To increase our knowledge on how application of organic material alters soil microbial populations and functionality, shotgun metagenomic sequencing was used to determine the microbial communities and their potential functionality in an arable soil amended with young maize plants (Zea mays L.) in a laboratory experiment after 3 days. The relative abundance of bacterial and viral groups was strongly affected by organic material application, whereas that of the archaeal, protist and fungal groups was less affected. Cellulose degraders with copiotrophic lifestyle (e.g., Betaproteobacteria) were enriched in the amended soil, whereas the groups with slow growing oligotrophic and chemolithoautotrophic metabolism within Bacteria and Archaea were greater in the unamended than in the amended soil. The soil viral structure and richness were also affected. Caudovirales was the dominant viral family, with members of Siphoviridae enriched in the amended soil and members of Myoviridae in the unamended soil. More specialized metabolic traits related to both the degradation of complex C compounds and denitrification related genes were enriched in the young maize plant amended soil than in the unamended soil, whereas nitrification related genes were enriched in the latter. Copiotrophic life-style bacterial groups were enriched in the amended soil, whereas oligotrophic life-style bacterial groups in the unamended soil. Many bacterial and viral phylotypes were affected by the application of young maize plants, but the number of soil fungi, archaea and protists affected was smaller. Metabolic functionality was affected by the application of organic material as the relative abundance of genes involved in the denitrification process was higher in the maize plant amended soil than in the unamended soil and those involved in the nitrification process was higher in the unamended soil.
... The transformation of U. maydis was performed as described previously (42). Genomic DNA of U. maydis cells was prepared according to a protocol described previously by Hoffman and Winston (43). Constructs for gene replacement were generated as established previously, using an SfiI-based cassette system and a PCR-based cloning strategy (44,45). ...
Article
Full-text available
Fungi produce and secrete various secondary metabolites that can act as weapons against competitors, help in accessing nutrients, or assist in development and communication. One group of secondary metabolites are surface-active glycolipids, which have significant biotechnological potential as biodegradable detergents.
... Genomic yeast DNA was extracted using glass beads as previously described [53]. Restriction enzymes and T4 DNA ligase (5 U µL −1 ) were purchased from Thermo Fisher Scientific. ...
Article
Full-text available
Background Despite decades of engineering efforts, recombinant Saccharomyces cerevisiae are still less efficient at converting d-xylose sugar to ethanol compared to the preferred sugar d-glucose. Using GFP-based biosensors reporting for the three main sugar sensing routes, we recently demonstrated that the sensing response to high concentrations of d-xylose is similar to the response seen on low concentrations of d-glucose. The formation of glycolytic intermediates was hypothesized to be a potential cause of this sensing response. In order to investigate this, glycolysis was disrupted via the deletion of the phosphoglucose isomerase gene (PGI1) while intracellular sugar phosphate levels were monitored using a targeted metabolomic approach. Furthermore, the sugar sensing of the PGI1 deletants was compared to the PGI1-wildtype strains in the presence of various types and combinations of sugars. Results Metabolomic analysis revealed systemic changes in intracellular sugar phosphate levels after deletion of PGI1, with the expected accumulation of intermediates upstream of the Pgi1p reaction on d-glucose and downstream intermediates on d-xylose. Moreover, the analysis revealed a preferential formation of d-fructose-6-phosphate from d-xylose, as opposed to the accumulation of d-fructose-1,6-bisphosphate that is normally observed when PGI1 deletants are incubated on d-fructose. This may indicate a role of PFK27 in d-xylose sensing and utilization. Overall, the sensing response was different for the PGI1 deletants, and responses to sugars that enter the glycolysis upstream of Pgi1p (d-glucose and d-galactose) were more affected than the response to those entering downstream of the reaction (d-fructose and d-xylose). Furthermore, the simultaneous exposure to sugars that entered upstream and downstream of Pgi1p (d-glucose with d-fructose, or d-glucose with d-xylose) resulted in apparent synergetic activation and deactivation of the Snf3p/Rgt2p and cAMP/PKA pathways, respectively. Conclusions Overall, the sensing assays indicated that the previously observed d-xylose response stems from the formation of downstream metabolic intermediates. Furthermore, our results indicate that the metabolic node around Pgi1p and the level of d-fructose-6-phosphate could represent attractive engineering targets for improved d-xylose utilization.
... The biomass of Streptomyces albus was determined by real-time quantitative PCR (qPCR). We extracted template DNA for a standard curve from the Daqu substate in which 10× serial dilutions of conidial suspensions of Streptomyces albus had been inoculated, as described by Hoffman and Winston [38]. ddH 2 O was used to dissolve the DNA, and then DNA concentrations were quantified using a NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA). ...
Article
Full-text available
Geosmin produced by Streptomyces can cause an earthy off-flavor at trace levels, seriously deteriorating the quality of Chinese liquor. Geosmin was detected during the Daqu (Chinese liquor fermentation starter)-making process, which is a multi-species fermentation process in an open system. Here, biocontrol, using the native microbiota present in Daqu making, was used to control the geosmin contamination. Six native strains were obtained according to their inhibitory effects on Streptomyces and then were inoculated into the Daqu fermentation. After inoculation, the content of geosmin decreased by 34.40% (from 7.18 ± 0.13 μg/kg to 4.71 ± 0.30 μg/kg) in the early stage and by 55.20% (from 8.86 ± 1.54 μg/kg to 3.97 ± 0.78 μg/kg) in the late stage. High-throughput sequencing combined with an interaction network revealed that the fungal community played an important role in the early stage and the correlation between Pichia and Streptomyces changed from the original indirect promotion to direct inhibition after inoculation. This study provides an effective strategy for controlling geosmin contamination in Daqu via precisely regulating microbial communities, as well as highlights the potential of biocontrol for controlling off-flavor chemicals at trace levels in complex fermentation systems.
... We used genomic DNA from BY and RM strains as a template to PCR amplify repair templates for CRISPR-Swap. Genomic DNA was extracted from BY and RM strains using the '10-min prep' protocol (Hoffman and Winston, 1987). We amplified full-length repair templates from RM and BY containing each GOI's promoter, open-reading frame (ORF), and terminator using Phusion Hot Start Flex DNA polymerase (NEB). ...
Article
Full-text available
Precise control of protein degradation is critical for life, yet how natural genetic variation affects this essential process is largely unknown. Here, we developed a statistically powerful mapping approach to characterize how genetic variation affects protein degradation by the ubiquitin-proteasome system (UPS). Using the yeast Saccharomyces cerevisiae, we systematically mapped genetic influences on the N-end rule, a UPS pathway in which protein N-terminal amino acids function as degradation-promoting signals. Across all 20 possible N-terminal amino acids, we identified 149 genomic loci that influence UPS activity, many of which had pathway- or substrate-specific effects. Fine-mapping of four loci identified multiple causal variants in each of four ubiquitin system genes whose products process (NTA1), recognize (UBR1 and DOA10), and ubiquitinate (UBC6) cellular proteins. A cis-acting promoter variant that modulates UPS activity by altering UBR1 expression alters the abundance of 36 proteins without affecting levels of the corresponding mRNAs. Our results reveal a complex genetic basis of variation in UPS activity.
... Hygromycin (200 397 µg/ml), carboxin (2 µg/ml) and G418 (400 µg/ml) were used for selection. Genomic DNA was 398 extracted as previously described (Hoffman and Winston, 1987). (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. ...
Preprint
Full-text available
Formation of specialized reaction spaces prevents interference between distinct cellular pathways. Peroxisomes are cellular compartments involved in a large diversity of metabolic processes. How peroxisomes differentiate into subpopulations and by which mechanism intraorganellar domains are formed remains largely elusive. Here, we report on enzymes from the fungus Ustilago maydis , which accumulate inside of peroxisomal subdomains. We describe a short peptide motif (Tyr-Ile-Ile-Val) sufficient to trigger focal localization. Mining for proteins with similar motifs uncovered several peroxisomal matrix proteins that accumulate in intraorganellar foci. These foci are enriched in the enzyme urate oxidase – a typical constituent of the paracrystalline core of peroxisomes. Upon peroxisome proliferation uneven distribution of focal structures results in the formation of peroxisome subpopulations with different protein content. The underlying principle of subdomain formation is evolutionary conserved in mammalian peroxisomes and formation of similar foci was also observed inside of mitochondria. We propose that peroxisomal proteins show an individual propensity to self-assemble. This formation of protein aggregates appears to be a ubiquitous driving force to spatially organize the peroxisomal proteome.
... Single colonies were grown overnight in YPD medium, DNA was extracted as described [56], and subjected to the FPNI DNA amplification protocol [57] using Ds-specific primers (S7 Table, primers 1-6) as described [25]. PCR reactions were tested for the presence of bands on an agarose gel and the positive reactions (>90%) were cleaned using the GenElute kit (Sigma-Aldrich) and sequenced by Sanger sequencing. ...
Article
Full-text available
Heme (iron-protoporphyrin IX) is an essential but potentially toxic cellular cofactor. While most organisms are heme prototrophs, many microorganisms can utilize environmental heme as iron source. The pathogenic yeast Candida albicans can utilize host heme in the iron-poor host environment, using an extracellular cascade of soluble and anchored hemophores, and plasma membrane ferric reductase-like proteins. To gain additional insight into the C . albicans heme uptake pathway, we performed an unbiased genetic selection for mutants resistant to the toxic heme analog Ga ³⁺ -protoporphyrin IX at neutral pH, and a secondary screen for inability to utilize heme as iron source. Among the mutants isolated were the genes of the pH-responsive RIM pathway, and a zinc finger transcription factor related to S . cerevisiae HAP1 . In the presence of hemin in the medium, C . albicans HAP1 is induced, the Hap1 protein is stabilized and Hap1-GFP localizes to the nucleus. In the hap1 mutant, cytoplasmic heme levels are elevated, while influx of extracellular heme is lower. Gene expression analysis indicated that in the presence of extracellular hemin, Hap1 activates the heme oxygenase HMX1 , which breaks down excess cytoplasmic heme, while at the same time it also activates all the known heme uptake genes. These results indicate that Hap1 is a heme-responsive transcription factor that plays a role both in cytoplasmic heme homeostasis and in utilization of extracellular heme. The induction of heme uptake genes by C . albicans Hap1 under iron satiety indicates that preferential utilization of host heme can be a dietary strategy in a heme prototroph.
... [KanR] transformants able to grow in presence of the drug G418 were streaked again on selective medium, and the genomic DNA of single colonies was extracted (48) and analyzed by PCR to look both for the correct insertion of the deletion cassette and the absence of the wild type sequences. Colonies carrying the deletion were back-crossed to a wild type strain to verify the co-segregation of the G418 resistance with the gene deletion. ...
Article
Full-text available
Mitochondrial mRNAs encode key subunits of the oxidative phosphorylation complexes that produce energy for the cell. In Saccharomyces cerevisiae, mitochondrial translation is under the control of translational activators, specific to each mRNA. In Schizosaccharomyces pombe, which more closely resembles the human system by its mitochondrial DNA structure and physiology, most translational activators appear to be either lacking, or recruited for post-translational functions. By combining bioinformatics, genetic and biochemical approaches we identified two interacting factors, Cbp7 and Cbp8, controlling Cytb production in S. pombe. We show that their absence affects cytb mRNA stability and impairs the detection of the Cytb protein. We further identified two classes of Cbp7/Cbp8 partners and showed that they modulated Cytb or Cox1 synthesis. First, two isoforms of bS1m, a protein of the small mitoribosomal subunit, that appear mutually exclusive and confer translational specificity. Second, a complex of four proteins dedicated to Cox1 synthesis, which includes an RNA helicase that interacts with the mitochondrial ribosome. Our results suggest that S. pombe contains, in addition to complexes of translational activators, a heterogeneous population of mitochondrial ribosomes that could specifically modulate translation depending on the mRNA translated, in order to optimally balance the production of different respiratory complex subunits.
... The presence of the fungi was confirmed by phylogenetic reconstruction based on the internal transcribed spacer (ITS) and 28S region of LSU rDNA. These gene regions were amplified with the ITS1-ITS4 and LR07-LR7 primers, employing protocols for total DNA extraction and PCR amplifications previously described [11][12][13]. The PCR products were purified with the Clean & Concentrator TM kit (Zymo Research, Orange Co., Irvine, CA, USA) and sequenced by Sanger dideoxy sequencing (Macrogen ® , Seoul, Korea). ...
Article
Full-text available
Magnusiomyces capitatus (also denominated “Geotrichum capitatum” and “the teleomorph stage of Saprochaete capitata”) mainly affects immunocompromised patients with hematological malignancies in rare cases of invasive fungal infections (IFIs). Few cases have been reported for pediatric patients with acute lymphoblastic leukemia (ALL), in part because conventional diagnostic methods do not consistently detect M. capitatus in infections. The current contribution describes a systemic infection in a 15-year-old female diagnosed with ALL. She arrived at the Children’s Hospital of Mexico City with a fever and neutropenia and developed symptoms of septic shock 4 days later. M. capitatus ENCB-HI-834, the causal agent, was isolated from the patient’s blood, urine, bile, and peritoneal fluid samples. It was identified with matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) and a phylogenetic reconstruction using internal transcribed spacer (ITS) and 28S ribosomal sequences. The phylogenetic sequence of M. capitatus ENCB-HI-834 clustered with other M. capitatus-type strains with a 100% identity. In vitro antifungal testing, conducted with the Sensititre YeastOne susceptibility system, found the following minimum inhibitory concentration (MIC) values (μg/mL): posaconazole 0.25, amphotericin B 1.0, fluconazole > 8.0, itraconazole 0.25, ketoconazole 0.5, 5-flucytosine ≤ 0.06, voriconazole 0.25, and caspofungin > 16.0. No clinical breakpoints have been defined for M. capitatus. This is the first clinical case reported in Mexico of an IFI caused by M. capitatus in a pediatric patient with ALL. It emphasizes the importance of close monitoring for a timely and accurate diagnosis of neutropenia-related IFIs to determine the proper treatment with antibiotics, antifungals, and chemotherapy for instance including children with ALL.
... DNA from U. maydis was measured under the conditions described by Hoffman and Winston [35]. To isolate DNA, cells were incubated in a complete medium, plus the selective antibiotic when necessary, under shaking conditions (125-150 rpm) at 28 • C for 18 h, and recovered by centrifugation. ...
Article
Full-text available
Smut fungi comprise a large group of biotrophic phytopathogens infecting important crops, such as wheat and corn. U. maydis is a plant pathogenic fungus responsible for common smut in maize and teocintle. Through our analysis of the transcriptome of the yeast-to-mycelium dimorphic transition at acid pH, we determined the number of genes encoding chitin deacetylases of the fungus, and observed that the gene encoding one of them (UMAG_11922; CDA1) was the only one up-regulated. The mutation of this gene and the analysis of the mutants revealed that they contained reduced amounts of chitosan, were severely affected in their virulence, and showed aberrant mycelial morphology when grown at acid pH. When the CDA1 gene was reinserted into the mutants by the use of an autonomous replication plasmid, virulence and chitosan levels were recovered in the retro mutant strains, indicating that the CDA1 gene was involved in these features. These data revealed that chitosan plays a crucial role in the structure and morphogenesis of the cell wall during mycelial development of the fungus, and that in its absence, the cell wall becomes altered and is unable to support the stress imposed by the defense mechanism mounted on by the plant host during the infection process.
... Developed colonies were restreaked onto QDO/X-gal 1 plates to screen for the development of blue color for the b-galactosidase activity, and finally the blue colonies were further streaked onto QDO/Xgal/Aureobasidin (40 mg/mL). Plasmids were isolated from the colonies as previously described (92) and sequenced for identity. ...
Article
Full-text available
Pathogen transmission by vectors involves multiple levels of interactions, and for the transmission of liberibacter species by psyllid vectors, much of these interactions are yet to be explored. Candidatus Liberibacter solanacearum (CLso) haplotype D inflicts severe economic losses to the carrot industry. Understanding the specific interactions at different stages of infection is hence fundamental and could lead to the development of better management strategies to disrupt the transmission of the bacteria to new host plants.
... Samples were collected at a time where bulk S phase is complete in non-HU treated cells (240 min for haploid cells undergoing a mitotic cycle; 210 min for pat1-114 diploids). Genomic DNA was extracted [49] and purified using the Qiagen Genomic DNA kit (Genomic-tip 20/G), and samples were labeled by random priming. Briefly, 2 µg of purified genomic DNA per sample was incubated for 5 min at 95 • C with 300 µg/mL of Random Primer (481907011, Invitrogen, Waltham, MA, USA). ...
Article
Full-text available
Eukaryotic DNA replication is regulated by conserved mechanisms that bring about a spatial and temporal organization in which distinct genomic domains are copied at characteristic times during S phase. Although this replication program has been closely linked with genome architecture, we still do not understand key aspects of how chromosomal context modulates the activity of replication origins. To address this question, we have exploited models that combine engineered genomic rearrangements with the unique replication programs of post-quiescence and pre-meiotic S phases. Our results demonstrate that large-scale inversions surprisingly do not affect cell proliferation and meiotic progression, despite inducing a restructuring of replication domains on each rearranged chromosome. Remarkably, these alterations in the organization of DNA replication are entirely due to changes in the positions of existing origins along the chromosome, as their efficiencies remain virtually unaffected genome wide. However, we identified striking alterations in origin firing proximal to the fusion points of each inversion, suggesting that the immediate chromosomal neighborhood of an origin is a crucial determinant of its activity. Interestingly, the impact of genome reorganization on replication initiation is highly comparable in the post-quiescent and pre-meiotic S phases, despite the differences in DNA metabolism in these two physiological states. Our findings therefore shed new light on how origin selection and the replication program are governed by chromosomal architecture.
... Correct integration of all expression cassettes was verified by diagnostic PCR using OneTaq Quick-load DNA polymerase and buffer according to the manufacturer's guidelines (New England Biolabs). Genomic DNA was isolated according to a modified protocol from Hoffman and Winston [30]. Approximately 50 mg of cells were suspended in 200 µL of TE buffer (10 mM Tris, 1 mM EDTA, pH 8.0). ...
Article
Full-text available
Membrane transporters are important targets in metabolic engineering to establish and improve the production of chemicals such as succinic acid from renewable resources by microbial cell factories. We recently provided a Saccharomyces cerevisiae strain able to strongly overproduce succinic acid from glycerol and CO2 in which the Dct-02 transporter from Aspergillus niger, assumed to be an anion channel, was used to export succinic acid from the cells. In a different study, we reported a new group of succinic acid transporters from the AceTr family, which were also described as anion channels. Here, we expressed these transporters in a succinic acid overproducing strain and compared their impact on extracellular succinic acid accumulation with that of the Dct-02 transporter. The results show that the tested transporters of the AceTr family hinder succinic acid accumulation in the extracellular medium at low pH, which is in strong contrast to Dct-02. Data suggests that the AceTr transporters prefer monovalent succinate, whereas Dct-02 prefers divalent succinate anions. In addition, the results provided deeper insights into the characteristics of Dct-02, showing its ability to act as a succinic acid importer (thus being bidirectional) and verifying its capability of exporting malate.
Article
Purpose Many articles describe the effects of extremely low-frequency magnetic fields (MF) on DNA damage induction. However, the mechanism of MF interaction with living matter is not yet known with certainty. Some works suggest that MF could induce an increase in the efficacy of Reactive Oxygen Species (ROS) production. This work investigates whether pulsed MF exposure produces alterations in genomic DNA damage induced by co-exposure to DNA damaging agents (bleomycin and methyl methanesulfonate (MMS)). Materials and methods Genomic DNA, prepared from S. cerevisiae cultures, was exposed to pulsed MF (1.5 mT peak, 25 Hz) and MMS (0-1%) (15-60 minutes), and to MF and bleomycin (0-0.6 IU/ml) (24-72 hours). The damage induced to DNA was evaluated by electrophoresis and image analysis. Results Pulsed MF induced an increment in the level of DNA damage produced by MMS and bleomycin in all groups at the exposure conditions assayed. Conclusions Pulsed MF could modulate the cytotoxic action of MMS and bleomycin. The observed effect could be the result of a multifactorial process influenced by the type of agent that damages DNA, the dose, and the duration of the exposure to the pulsed MF.
Article
DNA variants that alter gene expression in trans are important sources of phenotypic variation. Nevertheless, the identity of trans-acting variants remains poorly understood. Single causal variants in several genes have been reported to affect the expression of numerous distant genes in trans. Whether these simple molecular architectures are representative of trans-acting variation is unknown. Here, we studied the large RAS signaling regulator gene IRA2, which contains variants with extensive trans-acting effects on gene expression in the yeast Saccharomyces cerevisiae. We used systematic CRISPR-based genome engineering and a sensitive phenotyping strategy to dissect causal variants to the nucleotide level. In contrast to the simple molecular architectures known so far, IRA2 contained at least seven causal nonsynonymous variants. The effects of these variants were modulated by non-additive, epistatic interactions. Two variants at the 5′-end affected gene expression and growth only when combined with a third variant that also had no effect in isolation. Our findings indicate that the molecular basis of trans-acting genetic variation may be considerably more complex than previously appreciated.
Article
High arsenic and chromium concentrations are currently receiving attention because of their negative effects on the environment and human health. Microorganisms inhabiting contaminated environments have developed resistance mechanisms against the toxicity of these pollutants. Indeed, members of the bacterial genus Micrococcus have been isolated from different toxic-metal-contaminated environments. However, knowledge concerning the resistance mechanisms of Micrococcus to arsenic and chromium, isolated from contaminated sites, remains scarce. In response, the aim was to examine strains of Micrococcus luteus (An24, Mh, NE2TL6, and NE2TTS4) from the endosphere and soil of two different sites in Mexico contaminated with heavy metals in order to observe any differences in the resistance mechanisms by M. luteus group. The strains were resistant to arsenic (As³⁺, As⁵⁺), chromate, dichromate, cobalt, copper, nickel, and zinc. Genome analysis indicated that the heavy metal-resistant strains could be assigned to the M. luteus group (M. luteus NCTC 2665T and M. endophyticus JCM 16951T), which had more heavy metal-resistant genes (transporters, chaperones, and enzymes) compared to the type strains of the M. luteus group. The bacteria were able to biotransform arsenic (As³⁺ and As⁵⁺) through a carbon-source-dependent mechanism. The As⁵⁺ was potentially carried out in the cytoplasm through the thioredoxin-dependent pathway, which may be coupled with biosorption. A qualitative analysis of organic acids (OAs) picked up a change in the OA profile that was metal-depending (arsenic or chromium). Our findings on the genome and phenotype tests suggest that the four studied strains of the M. luteus group had developed resistance mechanisms that may have enabled their survival in contaminated sites in Mexico.
Article
Cryptococcus neoformans, the most common cause of fungal meningitis, is a basidiomycete haploid budding yeast with a complete sexual cycle. Genome modification by homologous recombination is feasible using biolistic transformation and long homology arms, but the method is arduous and unreliable. Recently, multiple groups have reported the use of CRISPR-Cas9 as an alternative to biolistics, but long homology arms are still necessary, limiting the utility of this method. Since the S. pyogenes Cas9 derivatives used in prior studies were not optimized for expression in C. neoformans, we designed, synthesized, and tested a fully C. neoformans-optimized Cas9. We found that a Cas9 harboring only common C. neoformans codons and a consensus C. neoformans intron together with a TEF1 promoter and terminator and a nuclear localization signal (C. neoformans-optimized CAS9 or “CnoCAS9”) reliably enabled genome editing in the widely-used KN99α C. neoformans strain. Furthermore, editing was accomplished using donors harboring short (50 bp) homology arms attached to marker DNAs produced with synthetic oligonucleotides and PCR amplification. We also demonstrated that prior stable integration of CnoCAS9 further enhances both transformation and homologous recombination efficiency; importantly, this manipulation does not impact virulence in animals. We also implemented a universal tagging module harboring a codon-optimized fluorescent protein (mNeonGreen) and a tandem Calmodulin Binding Peptide-2X FLAG Tag that allows for both localization and purification studies of proteins for which the corresponding genes are modified by short homology-directed recombination. These tools enable short-homology genome engineering in C. neoformans.
Article
Full-text available
The cyanobacterium strain Synechococcus cedrorum SAG 88.79 stock culture has fungal contamination stated by the Sammlung von Algenkulturen der Universität Göttingen itself. In this recent work, this particular fungal strain was isolated, identified, and morphologically characterised. The fungal strain AGSC12 belongs to the species Cyphellophora olivacea, with respect to the sequence similarity, phylogeny, and morphology of the strain. Colony morphology and growth capability were examined on SMA, EMMA, PDA, MEA, YEA, and YPA plates. Growth of the colonies was the most successful on YPA plates, followed by PDA and MEA containing plates. Surprisingly, the AGSC12 strain showed extreme tolerance to NaHCO3, albeit it, is is considered a general fungistatic compound. Moreover, positive association between the AGSC12 and SAG 88.79 strains was revealed, as the SAG 88.79 strain always attained higher cell density in co-cultures with the fungus than in mono-cultures. Besides, a taxonomic note on the SAG 88.79 strain itself was also stated.
Article
Species of Nannochloropsis are single-celled Stramenopiles commonly used in microalgae-based technologies for the manufacturing of bioproducts. Nannochloropsis oceanica QH25 was isolated from an algal cultivation pond located in Imperial, Texas (USA). We used PacBio continuous long read (CLR) sequencing to produce a highly contiguous 29.34 Mb genome.
Thesis
p>Analysis of the AtNramp sequences and comparison to other Nramps suggests that they contain 12 transmembrane domains and a conserved signature motif implicated in transport activity. The tissue-specific expression patterns of the AtNramp genes have been studied using RT-PCR and quantitative PCR performed on root, leaf, stem, flower and silique material. The AtNramps were detected in all tissues with the exception of AtNramp5 , which was only found in flowers. Upon Fe starvation, AtNramp3 transcript increased in roots while AtNramp6 increased in stem. No changes were observed in other AtNramp genes. The function of the AtNramps has been studied using yeast mutants deficient in Fe uptake. A tNramp3 and AtNramp4 were able to rescue the fet3/fet4 Fe uptake mutant while AtNramp5 and AtNramp6 have not successfully complemented this mutant. Radiolabelled Fe uptake assays in the same cells showed that AtNramp3 and Atnramp4 are capable of transporting Fe and that this transport is pH dependent in AtNramp4 transformed cells. A lower level of uptake activity was also observed with AtNramp5 in some experiments. Plant lines containing T-DNA inserts with the AtNramp genes have been identified in order to allow the future investigation of the effect of lack of function of the AtNramps. The data presented suggest that members of the AtNramp family play different roles in transition metal homeostasis in Arabidopsis thaliana. </p
Article
Full-text available
Large-scale genomic changes, including copy number variations (CNVs), are frequently observed in long-term evolution experiments (LTEEs). We have previously reported the detection of recurrent CNVs in Saccharomyces cerevisiae populations adapting to glutamine-limited conditions over hundreds of generations. Here, we present the whole-genome sequencing (WGS) assemblies of 7 LTEE strains and their ancestor.
Article
Full-text available
The phenotypic consequence of a genetic mutation depends on many factors including the expression level of a gene. However, a comprehensive quantification of this expression effect is still lacking, as is a further general mechanistic understanding of the effect. Here, we measured the fitness effect of almost all (>97.5%) single-nucleotide mutations in GFP, an exogenous gene with no physiological function, and URA3, a conditionally essential gene. Both genes were driven by two promoters whose expression levels differed by around tenfold. The resulting fitness landscapes revealed that the fitness effects of at least 42% of all single-nucleotide mutations within the genes were expression dependent. Although only a small fraction of variation in fitness effects among different mutations can be explained by biophysical properties of the protein and messenger RNA of the gene, our analyses revealed that the avoidance of stochastic molecular errors generally underlies the expression dependency of mutational effects and suggested protein misfolding as the most important type of molecular error among those examined. Our results therefore directly explained the slower evolution of highly expressed genes and highlighted cytotoxicity due to stochastic molecular errors as a non-negligible component for understanding the phenotypic consequence of mutations.
Article
Full-text available
Crop residue management and tillage are known to affect the soil bacterial community, but when and which bacterial groups are enriched by application of ammonium in soil under different agricultural practices from a semi-arid ecosystem is still poorly understood. Soil was sampled from a long-term agronomic experiment with conventional tilled beds and crop residue retention (CT treatment), permanent beds with crop residue burned (PBB treatment) or retained (PBC) left unfertilized or fertilized with 300 kg urea-N ha⁻¹ and cultivated with wheat (Triticum durum L.)/maize (Zea mays L.) rotation. Soil samples, fertilized or unfertilized, were amended or not (control) with a solution of (NH4)2SO4 (300 kg N ha⁻¹) and were incubated aerobically at 25 ± 2 °C for 56 days, while CO2 emission, mineral N and the bacterial community were monitored. Application of NH4⁺ significantly increased the C mineralization independent of tillage-residue management or N fertilizer. Oxidation of NH4⁺ and NO2⁻ was faster in the fertilized soil than in the unfertilized soil. The relative abundance of Nitrosovibrio, the sole ammonium oxidizer detected, was higher in the fertilized than in the unfertilized soil; and similarly, that of Nitrospira, the sole nitrite oxidizer. Application of NH4⁺ enriched Pseudomonas, Flavisolibacter, Enterobacter and Pseudoxanthomonas in the first week and Rheinheimera, Acinetobacter and Achromobacter between day 7 and 28. The application of ammonium to a soil cultivated with wheat and maize enriched a sequence of bacterial genera characterized as rhizospheric and/or endophytic independent of the application of urea, retention or burning of the crop residue, or tillage.
Article
Los aceites esenciales se caracterizan por presentar olor, sabor y muchas veces propiedades antifúngicas;son producidos por plantas aromáticas y medicinales. Es importante determinar qué efecto tienen los aceites esenciales de L graveolensen el control de fitopatógenos. Se realizó la evaluación del aceite esencial de Lippia graveolens sobre el hongo Fusarium chlamydosporum, que tiene alta incidencia, reduce la productividad y puede afectar al humano. La extracción de los aceites se realizó en etanol absoluto. De la biomasa se realizó la extracción de DNA y se hizo una PCR utilizando los oligonucleótidos ITS1 e ITS4. El hongose confrontóen cajas de petri con los aceites esencialesde L graveolens. Seobservó menor crecimiento de Fusarium sp, en la muestra Viad 01, con 1.23 cm de crecimiento;mientras que en el testigo se obtuvo una colonia de 4.60 cm, lo cual representa una diferencia de 3.37 cm con respecto a la muestra Viad 01. Lo anterior muestra que los extractos de Lippia graveolenspueden ser una alternativa para el control de enfermedades innovando para la agricultura sostenible y competitiva, además de su uso potencial en salud humana.
Article
Full-text available
Global warming has a significant impact on different viticultural parameters, including grape maturation. An increment of photosynthetic activity generates a rapid accumulation of sugars in the berry, followed by a dehydration process which leads to a higher concentration of soluble solids. This effect is exacerbated by current viticultural practices which favor the harvest of very mature grapes to obtain wines with sweet tannins. Considering the initial hyperosmotic stress conditions and the high ethanol concentration of the produced wine, fermentation of grape musts with high sugar content could be problematic for yeast starters. In the present study, we were able to obtain by classical hybridization and spore dissection methods one hybrid and one monosporic wine yeast strain with a combined ethanol and osmotolerant phenotype. The improved yeasts were tested in vinification trials with high sugar concentration and displayed excellent fermentation performance. Importantly, the obtained wines also showed good organoleptic properties during sensory analysis. Based on our results, we believed our improved hybrid and monosporic strains can be considered good alternatives to be used as yeast starters for fermentations with high sugar content.
Article
Ethanolic fermentation is frequently performed under conditions of low nitrogen. In Saccharomyces cerevisiae , nitrogen limitation induces macroautophagy, including the selective removal of mitochondria, also called mitophagy. Shiroma and co-workers (2014) showed that blocking mitophagy by deletion of the mitophagy specific gene ATG32 increased the fermentation performance during the brewing of Ginjo sake. In this study, we tested if a similar strategy could enhance alcoholic fermentation in the context of fuel ethanol production from sugarcane in Brazilian biorefineries. Conditions that mimic the industrial fermentation process indeed induce Atg32-dependent mitophagy in cells of S. cerevisiae PE-2, a strain frequently used in the industry. However, after blocking mitophagy, no significant differences in CO 2 production, final ethanol titres or cell viability were observed after five rounds of ethanol fermentation, cell recycling and acid treatment, as commonly performed in sugarcane biorefineries. To test if S. cerevisiae ’s strain background influences this outcome, cultivations were carried out in a synthetic medium with strains PE-2, Ethanol Red (industrial) and BY (laboratory), with and without a functional ATG32 gene, under oxic and oxygen restricted conditions. Despite the clear differences in sugar consumption, cell viability and ethanol titres, among the three strains, we could not observe any significant improvement in fermentation performance related to the blocking of mitophagy. We conclude with caution that results obtained with Ginjo sake yeast is an exception and cannot be extrapolated to other yeast strains and that more research is needed to ascertain the role of autophagic processes during fermentation. Importance Bioethanol is the largest (per volume) ever biobased bulk chemical produced globally. The fermentation process is very well established, and industries regularly attain nearly 85% of maximum theoretical yields. However, because of the volume of fuel produced, even a small improvement will have huge economic benefits. To this end, besides already implemented process improvements, various free energy conservation strategies have been successfully exploited at least in laboratory strains to increase ethanol yields and decrease by-product formation. Cellular housekeeping processes have been an almost unexplored territory in strain improvement. Shiroma and co-workers previously reported that blocking mitophagy by deletion of the mitophagy receptor gene ATG32 in Saccharomyces cerevisiae led to a 2.1% increase in final ethanol titres during Japanese sake fermentation. We found in two commercially used bioethanol strains (PE-2 and Ethanol Red) that ATG32 deficiency does not lead to a significant improvement in cell viability or ethanol levels during fermentation with molasses or in a synthetic complete medium. More research is required to ascertain the role of autophagic processes during fermentation conditions.
Thesis
Full-text available
Mitochondria are essential eukaryotic organelles containing multiple copies of mitochondrial DNA (mtDNA), which encodes protein subunits of the oxidative phosphorylation (OXPHOS) machinery. In addition to producing the majority of a cell’s ATP, the OXPHOS system can also generate reactive oxygen species (ROS), which are known to damage mtDNA molecules. Such ROS-induced mtDNA damage generally comprises strand breaks, base loss, and base modifications. Because of its complexity, a double-strand break (DSB) in the mitochondrial genome is regarded as the most deleterious form of mtDNA lesion. However, site-specific mtDNA DSBs can also be beneficial depending on the type of eukaryotic cell under consideration. Studies in the budding yeast Saccharomyces cerevisiae have revealed that mtDNA DSBs at the replication origin ori5 initiate mtDNA recombination dependent rolling circle replication (RDR) in respiratory deficient petite (ρ-) mutants. However, it was not certain if respiratory competent wild-type (ρ+) cells also employed a similar replication mechanism for propagating their mitochondrial genome. To understand this, the DSB binding property of an evolutionarily conserved protein was utilized. Ku, a central protein involved in DSB repair via non-homologous end joining, is found across different domains of life and contains a conserved ‘core’ domain dedicated for DNA end binding. Eukaryotic Ku, unlike bacterial Ku (bKu), also possesses additional N- and C- terminal domains required for communicating with downstream eukaryotic repair proteins. With this knowledge, I hypothesized that expression of mitochondrial-targeted bacterial Ku in ρ+ yeast cells would bind to mtDNA DSBs and prevent mtDNA replication or repair due to lack of communication with eukaryotic factors. Results revealed that mitochondrial-targeted bKu bound to ori5 in ρ+ mtDNA and inducible expression of bKu triggered petite formation preferentially in daughter cells. In addition, bKu expression induced mtDNA depletion, which occurred to such an extent that cells devoid of mtDNA (ρ0 cells) were identified. These observations supported the idea that mtDNA replication in ρ+ yeast cells is initiated by a DSB since binding of bKu to DSB at ori5 not only triggered mtDNA depletion but also interfered with mtDNA segregation into daughter cells. Expression of mitochondrial-targeted bKu, however, did not decrease mtDNA content in human breast cancer MCF7 cells. This is in agreement with the knowledge that human mtDNA replication, typically, is not initiated by a DSB. Collectively, the study provided a direct evidence for DSB-mediated replication as the predominant, and probably the only, form of mtDNA replication in ρ+ yeast cells. DSB-mediated mtDNA replication is a rare instance of the beneficial aspect of mtDNA DSBs, as these lesions are generally considered detrimental. By disrupting mtDNA integrity, mtDNA DSBs can compromise the function of the OXPHOS system and this in turn can prove disastrous to a cell. Fortunately, eukaryotic cells have evolved with a mtDNA DSB repair system, which is dedicated to restore the integrity of the mitochondrial genome. However, factors mediating mtDNA DSB repair are not well characterized and only a few proteins have been identified as bona fide mtDNA DSB repair factors in the entire Eukaryota domain. To identify mtDNA DSB repair factors, S. cerevisiae was utilized as a eukaryotic model system in which two putative proteins were selected: Mhr1 (mitochondrial homologous recombinase) and yeast Ku80 (Yku80). Utilizing mitochondrial-targeted restriction endonuclease XhoI (mitoXhoI), Mhr1 was shown to bind near mitoXhoI-induced DSBs in vivo. This observation, together with the preexisting knowledge of its homologous pairing activity in vitro, bolstered my hypothesis that Mhr1 is a general mtDNA DSB repair factor. Yku80, on the other hand, could not be detected in the yeast mitochondrial extracts. In addition, the level of Mhr1 binding near mitoXhoI-induced DSBs was comparable between the wild-type strain and isogenic yku80 null mutant, suggesting that YKU80 gene product did not compete with Mhr1 for binding to mtDNA DSBs. These observations indicated that Yku80, most likely, is not involved in repairing mtDNA DSBs. Hence, I concluded that Mhr1, but not Yku80, is a general mtDNA DSB repair factor in yeast. Taken together, this study has expanded our knowledge on mtDNA DSBs in replication and in repair. If explored comprehensively, the knowledge of mtDNA replication and repair can open new avenues to identifying potential therapeutic targets against different human diseases.
Chapter
Microorganisms offer a tremendous potential as cell factories, and they are indeed been used by humans since the previous centuries for biotransformations. Among them, yeasts combine the advantage of a unicellular state with a eukaryotic organization. Moreover, in the era of biorefineries, their biodiversity can offer solutions to specific process constraints. Zygosaccharomyces bailii, an ascomycete budding yeast, is widely known for its peculiar tolerance to different stresses, among which are organic acids. Moreover, the recent reclassification of the species, including diverse hybrids, is further expanding both fundamental and applied interests. It is therefore reasonable that despite the possibility to apply with this yeast some of the molecular tools and protocols routinely used to manipulate Saccharomyces cerevisiae, adjustments and optimizations are necessary. Here we describe in detail the methods for determining chromosome number, size, and aneuploidy, transformation, classical target gene disruption or gene integration, and designing of episomal expression plasmids helpful for engineering the yeast Z. bailii .Key words Zygosaccharomyces bailii Yeast transformation Targeted gene deletion Plasmids Promoters Contour-clamped homogeneous electric field (CHEF) gel electrophoresis
Article
Full-text available
Glucose is central to many biological processes, serving as an energy source and a building block for biosynthesis. After glucose enters the cell, hexokinases convert it to glucose-6-phosphate (Glc-6P) for use in anaerobic fermentation, aerobic oxidative phosphorylation, and the pentose-phosphate pathway. We here describe a genetic screen in Saccharomyces cerevisiae that generated a novel spontaneous mutation in hexokinase-2, hxk2G238V, that confers resistance to the toxic glucose analog 2-deoxyglucose (2DG). Wild-type hexokinases convert 2DG to 2-deoxyglucose-6-phosphate (2DG-6P), but 2DG-6P cannot support downstream glycolysis, resulting in a cellular starvation-like response. Curiously, though the hxk2G238V mutation encodes a loss-of-function allele, the affected amino acid does not interact directly with bound glucose, 2DG, or ATP. Molecular dynamics simulations suggest that Hxk2G238V impedes sugar binding by altering the protein dynamics of the glucose-binding cleft, as well as the large-scale domain-closure motions required for catalysis. These findings shed new light on Hxk2 dynamics and highlight how allosteric changes can influence catalysis, providing new structural insights into this critical regulator of carbohydrate metabolism. Given that hexokinases are upregulated in some cancers and that 2DG and its derivatives have been studied in anti-cancer trials, the present work also provides insights that may apply to cancer biology and drug resistance.
Article
Full-text available
A set of vector DNAs (Y vectors) useful for the cloning of DNA fragments in Saccharomyces cerevisiae (yeast) and in Escherichia coli are characterized. With these vectors, three modes of yeast transformation are defined. (i) Vectors containing yeast chromosomal DNA sequences (YIp1, YIp5) transform yeast cells at low frequency (1--10 colonies per microgram) and integrate into the genome by homologous recombination; this recombination is reversible. (ii) Hybrids containing endogenous yeast plasmid DNA sequences (YEp2, YEp6) transform yeast cells at much higher frequency (5000--20,000 colonies per microgram). Such molecules replicate autonomously with an average copy number of 5--10 covalently closed circles per yeast cell and also replicate as a chromosomally integrated structure. This DNA may be physically isolated in intact form from either yeast or E. coli and used to transform either organism at high frequency. (iii) Vectors containing a 1.4-kilobase yeast DNA fragment that includes the centromere linked trp1 gene (YRp7) transform yeast with an efficiency of 500--5000 colonies per microgram; such molecules behave as minichromosomes because they replicate autonomously but do not integrate into the genome. The uses of Y vectors for the following genetic manipulations in yeast are discussed: isolation of genes; construction of haploid strains that are merodiploid for a particular DNA sequence; and directed alterations of the yeast genome. General methods for the selection and the analysis of these events are presented.
Article
Full-text available
Previous work has demonstrated that the yeast SPT3 gene is required for transcription from δ sequences, the long terminal repeats that flank yeast Ty elements. In spt3 null mutants, transcription fails to initiate in δ sequences and instead intiates farther downstream. Null mutations in SPT3 cause other mutant phenotypes, including defects in sporulation and diploid formation. In this paper we report further genetic and physical characterization of the SPT3 gene and protein. By extensive linker insertion mutagenesis, we have delimited the region necessary for SPT3 function. From DNA sequence analysis, SPT3 encodes a protein of 337 amino acids. We have identified this protein an anti-SPT3 antibody. Finally, we show that overproduction of the SPT3 gene product does not alter the level of Ty transcription.
Article
Full-text available
We characterized a number of widely used yeast-Escherichia coli shuttle vectors in the fission yeast Schizosaccharomyces pombe. The 2 micron vectors pDB248 and YEp13 showed high frequency of transformation, intermediate mitotic and low meiotic stability, and a low copy number in S. pombe, analogous to their behavior in [cir0] strains of Saccharomyces cerevisiae. The S. cerevisiae integration vectors pLEU2 and pURA3 transformed S. pombe at very low frequencies but, surprisingly, in a nonintegrative fashion. Instead, they replicated autonomously, and they showed very high copy numbers (up to 150 copies per plasmid-containing cell). This could reflect a lack of sequence specificity for replication of plasmid DNA in S. pombe. pFL20, an S. pombe ars vector, and a series of plasmids derived from it were studied to analyze the unusually high stability of this plasmid. Mitotic stability and partitioning of the plasmids was measured by pedigree analysis of transformed S. pombe cells. An S. pombe DNA fragment (stb) was identified that stabilizes pFL20 by improvement of plasmid partitioning in mitosis and meiosis.
Article
Full-text available
The GAL1 and GAL10 genes of Saccharomyces cerevisiae are divergently transcribed, with 606 base pairs of DNA separating their transcription initiation sites. These two genes are stringently coregulated: their expression is induced ca. 1,000-fold in cells growing on galactose and is repressed by growth on glucose. The nucleotide sequence of the region of DNA between these genes and the precise sites of transcription initiation are presented here. The most notable feature of the nucleotide sequence of this region is a 108-base-pair guanine-plus-cytosine-rich stretch of DNA located approximately in the middle of the region between GAL1 and GAL10. Analysis of the effects of mutations that alter the region between these two genes, constructed in vitro or selected in vivo, suggest that these guanine-plus-cytosine-rich sequences are required for the expression of both genes. The region of DNA between GAL1 and GAL10 is sufficient for regulation of expression of these genes: fusion of the region to the yeast HIS3 gene places HIS3 under GAL control.
Article
A system of biological containment for recombinant DNA experiments in Saccharomyces cerevisiae (Brewer's/Baker's yeast) is described. The principle of containment is sterility: the haploid host strains all contain a matingtype-non-specific sterile mutation. The hosts also contain four auxotrophic mutations suitable for selection for the various kinds of vectors used. All vectors are derivatives of pBR322 which can be selected and maintained in both yeast and Escherichia coli. The system has recently been certified at the HV2 level by the National Institutes of Health.
Article
A method is described for the purification of chromosomal and plasmid DNA from the yeast Saccharomyces cerevisiae. This method is rapid, gives 75% of theoretical yield, and produces DNA that can be cut with restriction endonucleases. Yeast cells are treated with zymolyase, and the resulting spheroplasts are lysed in the presence of the chaotropic agent guanidine hydrochloride. After a brief ethanol precipitation, protein is removed by treatment with proteinase K followed by phenol-chloroform extraction. After ethanol precipitation, the DNA is sufficiently pure for restriction analysis or for the transformation of Escherichia coli.
Article
This chapter discusses a procedure for isolation of DNA from the yeast Saccharomyces cerevisiae. This procedure is a modification of an earlier method for isolating DNA from bacteria and has general operations: (1) preparation of osmotically fragile spheroplasts by enzymatic digestion of the cell wall, (2) lysis of the spheroplasts and partial proteolysis of the lysate, (3) deproteinization and extraction of lipids from the lysate, and (4) enzymatic digestion of RNA and elimination of polysaccharides by centrifugation or digestion, followed by separation of the DNA from the digestion products by selective isopropanol precipitation. This procedure yields a preparation of total-yeast DNA including all three buoyant density species observed in neutral isopycnic cesium chloride gradients: nuclear, nuclear heavy satellite, and mitochondrial. If spheroplasting of the cells is adequate and lysis is complete, there are no preferential losses of any of the observed DNA species. Preparations free of DNA of mitochondrial density can be obtained from petite yeast strains that lack mitochondrial DNA. The various DNA species obtained from normal strains by this method may be separated and purified using cesium chloride gradients, cesium chloride–ethidium bromide gradients, cesium sulfate–mercury, or cesium sulfate–silver gradients, and hydroxyapatite chromatography.
Article
This paper describes a method of transferring fragments of DNA from agarose gels to cellulose nitrate filters. The fragments can then be hybridized to radioactive RNA and hybrids detected by radioautography or fluorography. The method is illustrated by analyses of restriction fragments complementary to ribosomal RNAs from Escherichia coli and Xenopus laevis, and from several mammals.
Article
A complementation analysis of host-controlled modification and restriction of DNA by Escherichia coli has been carried out by examining the restriction and modification phenotypes of partial, permanent diploids containing various arrangements of wild type and mutant restriction and modification alleles. Intercistronic complementation was observed between three classes of restriction and modification mutants of E. coli B, indicating that at least three cistrons (the ram cistrons) are involved in the genetic control of the [restriction and modification of DNA. Mutations in one cistron (ramA) result in a loss of restriction activity but not in modification activity (r−m+). Mutations in a second cistron (ramC) result in a loss of restriction and modification activities (r−m−). Mutations in a third cistron result in a loss of modification activity and appear to be lethal unless accompanied by a mutation in the ramA or ramC cistrons. A fourth class of mutations, which are linked to the other ram cistrons and are expressed phenotypically as r−m− mutants, are trans dominant to the wild-type ram alleles. It is not known if this latter class of mutants represents a fourth cistron of the ram locus. Complementation was observed between E. coli K12 and B ramA and ramC mutations and the host specificity of the restored restriction activity was dependent on an intact ramC cistron. However, complementation was not detected between the P1 and K12 or P1 and B ram alleles. A general model for the genetic control of the restriction and modification properties of E. coli strains and their episomes is presented.
Article
The his4-912 mutation results from insertion of a 6200 bp transposable element into the his4 gene of yeast. In order to clone the his4-912 mutation, the plasmid pBR322 was integrated into the his4 gene by means of yeast transformation, and then the vector sequences and the his4-912 insertion element were excised as a single restriction fragment. This his 4-912 insertion element is homologous to Ty1, a family of repetitive yeast DNA sequences. His+ revertants derived from the his4-912 mutant carry a number of chromosomal aberrations including deletions, translocations, a transposition and an inversion. The majority of His+ revertants result from deletions which have both endpoints within the element and which leave behind only 300 bp of the insertion element. Other derivatives of the his4-912 mutant carry deletions which have one endpoint in the insertion element and one endpoint in the his4 coding sequence. In two His+ revertants carrying reciprocal translocations, the chromosome III translocation breakpoints occur within the his4-912 insertion element. A His+ revertant carrying an inversion of most of the left arm of chromosome III may be an intermediate in transposition of the his4-912 insertion element to a new site on chromosome III.
Article
Techniques for high frequency yeast transformation have been described. A double-strand break introduced by restriction enzyme cleavage can be used to direct a plasmid to integrate into a particular chromosomal locus. Plasmids containing a double-strand gap can be used in a straightforward method for the isolation and mapping of chromosomal alleles. These techniques extend the genetic applications of yeast transformation.
Article
Transcription of the structural gene URA3, coding for the orotidine 5′-phosphate decarboxylase in Saccharomyces cerevisiae is regulated by the product of the gene PPR1. Constitutive and noninducible mutant alleles of PPR1 have been cloned and separately introduced with the URA3 structural gene into a hybrid plasmid able to replicate in Schizosaccharomyces pombe. Despite the extensive divergence between both yeasts, the cloned constitutive allele PPR1 selectively stimulates 4-9 fold the transcriptional rate of the S. cerevisiae gene URA3 introduced in S. pombe. Study of the strand-specific transcription of URA3 indicates moreover that the PPR1 gene product can exert its regulatory action even when URA3 mRNA is transcribed from a flanking plasmid promoter.
High ofyeast: autonomous replication of Winston, F. and Minehart, and identification transcription Analysis of the yeast VT3 gene of its product, a positive regulator Nucl of Ty and trans-Enzymol
  • D T Scherer
  • S Davis
D.T., Scherer, S. and Davis, R.W.: High ofyeast: autonomous replication of Winston, F. and Minehart, and identification transcription. P.L.: Analysis of the yeast VT3 gene of its product, a positive regulator Nucl. Acids Res. 14 (1986) 6885-6900. of Ty and trans-Enzymol. 101 Communicated by G.R. Fink.
Cold Spring Harbor Laboratory Manual for a Course
  • F Sherman
  • G R Fink
  • C W Lawrence
Sherman, F., Fink, G.R. and Lawrence, C.W.: Cold Spring Harbor Laboratory Manual for a Course, Methods in Yeast Genetics, Revised Edition. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1978.