No full-text available
To read the full-text of this research,
you can request a copy directly from the authors.
A quantitative assay for DNA-RNA hybrids with DNA immobilized on a membrane
Abstract
An improved method for the formation of DNA—RNA hybrids is described. The procedure involves immobilizing denatured DNA on nitrocellulose membrane filters, hybridizing complementary RNA to the membrane-fixed DNA, and eliminating RNA “noise”. Denatured DNA and hybridized RNA remain on the filter throughout the procedure. Unpaired RNA is removed by washing, and RNA complexed over short regions is eliminated by RNase treatment.Many samples can be easily handled, permitting kinetic and saturation studies. Large amounts-of DNA can be loaded on a filter without interfering with the efficiency of the annealing reaction. Moreover, the “noise” can be depressed to a level (0·003% of the input RNA) permitting the identification of small regions of DNA complementary to a given RNA species. The results are quantitatively more certain than annealing in liquid, since the competing DNA renaturation reaction is suppressed.
... Using microscopy to locate specific genes on chromosomes was one of Joe's longtime dreams, and the time was ripe with the recent advent of biochemical molecular hybridization (Gillespie and Spiegelman, 1965). Success in developing the method depended on a biological system in which the suspected answer could be verified experimentally; Joe wisely picked Xenopus oocytes whose extrachromosomal nucleoli contained amplified rDNA. ...
Joseph Grafton Gall (1928–2024), a founder of modern cell biology, made foundational discoveries on eukaryotic chromosomes and RNA biogenesis. His major contributions include the development of in situ hybridization (later called FISH), demonstration of one DNA double helix/chromosome, isolation of the first eukaryote gene, localization of satellite DNA to centromeric heterochromatin, determination of the first telomeric DNA sequence, and elucidating the structure and functions of Cajal bodies. He was an expert microscopist, a scholar of science history, and an avid naturalist. These attributes, together with his ready embrace of new technologies, contributed to his remarkable success. He was also an early and strong supporter of women in science. His contributions to science and mentoring were recognized by numerous awards including the American Society for Cell Biology’s E.B. Wilson Medal, the Society for Developmental Biology’s Lifetime Achievement Award, the Albert Lasker Special Achievement Award in Medical Research, and the AAAS Mentor Award for Lifetime Achievement.
... Microarray technology is based on the basic property of nucleic acids, which is the selective binding of two complementary chains/sequences. The basic technological idea on the exploitation of this property already existed [1,2], but what gave a huge rash into this technology was the discovery of microarrays. However, this could not have been feasible without the unraveling of the sequence of the human genome. ...
Background: Microarray technology has revolutionized the way genomic analysis has been performed. High-throughput data acquisition, brought up a challenge in data comprehension i.e. in gene expression. Methods: k-means cluster obtained after analysis of miRNA expression data have been sorted by an algorithmic procedure. Results: The proposed method managed to sort k-means centroids and manifest a more simple way of drawing conclusions on studied tumor samples. miRNAs were unraveled that changed in expression levels with respect to tumor aggressiveness. Conclusions: In the present work we presented a new and simple approach in data analysis using a new analysis approach, which we termed sorted-k-means analysis.
... For almost 20 years, the only available support for immobilization of DNA was nitrocellulose, which was first used in powder form (Hall and Spiegelman 1961) and subsequently as sheets (Nygaard and Hall 1960;Gillespie and Spiegelman 1965;Southern 1975). Northern hybridization was initially performed exclusively with RNA immobilized on activated cellulose papers (Alwine et al. 1977;Seed 1982). ...
Southern transfer and hybridization are used to study how genes are organized within genomes by mapping restriction sites in and around segments of genomic DNA for which specific probes are available. Genomic DNA is first digested with one or more restriction enzymes, and the resulting fragments are separated according to size by electrophoresis through a standard agarose gel. The DNA is then denatured in situ and transferred from the gel to a solid support (usually a nylon or nitrocellulose membrane). The DNA attached to the membrane is hybridized to a labeled DNA, RNA, or oligonucleotide probe, and bands complementary to the probe are located by an appropriate detection system (e.g., by autoradiography). By estimating the size and number of the bands generated after digestion of the genomic DNA with different restriction enzymes, singly or in combination, it is possible to place the target DNA within a context of restriction sites.
... The RNase (0.5 mg per ml in 0.01 M Tris, pH 7.2) was heated for 10 min at about 90" to denature any contaminating DNase (9). Spermidine was obtained from Calbiochem and Sephadex G-200 from Pharmacia. ...
Ribonucleic acid polymerase directed by a native deoxyribonucleic acid template shows an initially rapid rate of ribonucleic acid synthesis which subsequently slows and finally establishes a plateau. It has been suggested that these kinetics result from the inhibition of RNA polymerase by the RNA formed during the reaction. The kinetics of the polymerase reaction under conditions where product RNA does not accumulate have been studied. By determining the release of ³²P-labeled pyrophosphate from γ-³²P-labeled ribonucleoside triphosphates, it is possible to assay RNA polymerase in the presence of pancreatic ribonuclease and ribonuclease T1. When the RNases are added to DNA-directed RNA polymerase reactions, there is a stimulation of ³²PPi release and the kinetics approach linearity. The addition of the nucleases to RNA polymerase reactions which had reached a plateau markedly stimulates RNA polymerase-dependent ³²PPi formation.
... Hy6ridization-The RNA-DNA hybridization was carried out essentially according to the procedure of Gillespie and Spiegelman (32). The denaturated DNA was dissolved in 0.90 M NaCl, 0.090 M sodium citrate (6-fold concentrated SSC) at concentration of 10 pg per ml; 50 to 60 pg were passed through the nitrocellulose filter and the total amount of DNA that adhered to the filter was determined by the difference found in the ultraviolet absorbance of the solution before and after the filtration. ...
To define more clearly the relationships of nucleolar 45 S, 35 S, and 28 S RNA to ribosomal 18 S and 28 S RNA, hybridization studies were carried out with these RNAs and DNA obtained from nucleoli of Novikoff hepatoma ascites cells. As determined by saturation studies, the percentage of nucleolar DNA complementary to 18 S and 28 S rRNA was 0.08 and 0.195%, respectively; the percentage of DNA complementary to 28 S, 35 S, and 45 S nucleolar RNA was 0.25, 0.35, and 0.52%, respectively. The percentage of nucleolar DNA complementary to an equimolar mixture of 18 S and 28 S rRNA was 0.28%. Competition experiments showed that 28 S rRNA competes to the extent of 84, 63, and 43%, respectively, with nucleolar 28 S, 35 S, and 45 S RNA. On the other hand, 18 S rRNA did not compete effectively with 28 S and 35 S nucleolar RNA but competed to the extent of 17% with nucleolar 45 S RNA. According to the saturation and competition experiments, nucleolar 28 S, 35 S, and 45 S RNA contain nonribosomal RNA segments corresponding in length to about 18, 41, and 43%, respectively, of the total molecules. Based upon these studies and those of the accompanying paper, a revised model is presented for the conversion reactions involved in formation of ribosomal RNA from nucleolar precursors.
... DNA/RNA hybridization studies were performed by using the membrane filter technique of Gillespie and Spiegelman as modified by McCarthy and McConaughy (5,11). We have modified the original procedures by using dual labels (OH-labeled filterbound DNA and [31P]RNA in solution) and dimethyl sulfoxide in the buffer to lower the optimum incubation temperature during renaturation and inhibit DNA leaching from filters. ...
The kinetics of host ribonucleic acid (RNA) degradation and its resynthesis into Bdellovibrio-specific polyribonucleotides has been studied. The kinetics of RNA turnover was followed during a one-step synchronous growth cycle of Bdellovibrio growing within ³²PO4-labeled Escherichia coli host cells. The species of labeled RNA present at any given time was ascertained through the specificity of the deoxyribonucleic acid (DNA)/RNA hybridization technique. At nearsaturating levels of RNA and at zero time, 7% of the host DNA sequences and only 0.04% of the Bdellovibrio DNA became hybridized with ³²P-labeled host cell RNA (greater than 99% host specific). At the end of the burst, 98% of the labeled RNA sequences were specific for Bdellovibrio DNA. About 74% of the initial labeled host cell RNA became turned over into Bdellovibrio-specific sequences. We provide data indicating that host cell ribosomal RNA is assimilated by Bdellovibrio. Degradation of host cell RNA occurs in a gradual fashion over most of the Bdellovibrio developmental growth cycle. This application of the DNA/RNA hybridization technique and its general concept should be of value in elucidating the kinetics of nucleic acid turnover in other types of host-parasite systems.
... Thus, the Tm of E. coli rRNA-DNA hybrids is close to that expected from its base composition (Moore and McCarthy, in preparation). The same thermal stability is obtained if the hybrids are treated with ribonuclease to remove grossly unpaired regions (15). The thermal stability of the hybrid is not dependent on the temperature of incubation (Fig. 12). ...
... With the exception of Ouchi et al. (92), who used the agar support method (16), all yeast polynucleotide sequence comparisons have been assayed by the nitrocellulose filter technique (35,46). The problems inherent in this method are well known and are often magnified in eucaryotic systems (24,86). ...
... Two procedures were used in determining DNA homology between environmental and human K. pneumoniae strains. In one procedure, the DNA membrane filter technique was used and hybridization was measured by the competition assay (13,17). About 20% of the input homologous radioactive DNA renatured to the membrane-bound DNA. ...
The phenotypic and nucleic acid properties of Klebsiella pneumoniae have been studied on cultures obtained from six different habitats (humans, vegetables, seeds, trees, rivers, and pulp mills). The 19 cultural reactions of 107 isolates varied significantly only in tryptophanase activity and dulcitol fermentation. The percentage of guanine plus cytosine base composition of 41 isolates varied from 53.9 to 59.2%. The range of percentage of guanine plus cytosine base composition for environmental klebsiellas was broader than that for the cultures of human origin. The range of deoxyribonucleic acid relative reassociation (homology) to the human K. pneumoniae reference strain extended from 5% to 100% and the chromosome molecular weights ranged from 2,200 × 10⁶ to 3,000 × 10⁶. The species of K. pneumoniae is thus molecularly more heterogeneous than previously thought and most isolates of human, pulp mill, and river origin are genetically indistinguishable. The presence of K. pneumoniae therefore represents a deterioration of the microbiological quality of the environment and should be considered of public health significance. At the present time the health significance of the molecularly more divergent strains, primarily of vegetable and seed origin, their relationship to klebsiellas of human origin, or to other genera of the Enterobacteriaceae is unclear.
... Loading membrane filters. Unlabeled strain B DNA was loaded onto the membrane filters (B-6; Schleicher and Schuell Co.) by the method of Gillespie and Spiegelman (13). The DNA in single-strength standard saline citrate (1 x SSC; 0.15 M NaCl + 0.015 M trisodium citrate, pH 7.0 + 0.2) was diluted with 0.1 x SSC to a DNA concentration of 50 gg/ml. ...
Molecular taxonomic and electron microscopy studies were performed on four bacterial isolates obtained from different sources of San Francisco sourdough (SD). These bacteria were first isolated by Kline and Sugihara who tentatively described them as a previously unreported species of heterofermentative Lactobacillus; they suggested the name Lactobacillus sanfrancisco. The guanine plus cytosine base composition (%GC) of the deoxyribonucleic acid (DNA) ranged from 38 to 40%. The possible genetic relatedness of these SD isolates to five known species of Lactobacillus with comparable GC contents was assessed in the present work by means of DNA-DNA hybridization competition experiments. Little or no DNA homology was observed between the SD bacteria and the known species. The SD bacteria exhibited a high degree of homology (>88%) among themselves, suggesting that the four isolates were identical taxonomically. Also, the electron photomicrographs revealed structures similar to those of gram-positive bacilli. Accordingly, since these SD isolates have the characteristic phenotypic and morphological properties of the genus Lactobacillus and are not related genetically to any known species, the tentative characterization by the above workers of these isolates as a new species is substantiated.
... A second disadvantage, which will be emphasized in later discussions, is that, since the reactants are present in solution, mixtures cannot be easily washed free from one type of RNA in order to re-expose the DNA to a second type of RNA. (ii) Another means of conducting hybridization is to fix the singlestranded DNA to a solid substrate (2,7,33) prior to exposure to RNA. Two advantages of such techniques exist. ...
... Complementary probe strands may bind with its complementary target DNA strand (test DNA) and form a probe-target heteroduplex which can be detected by different techniques. The complementary strands of nucleic acid may be allowed to bind in solution (solution hybridization), membrane or filter paper (filter hybridization) or on the tissue itself (in situ hybridization) (Britten and Kohne 1968;Gillespie and Spiegelman 1965). Among these, dot-blot hybridization uses mixed phase (filter) hybridization. ...
The dot-blot hybridization is a nucleic acid hybridization technique where complementary single-stranded sequences of the probe (either RNA or DNA) hybridizes with single-stranded sequences of the test samples (either RNA or DNA) under suitable conditions of temperature and salt concentration. It is based on the homology between two strands of nucleic acid (DNA:DNA, DNA:RNA or RNA:RNA). In this assay, a probe which is a single-stranded nucleic acid (either DNA or RNA) is ‘labelled’ with a reporter molecule. The labelled probe is then allowed to form hybrid with nucleic acid isolated from the test plant. The double-stranded hybrid molecule is then detected using appropriate method depending on the reporter molecule used. The process involves isolation of nucleic acid from test plant; it’s spotting on a membrane, pre-hybridization, hybridization using labelled probe and their detection. The DNA probes may be labelled using different methods, namely nick translation, random primed labelling or by polymerase chain reaction. The RNA probes are labelled by in vitro transcription. The labels can be either radioactive or non-radioactive. If radioactive probes are used, then the detection is done through autoradiography. If non-radioactive labels are used, then suitable detection methods through either chromogenic or chemiluminescence is used.
... Par conséquent, l'ADNc correspondant à la séquence nucléotidique codant pour ces protéines devrait permettre de détecter par hybridation moléculaire différentes souches de BECV et de mettre au point un test de diagnostic. SPIEGELMAN -1965 ;THOMAS -1980). Des membranes de nitrocellulose ont été choisies comme support. ...
Une étude de la structure moléculaire et des caractéristiques physicochimiques du coronavirus entérique bovin (BECV) a été envisagée afin de développer des techniques de détection de ce virus dans les milieux biologiques et l'environnement. Le clonage de l'ARN génomique a été réalisé dans E. coli. L'analyse de la banque d'ADNc obtenue a permis de sélectionner un fragment de 2 kb, comprenant la majeure partie des gènes codant pour les protéines virales N et M, et utilisé comme sonde pour la mise au point d'un test d'hybridation moléculaire par slot blot. Deux techniques de marquage de la sonde ont été comparées : marquage radioactif au 32p et marquage enzymatique par couplage covalent à la péroxydase et révélation par chimiluminescence. La sonde radioactive permet de détecter 1 à 3 pg d'ARN viral, soit 2.105 génomes, tandis que la sonde enzymatique, moins sensible, limite la détection à 100 pg d'ARN. Le test s'est avéré applicable à la détection du BECV produit en culture de cellules HRT 18 et présent dans les fécès de veaux atteints d'entérite. La recherche du BECV dans le milieu hydrique nécessite une étape de concentration préalable faisant intervenir les caractéristiques physicochimiques et antigéniques du virus. Ainsi, une technique d'immunoaffinité utilisant des anticorps monoclonaux et un procédé d'adsorption-élution sur poudre de verre ont été analysés. Dans chacun des cas, l'isolement des virus dispersés dans l'eau est efficace. Leur élution du support, par dissociation de l'immuncomplexe ou par répulsion électrostatique, entraîne une dégradation de l'enveloppe virale empêchant toute mise en évidence par inoculation à des cellules HRT 18 . En revanche, les virus concentrés ont pu être détectés par hybridation moléculaire. La conduite d'études épidémiologiques nécessitera cependant d'améliorer le seuil de détection par amplification du système de révélation ou du matériel nucléique viral.
... It was first observed that single stranded DNA binds strongly to nitrocellulose membranes in a way that prevents the strands from re-associating with each other but permits hybridization of complementary RNA (Gillespie, 1965). In eukaryotes it was used to measure the number of copies of repeated genes, like those for ribosomal RNAs and transfer of ribonucleic acid (tRNAs) and to measure changes in the number of copies during processes such as amplification (Ritossa et al., 1971). ...
In the 1980s, my research career begun with microbial DNA diagnostics at Orion Pharmaceutica in Helsinki, Finland, where I was part of an innovative team that developed novel methods based on the polymerase chain reaction (PCR) and the biotin–avidin interaction. One of our key achievements during this time was the invention of the solid-phase minisequencing method for genotyping single nucleotide polymorphisms (SNPs). In the 1990s, I shifted focus to human genetics, investigating mutations of the ‘Finnish disease heritage’. During this period, I also developed quantitative methods using PCR and minisequencing of mitochondrial mutations and for forensic analyses. In the late 1990s and early 2000s, microarray-based SNP genotyping became a major topic for my research, first in Helsinki and later with my research group at Uppsala University in Sweden. By the mid-2000s, I began collaborating with leading clinicians on genetics of autoimmune disease, specifically systemic lupus erythematosus and later worked on the classification and clinical outcome of pediatric acute lymphoblastic leukemia, when large-scale genomics and epigenomics emerged. These collaborations, which focused on integrating genomics into clinical practice, lasted almost two decades until I retired from research in 2022. In parallel with my research activities, I led the SNP/DNA Technology Platform in the Wallenberg Consortium North program from 2001 to 2006. I continued as Director of the SNP&SEQ Technology Platform, which expanded rapidly during the 2010s, and became part of Science for Life Laboratory in 2013. Today (in 2024), the SNP&SEQ Technology Platform is one of the largest units of the Swedish National Genomics Infrastructure hosted by SciLifeLab. The present article provides a personal perspective on nearly four decades of research, highlighting projects and methods I found particularly exciting or important.
Protein concentrations are set by a complex interplay between gene-specific regulatory processes and systemic factors, including cell volume and shared gene expression machineries. Elucidating this interplay is crucial for discerning and designing gene regulatory systems. We quantitatively characterized gene-specific and systemic factors that affect transcription and translation genome-wide for Escherichia coli across many conditions. The results revealed two design principles that make regulation of gene expression insulated from concentrations of shared machineries: RNA polymerase activity is fine-tuned to match translational output, and translational characteristics are similar across most messenger RNAs (mRNAs). Consequently, in bacteria, protein concentration is set primarily at the promoter level. A simple mathematical formula relates promoter activities and protein concentrations across growth conditions, enabling quantitative inference of gene regulation from omics data.
A blast-resistance rice mutant, GR978, generated by gamma-irradiation of indica cultivar IR64 was used to characterize the disease resistance transcriptome of rice to gain a better understanding of genes or chromosomal regions contributing to broad-spectrum disease resistance. GR978 was selected from the IR64 mutant collection at IRRI. To facilitate phenotypic characterization of the collection, a set of controlled vocabularies (CV) documenting mutant phenotypes in ∼3,700 entries was developed. In collaboration with the Tos17 rice mutant group at National Institute of Agrobiological Sciences, Japan, a merged CV set with 91 descriptions that map onto public ontology databases (PO, TO, OBO) is implemented in the IR64 mutant database.
To better characterize the disease resistance transcriptome of rice, gene expression data from a blast resistant cultivar, SHZ-2, was incorporated in the analysis. Disease resistance transcriptome parameters, including differentially expressed genes (DEGs), regions of correlated gene expression (RCEs), and associations between DEGs and RCEs were determined statistically within and between genotypes using MAANOVA, correlation, and fixed ratio analysis. Twelve DEGs were found within the inferred physical location of the recessive gene locus on a ∼3.8MB region of chromosome 12 defined by genetic analysis of GR978. Highly expressed DEGs (≥ 2fold difference) in GR978 or SHZ-2 and in common between the two, are mostly defense-response related, suggesting that most of the DEGs participate in causing the resistance phenotype.
Comparing RCEs between SHZ-2 and GR978 showed that most RCEs between genotypes did not overlap. However, an 8-gene RCE in chromosome 11 was in common between SHZ2 and GR978. Gene annotations and GO enrichment analysis showed a high association with resistance response. This region has no DEGs nor is it associated with known blast resistance QTLs. Association analyses between RCEs and DEGs show that there was no enrichment of DEGs in the RCEs within a genotype and across genotypes as well.
Association analysis of blast-resistance QTL (Bl-QTLs) regions (assembled from published literature; data courtesy of R. Wisser, pers comm., Cornell University) with DEGs and RCEs showed that while Bl- QTLs are not significantly associated with DEGs, they are associated with genotype-specific RCEs; GR978- RCEs are enriched within Bl-QTLs. The analysis suggested that examining patterns of correlated gene expression patterns in a chromosomal context (rather than the expression levels of individual genes) can yield additional insights into the causal relationship between gene expression and phenotype. Based on these results, we put forward a hypothesis that QTLs with small or moderate effects are represented by genomic regions in which the genes show correlated expression. It implies that gene expression within such a region is regulated by a common mechanism, and that coordinated expression of the region contributes to phenotypic effects. This hypothesis is testable by co segregation analysis of the expression patterns in well-characterized backcross and recombinant inbred lines.
When compared to other bacteria, the genus Streptomyces involves a distinct assembly of Gram-positive bacteria that are universal in nature and display complex range in colony color, secretion of pigments, etc. The greatest role of Streptomyces is its capacity to generate biologically active specialized products, for instance, antivirals, antihypertensives, anticancer, fungicides, immunosuppressors, and most importantly antibiotics. Taxonomy or systematics of bacteria involves the study of a range of organisms that makes use of classification, nomenclature, and identification. Streptomyces taxonomy is established on limited characters such as structural coloration, bionomical necessities, and structural aspect of chains of fungal spore morphology. Streptomyces have been classified based on different approaches like the International Streptomyces Project (ISP) of 1966, genomic sequence (phylogenetic approach), molecular techniques (genotyping approach), chemical characteristics (chemotaxonomy), or numerical taxonomy. As far as the diversity is concerned, in the majority of the bacterial domain, the genus Streptomyces is highly diversified and is scattered around substantial terrestrial sections.Keywords
Streptomyces
ClassificationClassification approachesTaxonomyDiversityAntibiotics
The 9/11 attack on US soil has inadvertently heightened the need for preparation for other potential means of terrorist attack. In particular, both biological and chemical warfare have been at the top of the priority list for most governmental agencies as these reagents can be covertly prepared and disseminated to result in both widespread fear and casualty. Among many others, one primary preventive step in preparing for the above attacks is to establish a network for efficient surveillance and rapid detection such that an appropriate response to such attacks can be timely and effective. Over the years, primarily due to technological advances, both chemical and biological agents that are able to inflict mass destructions are becoming more diverse and complex. Subsequently, improvement of sensing devices for rapid and sensitive detection should also be made to keep pace with these engineered or emerging threat agents. Of particular interest, the ability to encompass advances in micro and nanofabrication techniques to enable sensing devices are especially of interest as they have been shown to offer desired advantages such as improved and enhanced functionality, increased efficiency and speed in their readout, reduction in their fabrication cost, and also reduced reagent consumption. Numerous innovative and exciting reports which took advantage of these techniques for both chemical and biological sensing have appeared over the last decade. This unique book is the only current publication that provides readers with a brief, yet concise, collection of the latest advances in chemical and biological agent detection and/or their surveillance. It compiles and gives in-depth detail on several detection schemes so that the reader can be provided with a general sense of these micro and nanoscale sensing systems and platforms. The book covers both well established and "next-generation" micro- and nano-scale sensors and/or sensing platforms. Sensors or sensing platforms covered range from the novel utilization of nanotubes, cantilevers, nano and/or microsized pores, engineered whole cell, to polymeric transistors for sensing purposes. As a result of these advances there has been a synergistic marriage of a myriad of techniques, ranging from chemical, engineering and biological, for the development of sensors, which was once traditionally thought to be reserved for the immunologists. The enabling of these new technologies will result in a much improved sensing network for the detection and surveillance of both chemical and biological warfare agents.The book also contains chapters from leading experts in the field of chemical and biological sensing platforms and will be invaluable reading for anybody in this field.
An ultra-thin and highly sensitive SARS-CoV-2 detection platform was demonstrated using a nano-porous anodic aluminum oxide (AAO) membrane. The membrane surface was functionalized to enable efficient trapping and identification of SARS-CoV-2 genomic targets through DNA-DNA and DNA-RNA hybridization. To immobilize the probe oligonucleotides on the AAO membrane, the pore surface was first coated with the linking reagents, 3-aminopropyltrimethoxysilane (APTMS) and glutaraldehyde (GA), by a compact vacuum infiltration module. After that, complementary target oligos with fluorescent modifier was pulled and infiltrated into the nano-fluidic channels formed by the AAO pores. The fluorescent signal applying the AAO membrane sensors was two orders stronger than a flat glass template. In addition, the dependence between the nano-pore size and the fluorescent intensity was evaluated. The optimized pore diameter d is 200 nm, which can accommodate the assembled oligonucleotide and aminosilane layers without blocking the AAO nano-fluidic channels. Our DNA functionalized membrane sensor is an accurate and high throughput platform supporting rapid virus tests, which is critical for population-wide diagnostic applications result in a page being rejected by search engines. Ensure that your abstract reads well and is grammatically correct.
Recent developments in the microarray technologies have contributed
substantially to our understanding of gene regulation in plants. Availability of
complete genome sequences coupled with the microarray methods allows a
global comparison of the gene expression profiles and the development of a
transcriptome. Transcriptome is a catalogue of all the expressed messages
present in a cell (tissue). This approach, although in its development stages, has
already proved to be invaluable in identifying new genes involved in signaling
pathways as well as in confirming earlier findings in the elucidation of these
pathways. This article is aimed at reviewing state-of-the-art of microarray
techniques. A summary of the diverse applications of microarays in plant
genetics is provided with suggestions for future research.
The mechanism responsible for the accumulation of newly synthesized alpha- and beta-globin mRNA in the cytoplasm of induced murine erythroleukemia cells was examined by nuclear mRNA nascent chain elongation (run-off transcription). Hexamethylenebisacetimide, a potent inducer of murine erythroleukemia cell differention, induced high levels of both alpha- and beta-globin gene transcription within 48 to 72 h in culture. Butyric acid, a modest inducer of murine erythroleukemia cells, induced a somewhat lower level of globin gene transcription. With both inducers, alpha-globin transcriptional rates exceeded those of beta-globin. Hemin, on the other hand, showed no detectable increase over the basal rate observed in uninduced cells, even at a time (48 h) when newly synthesized globin mRNA was accumulating in the cytoplasm. These results suggest that there are at least two mechanisms responsible for regulating alpha- and beta-globin structural gene expression in induced murine erythroleukemia cells and that the mechanisms involved are inducer dependent. Hexamethylenebisacetimide and butyric acid increase the rate at which globin genes are transcribed, but hemin appears to allow constitutive levels of transcripts to accumulate.
A well-differentiated rat hepatoma cell line, Fu5-5, yields variant clones whose rate of secretion of serum albumin ranges from 40 to less than 0.08 micrograms of albumin/mg of cell protein per 48 h. Clones were classified as high producers (10 to 40 micrograms/mg per 48 h), intermediate producers (1 to 10 micrograms/mg per 48 h), low producers (0.1 to 1.0 micrograms/mg per 48 h), and null variants (less than 0.1 micrograms/mg per 48 h). Albumin synthetic rates are proportional to secretion rates and range from 0.9 to less than 0.002% of total protein synthesis as measured by pulse-labeling. Steady-state albumin mRNA levels were measured by filter hybridization of fragmented, end-labeled mRNA and by Northern blotting. Message levels are proportional to albumin synthetic rates except for a high producer in which albumin mRNA is less elevated than the synthetic rate. The extent of methylation was quantitated at each of 24 CpG-containing sites or site clusters at the albumin locus. These sites span a region that contains the albumin gene as well as 10 kilobases of the 5' flank and 1 kilobase of the 3' flank. An 8-kilobase region is described, with boundaries in the 5' flank and in the middle of the gene, within which all 11 sites examined showed a correlation of undermethylation with the high-producer phenotype. In contrast, 12 of 13 sites outside of this region showed no phenotype correlation. Null variants derived from a high producer underwent de novo methylation of this domain. Six independent hybrid clones derived from the cross of a high producer with a null variant showed extinction of albumin production and hypermethylation of the domain. Apparently these cells retain the capacity for the de novo methylation of these specific sites.
N6-methyladenosine (m6A) residues are present as internal base modifications in most higher eucaryotic mRNAs; however, the biological function of this modification is not known. We describe a method for localizing and quantitating m6A within a large RNA molecule, the genomic RNA of Rous sarcoma virus. Specific fragments of 32P-labeled Rous sarcoma virus RNA were isolated by hybridization with complementary DNA restriction fragments spanning nucleotides 6185 to 8050. RNA was digested with RNase and finger-printed, and individual oligonucleotides were analyzed for the presence of m6A by paper electrophoresis and thin-layer chromatography. With this technique, seven sites of methylation in this region of the Rous sarcoma virus genome were localized at nucleotides 6394, 6447, 6507, 6718, 7414, 7424, and 8014. Further, m6A was observed at two additional sites whose nucleotide assignments remain ambiguous. A clustering of two or more m6A residues was seen at three positions within the RNA analyzed. Modification at certain sites was found to be heterogeneous, in that different molecules of RNA appeared to be methylated differently. Previous studies have determined that methylation occurs only in the sequences Gm6AC and Am6AC. We observed a high frequency of methylation at PuGm6ACU sequences. The possible involvement of m6A in RNA splicing events is discussed.
A specific repression mechanism regulates arginine biosynthesis in Saccharomyces cerevisiae. The involvement of regulatory proteins displaying DNA-binding features and the location of an operator region between the TATA box and the transcription start of the structural gene ARG3 suggest that this mechanism operates at the level of transcription. A posttranscriptional mechanism has, however, been proposed to account for the conspicuous lack of proportionality between ARG3 mRNA steady-state levels (as determined by Northern [RNA] assays; F. Messenguy and E. Dubois, Mol. Gen. Genet. 189:148-156, 1983) and the cognate enzyme activities. In this work, we have analyzed the time course of the incorporation of radioactive precursors into ARG1 and ARG3 mRNAs and the kinetics of their decay under different regulatory statuses. The results (expressed in terms of relative mRNA levels, relative transcription rates, and mRNA half-lives) give the picture expected from a purely transcriptional control. A similar analysis of expression of the gene CPA1, for which a translational regulation by arginine has been clearly demonstrated (M. Werner, A. Feller, F. Messenguy, and A. Piérard, Cell 49:805-813, 1987), indicates that this gene is also partly regulated at the transcriptional level by the ARGR repressor system. Moreover, the half-life of CPA1 mRNA is reduced twofold in the presence of excess arginine; we suggest that this could be inherent in the mechanism of translational regulation of CPA1.
We previously isolated and characterized the structure of murine thymidine kinase (tk) genomic and cDNA sequences to begin a study designed to identify regions of the tk gene important for regulated expression during the transition of cells from G0 to a proliferating state. In this report, we describe the stable transfection of the cloned gene into L-M(TK-) cells and show that both thymidine kinase (TK) enzyme activity and DNA synthesis increase in parallel when transfectants in G0 arrest are stimulated by serum. To define promoter and regulatory regions more precisely, we have constructed a series of tk minigenes and have examined their expression in stable transfectants after serum stimulation. We have identified a 291-base-pair DNA fragment at the 5' end of the tk gene that has promoter function, and we have determined its sequence. In addition, we have found that DNA sequences which mediate serum-induced expression of TK are transcribed, since expression of the murine tk cDNA, fused to a promoter from either the murine tk gene, the simian virus 40 early region, or the herpes simplex virus tk gene, is stimulated by serum. Our constructs also reveal that the murine tk polyadenylation signal is not required for regulation, nor is most of the 3' untranslated region. RNA dot blot analysis indicates that murine cytoplasmic tk mRNA levels always parallel TK enzyme activity. Nuclear runon transcription assays show less than a 2-fold increase in transcription from the cloned tk gene in serum-stimulated transfectants, but an 11-fold increase in mouse L929 cells, which are inherently TK+. These results taken together suggest that the murine tk gene is controlled in serum-stimulated cells by a transcriptional mechanism influenced by DNA sequences that flank tk and also by a posttranscriptional system linked to gene sequences that are transcribed.
Transcriptional regulatory elements within the Rous sarcoma virus long terminal repeat were examined by the construction of a series of deletions and small insertions within the U3 region of the long terminal repeat. The analysis of these mutations in chicken embryo cells and COS cells permitted the identification of important transcriptional regulatory elements. Sequences within the region 31 to 18 base pairs upstream of the RNA cap site (-31 to -18), encompassing a TATA box-like sequence, function in the selection of the correct site of transcription initiation and, in addition, augment the efficiency of transcription. These sequences are essential for virus replication. Sequences within the region -79 to -59, overlapping a CAAT box-like sequence, are not required for virus replication and have no obvious effect on viral RNA transcription in the presence of an intact TATA box. However, in mutants lacking a functional TATA sequence, mutations in this region serve to decrease the efficiency of correct transcriptional initiation events.
Spore germination in the slime mold Dictyostelium discoideum was used as a model to study the developmental regulation of protein and mRNA synthesis. Changes in the synthesis of these macromolecules occur during the transition from dormant spore to amoebae. The study of the mechanisms which regulate the quantity and quality of protein synthesis can best be accomplished with cloned genes. cDNA clones which hybridized primarily with mRNAs from only spores or germinating spores and not with growing amoebae were collected. Three such clones, denoted pLK109, pLK229, and pRK270, were isolated and had inserts of approximately 500, 1,200, and 690 base pairs, respectively. Southern blot hybridization experiments suggested that each of the genes is present in multiple copies in the D. discoideum genome. RNA blot hybridizations were performed to determine the sizes of the respective mRNAs and their developmental regulation. The mRNA that hybridized to pLK109 DNA was present predominantly in spores and at 1 h after germination but was absent in growing amoebae. Its concentration dramatically dropped at 3 h. The mRNA present in spores is apparently larger (approximately 0.5 kilobase) than in the later stages of germination (0.4 kilobase), indicating processing of the RNA during germination. The mRNA that hybridized to pLK229 DNA was approximately 1.0 kilobase and was present in very low amounts during growth. Its concentration rose until 1 h after spore germination and decreased thereafter. pRK270-specific RNA was approximately 2.7 kilobases and was found predominantly at 1 h after germination. It was present in lower concentrations at 2 and 3 h after germination and was absent in spores and amoebae. In vitro translation of mRNA selected from 1-h polyadenylated RNA which was hybridized to pLK109 or pLK229 DNA gave proteins of molecular weights consistent with the sizes of the mRNAs as determined by the RNA blot analysis.
The chapter deals with the history of the discovery of viruses in the late 19 century as well as the progress made over the last 120 years in advancing the science of plant virology. These include but are not limited to biology of virus-or viroid-infected plants, vector and non-vector transmission, the rise of molecular and biophysical virology, replication of RNA and DNA viruses as well as viroids, and many methods used in plant virology. These methods include serology, electron microscopy, confocal microscopy, analytical and preparative ultracentrifugation, density gradient ultracentrifugation, gel electrophoresis, hybridization. polymerase chain reaction, microarrays, genetic engineering, first and next-generation nucleotide sequencing, CRISPR-Cas system editing and several others. Finally, control of viruses and viroids by exclusion was also discussed.
A new approach for evaluating homologous sequences among related DNAs is presented. Conventional filter hybridization techniques are employed at 35 degrees C in a range of formamide concentrations in order to perform annealings at effective temperatures as low as Tm -50 degrees C which permits the detection of regions of homology with as much as 33% base mismatch. Under such nonstringent conditions, high levels of specific annealing can be obtained at plateau levels. In combination with the Southern “blotting” technique (1975), this approach can be used to perform biochemical heteroduplex melting experiments. The homology among the genomes of the murine polyoma virus (Py), the simian virus 40 (SV40), and the human papovavirus BK was evaluated using this new methodology.
The nucleotide sequence of T4 tRNAleu, one of several transfer RNAs specifically coded for by bacteriophage T4, has been determined using ³²P-labeled material from T4-infected cultures of Escherichia coli. The purified RNA species which has been sequenced has been shown to have leucine acceptor activity, and to hybridize well to T4 DNA.
The sequence is: pGCGAGAAUGGUCAAADDGmGDAAAGGCACAGCACUNAAA * A ψ GCUGCGGAAUGAUUUCCUUGUGGGTψCGAGUCCCACUUCUCGCACCA—OH. The 87 nucleotide length is the same as that of the two E. coli leucine tRNAs, the sequences of which have been reported. The molecule can be arranged in the classic cloverleaf pattern. The sequence further shows that the anticodon of the T4 tRNAleu is -N-A-A-, in which N is a modified form of U. Thus, the molecule might be expected to recognize the leucine codons UUA or UUG, or both together, but trinucleotide binding studies by Scherberg and Weiss ((1972) Proc. Nat. Acad. Sci. U. S. A. 69, 114) indicate that it recognizes only UUA.
The role of DNA replication in the synthesis of RNA and proteins during the "late" period of the infective cycle of T5-infected Escherichia coli F has been examined. Inhibition of DNA synthesis was achieved by addition of chloramphenicol to T5-infected cultures or by use of a mutant of T5 (T5 am I), which is unable to cause the synthesis of an active DNA polymerase upon infection of the nonpermissive host, E. coli F. The synthesis of late or Class III RNA and lysozyme, a presumed late protein, was measured. In the absence of DNA synthesis a small amount of late or Class III RNA species is formed by 9 to 12 min after infection, but much greater quantities are produced under conditions allowing concurrent DNA replication. The synthesis of T5 lysozyme occurs normally in both the permissive and nonpermissive hosts.
Expression of the invading T5 phage genome in Escherichia coli F is shown to be under a high degree of transcriptional control. The kinetics of phage-directed RNA synthesis is investigated with the techniques of DNA-RNA hybridization and disc electrophoresis followed by autoradiography. Following complete transfer of the T5 genome three phage-specific RNA classes are induced. Their synthesis parallels that of the corresponding three classes of proteins. At 37° Class I RNA commences immediately, and synthesis continues for about 4 min. Class II RNA begins at 3 to 5 min and is detected by DNA-RNA hybridization-competition as late as 36 min, although bands distinguishable by disc electrophoresis disappear by 28 min. Class III RNA transcription commences at approximately 9 min and continues until lysis at 45 to 60 min. In cells that receive only the initial 8% of the T5 DNA, Class I RNA is detected but no Class II or III. In experiments with these incompletely infected cells Class I protein synthesis is required for shutoff of the synthesis of Class I and host RNA. Class I RNA bands were identified as products of phage transcription by hybridization to T5 DNA. Estimation of the approximate molecular weights of the RNA of these bands was made from plots of log molecular weight versus relative distance migrated. The range of molecular weights of individual components was for Class I RNA, 1.0 x 10⁶ to 8.5 x 10⁴ daltons; for Class II RNA, 7.5 x 10⁵ to 5.4 x 10⁴ daltons; and for Class III RNA, 1.5 x 10⁶ to 5.4 x 10⁵ daltons. The close parallel between the timing of phage protein and RNA synthesis suggests that the RNA bands identified by autoradiography represent messenger RNA. The presence of these bands in appropriate polysome fractions has further supported their role in protein synthesis.
An analysis has been made of the degradation of T5-specific RNA in the presence of rifampicin, an inhibitor of RNA synthesis. The average half-time of disappearance of either acid-precipitable labeled RNA or high molecular weight RNA bands identified by disc electrophoresis-autoradiography was 4 to 5 min at 37°. Several relatively stable degradation products between the molecular weights 8.0 x 10⁴ and 3.1 x 10⁴, as well as a large fraction of stable RNA fragments of 4 S size, were identified. These discrete degradation products were formed in the presence of chloramphenicol as well as in the absence of this inhibitor of protein synthesis. Therefore, at least one nuclease must be involved in the turnover of messenger RNA to specific degradation products that is not dependent on the process of protein synthesis for its activity. This nuclease is probably a host enzyme.
In a transcription system containing λpgal8 DNA as template and Escherichia coli RNA polymerase, the addition of cyclic adenosine monophosphate receptor protein (CRP) and 3',5'-cyclic AMP causes a 15-fold increase in gal mRNA synthesis. Gal mRNA was measured by hybridizing the [³H]RNA product to the separated strands of λpgal8 DNA after removal of λ mRNA by preliminary hybridization to λ DNA. Competition experiments indicate that a large fraction of this RNA is identical with in vivo gal mRNA. With λpgal8 DNA as template but not with λ DNA, 3',5'-cyclic AMP and CRP cause a 2-fold increase in λ mRNA. Since the increment in λ mRNA hybridizes to the left-hand half of the ι strand of λ DNA and is abolished by the addition of ρ, it is interpreted as read through from the 3',5'-cyclic AMP-CRP sensitive site in the gal region of λpgal8 DNA. The concentrations of CRP and 3',5'-cyclic AMP necessary for half-maximal stimulation of gal mRNA synthesis are 5 x 10⁻⁸ and 5 x 10⁻⁶m, respectively. 2',3'-Cyclic AMP and 5'-AMP do not stimulate gal mRNA synthesis; 3',5'-cyclic GMP is an inhibitor. When 3',5' cyclic AMP, CRP, DNA, and RNA polymerase are incubated together for 10 min, a rifampicin-resistant preinitiation complex is formed, and, upon the addition of nucleoside triphosphates, gal mRNA synthesis occurs. 3',5'-Cyclic GMP prevents the formation of this complex and can dissociate it after it has been formed. These results suggest that 3',5'-cyclic AMP and CRP stimulate gal transcription at a step prior to chain elongation.
The sections in this article are
Introduction
Transcript Profiling Technologies
Transcript Profiling Workflow
What Can We Learn from Transcript Profiles Performed in a Starchless Mutant?
Conclusion/Perspectives
Acknowledgements
This chapter presents the methods for the study of mRNA synthesis in bacteriophage-infected E. coli. T-even phages and their host Escherichia coli are model systems for genetic and biochemical studies of transcription and translation of phage genome. Messenger RNA (mRNA) in E. coli infected by DNA phages is assayed at the translational level by measuring the activities of various phage-specific enzymes and antigenic properties of phage structural proteins in the infected cell extracts. Meaningful analysis of mRNA depends on the RNA preparations assayed. This chapter also describes a number of methods in detail with brief comments on modifications of the methods and nature of the preparations. Two or more methods that measure different properties of mRNA are used sequentially to assay RNA preparations. This chapter also reviews the analytical methods available; useful modifications, limitations of the methods, and applications that yield more fundamental results in studies of phage development.
The application of various available biological, physicochemical, serological, and molecular techniques depends entirely on the type of disease situation. The classical techniques, which include mainly bioassay or host-range studies, are time consuming and require intensive labor; however, they are still recommended for primary screening, purification, and maintenance of the virus. More sensitive techniques such as electron microscopy, enzyme-linked immunosorbent assay (ELISA), hybridization assays, polymerase chain reaction (PCR), and their variants should be used for further verification of the virus. Reverse transcriptase-PCR (RT-PCR), immunocapture PCR, immunocapture RT-PCR, and a few other variants have all been proven to have greater sensitivity than ELISA and PCR techniques alone. Most recently, the loop-mediated isothermal amplification, recombinase polymerase amplification, biosensor, and microarray-based techniques have remarkably enhanced the speed, sensitivity, and scale at which virus detection can be achieved.
The implications of chemical transformations in the description of the evolution of natural systems are revisited, starting from a historical perspective. The connection with information theory allows for the deepening of how the systems, not in equilibrium with the environment, are subjected to a change that favors the formation of structures of increasing complexity. Then, the metabolic processes, apt to convert bio molecules into the building blocks needed to sustain the cellular formation and growth, are discussed within the frame of synthetic biology, which is triggering interest towards an approach in which the microbial organisms are utilized as factories for the bioconversion of renewable resources to fuels or high-value chemicals. Finally, the role of chemical kinetics in the design of industrial chemical reactors and in simulation of turbulent flames is presented.
The +1 site for initiation of inducible chloramphenicol acetyl transferase (CAT) mRNA encoded by plasmid pC194 was determined experimentally by using [alpha-32P]ATP-labeled runoff transcripts partially digested with T1 RNase. By partial digestion of the in vitro transcripts with S1, T1, and cobra venom nucleases as probes of mRNA conformation, single- and double-stranded regions, respectively, were also identified. Thus, a prominent inverted complementary repeat sequence was demonstrated spanning the +14 to +50 positions, which contain the complementary sequences CCUCC and GGAGG (the Shine and Dalgarno sequence for synthesis of CAT) symmetrically apposed and paired as part of a perfect 12-base-pair inverted complementary repeat sequence (-19.5 kcal [ca. -81.7 kJ] per mol). The CAT mRNA was stable to digestion by T1 RNase at the four guanosine residues in the Shine and Dalgarno sequence GGAGG , even at 60 degrees C, suggesting that nascent CAT mRNA allows ribosomes to initiate protein synthesis inefficiently and that induction involves post-transcriptional unmasking of the Shine and Dalgarno sequence. Consistent with this model of regulation, we found that cells carrying pC194 , induced with chloramphenicol, contain about the same concentration of pulse-labeled CAT-specific RNA as do uninduced cells. Induction of CAT synthesis by the non- acetylatable chloramphenicol analog fluorothiamphenicol was tested by using minicells of Bacillus subtilis carrying pC194 as well as minicells containing the cloned pC194 derivatives in which parts of the CAT structural gene were deleted in vitro with BAL 31 exonuclease. Optimal induction of both full-length (active) and deleted (inactive) CAT required similar concentrations of fluorothiamphenicol, whereas induction by chloramphenicol required a higher concentration for the wild-type full-length (active) CAT than for the (inactive) deleted CAT. Because synthesis of deleted CAT was inducible, we infer that CAT plays no direct role in regulating its own synthesis.
A systematic examination of a variety of isolates of the bacterial endoparasite Bdellovibrio has revealed extensive molecular diversity. The quantity of deoxyribonucleic acid (DNA) polynucleotide homology ranges from more than 90% among the isolates with DNA containing 50 to 51% guanine plus cytosine (GC) to undetectable levels between the 43% GC and 51% GC isolates. The two isolates with low GC-containing DNA (H-I Bdellovibrio A3.12 and UKi2) have only 16% DNA homology. H-I Bdellovibrio A3.12 and 109 have barely detectable ribosomal ribonucleic acid (rRNA) homology, whereas the homology approaches 100% among all the high GC isolates tested. Cases of high DNA/DNA and DNA/rRNA homologies are reflected in low dissimilarities of enzyme migration patterns in starch gel electrophoresis. The dissimilarities exhibited among the high GC Bdellovibrio isolates are as low as those previously reported for different Escherichia coli strains. The zymograms of H-I Bdellovibrio A3.12 and UKi2 are completely different from each other as well as from all other bdellovibrios (100% dissimilarity). Genome sizes determined for the representative isolates demonstrate three size ranges which coincide with group differences based on the above measurements. Enzyme assays reveal that all isolates possess a tricarboxylic acid cycle and most contain an alanine and glutamic dehydrogenase. We conclude that the use of bacterial endoparasitism as a defining trait has resulted in a molecularly diverse collection of isolates. It is recommended that the specific epitaph bacteriovorus be used only for the type specimen (Bdellovibrio 100 of Stolp and Starr, 1963) and for other related 50 to 51% GC isolates. The heterogeneity of the group warrants two new species. We designate Bdellovibrio A3.12 as the nomenclatural type of B. starrii sp. n. and Bdellovibrio UKi2 as the nomenclatural type of B. stolpii sp. n.
By the application of basic genetic knowledge. the artificial regeneration of woody plants is a very important component in the reforestation programme in recent years. Large gaps of knowledge still exist regarding the arrangement and functions of plant chromosomal DNA. In this review, priority has been offered to the need and use of plant genetic material in the management of natural forests deploying he knowledge of gene expression and heir successful manipulation. The basic principles, scope of application. prospects and probable shortcomings in the use of nucleic acid hybridisation, protoplast fusion and gene transfer by recombinant DNA technology have been focussed.
A method has been described for the isolation of DNA from micro-organisms which yields stable, biologically active, highly polymerized preparations relatively free from protein and RNA. Alternative methods of cell disruption and DNA isolation have been described and compared. DNA capable of transforming homologous strains has been used to test various steps in the procedure and preparations have been obtained possessing high specific activities. Representative samples have been characterized for their thermal stability and sedimentation behaviour.
Using a microbiological assay for RNase based on the inactivation of viral RNA and capable of detecting RNase at a concentration as low as 0.1 mμg/ml, commercially available crystalline preparations of the pancreatic enzymes DNase and trypsin were found to be contaminated with 1 part in 100,000 and 1 part in 10,000, respectively, of RNase. A previous hypothesis that the susceptibility of infectious FMDV-RNA to crystalline DNase and to trypsin was due to the presence of an exceedingly small amount of RNase was also confirmed. The RNase content of partially purified preparations of FMDV was found to be about 0.013 μg/ml, attributable to the bovine serum and host cells used for viral propagation. This RNase contamination could be removed by chromatography on DEAE-cellulose, which allowed most of the enzyme to pass through unadsorbed. Similar chromatographic treatment of DNase decreased the amount of RNase present. Amberlite XE-64 treatment of trypsin was unsatisfactory for the separation of RNase activity.
Deoxyribonucleic acid contains sequences complementary to homologous amino-acid transfer ribonucleic acid molecules which
serve as the translating device between polyribonucleotides and proteins. This implies that the RNA molecules have their primary
origin in DNA. From the amount of DNA participating, one would infer that more than 20 complementary sequences exist per genome,
a conclusion consistent with a degenerate code. The fact that complex formation occurs most readily with homologous RNA suggests
that, while the language remains universal, each dictionary is uniquely identifiable with its own genome.
Nucleic acid gels can be formed as a result of the cross-linking action of ultraviolet light or of nitrous acid. Such gels
form duplex combinations with complementary nucleic acid strands.
The rate of formation of complexes between T2 RNA and T2 DNA has been measured at various salt concentrations (0·2 to 1·5 M-KCl) and temperatures (50 to 85°C). With increasing temperature, the rate passes through a maximum which is higher the higher the salt concentration. In 0·5 M-KCI the optimum temperature is 67°C.The rate of reaction is proportional to both the RNA and DNA concentration. The apparent bimolecular constant for five different preparations of T2 RNA was 2 ml./μg DNA/minute, or 10 l./mole nucleotides/second (in 0·5 M-KCI, 67°C, pH 7·3). This rate is several orders of magnitude slower than that for the reaction between polyadenylic acid and polyuridylic acid. Differences and similarities between the two reactions are discussed.Annealing in the absence of RNA causes T2 DNA to lose its RNA-binding ability. The second-order rate constant for this process is approximately the same as that for the RNA-DNA reaction. Under the conditions used for their formation, RNA-DNA complexes are slowly destroyed. The fraction of complex breaking down in unit time increases as the concentration of RNA-DNA complex increases.RNA-DNA complexes were broken down completely by RNase at low salt concentrations. The resistance to RNase increased with increasing salt concentration but was not complete under any condition tested. The complex was destroyed completely by DNase.The extent of complex formation was measured using an excess of either reactant. At least 77% of RNA formed after T2 infection of Escherichia coli is capable of becoming bound to T2 DNA. The binding capacity of T2 DNA is approximately 0·3 μg RNA/μg DNA.
A procedure is described for the chromatographic detection and isolation of DNA-RNA hybrids on columns of methylated albumin coated on kieselguhr (MAK). Its use is illustrated with both annealed and enzymatically synthesized hybrids. The method has the advantage of a wide range in capacity and resolution and permits actual isolation of the hybrid structure. It is uniquely effective in experiments involving hybridization with small DNA fragments.
Mangalo, R. (University of Illinois, Urbana) and J. T. Wachsman. Effect of 8-azaguanine on growth and viability of Bacillus megaterium. J. Bacteriol.
83
27–34. 1962.—The addition of 8-azaguanine to exponentially growing cells of Bacillus megaterium results in an inhibition of growth after a lag of approximately 30 min. However, 8-azaguanine-2-C¹⁴ is incorporated into the nucleic acids in a linear fashion without a detectable lag. The inhibitory action is reversed by purines and their derivatives, but not by uridine, thymidine, or cytidine. 8-Azaguanine is bactericidal, especially under conditions where growth (ribonucleic acid synthesis) is possible. Growth in the presence of a complete amino acid mixture, either before or during exposure to 8-azaguanine, increases the rate of killing. Chloramphenicol has little or no effect on the bactericidal action of the analogue.
This communication presents a new method for the study of the molecular weight and partial specific volume of macromolecules, with some illustrations based on results with deoxyribonucleic acid (DNA) and several viruses. The method involves observation of the equilibrium distribution of macromolecular material in a density gradient itself at equilibrium. The density gradient is established by the sedimentation of a low-molecular-weight solute in a solution subject to a constant centrifugal field.